Download Infectious in vitro RNA transcripts derived from cloned cDNA of the

Journal o f General Virology (1991), 72, 2639-2643.
2639
Printed in Great Britain
Infectious in vitro RNA transcripts derived from cloned cDNA of the
cucurbit potyvirus, zucchini yellow mosaic virus
Amit Gal-On, Yeheskel Antignus, Arie Rosner and Benjamin Raccah*
Department of Virology, Agricultural Research Organization, The Volcani Center, P.O. Box 6, Bet Dagan 50-250, Israel
A full-length cDNA clone of the R N A genome of the
cucurbit potyvirus zucchini yellow mosaic virus
(ZYMV) was constructed downstream from a bacteriophage T7 R N A polymerase promoter. A single extra
guanosine residue not present in Z Y M V RNA was
added to the 5' and 3' ends. Capped (m7GpppG)
Z Y M V RNA transcripts were infectious in 10 of 91
Cucurbita pepo test plants; uncapped R N A transcripts
were not infectious. The appearance of symptoms in
plants inoculated with the infectious transcript was
delayed for more than a week compared to plants
inoculated with native viral RNA. The progeny virions
recovered from infected plants had the same biological
properties (aphid non-transmissibility and typical
symptoms) as the parental virus. The progeny virions
also reacted positively with Z Y M V antiserum and
ZYMV-specific probes by dot blot hybridization. The
authenticity of the progeny virus was verified by
identifying a specific molecular marker (C substituted
for T in the 3' non-coding region) using nucleotide
sequence analysis.
Introduction
study of plant virus gene functions, such as the promoter
involved in brome mosaic virus (BMV) coat protein (CP)
synthesis (French & Ahlquist, 1988) and a region in the
CP gene of TVMV that determines aphid transmissibility (Atreya et al., 1990). This study demonstrates the
construction of an infectious full-length eDNA clone of
ZYMV.
Zucchini yellow mosaic virus (ZYMV) is a member of
the potyvirus group which causes devastating epidemics
in commercial cucurbits world-wide (Lisa et al., 1981).
The virus particles are flexuous rods of 750 nm in length,
and have a genome consisting of a positive-sense ssRNA
of about 9.6 kb with a 5' end genome-linked protein
(VPg) and a poly(A) tail at the 3' end. Potyvirus genome
structure and expression have been studied extensively
during the last few years and are reviewed in detail by
Dougherty & Carrington (1988). According to the
general model, the viral RNA is expressed as a single
polyprotein, which is subsequently processed by at least
two virus-encoded proteases, producing seven or eight
individual proteins.
Infectious clones of plant and animal R N A viruses
have been reported (Ahlquist et al., 1984; Dawson et al.,
1986; van der Werf et al., 1986; Meshi et al., 1986; Vos et
al., 1988; Heaton et al., 1989). However, only two
infectious clones have been reported for members of the
potyvirus group, namely tobacco vein mottle virus
(TVMV; Domier et al., 1989) and plum pox virus (PPV;
Riechmann et al., 1990).
The production of infectious R N A transcripts from
full-length cDNA clones has proved to be of great
importance for studying the molecular biology of R N A
viruses. Site-directed mutagenesis as well as other
manipulations of the D N A template have facilitated the
0001-0335 © 1991 SGM
Methods
Virus strains and general procedures. The ZYMV isolates used, one
non-aphid-transmissible (NAT) and one aphid-transmissible (AT),
were those isolated by Antignus et al. (1989), and were propagated and
maintained in squash (Cucurbita pepo). Virus purification and RNA
extraction were as described (Antignus et al., 1989; Rosner et al., 1983).
The general recombinant DNA techniques were according to Maniatis
et al. (1982); DNA sequencing was according to Sanger et al. (1977) and
Korneluk et al. (1985). RNA was sequenced directly using the GemSeq
transcript sequencing system (Promega). Oligonucleotide-directed
mutagenesis was performed as described by Kunkel et al. (1987).
Construction o f a full-length cDNA o f Z Y M V RNA. The full-length
cDNA of ZYMV RNA was produced by combining three Pstl
fragments representing almost the entire ZYMV genome (Gal-On et
al., 1990a) (Fig. 1). These fragments were ligated either to PstI- or PstI
and E c o R V double-digested pBluescript plasmid (KS +) (Stratagene).
The clones obtained in this manner were ZYKS22, ZYKS3 and
ZYKS16 (Fig. lb). The integrity and proper alignment of the
fragments forming the full-length clone were confirmed by sequencing
the first 150 bases at their 5' and 3' ends. This allowed the preparation
of primers needed for sequencing the respective regions in the RNA.
Three oligonucleotides were synthesized, complementary to the 5' end
of clones, ZYKS220 ZYKS3 and ZYKS16 (5' GAACTCTCCCT-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 05 May 2017 07:32:25
A. Gal-On and others
2640
5'
(a)r_ q
,
?
HC
i
.
.
.
.
.
i
.
.
.
.
.
.
.
?
El
l
ZYKS3-NAT
?
,
NIo
NIb
,
i
............
CP
'
3'
'1
[
~.coRV
(b)
(c)
j(d)
Al;p718
T7 Promoter [ TranScripts
I
1A166 G
Fig. 1. A schematic representation of the construction of the fulllength cDNA clone of ZYMV RNA downstream from a T7 promoter.
(a) A general cistron map for potyviruses based on the model of
Dougherty & Carrington (1988). (b) Linking of the three ZYMV cDNA
clones. (I) Cloning of PstI, and PstI/EcoRV cDNA fragments; (II)
combining the viral 3' end (pKS22) and 5' end (pKS16) fragments; (III)
insertion of the middle PstI fragment. (c) Addition of 16 missing
nucleotides to the 5' end of the cDNA clone. (IV) Subcloning the 5' end
BamHI fragment; (V) replacement of the plasmid polylinker region
with the 16 missing nucleotides from the 5' end of the cDNA clone and
linking to the T7 promoter; (VI) reconstruction of the full-length clone
by insertion of a BamHI/KpnI fragment from pKS16322 into BamHIand KpnI-digested pKSM 16B. (d) Hybrid formation. (VII) Removal of
the KpnI/XbaI 3' end cDNA fragment of ZYMV-NAT and its
replacement with an Asp718/XbaI fragment from ZYMV-AT clone
pKSNTRM. (e) Transcription of the full-length cDNA clone.
CACTTG 3', 5" A G G A T C C T G G G T A A T T C 3' and 5' GCTTTGCTTGATCGTTG 3' respectively).
The full-length clone was constructed as follows (see Fig. 1). A new
BamHI site was introduced by insertion of a BamHI linker close to the
5' end of clone pKS16 (5' end fragment). The cDNA insert from clone
pKS 16 was removed by a BamHI and PstI double-digestion and ligated
into pKS22 digested similarly (3' end fragment) to form clone
pKS1622 (Fig. 1b). The middle viral cDNA fragment of clone pKS3
was removed by PstI digestion and ligated into pKS 1622 cleaved with
PstI (Fig. 1b). The BamHI site within the middle PstI fragment of the
resulting clone (pKS16322) served as a marker for determining its
proper orientation. Comparison of the sequence of the 5' end of the fulllength clone (pKS 16322) and that of the native viral RNA showed that
16 nucleotides were missing from the cloned cDNA molecule
(A. Gal-On et al., unpublished results). These nucleotides were added
by site-directed mutagenesis, pKS 16322 was digested with BamHI and
the resulting 5' end fragment was isolated and subcloned into
pBluescript KS +, forming pKS16B (Fig. 1 c). Oligonucleotide-directed
mutagenesis was performed for two reasons: first, to remove the 76
nucleotides from the polylinker region located between the transcription initiation site (position + 1) of the T7 promoter and the 5' end
of pKS16B and, second, to add the 16 missing nucleotides. The
oligonucleotide below was designed to contain the T7 promoter
(underlined), an extra guanosine residue (asterisk), the 16 missing
nucleotides and 17 nucleotides (italics) from the 5' end of clone
ZYKS16 (5' GTAATACGACTCACTATAG*AAATTAAAACAAATCACAAAGACTACAAGAATC 3'). A mutated clone (pKSM16B)
was identified by the loss of a BamHI site within the deleted portion of
the polylinker region (Fig. 1 c). The full-length clone was reconstructed
by removing the 3' end insert fragment of clone pKSB16322 by
digestion with BamHI and KpnI, and ligating it into pKSM16B
digested with the same enzymes.
We cloned the 3' end region of a ZYMV-AT isolate separately. This
clone contained a point mutation [C substituted for T at position 118
from the poly(A) tail]. An Asp718 site was introduced at the end of the
poly(A) tail of the ZYMV-AT 3" end region clone by oligonucleotidedirected mutagenesis using the oligonucleotide 5' AAAAAAAAAAAAAAAAAGGTACCATCAAGCTTATCGATAC 3'. An XbaI/
Asp718 fragment (160 nucleotides long) was removed from the resulting
clone, pKSNTRM, and used to replace the 3' end of the analogous
portion of a ZYMV-NAT clone. This complete full-length clone
(pKSM16322M) served as a template for in vitro synthesis of RNA
transcripts.
In vitro transcription. In vitro transcription of Asp718-1inearized
pKSM16322M was carried out using T7 RNA polymerase and an
mCAP mRNA capping kit (Stratagene), essentially as described by
Riechmann et al. (1989), but using 1 mM-mvGpppG (New England
Biolabs).
Plant inoculation. In vitro capped transcripts were diluted 1:1 with
double distilled H20 (final quantity of about 2 to 3 p.g RNA) and
applied to squash cotyledons (20 p.1/seedling) dusted with Carborundum grit. Control seedlings were inoculated with either transcription
buffer or with native ZYMV RNA (0-5 ~tg in 20 rtl/seedling).
lmmunoblotting. Samples (5 lal) of transcript-infected leaf extracts
were fractionated on a 12~ SDS-polyacrylamide gel (Laemmli, 1970)
and electroblotted onto nitrocellulose membranes (Schleicher &
Schuell). The viral CP band was visualized using an anti-ZYMV
antiserum and an anti-rabbit IgG alkaline phosphatase conjugate in a
picoBlue ImmunoDetection kit (Stratagene).
Dot blot hybridization. Samples (3 ~tl) of transcript-infected leaf
extracts were spotted onto a Hybond-N membrane (Amersham) and
fixed for 3 min under u.v. light. The blots were hybridized with a
radioactive, negative-sense ZYMV RNA probe prepared by transcription of a cDNA fragment derived from the virus CP gene, ZYKS22-CP
(Gal-On et al., 1990a), by T3 RNA polymerase. Hybridization
conditions were as described by Thomas (1980).
In vitro translation. About 1 ~tg of purified RNA transcript or native
RNA was used for in vitro translation in a rabbit reticulocyte cell-free
system as recommended by the manufacturer (Promega). 35S-Labelled
translation products were separated on a 7.5~ to 15~ gradient SDSpolyacrylamide gel. Translation products were identified by immunoprecipitation with the appropriate antisera (kindly provided by Drs D.
Purcifull and E. Hiebert, University of Florida, Gainesville, U.S.A.)
(data not shown).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 05 May 2017 07:32:25
2641
Infectious Z Y M V RNA transcripts
Sequence analysis of the recovered progeny virus RNA. Virus was
propagated from a single plant systematically infected with the RNA
transcripts. Progeny virus RNA was cloned, sequenced and analysed as
described by Gal-On et al. (1990a).
M
1
2
3
+P1
Results and Discussion
Construction of a full-length Z Y M V cDNA clone
A full-length cDNA clone was constructed by combining
three cDNA fragments constituting almost the entire
genome of ZYMV (Gal-On et al., 1990a). The integrity
and proper orientation of the fragments were confirmed
by comparing the nucleotide sequence at the 3' and 5'
ends of the fragments with the same regions of native
RNA. The comparison revealed that the fragments were
intact except that 16 nucleotides were missing from the 5'
end of clone ZYKS16 (Fig. lc).
The hybrid ZYMV NAT/AT clone was constructed
for the following reasons: (i) To introduce a longer
poly(A) tail (66 nucleotides in the AT cDNA clone
instead of 48 nucleotides in the original NAT clone), (ii)
to introduce a new Asp718 site at the end of the poly(A)
tail and (iii) to create a specific molecular marker using
the natural mutation found at position 118 of ZYMV-AT
(Gal-On et al., 1990b).
The R N A transcripts obtained by in vitro transcription
were found to be of the same size as the native ZYMV
RNA; the yield was about 20 ~tg/10 ~tg of linearized
D N A template (data not shown). Capped and uncapped
R N A transcripts yielded in vitro translation products
similar to those obtained from native ZYMV R N A (Fig.
2). This similarity of the translation products is an
additional indication of the integrity of the cloned
ZYMV genome. These results are in agreement with
those obtained by Carrington & Freed (1990).
Fig. 2. Autoradiogram of in vitro translation products of ZYMV-NAT
native RNA (lane 1), and those of in vitro capped and uncapped RNA
transcripts (lanes 3 and 2, respectively). The positions of the putative
ZYMV RNA-encoded proteins are indicated: NIa and NIb, nuclear
inclusion proteins; CI, cylindrical inclusion protein; HC + P 1, helper
component linked to the first protein (the individual proteins were
identified by immunoprecipitation with the respective antisera; data
not shown). The proteins were separated on a 7.5% to 15% gradient
SDS-polyacrylamide gel. The sizes of Mr markers (lane M) are given.
Table 1. Infectivity of in vitro RNA transcripts of cloned
Z Y M V cDNA in C. pepo plants
Mechanical
infection
Infectivity of the R N A transcripts
The capped in vitro transcripts were shown to be
infectious in each of five independent transcription
experiments. Typical mosaic symptoms appeared in 10
of 91 (11%) plants tested 2 to 3 weeks after inoculation
(Table 1). All 27 seedlings (100%) inoculated with native
R N A were infected after 8 days. This reveals that the
incubation time of in vitro transcript-infected plants is
delayed significantly compared to that of plants infected
with native RNA. The rate of infection is higher than
that obtained for TVMV (5 %), but lower than that for
PPV (49 %) (Domier et al., 1989; Riechmann et al., 1990).
Symptoms produced in squash plants after inoculation
with the R N A transcripts were identical to those
produced by native ZYMV RNA. Control inoculations
with linearized D N A (pKSM16322M), and uncapped
Inoculum*
Mock
ZYMV-AT RNA
ZYMV-NAT RNA
Capped transcripts:~
Uncapped transcripts
Linearized pKSM16322M
Aphid
transmissiont
Infected/tested (%) Infected/tested (%)
0/15
12/12
15/15
10/91
0/30
0/15
0
100
100
11
0
0
18/20
0/20
0/20
90
0
0
* C. pepo seedlings were inoculated with transcription buffer (mock),
native Z Y M V RNA (0-5 [.tg/plant) of either A T or NAT ZYMV
isolates, capped or uncapped in vitro RNA transcripts (about 2 to
3 ~tg/plant) or linearized pKSM16322M plasmid DNA (2 p.g/plant).
t Aphids were allowed a period of acquisition access feeding on
plants inoculated with native RNA (ZYMV-AT, ZYMV-NAT) or
with the infectious RNA transcripts (Antignus et al., 1989).
The results represent five separate transcription reactions. The
number of infected plants in the individual experiments was 2/20, 3/15,
2/15, 1/20 and 2/21.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 05 May 2017 07:32:25
2642
A. Gal-On and others
(a)
barley stripe mosaic virus (Petty et al., 1989), TVMV
(Domier et al., 1989) and PPV (Riechmann et al., 1990)].
Possible reasons for the low infectivity of in vitro
transcripts have been discussed (Riechmann et al., 1990).
These reasons include the presence of an extra guanosine
linked to the RNA (Dawson et al., 1986; Heaton et al.,
1989), the absence of VPg from RNA produced in vitro
(Riechmann et aL, 1989) or the possible introduction of
sequence errors (Ahlquist et al., 1984; Dawson et al.,
1986; Meshi et al., 1986; Vos et al., 1988; Eggen et al.,
1989), and may be applicable to the in vitro ZYMV RNA
transcripts.
Analysis o f progeny virus in transcript-infected plants
(b)
V
1
2
3
M
(c)
1
2
3
Fig. 3. Identification ofZYMV virions, RNA and CP in C. pepo plants
infected with native ZYMV or in vitro RNA transcripts. (a)
Immunosorbent electron microscopy using anti-ZYMV CP serum
based on the procedure described by Milne & Luisoni (1977). (b)
Immunoblots of total protein fractionated on a 12~ SDS-polyacrylamide gel, transferred to nitrocellulose and probed with anti-ZYMV
CP serum. Lane V, purified ZYMV virions; lanes 1 and 2, samples
from squash plants infected with native ZYMV RNA and with in vitro
capped RNA transcripts respectively; lane 3, mock-infected. The sizes
of Mr markers (lane M) are given. (c) Dot blot hybridization of crude
plant extracts (3 ~tl) spotted onto nitrocellulose and hybridized with a
32p-labelled negative-sense ZYMV RNA transcript probe. Samples 1,
2 and 3 are as in (b).
transcripts and transcription buffer (mock inoculations)
did not result in infection (Table 1). The delay in the
appearance of symptoms after inoculation with infectious transcripts was not observed with the progeny
virus, which was shown to have the same biological
characteristics as the original ZYMV-NAT isolate. Only
capped ZYMV transcripts were found to be infective, as
is the case with other infectious clones [BMV (Ahlquist et
al., 1984), tobacco mosaic virus (Dawson et al., 1986),
ZYMV CP was shown to accumulate in transcriptinoculated plants both by ELISA and immunoblotting
(Fig. 3b). ZYMV RNA was also shown to accumulate in
the same tissues by dot blot hybridization (Fig. 3 c). Virus
particles from transcript-infected plants were labelled
using anti-ZYMV serum (Fig. 3a). Finally, the progeny
virus present in transcript-infected plants was found to
be non-aphid-transmissible (Table 1), as was the parental
ZYMV-NAT isolate.
To rule out the possibility of casual contamination as a
cause of infection in test plants, we looked for the
specific C to T transition at position 118 in the hybrid
clone; this mutation was detected. This base transition
was not due to random variation of RNA molecules
because it was conserved in several independently
sequenced AT and NAT cDNA clones (data not shown).
This paper reports the isolation of the first infective
RNA transcript of a cucurbit potyvirus. Several natural
ZYMV isolates differing in aphid transmissibility,
multiplication rate and host range specificity have been
described recently (Antignus et al., 1989). The infectious
ZYMV clone described in the present report may serve
as a useful tool for elucidating the relationship between
gene function and the biological properties of the virus.
The authors are grateful to Mrs Merav Hecht for performing the in
vitro translations and to Mrs Sima Singer for excellent technical
assistance. We also thank Dr V. Gaba for critical reading of the
manuscript. This research was supported by grants from the Eshkol
foundation to the senior author, and by BARD no. US-1390-1987 and
CDR no. C8-077. Contribution no. 3330E series, from the Agricultural
Research Organization, The Volcani Center, Bet Dagan, Israel.
References
AHLQUIST,P., FRENCH, R., JANDA, M. & LOESCH-FRIES,L. S. (1984).
Multicomponent RNA plant virus infection derived from cloned
viral cDNA. Proceedings of the National Academy of Sciences, U.S.A.
81, 7066-7070.
ANTIGNUS,Y., RACCAH,B., GAL-ON, A. & COHEN,S. (1989). Biological
and serological characterization of zucchini yellow mosaic and
watermelon mosaic virus-2 isolates in Israel. Phytoparasitica 17,
289-297.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 05 May 2017 07:32:25
Infectious Z Y M V
ATREYA,C. D., RACCAH,B. & PIRONE, T. P. (1990). A point mutation
in the coat protein abolishes aphid transmissibility of a potyvirus.
Virology 178, 161-165.
CARRINGTON, J. C. & FREED, D. D. (1990). Cap-independent
enhancement of translation by a plant potyvirus 5' nontranslation
region. Journal of Virology 64, 1590-1597.
DAWSON, W. O., BECK, n. L., KNORR, D. A. & GRANTHAM,G. L.
(1986). cDNA cloning of the complete genome of tobacco mosaic
virus and production of infectious transcripts. Proceedings of the
National Academy of Sciences, U.S.A. 83, 1832-1836.
DOMIER, L. L., FRANKLIN, K. M., HUNT, A. G., RJ,IOADS,R. E. &
SHAW,J. G. (1989). Infectious in vitro transcripts from cloned cDNA
of a potyvirus, tobacco vein mottling virus. Proceedings of the
National Academy of Sciences, U.S.A. 86, 3509-3513.
DOUGHERTY, W. G. & CARRINOTON, J. C. (1988). Expression and
function of potyviral gene products. Annual Reviewof Phytopathology
26, 123-143.
EGGEN, R., VERVER, J., WELLINK, J., JONG, A. D., GOLDBACH,R. &
VAN KAMMEN,A. (1989)~ Improvements of the infectivity" of in vitro
transcripts from cloned cowpea mosaic virus cDNA: impact of
terminal nucleotide sequences. Virology 173, 447-455.
FRENCH, R. & AHLQUIST,P. (1988). Characterization and engineering
of sequences controlling in vivo synthesis of brome mosaic virus
subgenomic RNA. Journal of Virology 62, 2411 2420.
GAL-ON, A., ANTIGNUS, Y., ROSNER, A. & RACCAH, B. (1990a).
Nucleotide sequence of zucchini yellow mosaic virus capsidencoding gene and its expression in Escheriehia coll. Gene 87,
273-277.
GAL-ON, A., ANTIGNUS, Y., ROSNER, A. & RACCAH, B. (1990b).
Nucleotide sequence comparison between zucchini yellow mosaic
virus (ZYNV) strains differing in their multiplication rate and
transmissibility by aphids. In Abstracts of the 8th International
Congress of Virology, Berlin, Germany, p. 468.
HEATON, L. A., CARRINGTON,J. C. & MORRIS, T. J. (1989). Turnip
crinkle virus infection from RNA synthesized in vitro. Virology 170,
214-218.
KORNELUK, R. G., QUAN, F. & GRAVEL, R. A. (1985). Rapid and
reliable dideoxy sequencing of double-stranded DNA. Gene 40,
317-323,
KUNKEL, T. A., ROBERTS,J. D. & ZAKOUR,R. A. (1987). Rapid and
efficient site-specific mutagenesis without phenotypic selection.
Methods in Enzymology 154, 367-382.
LAEMMLI, U. K. (1970). Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature, London 227,
680-685.
R N A transcripts
2643
LISA, V., BOCCARDO, G., D'AGOSTINO, G., DELLAVALLE, G. &
D'AQUILLO, M. (1981). Characterization of a potyvirus that causes
zucchini yellow mosaic virus. Phytopatbology 571, 667 672.
MANIATIS, T., FRITSCH, E. F. & SAMBROOK, J. (1982). Molecular
Cloning: A Laboratory Manual. New York: Cold Spring Harbor
Laboratory.
MESHI, T., ISHIKAWA,M., MOTOYOSHI,F., SEMBA, K. & OKADA, V.
(1986). In vitro transcription of infectious RNAs from full-length
cDNAs of tobacco mosaic virus. Proceedingsof the NationalAcademy
of Sciences, U.S.A. 83, 5043-5047.
MILNE, R. G. & LUISONI, E. (1977). Rapid immuno-electron
microscopy of virus preparations. Methods' in Virology 6, 265
281.
PEATY, I. T. D., HUNTER, B. G., WEI, N. & JACKSON,A. O. (1989).
Infectious barley mosaic virus RNA transcribed in vitro from fulllength genomic cDNA clones. Virology 171, 342-349.
RIEeVlMANN,J. L., LAIN,S. & GARCiA,J. A. (1989). The genome-linked
protein and 5" end RNA sequence of plum pox potyvirus. Journalof
General Virology 70, 2785-2789.
RIECHMANN,J. L., LAIN, S. & GA•CiA, J. A. (1990). Infectious in vitro
transcripts from plum pox potyvirus cDNA clone. Virology 177,
710-716.
ROSNER, A., BAR-JoSEPH, M., MOSKOVITZ, M. & MEVARECH, M.
(1983). Diagnosis of specific viral RNA sequences in plant extracts
by hybridization with polynucleotide kinase-mediated, 32P-labeled,
double stranded RNA probe. Phytopathology 73, 609-702.
SANGER, F., NICKLEN,S. & COULSON,A. R. (1977). DNA sequencing
with chain-terminating inhibitors. Proceedings of the National
Academy of Sciences, U.S.A. 74, 5463-5467.
THOMAS, P. S. (1980). Hybridization of denatured RNA and small
DNA fragments transferred to nitrocellulose. Proceedings of the
National Academy of Sciences, U.S.A. 77, 5201-5205.
VANDER WERF, S., BRADLEY,J., WIMMER,E., STUDIER,F. W. & DUNN,
J. J. (1986). Synthesis of infectious poliovirus RNA by purified T7
RNA polymerase. Proceedings of the National Academy of Sciences,
U.S.A. 83, 2330-2334.
Vos, P., JAEGLE, M., WELLINK, J., VERVER, J., EGGEN, R., VAN
KAMMEN, A. & GOLDBACH,R. (1988). Infectious RNA transcripts
derived from full-length DNA copies of the genomic RNAs of
cowpea mosaic virus. Virology 165, 33-41.
(Received 19 April 1991; Accepted 25 July 1991)
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 05 May 2017 07:32:25