* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Infectious in vitro RNA transcripts derived from cloned cDNA of the
Elsayed Elsayed Wagih wikipedia , lookup
Hepatitis C wikipedia , lookup
Taura syndrome wikipedia , lookup
Canine parvovirus wikipedia , lookup
Canine distemper wikipedia , lookup
Hepatitis B wikipedia , lookup
Orthohantavirus wikipedia , lookup
Marburg virus disease wikipedia , lookup
Influenza A virus wikipedia , lookup
Journal o f General Virology (1991), 72, 2639-2643. 2639 Printed in Great Britain Infectious in vitro RNA transcripts derived from cloned cDNA of the cucurbit potyvirus, zucchini yellow mosaic virus Amit Gal-On, Yeheskel Antignus, Arie Rosner and Benjamin Raccah* Department of Virology, Agricultural Research Organization, The Volcani Center, P.O. Box 6, Bet Dagan 50-250, Israel A full-length cDNA clone of the R N A genome of the cucurbit potyvirus zucchini yellow mosaic virus (ZYMV) was constructed downstream from a bacteriophage T7 R N A polymerase promoter. A single extra guanosine residue not present in Z Y M V RNA was added to the 5' and 3' ends. Capped (m7GpppG) Z Y M V RNA transcripts were infectious in 10 of 91 Cucurbita pepo test plants; uncapped R N A transcripts were not infectious. The appearance of symptoms in plants inoculated with the infectious transcript was delayed for more than a week compared to plants inoculated with native viral RNA. The progeny virions recovered from infected plants had the same biological properties (aphid non-transmissibility and typical symptoms) as the parental virus. The progeny virions also reacted positively with Z Y M V antiserum and ZYMV-specific probes by dot blot hybridization. The authenticity of the progeny virus was verified by identifying a specific molecular marker (C substituted for T in the 3' non-coding region) using nucleotide sequence analysis. Introduction study of plant virus gene functions, such as the promoter involved in brome mosaic virus (BMV) coat protein (CP) synthesis (French & Ahlquist, 1988) and a region in the CP gene of TVMV that determines aphid transmissibility (Atreya et al., 1990). This study demonstrates the construction of an infectious full-length eDNA clone of ZYMV. Zucchini yellow mosaic virus (ZYMV) is a member of the potyvirus group which causes devastating epidemics in commercial cucurbits world-wide (Lisa et al., 1981). The virus particles are flexuous rods of 750 nm in length, and have a genome consisting of a positive-sense ssRNA of about 9.6 kb with a 5' end genome-linked protein (VPg) and a poly(A) tail at the 3' end. Potyvirus genome structure and expression have been studied extensively during the last few years and are reviewed in detail by Dougherty & Carrington (1988). According to the general model, the viral RNA is expressed as a single polyprotein, which is subsequently processed by at least two virus-encoded proteases, producing seven or eight individual proteins. Infectious clones of plant and animal R N A viruses have been reported (Ahlquist et al., 1984; Dawson et al., 1986; van der Werf et al., 1986; Meshi et al., 1986; Vos et al., 1988; Heaton et al., 1989). However, only two infectious clones have been reported for members of the potyvirus group, namely tobacco vein mottle virus (TVMV; Domier et al., 1989) and plum pox virus (PPV; Riechmann et al., 1990). The production of infectious R N A transcripts from full-length cDNA clones has proved to be of great importance for studying the molecular biology of R N A viruses. Site-directed mutagenesis as well as other manipulations of the D N A template have facilitated the 0001-0335 © 1991 SGM Methods Virus strains and general procedures. The ZYMV isolates used, one non-aphid-transmissible (NAT) and one aphid-transmissible (AT), were those isolated by Antignus et al. (1989), and were propagated and maintained in squash (Cucurbita pepo). Virus purification and RNA extraction were as described (Antignus et al., 1989; Rosner et al., 1983). The general recombinant DNA techniques were according to Maniatis et al. (1982); DNA sequencing was according to Sanger et al. (1977) and Korneluk et al. (1985). RNA was sequenced directly using the GemSeq transcript sequencing system (Promega). Oligonucleotide-directed mutagenesis was performed as described by Kunkel et al. (1987). Construction o f a full-length cDNA o f Z Y M V RNA. The full-length cDNA of ZYMV RNA was produced by combining three Pstl fragments representing almost the entire ZYMV genome (Gal-On et al., 1990a) (Fig. 1). These fragments were ligated either to PstI- or PstI and E c o R V double-digested pBluescript plasmid (KS +) (Stratagene). The clones obtained in this manner were ZYKS22, ZYKS3 and ZYKS16 (Fig. lb). The integrity and proper alignment of the fragments forming the full-length clone were confirmed by sequencing the first 150 bases at their 5' and 3' ends. This allowed the preparation of primers needed for sequencing the respective regions in the RNA. Three oligonucleotides were synthesized, complementary to the 5' end of clones, ZYKS220 ZYKS3 and ZYKS16 (5' GAACTCTCCCT- Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 05 May 2017 07:32:25 A. Gal-On and others 2640 5' (a)r_ q , ? HC i . . . . . i . . . . . . . ? El l ZYKS3-NAT ? , NIo NIb , i ............ CP ' 3' '1 [ ~.coRV (b) (c) j(d) Al;p718 T7 Promoter [ TranScripts I 1A166 G Fig. 1. A schematic representation of the construction of the fulllength cDNA clone of ZYMV RNA downstream from a T7 promoter. (a) A general cistron map for potyviruses based on the model of Dougherty & Carrington (1988). (b) Linking of the three ZYMV cDNA clones. (I) Cloning of PstI, and PstI/EcoRV cDNA fragments; (II) combining the viral 3' end (pKS22) and 5' end (pKS16) fragments; (III) insertion of the middle PstI fragment. (c) Addition of 16 missing nucleotides to the 5' end of the cDNA clone. (IV) Subcloning the 5' end BamHI fragment; (V) replacement of the plasmid polylinker region with the 16 missing nucleotides from the 5' end of the cDNA clone and linking to the T7 promoter; (VI) reconstruction of the full-length clone by insertion of a BamHI/KpnI fragment from pKS16322 into BamHIand KpnI-digested pKSM 16B. (d) Hybrid formation. (VII) Removal of the KpnI/XbaI 3' end cDNA fragment of ZYMV-NAT and its replacement with an Asp718/XbaI fragment from ZYMV-AT clone pKSNTRM. (e) Transcription of the full-length cDNA clone. CACTTG 3', 5" A G G A T C C T G G G T A A T T C 3' and 5' GCTTTGCTTGATCGTTG 3' respectively). The full-length clone was constructed as follows (see Fig. 1). A new BamHI site was introduced by insertion of a BamHI linker close to the 5' end of clone pKS16 (5' end fragment). The cDNA insert from clone pKS 16 was removed by a BamHI and PstI double-digestion and ligated into pKS22 digested similarly (3' end fragment) to form clone pKS1622 (Fig. 1b). The middle viral cDNA fragment of clone pKS3 was removed by PstI digestion and ligated into pKS 1622 cleaved with PstI (Fig. 1b). The BamHI site within the middle PstI fragment of the resulting clone (pKS16322) served as a marker for determining its proper orientation. Comparison of the sequence of the 5' end of the fulllength clone (pKS 16322) and that of the native viral RNA showed that 16 nucleotides were missing from the cloned cDNA molecule (A. Gal-On et al., unpublished results). These nucleotides were added by site-directed mutagenesis, pKS 16322 was digested with BamHI and the resulting 5' end fragment was isolated and subcloned into pBluescript KS +, forming pKS16B (Fig. 1 c). Oligonucleotide-directed mutagenesis was performed for two reasons: first, to remove the 76 nucleotides from the polylinker region located between the transcription initiation site (position + 1) of the T7 promoter and the 5' end of pKS16B and, second, to add the 16 missing nucleotides. The oligonucleotide below was designed to contain the T7 promoter (underlined), an extra guanosine residue (asterisk), the 16 missing nucleotides and 17 nucleotides (italics) from the 5' end of clone ZYKS16 (5' GTAATACGACTCACTATAG*AAATTAAAACAAATCACAAAGACTACAAGAATC 3'). A mutated clone (pKSM16B) was identified by the loss of a BamHI site within the deleted portion of the polylinker region (Fig. 1 c). The full-length clone was reconstructed by removing the 3' end insert fragment of clone pKSB16322 by digestion with BamHI and KpnI, and ligating it into pKSM16B digested with the same enzymes. We cloned the 3' end region of a ZYMV-AT isolate separately. This clone contained a point mutation [C substituted for T at position 118 from the poly(A) tail]. An Asp718 site was introduced at the end of the poly(A) tail of the ZYMV-AT 3" end region clone by oligonucleotidedirected mutagenesis using the oligonucleotide 5' AAAAAAAAAAAAAAAAAGGTACCATCAAGCTTATCGATAC 3'. An XbaI/ Asp718 fragment (160 nucleotides long) was removed from the resulting clone, pKSNTRM, and used to replace the 3' end of the analogous portion of a ZYMV-NAT clone. This complete full-length clone (pKSM16322M) served as a template for in vitro synthesis of RNA transcripts. In vitro transcription. In vitro transcription of Asp718-1inearized pKSM16322M was carried out using T7 RNA polymerase and an mCAP mRNA capping kit (Stratagene), essentially as described by Riechmann et al. (1989), but using 1 mM-mvGpppG (New England Biolabs). Plant inoculation. In vitro capped transcripts were diluted 1:1 with double distilled H20 (final quantity of about 2 to 3 p.g RNA) and applied to squash cotyledons (20 p.1/seedling) dusted with Carborundum grit. Control seedlings were inoculated with either transcription buffer or with native ZYMV RNA (0-5 ~tg in 20 rtl/seedling). lmmunoblotting. Samples (5 lal) of transcript-infected leaf extracts were fractionated on a 12~ SDS-polyacrylamide gel (Laemmli, 1970) and electroblotted onto nitrocellulose membranes (Schleicher & Schuell). The viral CP band was visualized using an anti-ZYMV antiserum and an anti-rabbit IgG alkaline phosphatase conjugate in a picoBlue ImmunoDetection kit (Stratagene). Dot blot hybridization. Samples (3 ~tl) of transcript-infected leaf extracts were spotted onto a Hybond-N membrane (Amersham) and fixed for 3 min under u.v. light. The blots were hybridized with a radioactive, negative-sense ZYMV RNA probe prepared by transcription of a cDNA fragment derived from the virus CP gene, ZYKS22-CP (Gal-On et al., 1990a), by T3 RNA polymerase. Hybridization conditions were as described by Thomas (1980). In vitro translation. About 1 ~tg of purified RNA transcript or native RNA was used for in vitro translation in a rabbit reticulocyte cell-free system as recommended by the manufacturer (Promega). 35S-Labelled translation products were separated on a 7.5~ to 15~ gradient SDSpolyacrylamide gel. Translation products were identified by immunoprecipitation with the appropriate antisera (kindly provided by Drs D. Purcifull and E. Hiebert, University of Florida, Gainesville, U.S.A.) (data not shown). Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 05 May 2017 07:32:25 2641 Infectious Z Y M V RNA transcripts Sequence analysis of the recovered progeny virus RNA. Virus was propagated from a single plant systematically infected with the RNA transcripts. Progeny virus RNA was cloned, sequenced and analysed as described by Gal-On et al. (1990a). M 1 2 3 +P1 Results and Discussion Construction of a full-length Z Y M V cDNA clone A full-length cDNA clone was constructed by combining three cDNA fragments constituting almost the entire genome of ZYMV (Gal-On et al., 1990a). The integrity and proper orientation of the fragments were confirmed by comparing the nucleotide sequence at the 3' and 5' ends of the fragments with the same regions of native RNA. The comparison revealed that the fragments were intact except that 16 nucleotides were missing from the 5' end of clone ZYKS16 (Fig. lc). The hybrid ZYMV NAT/AT clone was constructed for the following reasons: (i) To introduce a longer poly(A) tail (66 nucleotides in the AT cDNA clone instead of 48 nucleotides in the original NAT clone), (ii) to introduce a new Asp718 site at the end of the poly(A) tail and (iii) to create a specific molecular marker using the natural mutation found at position 118 of ZYMV-AT (Gal-On et al., 1990b). The R N A transcripts obtained by in vitro transcription were found to be of the same size as the native ZYMV RNA; the yield was about 20 ~tg/10 ~tg of linearized D N A template (data not shown). Capped and uncapped R N A transcripts yielded in vitro translation products similar to those obtained from native ZYMV R N A (Fig. 2). This similarity of the translation products is an additional indication of the integrity of the cloned ZYMV genome. These results are in agreement with those obtained by Carrington & Freed (1990). Fig. 2. Autoradiogram of in vitro translation products of ZYMV-NAT native RNA (lane 1), and those of in vitro capped and uncapped RNA transcripts (lanes 3 and 2, respectively). The positions of the putative ZYMV RNA-encoded proteins are indicated: NIa and NIb, nuclear inclusion proteins; CI, cylindrical inclusion protein; HC + P 1, helper component linked to the first protein (the individual proteins were identified by immunoprecipitation with the respective antisera; data not shown). The proteins were separated on a 7.5% to 15% gradient SDS-polyacrylamide gel. The sizes of Mr markers (lane M) are given. Table 1. Infectivity of in vitro RNA transcripts of cloned Z Y M V cDNA in C. pepo plants Mechanical infection Infectivity of the R N A transcripts The capped in vitro transcripts were shown to be infectious in each of five independent transcription experiments. Typical mosaic symptoms appeared in 10 of 91 (11%) plants tested 2 to 3 weeks after inoculation (Table 1). All 27 seedlings (100%) inoculated with native R N A were infected after 8 days. This reveals that the incubation time of in vitro transcript-infected plants is delayed significantly compared to that of plants infected with native RNA. The rate of infection is higher than that obtained for TVMV (5 %), but lower than that for PPV (49 %) (Domier et al., 1989; Riechmann et al., 1990). Symptoms produced in squash plants after inoculation with the R N A transcripts were identical to those produced by native ZYMV RNA. Control inoculations with linearized D N A (pKSM16322M), and uncapped Inoculum* Mock ZYMV-AT RNA ZYMV-NAT RNA Capped transcripts:~ Uncapped transcripts Linearized pKSM16322M Aphid transmissiont Infected/tested (%) Infected/tested (%) 0/15 12/12 15/15 10/91 0/30 0/15 0 100 100 11 0 0 18/20 0/20 0/20 90 0 0 * C. pepo seedlings were inoculated with transcription buffer (mock), native Z Y M V RNA (0-5 [.tg/plant) of either A T or NAT ZYMV isolates, capped or uncapped in vitro RNA transcripts (about 2 to 3 ~tg/plant) or linearized pKSM16322M plasmid DNA (2 p.g/plant). t Aphids were allowed a period of acquisition access feeding on plants inoculated with native RNA (ZYMV-AT, ZYMV-NAT) or with the infectious RNA transcripts (Antignus et al., 1989). The results represent five separate transcription reactions. The number of infected plants in the individual experiments was 2/20, 3/15, 2/15, 1/20 and 2/21. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 05 May 2017 07:32:25 2642 A. Gal-On and others (a) barley stripe mosaic virus (Petty et al., 1989), TVMV (Domier et al., 1989) and PPV (Riechmann et al., 1990)]. Possible reasons for the low infectivity of in vitro transcripts have been discussed (Riechmann et al., 1990). These reasons include the presence of an extra guanosine linked to the RNA (Dawson et al., 1986; Heaton et al., 1989), the absence of VPg from RNA produced in vitro (Riechmann et aL, 1989) or the possible introduction of sequence errors (Ahlquist et al., 1984; Dawson et al., 1986; Meshi et al., 1986; Vos et al., 1988; Eggen et al., 1989), and may be applicable to the in vitro ZYMV RNA transcripts. Analysis o f progeny virus in transcript-infected plants (b) V 1 2 3 M (c) 1 2 3 Fig. 3. Identification ofZYMV virions, RNA and CP in C. pepo plants infected with native ZYMV or in vitro RNA transcripts. (a) Immunosorbent electron microscopy using anti-ZYMV CP serum based on the procedure described by Milne & Luisoni (1977). (b) Immunoblots of total protein fractionated on a 12~ SDS-polyacrylamide gel, transferred to nitrocellulose and probed with anti-ZYMV CP serum. Lane V, purified ZYMV virions; lanes 1 and 2, samples from squash plants infected with native ZYMV RNA and with in vitro capped RNA transcripts respectively; lane 3, mock-infected. The sizes of Mr markers (lane M) are given. (c) Dot blot hybridization of crude plant extracts (3 ~tl) spotted onto nitrocellulose and hybridized with a 32p-labelled negative-sense ZYMV RNA transcript probe. Samples 1, 2 and 3 are as in (b). transcripts and transcription buffer (mock inoculations) did not result in infection (Table 1). The delay in the appearance of symptoms after inoculation with infectious transcripts was not observed with the progeny virus, which was shown to have the same biological characteristics as the original ZYMV-NAT isolate. Only capped ZYMV transcripts were found to be infective, as is the case with other infectious clones [BMV (Ahlquist et al., 1984), tobacco mosaic virus (Dawson et al., 1986), ZYMV CP was shown to accumulate in transcriptinoculated plants both by ELISA and immunoblotting (Fig. 3b). ZYMV RNA was also shown to accumulate in the same tissues by dot blot hybridization (Fig. 3 c). Virus particles from transcript-infected plants were labelled using anti-ZYMV serum (Fig. 3a). Finally, the progeny virus present in transcript-infected plants was found to be non-aphid-transmissible (Table 1), as was the parental ZYMV-NAT isolate. To rule out the possibility of casual contamination as a cause of infection in test plants, we looked for the specific C to T transition at position 118 in the hybrid clone; this mutation was detected. This base transition was not due to random variation of RNA molecules because it was conserved in several independently sequenced AT and NAT cDNA clones (data not shown). This paper reports the isolation of the first infective RNA transcript of a cucurbit potyvirus. Several natural ZYMV isolates differing in aphid transmissibility, multiplication rate and host range specificity have been described recently (Antignus et al., 1989). The infectious ZYMV clone described in the present report may serve as a useful tool for elucidating the relationship between gene function and the biological properties of the virus. The authors are grateful to Mrs Merav Hecht for performing the in vitro translations and to Mrs Sima Singer for excellent technical assistance. We also thank Dr V. Gaba for critical reading of the manuscript. This research was supported by grants from the Eshkol foundation to the senior author, and by BARD no. US-1390-1987 and CDR no. C8-077. Contribution no. 3330E series, from the Agricultural Research Organization, The Volcani Center, Bet Dagan, Israel. References AHLQUIST,P., FRENCH, R., JANDA, M. & LOESCH-FRIES,L. S. (1984). Multicomponent RNA plant virus infection derived from cloned viral cDNA. Proceedings of the National Academy of Sciences, U.S.A. 81, 7066-7070. ANTIGNUS,Y., RACCAH,B., GAL-ON, A. & COHEN,S. (1989). Biological and serological characterization of zucchini yellow mosaic and watermelon mosaic virus-2 isolates in Israel. Phytoparasitica 17, 289-297. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 05 May 2017 07:32:25 Infectious Z Y M V ATREYA,C. D., RACCAH,B. & PIRONE, T. P. (1990). A point mutation in the coat protein abolishes aphid transmissibility of a potyvirus. Virology 178, 161-165. CARRINGTON, J. C. & FREED, D. D. (1990). Cap-independent enhancement of translation by a plant potyvirus 5' nontranslation region. Journal of Virology 64, 1590-1597. DAWSON, W. O., BECK, n. L., KNORR, D. A. & GRANTHAM,G. L. (1986). cDNA cloning of the complete genome of tobacco mosaic virus and production of infectious transcripts. Proceedings of the National Academy of Sciences, U.S.A. 83, 1832-1836. DOMIER, L. L., FRANKLIN, K. M., HUNT, A. G., RJ,IOADS,R. E. & SHAW,J. G. (1989). Infectious in vitro transcripts from cloned cDNA of a potyvirus, tobacco vein mottling virus. Proceedings of the National Academy of Sciences, U.S.A. 86, 3509-3513. DOUGHERTY, W. G. & CARRINOTON, J. C. (1988). Expression and function of potyviral gene products. Annual Reviewof Phytopathology 26, 123-143. EGGEN, R., VERVER, J., WELLINK, J., JONG, A. D., GOLDBACH,R. & VAN KAMMEN,A. (1989)~ Improvements of the infectivity" of in vitro transcripts from cloned cowpea mosaic virus cDNA: impact of terminal nucleotide sequences. Virology 173, 447-455. FRENCH, R. & AHLQUIST,P. (1988). Characterization and engineering of sequences controlling in vivo synthesis of brome mosaic virus subgenomic RNA. Journal of Virology 62, 2411 2420. GAL-ON, A., ANTIGNUS, Y., ROSNER, A. & RACCAH, B. (1990a). Nucleotide sequence of zucchini yellow mosaic virus capsidencoding gene and its expression in Escheriehia coll. Gene 87, 273-277. GAL-ON, A., ANTIGNUS, Y., ROSNER, A. & RACCAH, B. (1990b). Nucleotide sequence comparison between zucchini yellow mosaic virus (ZYNV) strains differing in their multiplication rate and transmissibility by aphids. In Abstracts of the 8th International Congress of Virology, Berlin, Germany, p. 468. HEATON, L. A., CARRINGTON,J. C. & MORRIS, T. J. (1989). Turnip crinkle virus infection from RNA synthesized in vitro. Virology 170, 214-218. KORNELUK, R. G., QUAN, F. & GRAVEL, R. A. (1985). Rapid and reliable dideoxy sequencing of double-stranded DNA. Gene 40, 317-323, KUNKEL, T. A., ROBERTS,J. D. & ZAKOUR,R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods in Enzymology 154, 367-382. LAEMMLI, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, London 227, 680-685. R N A transcripts 2643 LISA, V., BOCCARDO, G., D'AGOSTINO, G., DELLAVALLE, G. & D'AQUILLO, M. (1981). Characterization of a potyvirus that causes zucchini yellow mosaic virus. Phytopatbology 571, 667 672. MANIATIS, T., FRITSCH, E. F. & SAMBROOK, J. (1982). Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory. MESHI, T., ISHIKAWA,M., MOTOYOSHI,F., SEMBA, K. & OKADA, V. (1986). In vitro transcription of infectious RNAs from full-length cDNAs of tobacco mosaic virus. Proceedingsof the NationalAcademy of Sciences, U.S.A. 83, 5043-5047. MILNE, R. G. & LUISONI, E. (1977). Rapid immuno-electron microscopy of virus preparations. Methods' in Virology 6, 265 281. PEATY, I. T. D., HUNTER, B. G., WEI, N. & JACKSON,A. O. (1989). Infectious barley mosaic virus RNA transcribed in vitro from fulllength genomic cDNA clones. Virology 171, 342-349. RIEeVlMANN,J. L., LAIN,S. & GARCiA,J. A. (1989). The genome-linked protein and 5" end RNA sequence of plum pox potyvirus. Journalof General Virology 70, 2785-2789. RIECHMANN,J. L., LAIN, S. & GA•CiA, J. A. (1990). Infectious in vitro transcripts from plum pox potyvirus cDNA clone. Virology 177, 710-716. ROSNER, A., BAR-JoSEPH, M., MOSKOVITZ, M. & MEVARECH, M. (1983). Diagnosis of specific viral RNA sequences in plant extracts by hybridization with polynucleotide kinase-mediated, 32P-labeled, double stranded RNA probe. Phytopathology 73, 609-702. SANGER, F., NICKLEN,S. & COULSON,A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, U.S.A. 74, 5463-5467. THOMAS, P. S. (1980). Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proceedings of the National Academy of Sciences, U.S.A. 77, 5201-5205. VANDER WERF, S., BRADLEY,J., WIMMER,E., STUDIER,F. W. & DUNN, J. J. (1986). Synthesis of infectious poliovirus RNA by purified T7 RNA polymerase. Proceedings of the National Academy of Sciences, U.S.A. 83, 2330-2334. Vos, P., JAEGLE, M., WELLINK, J., VERVER, J., EGGEN, R., VAN KAMMEN, A. & GOLDBACH,R. (1988). Infectious RNA transcripts derived from full-length DNA copies of the genomic RNAs of cowpea mosaic virus. Virology 165, 33-41. (Received 19 April 1991; Accepted 25 July 1991) Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 05 May 2017 07:32:25