Download List of Figures - Research Projects

1
Technical Report
Transmittal Letter
Date: 10/09/2014
Researcher name: Soundararajan Krishnaswamy
College: College of Science
Department: Department of Biochemistry
Address: E-mail:[email protected]
Dear Sir,
We are submitting to you the report, due 1/9/2014, that you requested. The report
is entitled First Year End technical report on my ongoing project entitled:
Alternatively Spliced Isoforms of RON (MST1R) as Etiologic Agents in
Cancer: Structure and Function Elucidation and Therapeutic Targeting. The
purpose of this report is to update you on the progress of this project . The content
of this report concentrates on the various objectives outlined for the first year and
the progress that has been made so far. This report also discusses some issues
arising out of our research results and the need to make some minor changes to
certain objectives. If you should have any questions concerning our project and
paper please feel free to contact me by mobile: 0531352016 or email:
[email protected].
Sincerely,
Soundararajan Krishnaswamy
Principal Investigator (PI)
Affiliation: Biomarker Research Program, Dept. of Biochemistry.
2
Title Page
Submitted for
National Plan for Science and Technology
King Saud University
Project title
Alternatively Spliced Isoforms of RON (MST1R) as Etiologic Agents in Cancer:
Structure and Function Elucidation and Therapeutic Targeting
Project number
11-MED-2806-02
Project Investigator
Soundararajan Krishnaswamy
Year
2013-2015
3
Abstract
Ample evidence correlates aberrant RON receptor tyrosine kinase expression to tumor aggressiveness and
metastasis in various cancer types. We aimed to understand the molecular aberrations, occurring at the
isoform level, of the proto-oncogene RON. We hypothesized that the plethora of tumor enhancing
functions of RON, observed in numerous independent studies, may be caused by isoforms formed as a
result of increased alternative splicing associated with aberrant expression of RON in tumors. We
reasoned that application of methods deficient in isoform-specificity, for both quantification and
functional determination of RON, may have hindered our understanding of the precise molecular
mechanism linking aberrant RON expression and cancer. Screening RON transcripts from 12 small cell
lung cancer (SCLC) and 12 non-small cell lung cancer (NSCLC) cell lines by cDNA sequencing revealed
the presence of numerous alternatively spliced RON transcripts as demonstrated by the presence of
numerous unique exon/intron deletions and insertions. Somatic mutations were not detected in RON
coding sequence. Analysis of lysates by Western blotting indicated the presence of several isoforms of
RON in most of these cell lines. When probed using different RON antibodies, each recognizing a unique
epitope of RON, Western blotting of cell lysates showed different RON specific banding patterns. While
isoforms of RON were detected in the lysates of all the cell lines tested, wild type RON was missing in
several of them. Analysis of the protein sequences (predicted from transcript sequences) indicated that
alternatively spliced isoforms of RON could be localized differently (cytoplasmic, transmembraneous and
extracellular) and may exhibit constitutive or dominant negative activities of RON. Besides, the secreted
isoforms of RON may interact with intra-tumor ligand, macrophage stimulating protein (MSP), or wildtype RON present on tumor associated macrophages (TAM) and other cells of the tumor
microenvironment. Future functional studies of the newly identified transcripts, by cloning and
expression of the individual transcripts, are expected to reveal the tumor promoting functions of specific
isoforms and leading to development of better targeted therapies.
Acknowledgments
Funding support for this ongoing project is provided by The National Plan for Science, Technology and
Innovation (NPST), King Saud University.
4
Contents
Introduction
Receptor tyrosine kinases in cancer development and therapy
Role of RON in cancer development
Role of RON in cancer development
Isoforms of RON
Need to study RON functions at the isoform level
Objectives
List of Figures
Report Body
Materials and methods
Cells, media and lysate preparation and Western blotting
RNA isolation, cDNA preparation and sequencing
Cloning of full length alternatively spliced RON transcripts
Results
Western blotting
Sequencing
Bioinformatic analysis of sequencing results
Cloning of full length RON transcripts and sequencing
Discussion
Future work
References
Introduction
Receptor tyrosine kinases in cancer development and therapy
Currently applied chemotherapies for cancer patients cause suffering worse than the disease itself, due to
the severe non-specific side effects. Even though research over the last few decades has led to a greater
understanding of tumor biology at the molecular level and offers therapies that are more targeted to the
5
tumor, only a small fraction of cancer patients respond to these therapeutics and the cure rate is even
smaller due to deficiencies in our understanding of the molecular sub-types in tumors.
Receptor tyrosine kinases (RTKs) control cellular growth, metabolism and migration and hence are
targeted widely in cancer treatment. Consequently, cancer cells employ various intrinsic cellular
mechanisms to alter their functions to enhance tumorigenesis as well as metastasis. EGFR, for example, is
one of the RTKs mutated or amplified in several cancers and hence is targeted by several drugs in lung
and other cancers. However, only 10 to 15% patients respond to EGFR treatment. Lack of complete
understanding of EGFR molecular alterations in cancer may be the reason behind the low response rate.
Role of RON in cancer development
RON is another member of tansmembrane RTKs. RON is a member of Met family of receptor tyrosine
kinases and overexpression of RON has been observed in several cancers where its expression level
correlated to tumor stage and malignancy (Maggiora, Marchio et al. 1998; Zhou, He et al. 2003; O'Toole,
Rabenau et al. 2006; Camp, Yang et al. 2007). Currently, intense research efforts are on to target RON
using small molecule tyrosine kinase inhibitors or specific antibodies. However, understanding and
targeting RON for therapy is complicated due to the presence of multiple isoforms in tumors which have
similar sequence structures but vastly different functions.
Isoforms of RON
Northern blot analysis of multiple normal tissues have confirmed the constitutive splicing of RON
resulting in a single sized mRNA (Ronsin, Muscatelli et al. 1993; Gaudino, Follenzi et al. 1994)and
spliced RON variants mainly in primary and established cancer cell lines (Collesi, Santoro et al. 1996;
Wang, Kurtz et al. 2000; Zhou, He et al. 2003; Wang, Lao et al. 2007) suggesting that a switch from the
constitutive to alternative splicing occurs in cancer cells. Several transcripts and corresponding protein
isoforms have already been identified for RON.
Various structural features of RON, like large number of exons and several functional motifs, affect both
the variety and functionality of splicing products (Fig 1). Signal sequence, located at the N-terminal
(amino acids 1 to 24), and transmembrane domain (amino acids 960 to 982), coded by exon 12, are
important determinants of localization of various alternatively spliced isoform of RON. Alternative
splicing also leads to formation of truncated isoforms due to frame-shift caused by exon skipping
(Eckerich, Schulte et al. 2009) or intron retention, both of which result in loss of transmembrane region.
Accordingly, intracellular, transmembraneous and extracellular isoforms of RON have been identified.
6
Functionally, constitutively phosphorylated (Collesi, Santoro et al. 1996) and ligand (MSP) binding
dominant negative isoforms (Eckerich, Schulte et al. 2009) of RON have been reported. Constitutively
active forms have been found to be either transmembraneous or intracellular while dominant negative
isoforms have been found to be extracellular or transmembraneous.
RON isoforms have caused epithelial cell transformation in in vitro studies, and produced invasive
phenotypes and mediated tumor growth, in vivo (Wang, Wang et al. 2003). RON variants have also been
shown to facilitate tumor progression towards malignancy (Zhou, He et al. 2003; Camp, Liu et al. 2005).
In a recent study, targeting wild type RON using multiple monoclonal antibodies has failed to stop tumor
progression (Gunes, Zucconi et al. 2011).
Need to study RON functions at the isoform level
Application of methods lacking isoform specificity in the study of aberrantly expressed RON in cancers
has led to the general belief that RON overexpression as the driver of various cancers. Methods to
quantify specific isoforms have not been developed/applied, yet. Currently applied antibody or PCR
based quantification methods are not capable of distinguishing isoforms. Also, methods used to study the
tumor promoting functions of aberrantly expressed RON, like siRNA knockdown, lack isoform
specificity. Isoform specific quantification and functional determination are important prerequisites for
understanding the deregulated RON signaling in cancers. Understanding and targeting aberrantly
expressed RON for tumor treatments requires identification of all the isoforms as well as their distribution
in cancers.
List of Figures
Figure 1: Western blot profile of RON expression in non-small cell lung cancer (NSCLC) and small cell
lung cancer (SCLC) cell lines using Ron β (C-20) antibody (antibody targeting the cytoplasmic Cterminus epitope of Ron β chain).
Figure 2. Western blot analysis of RON expression in NSCLC and SCLC cell lines using Ron β (H-160)
antibody (antibody specific for amino acids 531-690 of the extracellular region of Ron β chain)
Figure 3. Schematic diagram showing exons, domains and important amino acid residues of RON coding
sequence.
Figure 4A. RON transcripts lacking exons 18 and 19 in cell line H249.
7
Figure 4B. RON transcripts lacking exon 19 in cell line H249.
Figure 4C. RON transcripts lacking exons 18 + 19 and exon 19 in cell line H249.
Figure 5. Alternatively spliced RON transcripts from 4 SCLC cell lines showing deletion of exons 18 +
19 and exon 19.
Figure 6. RON transcripts lacking exons 18 and 19 in 7 NSCLC cell lines.
Figure 7. Schematic diagram showing cloned and sequenced full length transcripts of RON.
Report Body
Objectives
1. To confirm the presence of isoforms of RON by analysis of transcripts and corresponding protein
products in cancer cell lines.
2. To clone and identify the primary sequences of the mRNA transcripts of RON using different cancer
cell lines.
Details of experiments and results obtained are given below.
Materials and methods
Cells, media and lysate preparation and Western blotting
Lung cancer cell lines were procured from ATCC (USA) and cultured according to protocol given on
ATCC website. Cells were lysed in RIPA buffer in the presence of protease inhibitor cocktail (from Santa
Cruz). Protein concentrations were determined and 25 microgram protein of the lysates were used for
analysis by SDS-PAGE (SDS-polyacrylamide gel electrophoresis). Following SDS-PAGE, the proteins
were transferred on to PVDF membrane by Semi-Dry transfer and probed using RON specific antibodies
according to standing protocols.
RNA isolation, cDNA preparation and sequencing
Cells growing in logarithmic phase were harvested in Qiazol reagent and RNA isolated using RNeasy
Lipid Tissue Mini Kit (from Qiagen). RNA isolated from individual cell lines was converted into cDNA
8
using GOSCRIPT REVERSE TRANSCRIPTION SYSTEM from Promega. cDNA was generated using 1
ug of total RNA and oligo dT primer by using Single Strand cDNA Synthesis Kit (Clontech, Palo Alto,
CA,USA). cDNAs were PCR amplified using RON specific PCR primers covering 755 bps of RON
reference mRNA sequence (NM_000247) using forward primer (located in exon 16) 5’CCCTATATGTGCCACGGTGA - 3’ and reverse primer (located in exon 20) 5’CAAGGCAGCTAAGCAGGTCCAG - 3’. PCR reactions were carried out using Phusion high fidelity
DNA polymerase (New England Biolabs, MA), in a final volume of 15 uL reagent. PCR conditions were:
initial denaturation at 98○C for 30 sec followed by 30 cycles of i) denaturation at 98○C for 10 sec, ii)
annealing at 60○C for 20 sec and iii) extension at 72○C for 15 sec. PCR products were treated with EXOSAP-IT (USB, Cleveland, OH) to remove excess primers, following the manufacturer's instructions and
sequenced bi-directionally using the same PCR amplification primers. Sequencing was performed by
employing Big Dye Terminator Chemistry (Applied Biosystems, Weiterstadt, Germany). Sequence
deletions in the PCR products were identified manually by aligning sequencing chromatograms with
reference RON sequence using Mutation Surveyor version 3.1 software (SoftGenetics, State College,
PA). The nucleotide positions numbering is relative to the first base of the translational initiation codon
according to the full-length RON coding sequence (CCDS 2807.1).
Cloning of full length alternatively spliced RON transcripts
Total RNA was isolated from SCLC and NSCLC cell lines as described above; the RNAs were pooled.
RNA was converted to cDNA using RON specific 3’ primer and cloned into pENTR by TOPO cloning
(Gateway Technology, Invitrogen) vector. These vectors carrying inserts were amplified in bacteria by
transformation. Plasmids isolated and the full lengths of inserts were sequenced bi-directionally.
Results
Western blotting
Following the PCR confirmation of the presence of multiple transcripts of RON in lung Cancer cell lines
(summarized in the previous report), Western blotting was performed on lysates from several cell lines.
Cells were procured from ATCC and cultured according to protocol given in ATCC website. Cells were
lysed in RIPA buffer in the presence of protease inhibitor cocktail (from Santa Cruz). Protein
concentrations were determined and 25 microgram protein of the lysates were used for analysis by SDSPAGE (SDS-polyacrylamide gel electrophoresis). Following SDS-PAGE, the proteins were transferred
on to PVDF membrane by Semi-Dry transfer and probed using RON specific antibodies.
9
Figure 1: Western blot profile of RON expression in non-small cell lung cancer (NSCLC) and small
cell lung cancer (SCLC) cell lines using Ron β (C-20) antibody (antibody targeting the cytoplasmic
C-terminus epitope of Ron β chain).
Figure 2. Western blot analysis of RON expression in NSCLC and SCLC cell lines using
Ron β (H-160) antibody (antibody specific for amino acids 531-690 of the extracellular
region of Ron β chain)
Probing was performed using two different antibodies, which have been raised against different
epitopes of RON. C-20 antibody specifically binds to a region in the C-terminal end of RON β
chain and H-160 antibody, specific for amino acids 531-690 of β chain of RON.
10
The different banding profiles seen with the two antibody probes (shown in the above two
figures), for each of the cell lines used in the study, indicates, clearly, the existence of multiple
RON isoform proteins in all the cell lines; in the absence of isoforms, both the antibodies are
expected to yield a single band of RON on Western blot.
Sequencing
cDNA obtained from individual cell clines were PCR amplified and sequenced using two C-terminal
primers as described in methods section. The products were sequenced using both forward and reverse
primers and the chromatograms were analyzed and the results are presented in the following sections.
.
Figure 3. Schematic diagram showing exons, domains and important amino acid residues of RON
coding sequence. A: 20 coding exons of RON gene are shown alternatingly,in red and blue; B: 20 coding
exons of RON CCDS drawn in proportion to length; C: segment of RON coding sequence PCR amplifed
for sequencing; D: various domains of RON protein and two juxtaposed tyrosine residues at position 1238
and 1239 respectively (Y-Y) in the kinase domain (exon 18, to be specific). A carboxy-terminal docking
site for multiple substrates with src homology 2 (SH2) domains is composed of two phosphorylation sites
for tyrosine at positions 1353 and 1360.
11
Figure 4A. RON transcripts lacking exons 18+19 in cell line H249. PCR product sequenced sequenced
from 5’ end showing deletion of exons 18+19. Corresponding region of reference RON sequence is
numbered and sequencing chromatogram shown at the top in each panel; the bottom chromatogram is that
of specific cell line.
Figure 4B. RON transcript lacking exon 19 in cell line H249. PCR product sequenced from 3’ end
showing deletion of exon 19.
12
Figure 4C. RON transcripts lacking exons 18 + 19 and exon 19 in cell line H249. PCR product
sequenced from 5’ end showing 2 transcripts having deletions of exons 18 + 19 and exon 19.
In each of the above cases, corresponding region of reference RON sequencing chromatogram is shown at
the top in each panel. The bottom chromatogram is that of specific cell line. cDNA sequence is numbered
according to reference RON cDNA (GENBANK) sequence.
13
Figure 5. Alternatively spliced RON transcripts from 4 SCLC cell lines showing deletion of exons
18 + 19 and exon 19. cDNAs from cell lines were PCR amplified and sequenced from 5’ end using
reverse primer as described in methods. Reference sequence and the numbers of base pairs are given at
the top of the panel.
14
Figure 6. RON transcripts lacking exons 18 and 19 in 7 NSCLC cell lines.
15
Bioinformatic analysis of sequencing results
A search of human EST database for partial RON transcripts involving deletion of exons 18 + 19
failed to bring up any positive result indicating that this is a novel transcript. However, exon 19
deletion is represented by EST sequence AW009348.
Loss of 303 bases from 3645 to 3947, caused by deletion of exons 18+19, corresponded to loss
of 101 amino acids from 1216 to 1316 of the reference sequence. Deletion of exons 18 + 19
doesn’t cause reading-frame shift. Amino acids coded by exons 18 and 19 form part of tyrosine
kinase domain (amino acids 1082 to 1341 of RON). This region of the tyrosine kinase domain
has tyrosine residues Y1238 and Y1239 that are phosphorylated following binding of RON by
MSP (Fig 1). However, exon 19 is 137 bases long and consists of nucleotides 3811 to 3947 of
the reference RON sequence. Deletion of exon 19 leads to a shift in reading frame. Hence,
changes appear after amino acid 1270, including the appearance of a termination codon.
Cloning of full length RON transcripts and sequencing
Figure 7. Schematic diagram showing cloned and sequenced full length transcripts of RON.
Sequencing of inserts from plasmids isolated from several colonies of cDNA library yielded two clones
containing unique alternatively spliced transcripts; one of them lacking exons 6 and 11-13; the other
lacking only exon 11. More clones are being sequenced.
16
Discussion
A novel RON transcript lacking exons 18 and 19 was discovered in lung cancer cell lines. This
transcript co-occurred with a previously reported transcript lacking exon 19 in 12 lung cancer
cell lines. Deletion of exons 18 + 19 results in an in frame deletion of 303 bases corresponding to
101 amino acids, which form part of the catalytic kinase domain. The isoform product coded by
this transcript is predicted to act in a dominant negative fashion and block MSP stimulated RON
signaling. These isoforms may enable tumors acquire growth factor (MSP) independent signaling
of cancers. Presence of these two transcripts in tumor cells may interfere with estimation of
normal RON either by immunological or PCR methods leading to exaggerated values.
Structural similarities between different isoforms of RON are enough to make their individual
quantification difficult, if not impossible. However, the small structural differences between
isoforms are enough to create functionally very different proteins. A major problem is in
quantification of aberrantly expressed RON where antibodies and PCR primers are not specific
to any of the isoforms are used. Another deficiency is in the functional analysis of RON in
cancers, where the lack of specificity of siRNAs may indiscrimately target several isoforms of
RON (Logan-Collins, Thomas et al. 2010; Park, Park et al. 2010). Based on studies performed
using reagents lacking isoform specificity reduced survival and increased apoptosis were
attributed to wild type RON overexpression even though constitutively expressed isoforms have
also been shown to accelerate cell proliferation in various cancers (Collesi, Santoro et al. 1996;
Lu, Yao et al. 2007). Since isoforms of RON have diverse, and sometimes even opposing,
functions it is imperative to identify and characterize the individual isoforms, both structurally
and functionally, for target validation and therapeutic targeting.
Our study has revealed the presence of a novel transcript involving deletion of exons 18 +19 in
almost all the cell lines and tissues of lung cancer. Also, another transcript involving deletion of
exon 19 was found in all the samples and this transcript has been reported previously (Wang,
Lao et al. 2007). Transcript lacking exons 18+19 can’t be a substrate for nonsense mediated
decay (NMD), since no nonsense codons are generated prematurely due to alternative splicing.
17
Several dominant negative isoforms of RON have previously been reported in cancers. These
dominant negative forms are either secreted or intracellular. The variant RONΔ85 is a soluble
protein from an mRNA transcript with an insertion of 49 nucleotides between exons 5 and 6.
RONΔ90 is another secreted RON isform, formed from a transcript lacking exon 6 and truncated
as a result (Eckerich, Schulte et al. 2009). Both these forms are capable of binding both MSP and
RON and eventually block MSP/RON signaling. RONΔ170 is a splice variant formed due to
deletion of exon 19 resulting in a loss of 46 amino acids in the catalytic kinase domain (Wang,
Lao et al. 2007). Additionally, this deletion also caused frame-shift resulting in absence of the
multi-functional C terminal docking site. RONΔ170, capable of binding MSP as well as
dimerizing with normal RON, has been shown to act as a dominant negative receptor that
negatively regulates biochemical and biological activities initiated by MSP binding to RON
(Wang, Lao et al. 2007). The product of the novel transcript lacking exons 18 + 19 is also
expected to perform functions similar to RONΔ170.
Based on the dominant negative role of some of the RON isoforms formed by cancer cells we
hypothesize that inhibiting normal RON or MSP for therapeutic purposes might not neutralize
the tumor promoting role of RON. In a recent study, three high-affinity monoclonal antibodies
against human RON were found to efficiently block ligand (MSP) binding and RON
dimerization. However, none of the antibodies inhibited tumor growth in different epithelial
tumor xenografts in nude mice and the authors of this study suggested that properties other than
blocking MSP ligand binding as essential for anti-RON mAbs to exert antitumor effects in
vivo (Gunes, Zucconi et al. 2011).
While dominant negative isoforms are produced in cancers, tumor cells also form constitutively
active isoforms which can act without stimulation by MSP. Three splicing variants of RON,
namely RONΔ165, RONΔ160, and RONΔ155, detected in two primary colon cancer samples,
were generated by deletions in different regions in extracellular domains of the RON beta chain.
RON 165 and RON 155 are intracellular isoforms lacking exon 11 and exons 5, 6 and 11,
respectively, are also constitutively phosphorylated. RONΔ160 is an isoform resulting from an
in-frame deletion of 109 amino acids in the RON β-chain extracellular domain (Wang, Kurtz et
18
al. 2000). This deletion results in protein conformational changes leading to autophosphorylation
and increased kinase activities. Overexpression of RON Δ160 isoform caused abnormal
accumulation of β-catenin, leading to tumorigenic phenotypes (Xu, Zhou et al. 2005).
Accelerated cellular proliferation and migration by constitutively active forms and suppression
of MSP dependent RON activation through dominant negative forms are only some of the
functions of aberrantly expressed RON.
RON expression analysis in tumors is widely used in target identification and validation
experiments. Currently used methods for quantification and functional analysis of RON don’t
distinguish between isoforms even though the functionality of many of the isoforms may be
different and even opposing in some cases. For instance, quantifying wild type RON by
immunohistochemical or RT-PCR methods would fail to account for the interference by the
isoform lacking exons 18 and 19 even though the two forms of RON have opposing functions.
Similarly, siRNA studies performed without giving consideration to lack of exons 18 or 19
would lead to erroneous functional correlations. Identification of this novel transcript together
with knowledge of previously identified isoforms will enable to us to design primers, siRNAs
and antibodies appropriately to quantify the wild type RON and other known isoforms.
One of the primary hallmarks of cancer is growth factor independent signaling. However, how
cancer cells achieve this is not understood yet. More research on these dominant negative
isoforms produced by cancer cells may shed light on this aspect. Ubiquitous presence of RON
isoforms with dominant negative functions in cancer raises important questions regarding the
appropriateness of targeting wild type RON, which in fact may end up aiding tumors. Besides,
targeting wild type RON in tumors would result in side effects since RON is also expressed in
macrophages.
Future work
PCR amplification and sequencing will be performed to identify alterations in additional exons of RON.
Also, more cDNA clones will be screened to identify and isolate colonies containing novel exon
deletions.
19
REFERENCES
Camp, E. R., W. Liu, et al. (2005). "RON, a tyrosine kinase receptor involved in tumor progression and
metastasis." Ann Surg Oncol 12(4): 273-281.
Camp, E. R., A. Yang, et al. (2007). "Tyrosine kinase receptor RON in human pancreatic cancer:
expression, function, and validation as a target." Cancer 109(6): 1030-1039.
Collesi, C., M. M. Santoro, et al. (1996). "A splicing variant of the RON transcript induces constitutive
tyrosine kinase activity and an invasive phenotype." Mol Cell Biol 16(10): 5518-5526.
Eckerich, C., A. Schulte, et al. (2009). "RON receptor tyrosine kinase in human gliomas: expression,
function, and identification of a novel soluble splice variant." J Neurochem 109(4): 969-980.
Gaudino, G., A. Follenzi, et al. (1994). "RON is a heterodimeric tyrosine kinase receptor activated by the
HGF homologue MSP." EMBO J 13(15): 3524-3532.
Gunes, Z., A. Zucconi, et al. (2011). "Isolation of Fully Human Antagonistic RON Antibodies Showing
Efficient Block of Downstream Signaling and Cell Migration." Transl Oncol 4(1): 38-46.
Logan-Collins, J., R. M. Thomas, et al. (2010). "Silencing of RON receptor signaling promotes apoptosis
and gemcitabine sensitivity in pancreatic cancers." Cancer Res 70(3): 1130-1140.
Lu, Y., H. P. Yao, et al. (2007). "Multiple variants of the RON receptor tyrosine kinase: biochemical
properties, tumorigenic activities, and potential drug targets." Cancer Lett 257(2): 157-164.
Maggiora, P., S. Marchio, et al. (1998). "Overexpression of the RON gene in human breast carcinoma."
Oncogene 16(22): 2927-2933.
O'Toole, J. M., K. E. Rabenau, et al. (2006). "Therapeutic implications of a human neutralizing antibody
to the macrophage-stimulating protein receptor tyrosine kinase (RON), a c-MET family
member." Cancer Res 66(18): 9162-9170.
Park, J. S., J. H. Park, et al. (2010). "Small interfering RNA targeting of Recepteur d'Origine Nantais
induces apoptosis via modulation of nuclear factor-kappaB and Bcl-2 family in gastric cancer
cells." Oncol Rep 24(3): 709-714.
Ronsin, C., F. Muscatelli, et al. (1993). "A novel putative receptor protein tyrosine kinase of the met
family." Oncogene 8(5): 1195-1202.
Wang, M. H., A. L. Kurtz, et al. (2000). "Identification of a novel splicing product of the RON receptor
tyrosine kinase in human colorectal carcinoma cells." Carcinogenesis 21(8): 1507-1512.
Wang, M. H., W. F. Lao, et al. (2007). "Blocking tumorigenic activities of colorectal cancer cells by a
splicing RON receptor variant defective in the tyrosine kinase domain." Cancer Biol Ther 6(7):
1121-1129.
Wang, M. H., D. Wang, et al. (2003). "Oncogenic and invasive potentials of human macrophagestimulating protein receptor, the RON receptor tyrosine kinase." Carcinogenesis 24(8): 12911300.
Xu, X. M., Y. Q. Zhou, et al. (2005). "Mechanisms of cytoplasmic {beta}-catenin accumulation and its
involvement in tumorigenic activities mediated by oncogenic splicing variant of the receptor
originated from Nantes tyrosine kinase." J Biol Chem 280(26): 25087-25094.
Zhou, Y. Q., C. He, et al. (2003). "Altered expression of the RON receptor tyrosine kinase in primary
human colorectal adenocarcinomas: generation of different splicing RON variants and their
oncogenic potential." Oncogene 22(2): 186-197.
20
PUBLICATIONS/PRESENTATIONS
An oral presentation entitled “RON (MST1R) Isoforms in Lung Cancer: Expression and Oncogenic
Function Prediction from Primary Transcript Sequences” was made at “Global Cancer Conference and
Medicare Summit 2014”, held at Hyderabad, India. An abstract of the presentation has been published in
the proceedings.