Download Mutation of plakophilin-2 gene in arrhythmogenic right ventricular

Chinese Medical Journal 2009;122(4):403-407
403
Original article
Mutation of plakophilin-2 gene in arrhythmogenic right
ventricular cardiomyopathy
WU Shu-lin, WANG Pei-ning, HOU Yue-shuang, ZHANG Xu-chao, SHAN Zhi-xin, YU Xi-yong and DENG Mei
Keywords: arrhythmogenic right ventricular cardiomyopathy; plakophilin-2 gene; mutation
Background Arrhythmogenic right ventricular cardiomyopathy (ARVC) is one of the leading causes of sudden cardiac
death. Recent studies have shown that ARVC, which is an inheritable genetic change, results from mutations in genes
encoding desmosomal proteins. Plakophilin-2 is an important component of the desmosome. Because the full range of
genetic variations related to ARVC is unknown and no related studies of the Chinese population have been reported, we
aimed to investigate the genetic variation of plakophilin-2 in ARVC patients from the Southern Region of China.
Methods Genomic DNA was isolated from peripheral blood samples of all 34 ARVC patients, who were screened
through a clinical evaluation. They were used to detect variations in the sequences of the plakophilin-2 genes by
polymerase chain reaction amplification in combination with direct sequencing.
Results In exon-1 of the plakophilin-2 gene, a deletion mutation (c.145_148 del GACA) was found in one family
pedigree. The mutation was also found in exon-2, 4, and 11 of the plakophilin-2 gene. The QT interval dispersion of the
ECG was considerably longer in the mutation group than in the non-mutation group of ARVC patients, and this result was
statistically significant (P <0.05).
Conclusion We discovered a plakophilin-2 mutation that prolongs the QT interval dispersion in the southern Chinese
ARVC population.
Chin Med J 2009;122(4):403-407
A
rhythmogenic right ventricular cardiomyopathy
(ARVC), which is one of the leading causes of
sudden cardiac death (SCD), is an inheritable
cardiomyopathy characterized by a progressive fibro-fatty
replacement of the right ventricular (RV) myocardium.1,2
Recurrent ventricular tachycardia (VT) and SCD are
clinical hallmarks of the disease.3,4
A recent study has shown that ARVC results from
mutations in genes encoding desmosomal proteins, a
component of the intercalated disc essential for the
mechanical coupling of cardiac cells.5 It has been
hypothesized that altered desmosomal proteins impair
cell-to-cell adhesion resulting in cellular uncoupling and
the fibro-fatty replacement of myocytes. Plakophilin-2
(PKP2) is an important component of the desmosome and
is directly involved in desmosome formation, so as to be
implicated in the pathogenesis of ARVC. Whether as an
autosomal dominant or an autosomal recessive disease,
PKP2 is correlated with ARVC.6,7 In the Chinese
population, genetic studies of ARVC have not been
reported. The purpose of this study was to investigate the
correlation between the genetic variation of PKP2 and
ARVC in Southern Chinese patients enrolled in the
Guangdong General Hospital.
METHODS
Study subjects
Each of the enrolled patients met the strict criteria for the
diagnosis of ARVC, the International Task Force
diagnostic criteria,8 as well as a proposed modified
criteria.9
We screened out 29 probands and their 14 family
members. Five family members were later diagnosed with
ARVC for a total of 34 ARVC patients including 25
males and 9 females. We collected the clinical data of
ARVC patients and their family members in Guangdong
General Hospital, including 12-lead ECG, signalaveraged ECG (SAECG), 24-hour-Holter monitor, and
ultrasonic cardiography (UCG). Peripheral blood samples
of all subjects were collected after their written informed
consents were obtained. The control group included 80
ethnically matched healthy individuals (160 control
chromosomes). This study was approved by the Trust
Ethics Committee of Guangdong General Hospital.
Diagnosis was independently performed by several of our
colleagues from our institute, then reviewed by three
investigators and classified by a consensus without
DOI: 10.3760/cma.j.issn.0366-6999.2009.04.009
Department of Cardiology (Wu SL, Wang PN, Hou YS and Deng
M), Research Center of Guangdong Academy of Medical Science
(Zhang XC, Shan ZX and Yu XY)，Guangdong General Hospital,
Guangdong Provincial Cardiovascular Institute, Guangzhou,
Guangdong 510080, China
Correspondence to: Dr. WU Shu-lin, Department of Cardiology,
Guangdong
General
Hospital,
Guangdong
Provincial
Cardiovascular Institute, Guangzhou, Guangdong 510080, China
(Tel: 86-20-83827812 ext 10280. Fax: 86-20-83875453. Email:
[email protected])
This study was supported by a grant from Guangdong Provincial
Medical Research Foundation in 2008 (No.A2008054).
Chin Med J 2009;122(4):403-407
404
Table 1.The primers sequence of exon-1, 2, 4, 11 of PKP2 gene
Exon
Exon-1
Exon-2
Exon-4
Exon-11
Forward sequence (5′–3′)
GCCCACGAGGCCGAGCTCC
TACTTGTTCTTGGCCTTCATTAC
TAGGCAGGAGGAGGGAGGT
TCAACCTCTGGTAATCTACAGA
Reverse sequence (5′–3′)
AGCAAGTCGGTCATACCGAAGA
TGCACTAGGATGTAAGAATGTTTC
CCAAAGTGCTGGGAATAT
CATTGCATTGTATCTTCAGCATG
Table 2. The clinical characteristics and PKP2 mutations position of 6 ARVC patients
Characteristics
No. 8
No. 9
No. 20
No. 47
No. 73
No. 84
Sex
M
M
M
M
M
M
Age at onset (years)
60
52
10
40
34
27
Exon
11
2
1
4
1
1
Position of nucleotide
c.2146–1–1
c.331
c. 156
c. 1097
c.145_148
c.145_148
mutation
Del GA
C>T
G>A
T>C
Del CAGA
Del CAGA
Family history
–
–
+
+
+
+
QRS V1–3≥110 ms
–
+
+
–
–
–
SAECG (VLP)
+
+
+
–
+
–
Epsilon wave
+
–
+
+
+
+
+
+
+
–
–
–
Negative T wave in V2–3
Arrhythmias
VT
VPBs
VPBs
VPBs
VT
VT
Structural and functional
changes in UCG
++
++
++
++
++
±
RFCA
+
–
–
–
–
–
ICD
+
–
–
–
–
–
M: male. UCG: ultrasonic cardiography. SAECG: signal-averaged ECG. VLP: ventricular late potential. VT: ventricular tachyarrhythmia. VPBs: ventricular premature
beats. RFCA: radiofrequency current catheter ablation. ICD: implantational cardiac defibrillator. +: positive or yes. －: negative or no structural and functional changes
in UCG. ++: severe global or regional dilation of the right ventricular, severe systolic impairment, or aneurysm formation. ±: mild wall motion abnormalities, mild global
or regional right ventricular enlargement.
knowledge of the clinical data. The repeatability of these
measurements was tested.
Twelve-lead ECGs were obtained (recorded at 25 mm/s,
200 mm/s respectively) from multi-lead electrophysiological recording instruments in order to analyze the
results due to the different ECG criteria: Epsilon wave,
QRS-complex duration in V1-3 of 110 ms or higher, T-wave
inversion, QRS-complex duration (V1+V2+V3)/(V4+V5+V6),
QRS dispersion, and QT dispersion. The QRS-complex
duration was measured from the beginning of the QRS
complex to its end. The QT interval was measured from the
onset of the QRS-complex to the end of the T wave.
Whenever possible, 3 consecutive cycles were measured
in each of the 12 leads for the calculation of a mean value.
The QT, QRS dispersions were defined as the difference
between the maximum and minimum QT, QRS values
occurring in any of the 12 ECG leads, respectively. No
patients were on antiarrhythmic drugs or other drugs
known to affect the QRS-complex and/or the QT interval
during and before the acquisition of the ECG tracings
analyzed in the present study.
DNA isolation
Genomic DNA was isolated from whole blood samples
using TIANamp genomic DNA kits (Beijing, China).
Based on the published sequence of the PKP2 (Ensembl
gene No. ENSG00000057294), amplification and
sequencing of the exonic and adjacent intronic sequences for
exon-1, exon-2, exon-4 and exon-11 of the PKP2 gene were
carried out following standard protocols for all fragments.
Due to the high GC content, exon-1 of the PKP2 gene was
amplified using the GC buffer. The primers sequence is
shown in Table 1. The primers were designed using the
Primer Express 3.0 software. After amplification, PCR
products were purified and labeled with a Bigdye 3.1 kit
sequenced in both directions on an ABI PRISM 3730
genetic analyzer. DNA samples from 80 healthy persons of
the same ethnic origin were used as controls.
Statistical analysis
To compare the difference between the ECG and UCG
data obtained from the mutation group versus the
non-mutation group, the two independent-samples test
was used because the test of normality demonstrated a
normal distribution. The χ2 test was used to analyze the
classified ECG data of the two groups. A P value less
than 0.05 was considered statistically significant.
RESULTS
Mutations in PKP2
We identified 5 heterozygous PKP2 mutations in 6 of the
34 ARVC patients (Table 2). The numbering of the coding
sequence uses the A of the ATG start codon as position +1.
This mutation was not found in any of the other ARVC
patients or in any of the 80 ethnically-matched controls
(160 chromosomes).
The one pedigree with the PKP2 mutation (Family A)
was composed of patients No. 73, No. 84, No. 85, No. 86,
and No. 87 (Figure 1: Family A). The members of Family
A (except No. 87) had the same c.145–148 Del CAGA
(Figure 2: left -the reverse sequence Del TCTG) mutation
of PKP2. Also shown in Figure 2: right are the mutations
of PKP2 for patients No. 9, No. 20, and No. 47. The
positions of patients No. 9, No. 20, and No. 47 are c.331
C>T, c.156 G>A. c.1097 T>C, respectively.
Chinese Medical Journal 2009;122(4):403-407
Figure 1. ■□ denote males; ●○ denote females; ■● denote
individuals fulfilling International Task Force diagnostic criteria
for ARVC;8 grey denote family member fulfilling the modified
diagnostic criteria only;9 □○ denote unaffected individuals; N/A
denotes individuals who did not undergo clinical evaluation and
genetics evaluation; ⊙ denotes mutation carriers not fulfilling
ARVC diagnostic criteria respectively. The index patient in each
family is marked with an arrow.
405
received Radiofrequency Current Catheter Ablation
(RFCA) four times, but the therapy was unsuccessful, and
therefore an ICD was implanted. Patients No.73 and No.
84 had indications of RFCA; however, they refused to
undergo the treatment due to economic problems. The
remaining patients had premature ventricular beats of
more than 2000 beats in a 24-hour period.
Among all the clinical data, the only significant finding
was that the QT dispersion (QTD) was longer in the
mutation group than in the non-mutation group of ARVC
patients, and this result was statistically significant, with a
P value < 0.05, as shown in Table 3.
Table 3. The comparison of age, ECG and UCG characteristics in
PKP2-positive individuals vs individuals in whom no
mutation was identified (mean±SD)
Mutation
No mutation
P
(n=6)
(n=29)
values
Age (years)
38 ±17
32±14
0.442
QRS V1+V2+V3/ V4+V5+V6
1.1 ±0.1
1.20 ±0.21
0.504
QTD (ms)*
40±9
56±31
0.026
QRSD (ms)
26±9
31±14
0.294
LA (mm)
28±2
28±5
0.841
RA (mm)
55±15
45±8
0.162
RV A-PD (mm)
30±13
24±7
0.348
RV (mm)
62±15
55±9
0.332
LVEF (%)
60±10
71±6
0.311
MPA (mm)
24±2
22±3
0.402
RVIT (mm)
47±8
45±8
0.630
RVOT (mm)
35±12
31±6
0.504
Two-Independent-Samples of Test is used. *P <0.05 Mutation vs No mutation.
QTD: QT dispersion. QRSD: QRS dispersion. LA: the transverse diameter of left
atrium. RA: right atrium. RV A-PD: anteroposterior diameter of right ventricular.
LVEF: left ventricular ejection fraction. MPA: main pulmonary artery. RVIT:
right ventricular inflow tract. RVOT: right ventricular outflow tract.
Characteristics
Figure 2. Mutation type: No.73, No.
84, No. 85, No. 86 exon-1 145_148
Del CAGA (The reverse sequence:
Del TCTG). No.9 the forward
sequence: c.331 C>T. No.20 the
forward sequence: c.156 G>A (Reverse: C>T). No.47 the forward
sequence: c.1097 T>C. The arrows showing the mutation sites.
Patient No.8 is c.2146–1–c.2146 Del GA (Figure 3A) of
the mutation. Its sequence of transcription level is to
delete all Exon-12 (Figure 3B).
DISCUSSION
Figure 3. A: No. 8 the forward sequence: DNA level
c.2146–1–c.2146 Del GA. B: No. 8 The reverse sequence:
Transcription level deletion of all exon-12. The arrows showing
the mutation sites.
Two other family members, patient No.20 and patient
No.47, were diagnosed with ARVC (Figure 1: Family B,
C), but their family members did not possess the
corresponding mutation of the proband. That is to say,
there was one pedigree at the molecular level and three
pedigrees at the clinical level within our study.
Clinical findings
The clinical characteristics of the six patients with the
PKP2 mutation are shown in Table 2 and Table 3. Three
patients (No. 8, No. 73, and No. 84) had severe VT. Their
sequence contained a deletion mutation. Patient No.8
Our study showed that PKP2 mutations can occur in
southern Chinese patients with ARVC. The Plakophilin-2
protein, a 98-kDa desmosomal protein encoded by PKP2,
can affect the structural function of the desmosome.
Desmosomes are the most prevalent in tissues exposed to
friction and shear stress, such as the myocardium and
epithelium, where they play a key role in imparting
mechanical strength. Desmosomes accomplish this using
both cell to cell adhesion and via transmission of the
force between the junctional complex and the
intermediate filaments in the cytoskeleton.10
Gerull and colleagues6 screened 120 probands with
ARVC for mutations in PKP2. They found that 32 of
these individuals harbored heterozygous mutations in this
gene. Lahtinen AM et al identified three PKP2 mutations
in 29 unrelated Finnish ARVC patients (10%), absent of
controls.11 In our study, we screened 34 ARVC patients
for mutations in exon-1, 2, 4, and 11 of PKP2. We found
that 6 of these individuals had heterozygous mutations in
this gene, with a prevalence of 18%.
As genetic testing for heritable cardiomyopathies
Chin Med J 2009;122(4):403-407
406
proceeds to clinical use, it is critical for clinicians to have
an understanding of the implications of a positive genetic
test. Familial ARVC is believed to account for at least
30% to 50% of all ARVC cases.12 It is estimated that as
many as 70% of the mutations linked to familial ARVC
are in the gene coding for PKP2.13 Dalal et al14 reported
that PKP2 mutations in a group of North American
families with ARVC have both reduced penetrance and
varying expressivity. Therefore, if a proband is identified
with a PKP2 mutation, his family members should
undergo genetic screening and clinical evaluation as well.
In our study, there were three probands. Among those
three probands, there were a total of five family members
diagnosed with ARVC.
ARVC patients ((40±9) ms); this result was statistically
significant, with a P value less than 0.05, as shown in
Table 3. These patients were not on any medication;
therefore, the QTD was not affected by drugs. It has been
shown in the study that non-invasive family screening
used to identify mutation carriers may largely be based on
QTD.
In summary, this is the demonstration of PKP2 in the
Chinese population. Our results support the idea that
PKP2 is also a predisposing gene in the Chinese ARVC
population. In future studies, we hope to research the
function of this mutation in more detail.
REFERENCES
A deletion mutation (c.145_148 del GACA) was found in
one family pedigree. In that family pedigree, the male
was found to have ARVC. Two of his three sisters were
mutation carriers but had no clinical symptoms, and the
other sister did not have the mutation. These findings
suggest that the men may be at a greater risk for this
condition. Other reports that describe the clinical
characteristics of family members of ungenotyped ARVC
cases show a male preponderance of cases. In a study of
37 Italian families with ARVC, 62% of individuals with
ARVC were men.15 Similarly, Hamid et al16 found that
among first-and second-degree relatives of ARVC cases
in Western Europe, 10% met TFC for ARVC, and 72% of
them were men. Kannankeril et al17 reported a novel
PKP2 mutation that causes familial ARVC. All mutation
carriers in this kindred group were women. Of the four
relatives, only the mother and younger sister were
identified as mutation carriers. The mother was
phenotypically normal, while the younger sister has
repolarization abnormalities and frequent ventricular
ectopy. Lower penetrance among women may be the
result of less exposure to environmental factors, such as
sustained vigorous athletic activity or exposure to viral
agents causing inflammation, which are hypothesized to
trigger ARVC in susceptible individuals. Alternately, the
reduced penetrance may result from biological
differences.
Dalal et al18 analyzed the clinical features of 58 ARVC
patients with different PKP2 mutations and with no-PKP2
mutations. They found that the mean age at presentation
was lower among those with a PKP2 mutation (28±11
years) than among those without a PKP2 mutation (36±16
years) (P <0.05). In our study, the difference between the
mean ages of the two groups at presentation was not
significant.
Antoniades L et al19 reported that non-invasive family
screening may largely be based on T-wave inversion,
right ventricular wall motion abnormalities, and frequent
ventricular extrasystoles to identify mutation carriers.
Among all the clinical data, the only significant finding
was that the QTD was longer in patients with a PKP2
mutation ((56±31) ms) than in the non-mutation group of
1.
Marcus FI, Fontaine GH, Guiraudon G, Frank R, Laurenceau
JL, Malergue C, et al. Right ventricular dysplasia: a report of
24 adult cases. Circulation 1982; 65: 384-398.
2. Thiene G, Nava A, Corrado D, Rossi L, Pennelli N. Right
ventricular cardiomyopathy and sudden death in young people.
N Engl J Med 1988; 318: 129-133.
3. Hulot JS, Jouven X, Empana JP, Frank R, Fontaine G. Natural
history and risk stratification of arrhythmogenic right
ventricular dysplasia/cardiomyopathy. Circulation 2004; 110:
1879-1884.
4. Dalal D, Nasir K, Bomma C, Prakasa K, Tandri H, Piccini J, et
al. Arrhythmogenic right ventricular dysplasia: a United States
experience. Circulation 2005; 112: 3823-3832.
5. Garrod DR. Desmosomes and hemidesmosomes. Curr Opin
Cell Biol 1993; 5: 30-40.
6. Gerull B, Heuser A, Wichter T, Paul M, Basson CT,
McDermott DA, et al. Mutations in the desmosomal protein
plakophilin-2 are common in arrhythmogenic right ventricular
cardiomyopathy. Nat Genet 2004; 36: 1162-1164.
7. Awad MM, Dalal D, Tichnell C, James C, Tucker A, Abraham
T, et al. Recessive arrhythmogenic right ventricular dysplasia
due to novel cryptic splice mutation in PKP2. Hum Mutat
2006; 27: 1157.
8. McKenna WJ, Thiene G, Nava A, Fontaliran F,
Blomstrom-Lundqvist C, Fontaine G, et al. Diagnosis of
arrhythmogenic right ventricular dysplasia/cardiomyopathy:
Task Force of the Working Group Myocardial and Pericardial
Disease of the European Society of Cardiology and of the
Scientific Council on Cardiomyopathies of the International
Society and Federation of Cardiology. Br Heart J 1994; 71:
215-218.
9. Hamid MS, Norman M, Quraishi A, Firoozi S, Thaman R,
Gimeno JR, et al. Prospective evaluation of relatives for
familial arrhythmogenic right ventricular cardiomyopathy/
dysplasia reveals a need to broaden diagnostic criteria. J Am
Coll Cardiol 2002; 40: 1445-1450.
10. Sen-Chowdhry S, Syrris P, McKenna WJ. Genetics of right
ventricular cardiomyopathy. J Cardiovasc Electrophysiol 2005;
16: 927-935.
11. Lahtinen AM, Lehtonen A, Kaartinen M, Toivonen L, Swan H,
Widén E, et al. Plakophilin-2 missense mutations in
arrhythmogenic right ventricular cardiomyopathy. Int J
Cardiol 2008; 126: 92-100.
Chinese Medical Journal 2009;122(4):403-407
12. Corrado D, Fontaine G, Marcus FI, McKenna WJ, Nava A,
Thiene G, et al. Arrhythmogenic right ventricular
cardiomyopathy: need for an international registry. Circulation
2000; 101: E101-E106.
13. van Tintelen JP, Entius MM, Bhuiyan ZA, Jongbloed R,
Wiesfeld AC, Wilde AA, et al. Plakophilin-2 mutations are the
major determinant of familial arrhythmogenic right ventricular
dysplasia/cardiomyopathy. Circulation 2006; 113: 1650-1658.
14. Dalal D, James C, Devanagondi R, Tichnell C, Tucker A,
Prakasa K, et al. Penetrance of mutations in plakophilin-2
among families with arrhythmogenic right ventricular
dysplasia/cardiomyopathy. J Am Coll Cardiol 2006; 48:
1416-1424.
15. Nava A, Bauce B, Basso C, Muriago M, Rampazzo A,
Villanova C, et al. Clinical profile and long-term follow-up of
37 families with arrhythmogenic right ventricular
cardiomyopathy. J Am Coll Cardiol 2000; 36: 2226-2233.
16. Hamid MS, Norman M, Quraishi A, Firoozi S, Thaman R,
Gimeno JR, et al. Prospective evaluation of relatives for
familial arrhythmogenic right ventricular cardiomyopathy/
dysplasia reveals a need to broaden diagnostic criteria. J Am
407
Coll Cardiol 2002; 40: 1445-1450.
17. Kannankeril PJ, Bhuiyan ZA, Darbar D, Mannens MM, Wilde
AA, Roden DM. Arrhythmogenic right ventricular
cardiomyopathy due to a novel plakophilin 2 mutation: wide
spectrum of disease in mutation carriers within a family. Heart
Rhythm 2006; 3: 939-944.
18. Dalal D, Molin LH, Piccini J, Tichnell C, James C, Bomma C,
et al. Clinical features of arrhythmogenic right ventricular
dysplasia/cardiomyopathy associated with mutations in
plakophilin-2. Circulation 2006; 113: 1641-1649.
19. Antoniades L, Tsatsopoulou A, Anastasakis A, Syrris P,
Asimaki A, Panagiotakos D, et al. Arrhythmogenic right
ventricular cardiomyopathy caused by deletions in
plakophilin-2 and plakoglobin (Naxos disease) in families
from Greece and Cyprus: genotype-phenotype relations,
diagnostic features and prognosis. Eur Heart J 2006; 27:
2208-2216.
(Received May 20, 2008)
Edited by WANG Mou-yue and LIU Huan