Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
The 2nd International Symposium „VERA JOHANIDES” BIOTECHNOLOGY IN CROATIA by 2020 Zagreb, May 10-11, 2013 Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković Laboratory for antibiotic, enzyme, probiotic and starter cultures technology Department of Biochemical Engineering Faculty of Food Technology and Biotechnology, University of Zagreb, Croatia Strategy for the selection of probiotic strains in Laboratory for antibiotics, enzymes, probiotics and starter cultures technology (Šušković et al., 1992.) Accurate taxonomic identifications General Biosafety BCCM confirmed taxonomic nomenclature of our 9 selected strains: Lactobacillus helveticus M92, L. plantarum L4, L. brevis D6, L. brevis ZG1, L. brevis SF9B, L. paraplantarum SF15B, L. fermentum A8, Enterococcus faecium L3, E. faecium A7… GRAS (Generally Regarded As Safe, according US FDA) status of selected strains Resistance to pH, gastric juice bile, pancreatic juice (Antibiotic susceptibility) Technological Activity and viability (production/processing) Antimicrobial activity Antagonism to pathogens Functional aspects Adherence to intestinal epithelium/tissue Influencing metabolic activities Stimulation immune response PhD Thesis (Šušković, 1996) PhD Thesis (Šušković, 1996) Master Thesis (Kos, 1995) PhD Thesis (Uroić, in progress) PhD Thesis (Šušković, 1996) Master Thesis (Frece, 2003) PhD Thesis (Leboš Pavunc, 2012) PhD Thesis (Kos, 2001) PhDThesis (Uroić, in progress ) PhD Thesis (Beganović, 2008) PhD Thesis (Šušković, 1996) PhD Thesis (Kos, 2001) PhD Thesis (Leboš Pavunc, 2012) PhD Thesis (Frece, 2007) PhD Thesis (Beganović, 2008) PhD Thesis (Uroić, in progress) Characteristics of Lactobacillus S-layer proteins • • • • monomolecular crystalline arrays composed of (glyco)proteins located on external side of cell envelope identified in different microorganisms from the domains of Bacteria and Archaea detected in just a few strains among 117 know Lactobacillus species: – lower MW : 25-71 kDa – highly basic proteins (pI = 9.35-10.4) – mostly non-glycosylated – signal peptide (N- terminal secretion signal ) typical for Sec pathway (25-30 AA) cell membrane cell wall S-layer S-layer present on the L. brevis D6 cell surface performed by transmission electron microscopy (PhD in progress, Ksenija Uroić) Detection of S-layer proteins of Lactobacillus strains from Laboratory of antibiotics, enzymes, probiotics and starter cultures technology SDS-PAGE surface protein profiles S-layer proteins: 1. L. paraplantarum SF15B 2. L. brevis D6 3. L. brevis ZG1 4. L. brevis SF9B PCR analysis with the specific primers ATGAAGAAAAATTTAAGAAT and CACCGATCTTGTAGTA. 1 2 S 1. L. helveticus M92 2. L. plantarum L4 S- DNA standard slpA gene (GenBank acession number HM140425) L. helveticus M92 S-layer protein identified by SDS-PAGE coupled to LC-MS/MS S 1 (LC-MS/MS) SlpA protein nESI linear ion trap-MS Nano HPLC Peptide separation S – low MW protein standard; 1 – S-layer, purified by dialysis Peptide sequences assigned to SlpA protein by Bioworks 3.2. Beganović et al., (2010) Journal of Proteomic Research, 9 (2): 677-688 Beganović et al., (2011) Antonie van Leeuwenhoek, 100 (1): 43-53 Role of S-layer proteins in probiotic activity of Lactobacillus strains 1. Adhesion of Lactobacillus strains to IPEC-1 cell line (porcine intestinal epithelial cells) 16% 14% 12% % adhesion 10% A600=0,25 8% A600=0,5 A600=1 6% 4% 2% 0% 1110 1112 1115 1118 M92 D6 Lactobacillus strains are labeled by thymidine and the radioactivity of the samples was measured by liquid scintillation (L. helveticus M92 as reference strain) Role of S-layer proteins in probiotic activity of Lactobacillus strains 2. Inhibition of adhesion of enterotoxigenic Echerichia coli to IPEC-1 cell line by Lactobacillus strains - COMPETITION simultaneous addition of Lactobacillus and E. coli ERL 2055 - DISPLACMENT addition of Lactobacillus after incubation of E. coli ERL 2055 100% % inhibition 80% 60% 40% 20% 0% 1110 1112 1115 1118 M92 D6 - EXCLUSION addition of Lactobacillus before incubation of E. coli ERL 2055 Role of S-layer proteins in probiotic activity of Lactobacillus strains 3. Imunomodulation mediated by Lactobacillus purified S- layer proteins • Extraction of S-layers from Lactobacillus cell surface 1 2 3 4 5 6 1 1 - L. brevis GRL1 2 - L. amylovorus GRL 1110 3 - L. amylovorus GRL 1111 4 - L. amylovorus GRL 1112 5 - L. helveticus M92 6 – L. plantarum D6 2 3 4 5 6 Induction of IL-1, IL-6, IL-10, IL-12, TNF cytokines production in human monocyte-derived dendritic cells with Lactobacillus strains and purified S-layer proteins - determined by cytokine specific ELISA Stimulation of HEK Blue cell lines -TLR2, TLR4, TLR5 and NOD2with Lactobacillus strains and purified S-layer proteins Maturation of dendritic cells in response to Lactobacillus bacterial cells and purified S-layer proteins analysed by Flow Cytometric Analysis (FACS) 120 120 CD86 100 % positive cells 100 80 60 40 80 60 40 20 20 0 0 % positive cells % positive cells HLA-DR II 5 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0 CD83 Bacteria/S-layer proteins induced expression of moDC maturation markers HLA class II, CD86 and CD83 Biotechnological protocol in Laboratory for antibiotics, enzymes, probiotics and starter cultures technology, for probiotic and starter culture production technology Collection of lactic acid bacteria (ZBMK) over than 300 characterised LAB strains Inoculation Growth medium Phenotypic characterisation probiotic strain / starter culture Inoculum Growth Sterilisation Production process control: - microbiological control - genetic control Nutrient medium removal Wet biomass of probiotic / starter culture lyoprotectant addition MICROENCAPSULATION LYOPHILIZATION microbiological control genetic control MIKROENCAPSULATION microbiological control genetic control Probiotic bacterium/ starter culture functionality control SCIENTIFIC PROJECTS & COLLABORATIONS: o National scientific project “Probiotics, prebiotics and functional starter cultures” No. 058- 1990-2007 o International project SEE-ERA.NET PLUS: PSALAB No. 195/1 Project leader: PhD Jagoda Šušković, full prof. o Collaborative project with research team of PhD Airi Palva, prof., University of Helsinki, Finland