Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Supplemental Digital Content 1. Real-time quantitative PCR amplicons Target Primers and probes Eff. Ref. Bacteria TCC TAC GGG AGG CAG CAG T 1.07 [1] 0.91 [2] 1.15 [3] 0.82 [4] 0.62 [5] 0.94 [6] FAM-CTG ATT ACC GCG GCT GCT GGC ACTAMRA GGA CTA CCA GGG TAT CTA ATC CTG TT Bacteroides GAA AGC ATT AAG TAT TCC ACC TG fragilis FAM-TGA AAC TCA AAG GAA TTG ACG GGGTAMRA CGG TGA TTG GTC ACT GAC A Escherichia coli GTG TGA TAT CTA CCC GCT TCG C FAM-TCG GCA TCC GGT CAG TGG CAG TTAMRA AGA ACG GTT TGT GGT TAA TCA GGA Bifidobacterium TGG AAG ACG TCG TTG GCT TT longum FAM-CGC ACC CAC CGC A-MGB ATC GCG CCA GGC AAA A Lactobacillus CAT AAA TCC AAG AAC CGC ATG G rhamnosus GG FAM-CTT GGC TGA AAG ATG-MGB CAC GCC GAC AAC AGT TACT CT GC Helicobacter pylori TTT GTT AGA GAA GAT AAT GAC GGT ATC TAA C FAM-CGT GCC AGC AGC CGC GGT-TAMRA CAT AGG ATT TCA CAC CTG ACT GAC TAT C Staphylococcus GGC GCT TGT AAA ATT TTC GT aureus FAM- TTG TTC ACG ATA TGC GTA CAC GTG- 0.78 [7] 0.91 [5] 0.81 [8] Not [9] TAMRA TGC GCA AAG TTT TAT TGA ACA Bifidobacterium AGA ACC ACG GCG GCG TC 0.91 animalis subsp. FAM-TGC GCT CGC CGA CG-MGB lactis Bb-12 CGC GGT CTT CTC GAG CAC T Lactobasillus GAA AGA GCC CAA ACC AAG TGA TT acidophilus La-5 FAM-TAC CAC TTT GCA GTC CTA CA-MGB CTT CCC AGA TAA TTC AAC TAT CGC TTA Bacteroides CGTTCCATTAGGCAGTTGGT determi thetaiotaomicron FAM-CTGAGAGGAAGGTCCCCCACATTGGA- ned TAMRA ACACGGTCCAAACTCCTACG 1. Nadkarni MA, Martin FE, Jacques NA, Hunter N. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 2002;148:257-66. 2. Malinen E, Kassinen A, Rinttila T, Palva A. Comparison of real-time PCR with SYBR Green I or 5'-nuclease assays and dot-blot hybridization with rDNAtargeted oligonucleotide probes in quantification of selected faecal bacteria. Microbiology 2003;149:269-77. 3. Frahm E, Obst U. Application of the fluorogenic probe technique (TaqMan PCR) to the detection of Enterococcus spp. and Escherichia coli in water samples. Journal of microbiological methods 2003;52:123-31. 4. Haarman M, Knol J. Quantitative real-time PCR assays to identify and quantify fecal Bifidobacterium species in infants receiving a prebiotic infant formula. Appl Environ Microbiol 2005;71:2318-24. 5. Storro O, Oien T, Langsrud O, Rudi K, Dotterud C, Johnsen R. Temporal variations in early gut microbial colonization are associated with allergen-specific immunoglobulin E but not atopic eczema at 2 years of age. Clin Exp Allergy 2011;41:1545-54. 6. Roussel Y, Wilks M, Harris A, Mein C, Tabaqchali S. Evaluation of DNA extraction methods from mouse stomachs for the quantification of H. pylori by realtime PCR. Journal of microbiological methods 2005;62:71-81. 7. Liu D, Lawrence ML, Austin FW. Evaluation of PCR primers from putative transcriptional regulator genes for identification of Staphylococcus aureus. Letters in applied microbiology 2005;40:69-73. 8. Haarman M, Knol J. Quantitative real-time PCR analysis of fecal Lactobacillus species in infants receiving a prebiotic infant formula. Appl Environ Microbiol 2006;72:2359-65. 9. Shanks OC, Atikovic E, Blackwood AD, Lu J, Noble RT, Domingo JS, et al. Quantitative PCR for detection and enumeration of genetic markers of bovine fecal pollution. Appl Environ Microbiol 2008;74:745-52.