Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Manzan al., 2003 Supplementary Material 0 ATP + ATP g MlaA Comple x Free DNA (DNA binding)Supplementary Figure 1: ATP dependent DNA binding. Electrophoretic mobility shift assays of labeled dsDNA 20-mers +/- ATP show that DNA binding of MlaA is not strongly affected by ATP-binding. Increasing concentrations of MlaA (0, 0.25, 0.5, 1, 2 g) were incubated with 50 fmol of ds oligonucleotide with one strand labeled at the 5 end in 25 mM HEPES, pH 8.0, 50 mM NaCl, 1 mM DTT, 5 mM MgCl2, 10% glycerol, ±1 mM ATP as indicated. Reactions were incubated for 15 minutes at room temperature and loaded on a 6% polyacrylamide gel in 1X TBE. Complexes were separated and the gel dried and visualized by phosphoimager.. 1 Manzan al., 2003 A B b uf fe r 9 00 C b uf fe r b -ATP +ATP +ATP uf µM µM fe µM MlaA MlaA MlaA r 0. 0. 0. 0. 0. 0. 0. 0. 1 2 4 8 + 1 2 4 8 1 2 4 8 A T P (Helicase Assays)Supplementary Figure 2: Helicase activity assays. a) MlaA (8 and 16 M) was incubated in 25 mM HEPES, pH 8.0, 50 mM NaCl, 1 mM DTT, 5 mM MgCl 2 and 1 mM ATP with 200 fmol of the indicated Y-substrates at 50C for 15 minutes. Reactions were terminated by the addition of 3X stop dye (50 mM EDTA, 40% glycerol, 0.9% SDS, 0.1% bromophenol blue, 0.1% xylene cyanol. Proteinase K was added to a final concentration of 10 µg/ml and incubated at 37C for ten minutes. Reactions were separated on a 6% polyacrylamide gel in 1 X TBE, dried and visualized with a phosphoimager. b) To test for helicase activity of Holliday-junctions, MlaA (indicated concentrations) was incubated with Holliday junction substrate (gel purified, 50 fmol) in the presence of excess unlabelled scavenger oligonucleotide Hol1 (supplement Table1) for 30 min at 600C in 2 Manzan al., 2003 50mM Tris 7.5, 100 mM NaCl, 5mM MgCl2, +/- 100 mM ATP. 1% SDS and 10 µg/ml proteinase K were added and the reaction was incubated at 370C for another 10 min to digest MlaA. The DNA was resolved by 10% native PAGE in Tris-Borate buffer. In the control lane (left), the Holliday-junction substrate was incubated at 900C to completely denature the DNA. The data show no evidence for significant helicase activity. However, it must be noted that for technical reasons we assayed the MlaA helicase activity appr 400C below physiological temperatures of P. abyssii (growth temperature above 900C). Thus, we cannot rule out that MlaA displays significant helicase activity at physiological temperatures. 3 Manzan al., 2003 Supplementary Table 1: Oligonucleotides used for filter binding and helicase assays. Hol1 was end labeled with 32P. Holliday-junctions (Hol1,2,3,4) and Y-substrates (Hol1,4) were assembled by mixing stoichiometric amounts of oligos in TBE, followed by slow cooling from 90 0C to 40C overnight. Products were separated on a 10% non-denaturing polyacrylamide gel. Desired species were excised, eluted from the gel slices overnight in TBE and used for assays. For single-strand assays, we used Hol1. Oligo Sequence Hol1 GGCGACGTGATCACCAGATGATGCTAGATGCTTTCCGAAGAGAGAGC Hol2 GCTCTCTCTTCGGAAAGCATCTAGCATCCTGTCAGCTGCATGGAACG Hol3 CGTTCCATGCAGCTGACAGGATGCTAGTCAAGGCGAACTGCTAACGG Hol4 CCGTTAGCAGTTCGCCTTGACTAGCATCATCTGGTGATCACGTCGCC 4