Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Transcriptional response to muscle ischemia in rats with CKD SUPPLEMENT Genes Primer-sequence 5'-3' 18S fw: TTGATTAAGTCCCTGCCCTTTGT rv: CGATCCGAGGGCCTCACTA fw: AACGAAAGCGCAAGAAATCC rv: GCTCACAGTGAACGCTCCAG fw: CGACACTCTTTTGGCTCCTTCTAAC rv: TGACAGGTAGTCCGTCTTTACTTCG fw: CCACCCCAGAAATGTACCAAAC rv: AAAACGCGGGTCTCTGGTT fw: TGGAAGTGGATCCACGCGCCCAAGG rv: GCAGGAGCGCACGATCATGTTGGAC fw: CTCGTCCATGGTGCTGACCAAG rv: CCGCTGCGAGTCGTTGAAGTAG fe: TATGGAGCACCACTGATGGA rv: TCAGCCAGGCTTTGAGATTT fw: CCTCCACCACTATGCAGGTCTC rv: GCACGTGGATGCTACAGGC fw: AAACCACACGGCCACCAT rv: TGGATTTCAAGACGGGATGT fw: GACCAGTGGGCATCGCTACG rv: CATTGTCCGAATCCTTGTGCT fw: CAAGCCATCTGCGGCATCTC rv: CAGGACACCTTTTTGCAGA fw: CAGACCTCAAGTATGAGTGCAGAG rv: GGTGTTGGCAGCACACTG fw: AAAGTGGCTGAGTTTGGCAG rv: AAGTGGCTACAGCATCTGAGTGT Probe (5' FAM, 3' TAMRA): TCAGAGGAGAAGGCGCATTACAGCA fw: GCCACGGAATCCAGATTTGT rv: GGGAAGGCTTCGGGTCAT fw: CTGGCTCACGCCATTCG rv: CTGTACTTCTTGTCCTCATAGCTTGTG fw: GCCCATGCATTTAATTTGATCA rv: TGAGGATCACAAGCCATGACA fw: AGGGCTGTGTCTGCAAAGGT rv: GCAGCACTGTTCGTCACTTCAG fw: CTCCCGCTTTGATGTCATTCA rv: CCCACACTCATGTCTAGGTGGTT fw: TGTGGGCCCAACCAGATG rv: CTTGGGAATCTTTTGTTTCTTGACA fw: TGCCAGGGATTCACCAGTGT rv: GGCAGGTGCTATGACGAGAAG fw: TCCCCCATTCCATGTGACA rv: CAACAGGTACGGCTGCCATA fw: TCAGCCTACAAAGGACACAATCTC rv: GAGCTGTTGGGAAAGGACATTTT Vegfa Flt1 Kdr Tgfb1 Hsp70 Pgf Ccl2 Angpt1 Angpt2 Thbs1 Thbs2 Spp1 Timp1 Gstm2 Gprc51 Mt1a Prkag3 Ccl7 Csrnp1 E2f8 Hoxd10 Supplement 1 Primer for real-time RT-PCR Transcriptional response to muscle ischemia in rats with CKD Symbol Gene title Probeset ID p-value FC Prkab2 protein kinase. AMP-activated. beta 2 non-catalytic subunit 1369271_at 0.020 2.02 Klhdc3 kelch domain containing 3 1392378_at 0.014 2.02 Rbfox1 RNA binding protein. fox-1 homolog (C. elegans) 1 1378371_at 0.016 2.14 Tpm1 tropomyosin 1. alpha 1395794_at 0.031 2.17 Myod1 myogenic differentiation 1 1398655_at 0.010 2.19 Col7a1 procollagen. type VII. alpha 1 1374226_at 0.047 2.35 Eml1 Echinoderm microtubule associated protein like 1 1390174_at 0.031 2.36 Gstm2 glutathione S-transferase mu 2 1370952_at 0.038 2.42 similar to germinal histone H4 gene 1369728_at 0.001 2.48 Camk2a Calcium/calmodulin-dependent protein kinase II alpha 1381637_at 0.013 2.68 Neu2 sialidase 2 (cytosolic sialidase) 1368127_at 0.026 2.79 Hist4h4 Supplement 2 All upregulated genes of SNX I vs. Sham I (FC > 2, p < 0.05), I = ischemic, NI = nonischemic, FC = Fold Change Ratio Gene Symbol Title PCR Microarray PCR Microarray PCR Microarray Sham I/NI Sham I/NI SNX I/NI SNX I/NI SNX I/Sham I SNX I/ Sham I Vegfa vascular endothelial growth factor A 2.05 1.75 1.67 1.38 0.46 0.54 Flt1 vascular endothelial growth factor receptor 1 1.50 1.24 1.31 1.10 0.68 0.85 Kdr vascular endothelial growth factor receptor 2 2.04 1.72 1.96 1.89 0.64 0.88 Angpt1 angiopoietin 1 1.04 0.84 1.00 0.89 1.01 1.17 Angpt2 angiopoietin 2 2.81 2.53 2.90 2.29 0.75 0.69 Ccl2 chemokine (C-C motif) ligand 2 68.80 53.13 30.57 29.14 0.16 0.31 Ccl7 chemokine (C-C motif) ligand 7 28.36 43.09 18.80 11.50 0.33 0.22 Hsp70 heat shock 70kD protein 1A 3.93 2.55 4.23 3.50 0.42 0.63 Il6 interleukin 6 40.25 2.88 11.10 1.02 0.37 0.36 Mt1a \\\ Ttr metallothionein 1a /// transthyretin 15.39 40.58 7.43 11.68 0.26 0.22 Timp1 TIMP metallopeptidase inhibitor 1 12.59 12.81 10.04 10.60 0.44 0.40 E2f8 E2F transcription factor 8 10.24 5.59 9.20 3.29 0.18 0.25 Pgf placental growth factor 1.67 2.76 1.09 1.21 0.59 0.33 Tgfb1 transforming growth factor. beta 1 3.56 1.39 3.04 1.04 0.79 0.73 Thbs2 thrombospondin 2 1.67 1.54 2.12 1.05 0.66 0.65 Spp1 osteopontin 2.46 13.13 8.67 35.02 0.85 0.45 Gstm2 glutathione S-transferase mu 2 1.51 0.58 0.82 0.81 1.25 2.42 1.11 0.49 0.88 0.60 1.14 1.79 Prkag3 Csrnp1 protein kinase. AMP-activated. gamma 3 noncatalytic subunit cysteine-serine-rich nuclear protein 1 8.54 8.57 3.18 3.63 0.17 0.14 Gprc5a G protein-coupled receptor. family C. group 5. member A 10.13 6.19 13.20 2.39 0.60 0.38 Hoxd10 homeo box D10 1.03 0.49 1.50 1.10 1.85 2.55 Supplement 3 Overview of all ratios for the relative expression changes in both analytic procedures (PCR and Microarray), I = ischemic, NI = non-ischemic. Transcriptional response to muscle ischemia in rats with CKD Symbol Gene title Probeset ID p-value FC Spp1 secreted phosphoprotein 1 1367581_a_at 0.003 35.02 Ccl2 chemokine (C-C motif) ligand 2 1367973_at 0.000 29.14 Ccl7 chemokine (C-C motif) ligand 7 1379935_at 0.000 11.5 Timp1 TIMP metallopeptidase inhibitor 1 1367712_at 0.002 10.6 Tnfrsf12 tumor necrosis factor receptor superfamily. member 12A 1371785_at 0.001 7.08 Cd44 CD44 molecule (Indian blood group) 1387952_a_at 0.003 5.8 Apln apelin 1389651_at 0.000 5.79 Hmox1 heme oxygenase (decycling) 1 1370080_at 0.004 5.57 Junb jun B proto-oncogene 1387788_at 0.000 5.41 Runx1 runt-related transcription factor 1 1368914_at 0.003 5.02 Serpine1 serpin peptidase inhibitor. clade E 1368519_at 0.004 4.95 Myc v-myc myelocytomatosis viral oncogene homolog (avian) 1368308_at 0.002 4.29 Col8a1 collagen. type VIII. alpha 1 1393891_at 0.009 4.01 Lgals3 lectin. galactoside-binding. soluble. 3 1386879_at 0.014 3.65 Fn1 fibronectin 1 1370234_at 0.003 3.6 Alcam activated leukocyte cell adhesion molecule 1370043_at 0.021 3.52 Tnc tenascin C 1373401_at 0.002 3.48 Klf5 Kruppel-like factor 5 (intestinal) 1368363_at 0.002 3.43 Anxa2 annexin A2 1367584_at 0.02 2.97 Icam1 intercellular adhesion molecule 1 1387202_at 0.002 2.7 F2r coagulation factor II (thrombin) receptor 1367899_at 0.000 2.63 Ccnd1 cyclin D1 1371643_at 0.006 2.54 Col4a1 collagen. type IV. alpha 1 1372439_at 0.000 2.47 Gadd45a growth arrest and DNA-damage-inducible. alpha 1368947_at 0.019 2.45 Sema3b sema domain. immunoglobulin domain (Ig) 1377336_at 0.003 2.44 Aangpt2 angiopoietin 2 1374207_at 0.000 2.29 Igfbp3 insulin-like growth factor binding protein 3 Ednrb endothelin receptor type B Stat3 1386881_at 0.001 2.26 1387146_a_at 0.009 2.22 signal transducer and activator of transcription 3 1371781_at 0.002 2.14 Vim vimentin 1367574_at 0.003 2.13 Hspb1 heat shock 27kDa protein 1 1367577_at 0.017 2.08 Ehd4 EH-domain containing 4 1374399_at 0.043 2.08 Rgcc regulator of cell cycle 1368080_at 0.016 2.07 Ctsb cathepsin B 1367646_at 0.029 2.06 G6pd glucose-6-phosphate dehydrogenase 1367856_at 0.019 2.06 Cxcl12 chemokine (C-X-C motif) ligand 12 1387655_at 0.009 -2.03 Supplement 3 All up- or down-regulated angiogenesis related genes of SNX I vs. SNX NI (FC > 2 and FC < -2, p < 0.05), I = ischemic, NI = non-ischemic, FC = Fold Change Transcriptional response to muscle ischemia in rats with CKD Symbol Gene title Probeset ID p-value FC Ccl2 chemokine (C-C motif) ligand 2 1367973_at 0.000 53.13 Ccl7 chemokine (C-C motif) ligand 7 1379935_at 0.000 43.11 Timp1 TIMP metallopeptidase inhibitor 1 1367712_at 0.002 12.81 Spp1 secreted phosphoprotein 1 1367581_a_at 0.035 13.13 Junb jun B proto-oncogene 1387788_at 0.000 11.11 Serpine1 serpin peptidase inhibitor. clade E 1368519_at 0.000 10.44 Hmox1 heme oxygenase (decycling) 1 1370080_at 0.003 7.69 Itgb2 integrin. beta 2 1383131_at 0.029 6.75 Myc v-myc myelocytomatosis viral oncogene homolog (avian) 1368308_at 0.001 6.39 Runx1 runt-related transcription factor 1 1368914_at 0.004 5.56 Col8a1 collagen. type VIII. alpha 1 1393891_at 0.010 4.60 Tnfrsf12 tumor necrosis factor receptor superfamily. member 12A 1371785_at 0.015 4.27 Lgals3 lectin. galactoside-binding. soluble. 3 1386879_at 0.014 4.19 Efna1 ephrin-A1 Cd44 CD44 molecule (Indian blood group) Adm Apln 1372844_at 0.000 3.92 1387952_a_at 0.034 3.60 adrenomedullin 1387219_at 0.004 3.57 apelin 1389651_at 0.013 3.48 S1pr3 sphingosine-1-phosphate receptor 3 1376150_at 0.000 3.22 Klf5 Kruppel-like factor 5 (intestinal) 1368363_at 0.008 3.11 F2r coagulation factor II (thrombin) receptor 1367899_at 0.000 2.89 IL6 interleukin 6 (interferon. beta 2) 1369191_at 0.028 2.88 Igfbp3 insulin-like growth factor binding protein 3 1367652_at 0.000 2.87 Stat3 signal transducer and activator of transcription 3 1370224_at 0.001 2.74 Gadd45a growth arrest and DNA-damage-inducible. alpha 1368947_at 0.022 2.65 Ptafr platelet-activating factor receptor 1383372_at 0.022 2.58 Cxcl9 chemokine (C-X-C motif) ligand 9 1373544_at 0.047 2.55 Angpt2 angiopoietin 2 Ednrb endothelin receptor type B Icam1 Ehd4 Nab2 NGFI-A binding protein 2 (EGR1 binding protein 2) Cxcr4 chemokine (C-X-C motif) receptor 4 Ctsb G6pd 1374207_at 0.000 2.53 1387146_a_at 0.007 2.53 intercellular adhesion molecule 1 1387202_at 0.007 2.53 EH-domain containing 4 1372106_at 0.015 2.42 1374925_at 0.000 2.38 1373661_a_at 0.049 2.28 cathepsin B 1367646_at 0.030 2.23 glucose-6-phosphate dehydrogenase 1367856_at 0.024 2.15 Tnfrsf1 tumor necrosis factor receptor superfamily. member 1A 1367715_at 0.000 2.13 Ptgs2 prostaglandin-endoperoxide synthase 2 1368527_at 0.004 2.08 Ccnd1 cyclin D1 1371150_at 0.046 2.06 Fgr Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog 1368693_at 0.049 2.04 Supplement 4 All up-regulated angiogenesis related genes of Sham I vs. Sham NI (FC > 2, p < 0.05), I = ischemic, NI = non-ischemic, FC = Fold Change Transcriptional response to muscle ischemia in rats with CKD Symbol Gene title Probeset ID p-value FC Gem GTP binding protein overexpressed in skeletal muscle 1382351_at 0.004 -3.7 Serpine1 serpin peptidase inhibitor. clade E 1368519_at 0.029 -3.29 Ccl2 chemokine (C-C motif) ligand 2 1367973_at 0.031 -3.28 Myc v-myc myelocytomatosis viral oncogene homolog 1368308_at 0.015 -3.18 Cxcl9 chemokine (C-X-C motif) ligand 9 1373544_at 0.019 -2.95 Il6 interleukin 6 (interferon. beta 2) 1369191_at 0.025 -2.79 Ctgf connective tissue growth factor 1367631_at 0.024 -2.28 Adm adrenomedullin 1387219_at 0.041 -2.2 Nr4a1 nuclear receptor subfamily 4. group A. member 1 1386935_at 0.027 -2.17 Junb jun B proto-oncogene 1387788_at 0.009 -2.17 Cxcl14 chemokine (C-X-C motif) ligand 14 1388485_at 0.000 -2.08 Efna1 ephrin-A1 1372844_at 0.004 -2.05 Ptgs1 prostaglandin-endoperoxide synthase 1 1368259_at 0.008 -2.04 Supplement 5 All down-regulated angiogenesis related genes of SNX I vs. Sham I (FC > 2 and FC < 2, p < 0.05), I = ischemic, FC = Fold Change Abbreviation Explanation ANOVA analysis of variance cDNA complementary deoxyribonucleic acid CKD chronic kidney disease cRNA complementary ribonucleic acid dl deciliter FC fold change g gram GEO Gene Expression Omnibus h hour I ischemic IPA Ingenuity Pathway Analysis IPKB Ingenuity Pathways Knowledge Base mg millilgram mRNA messenger ribonucleic acid NCBI National Center for Biotechnology Information NI non-ischemic nm nanometer RIN RNA-Integrity-Number RNA ribonucleic acid RT-PCR realtime polymerase chain reaction SNX 5/6 nephrectomy vs versus Supplement 7 Overview of used abbreviations and their explanations.