Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Transcriptional response to muscle ischemia in rats with CKD SUPPLEMENT Genes Primer-sequence 5'-3' 18S fw: TTGATTAAGTCCCTGCCCTTTGT rv: CGATCCGAGGGCCTCACTA fw: AACGAAAGCGCAAGAAATCC rv: GCTCACAGTGAACGCTCCAG fw: CGACACTCTTTTGGCTCCTTCTAAC rv: TGACAGGTAGTCCGTCTTTACTTCG fw: CCACCCCAGAAATGTACCAAAC rv: AAAACGCGGGTCTCTGGTT fw: TGGAAGTGGATCCACGCGCCCAAGG rv: GCAGGAGCGCACGATCATGTTGGAC fw: CTCGTCCATGGTGCTGACCAAG rv: CCGCTGCGAGTCGTTGAAGTAG fe: TATGGAGCACCACTGATGGA rv: TCAGCCAGGCTTTGAGATTT fw: CCTCCACCACTATGCAGGTCTC rv: GCACGTGGATGCTACAGGC fw: AAACCACACGGCCACCAT rv: TGGATTTCAAGACGGGATGT fw: GACCAGTGGGCATCGCTACG rv: CATTGTCCGAATCCTTGTGCT fw: CAAGCCATCTGCGGCATCTC rv: CAGGACACCTTTTTGCAGA fw: CAGACCTCAAGTATGAGTGCAGAG rv: GGTGTTGGCAGCACACTG fw: AAAGTGGCTGAGTTTGGCAG rv: AAGTGGCTACAGCATCTGAGTGT Probe (5' FAM, 3' TAMRA): TCAGAGGAGAAGGCGCATTACAGCA fw: GCCACGGAATCCAGATTTGT rv: GGGAAGGCTTCGGGTCAT fw: CTGGCTCACGCCATTCG rv: CTGTACTTCTTGTCCTCATAGCTTGTG fw: GCCCATGCATTTAATTTGATCA rv: TGAGGATCACAAGCCATGACA fw: AGGGCTGTGTCTGCAAAGGT rv: GCAGCACTGTTCGTCACTTCAG fw: CTCCCGCTTTGATGTCATTCA rv: CCCACACTCATGTCTAGGTGGTT fw: TGTGGGCCCAACCAGATG rv: CTTGGGAATCTTTTGTTTCTTGACA fw: TGCCAGGGATTCACCAGTGT rv: GGCAGGTGCTATGACGAGAAG fw: TCCCCCATTCCATGTGACA rv: CAACAGGTACGGCTGCCATA fw: TCAGCCTACAAAGGACACAATCTC rv: GAGCTGTTGGGAAAGGACATTTT Vegfa Flt1 Kdr Tgfb1 Hsp70 Pgf Ccl2 Angpt1 Angpt2 Thbs1 Thbs2 Spp1 Timp1 Gstm2 Gprc51 Mt1a Prkag3 Ccl7 Csrnp1 E2f8 Hoxd10 Supplement 1 Primer for real-time RT-PCR Transcriptional response to muscle ischemia in rats with CKD Symbol Gene title Probeset ID p-value FC Prkab2 protein kinase. AMP-activated. beta 2 non-catalytic subunit 1369271_at 0.020 2.02 Klhdc3 kelch domain containing 3 1392378_at 0.014 2.02 Rbfox1 RNA binding protein. fox-1 homolog (C. elegans) 1 1378371_at 0.016 2.14 Tpm1 tropomyosin 1. alpha 1395794_at 0.031 2.17 Myod1 myogenic differentiation 1 1398655_at 0.010 2.19 Col7a1 procollagen. type VII. alpha 1 1374226_at 0.047 2.35 Eml1 Echinoderm microtubule associated protein like 1 1390174_at 0.031 2.36 Gstm2 glutathione S-transferase mu 2 1370952_at 0.038 2.42 similar to germinal histone H4 gene 1369728_at 0.001 2.48 Camk2a Calcium/calmodulin-dependent protein kinase II alpha 1381637_at 0.013 2.68 Neu2 sialidase 2 (cytosolic sialidase) 1368127_at 0.026 2.79 Hist4h4 Supplement 2 All upregulated genes of SNX I vs. Sham I (FC > 2, p < 0.05), I = ischemic, NI = nonischemic, FC = Fold Change Ratio Gene Symbol Title PCR Microarray PCR Microarray PCR Microarray Sham I/NI Sham I/NI SNX I/NI SNX I/NI SNX I/Sham I SNX I/ Sham I Vegfa vascular endothelial growth factor A 2.05 1.75 1.67 1.38 0.46 0.54 Flt1 vascular endothelial growth factor receptor 1 1.50 1.24 1.31 1.10 0.68 0.85 Kdr vascular endothelial growth factor receptor 2 2.04 1.72 1.96 1.89 0.64 0.88 Angpt1 angiopoietin 1 1.04 0.84 1.00 0.89 1.01 1.17 Angpt2 angiopoietin 2 2.81 2.53 2.90 2.29 0.75 0.69 Ccl2 chemokine (C-C motif) ligand 2 68.80 53.13 30.57 29.14 0.16 0.31 Ccl7 chemokine (C-C motif) ligand 7 28.36 43.09 18.80 11.50 0.33 0.22 Hsp70 heat shock 70kD protein 1A 3.93 2.55 4.23 3.50 0.42 0.63 Il6 interleukin 6 40.25 2.88 11.10 1.02 0.37 0.36 Mt1a \\\ Ttr metallothionein 1a /// transthyretin 15.39 40.58 7.43 11.68 0.26 0.22 Timp1 TIMP metallopeptidase inhibitor 1 12.59 12.81 10.04 10.60 0.44 0.40 E2f8 E2F transcription factor 8 10.24 5.59 9.20 3.29 0.18 0.25 Pgf placental growth factor 1.67 2.76 1.09 1.21 0.59 0.33 Tgfb1 transforming growth factor. beta 1 3.56 1.39 3.04 1.04 0.79 0.73 Thbs2 thrombospondin 2 1.67 1.54 2.12 1.05 0.66 0.65 Spp1 osteopontin 2.46 13.13 8.67 35.02 0.85 0.45 Gstm2 glutathione S-transferase mu 2 1.51 0.58 0.82 0.81 1.25 2.42 1.11 0.49 0.88 0.60 1.14 1.79 Prkag3 Csrnp1 protein kinase. AMP-activated. gamma 3 noncatalytic subunit cysteine-serine-rich nuclear protein 1 8.54 8.57 3.18 3.63 0.17 0.14 Gprc5a G protein-coupled receptor. family C. group 5. member A 10.13 6.19 13.20 2.39 0.60 0.38 Hoxd10 homeo box D10 1.03 0.49 1.50 1.10 1.85 2.55 Supplement 3 Overview of all ratios for the relative expression changes in both analytic procedures (PCR and Microarray), I = ischemic, NI = non-ischemic. Transcriptional response to muscle ischemia in rats with CKD Symbol Gene title Probeset ID p-value FC Spp1 secreted phosphoprotein 1 1367581_a_at 0.003 35.02 Ccl2 chemokine (C-C motif) ligand 2 1367973_at 0.000 29.14 Ccl7 chemokine (C-C motif) ligand 7 1379935_at 0.000 11.5 Timp1 TIMP metallopeptidase inhibitor 1 1367712_at 0.002 10.6 Tnfrsf12 tumor necrosis factor receptor superfamily. member 12A 1371785_at 0.001 7.08 Cd44 CD44 molecule (Indian blood group) 1387952_a_at 0.003 5.8 Apln apelin 1389651_at 0.000 5.79 Hmox1 heme oxygenase (decycling) 1 1370080_at 0.004 5.57 Junb jun B proto-oncogene 1387788_at 0.000 5.41 Runx1 runt-related transcription factor 1 1368914_at 0.003 5.02 Serpine1 serpin peptidase inhibitor. clade E 1368519_at 0.004 4.95 Myc v-myc myelocytomatosis viral oncogene homolog (avian) 1368308_at 0.002 4.29 Col8a1 collagen. type VIII. alpha 1 1393891_at 0.009 4.01 Lgals3 lectin. galactoside-binding. soluble. 3 1386879_at 0.014 3.65 Fn1 fibronectin 1 1370234_at 0.003 3.6 Alcam activated leukocyte cell adhesion molecule 1370043_at 0.021 3.52 Tnc tenascin C 1373401_at 0.002 3.48 Klf5 Kruppel-like factor 5 (intestinal) 1368363_at 0.002 3.43 Anxa2 annexin A2 1367584_at 0.02 2.97 Icam1 intercellular adhesion molecule 1 1387202_at 0.002 2.7 F2r coagulation factor II (thrombin) receptor 1367899_at 0.000 2.63 Ccnd1 cyclin D1 1371643_at 0.006 2.54 Col4a1 collagen. type IV. alpha 1 1372439_at 0.000 2.47 Gadd45a growth arrest and DNA-damage-inducible. alpha 1368947_at 0.019 2.45 Sema3b sema domain. immunoglobulin domain (Ig) 1377336_at 0.003 2.44 Aangpt2 angiopoietin 2 1374207_at 0.000 2.29 Igfbp3 insulin-like growth factor binding protein 3 Ednrb endothelin receptor type B Stat3 1386881_at 0.001 2.26 1387146_a_at 0.009 2.22 signal transducer and activator of transcription 3 1371781_at 0.002 2.14 Vim vimentin 1367574_at 0.003 2.13 Hspb1 heat shock 27kDa protein 1 1367577_at 0.017 2.08 Ehd4 EH-domain containing 4 1374399_at 0.043 2.08 Rgcc regulator of cell cycle 1368080_at 0.016 2.07 Ctsb cathepsin B 1367646_at 0.029 2.06 G6pd glucose-6-phosphate dehydrogenase 1367856_at 0.019 2.06 Cxcl12 chemokine (C-X-C motif) ligand 12 1387655_at 0.009 -2.03 Supplement 3 All up- or down-regulated angiogenesis related genes of SNX I vs. SNX NI (FC > 2 and FC < -2, p < 0.05), I = ischemic, NI = non-ischemic, FC = Fold Change Transcriptional response to muscle ischemia in rats with CKD Symbol Gene title Probeset ID p-value FC Ccl2 chemokine (C-C motif) ligand 2 1367973_at 0.000 53.13 Ccl7 chemokine (C-C motif) ligand 7 1379935_at 0.000 43.11 Timp1 TIMP metallopeptidase inhibitor 1 1367712_at 0.002 12.81 Spp1 secreted phosphoprotein 1 1367581_a_at 0.035 13.13 Junb jun B proto-oncogene 1387788_at 0.000 11.11 Serpine1 serpin peptidase inhibitor. clade E 1368519_at 0.000 10.44 Hmox1 heme oxygenase (decycling) 1 1370080_at 0.003 7.69 Itgb2 integrin. beta 2 1383131_at 0.029 6.75 Myc v-myc myelocytomatosis viral oncogene homolog (avian) 1368308_at 0.001 6.39 Runx1 runt-related transcription factor 1 1368914_at 0.004 5.56 Col8a1 collagen. type VIII. alpha 1 1393891_at 0.010 4.60 Tnfrsf12 tumor necrosis factor receptor superfamily. member 12A 1371785_at 0.015 4.27 Lgals3 lectin. galactoside-binding. soluble. 3 1386879_at 0.014 4.19 Efna1 ephrin-A1 Cd44 CD44 molecule (Indian blood group) Adm Apln 1372844_at 0.000 3.92 1387952_a_at 0.034 3.60 adrenomedullin 1387219_at 0.004 3.57 apelin 1389651_at 0.013 3.48 S1pr3 sphingosine-1-phosphate receptor 3 1376150_at 0.000 3.22 Klf5 Kruppel-like factor 5 (intestinal) 1368363_at 0.008 3.11 F2r coagulation factor II (thrombin) receptor 1367899_at 0.000 2.89 IL6 interleukin 6 (interferon. beta 2) 1369191_at 0.028 2.88 Igfbp3 insulin-like growth factor binding protein 3 1367652_at 0.000 2.87 Stat3 signal transducer and activator of transcription 3 1370224_at 0.001 2.74 Gadd45a growth arrest and DNA-damage-inducible. alpha 1368947_at 0.022 2.65 Ptafr platelet-activating factor receptor 1383372_at 0.022 2.58 Cxcl9 chemokine (C-X-C motif) ligand 9 1373544_at 0.047 2.55 Angpt2 angiopoietin 2 Ednrb endothelin receptor type B Icam1 Ehd4 Nab2 NGFI-A binding protein 2 (EGR1 binding protein 2) Cxcr4 chemokine (C-X-C motif) receptor 4 Ctsb G6pd 1374207_at 0.000 2.53 1387146_a_at 0.007 2.53 intercellular adhesion molecule 1 1387202_at 0.007 2.53 EH-domain containing 4 1372106_at 0.015 2.42 1374925_at 0.000 2.38 1373661_a_at 0.049 2.28 cathepsin B 1367646_at 0.030 2.23 glucose-6-phosphate dehydrogenase 1367856_at 0.024 2.15 Tnfrsf1 tumor necrosis factor receptor superfamily. member 1A 1367715_at 0.000 2.13 Ptgs2 prostaglandin-endoperoxide synthase 2 1368527_at 0.004 2.08 Ccnd1 cyclin D1 1371150_at 0.046 2.06 Fgr Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog 1368693_at 0.049 2.04 Supplement 4 All up-regulated angiogenesis related genes of Sham I vs. Sham NI (FC > 2, p < 0.05), I = ischemic, NI = non-ischemic, FC = Fold Change Transcriptional response to muscle ischemia in rats with CKD Symbol Gene title Probeset ID p-value FC Gem GTP binding protein overexpressed in skeletal muscle 1382351_at 0.004 -3.7 Serpine1 serpin peptidase inhibitor. clade E 1368519_at 0.029 -3.29 Ccl2 chemokine (C-C motif) ligand 2 1367973_at 0.031 -3.28 Myc v-myc myelocytomatosis viral oncogene homolog 1368308_at 0.015 -3.18 Cxcl9 chemokine (C-X-C motif) ligand 9 1373544_at 0.019 -2.95 Il6 interleukin 6 (interferon. beta 2) 1369191_at 0.025 -2.79 Ctgf connective tissue growth factor 1367631_at 0.024 -2.28 Adm adrenomedullin 1387219_at 0.041 -2.2 Nr4a1 nuclear receptor subfamily 4. group A. member 1 1386935_at 0.027 -2.17 Junb jun B proto-oncogene 1387788_at 0.009 -2.17 Cxcl14 chemokine (C-X-C motif) ligand 14 1388485_at 0.000 -2.08 Efna1 ephrin-A1 1372844_at 0.004 -2.05 Ptgs1 prostaglandin-endoperoxide synthase 1 1368259_at 0.008 -2.04 Supplement 5 All down-regulated angiogenesis related genes of SNX I vs. Sham I (FC > 2 and FC < 2, p < 0.05), I = ischemic, FC = Fold Change Abbreviation Explanation ANOVA analysis of variance cDNA complementary deoxyribonucleic acid CKD chronic kidney disease cRNA complementary ribonucleic acid dl deciliter FC fold change g gram GEO Gene Expression Omnibus h hour I ischemic IPA Ingenuity Pathway Analysis IPKB Ingenuity Pathways Knowledge Base mg millilgram mRNA messenger ribonucleic acid NCBI National Center for Biotechnology Information NI non-ischemic nm nanometer RIN RNA-Integrity-Number RNA ribonucleic acid RT-PCR realtime polymerase chain reaction SNX 5/6 nephrectomy vs versus Supplement 7 Overview of used abbreviations and their explanations.