Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Mol Biol Rep (2013) 40:5921–5929 DOI 10.1007/s11033-013-2699-8 Evaluation of tumor suppressor gene expressions and aberrant methylation in the colon of cancer-induced rats: a pilot study Veronika Polakova Vymetalkova • Luca Vannucci • Vlasta Korenkova • Pavel Prochazka • Jana Slyskova • Ludmila Vodickova • Vendula Rusnakova Ludovit Bielik • Monika Burocziova • Pavel Rossmann • Pavel Vodicka • Received: 28 March 2013 / Accepted: 14 September 2013 / Published online: 25 September 2013 Ó Springer Science+Business Media Dordrecht 2013 Abstract Altered expression and methylation pattern of tumor suppressor and DNA repair genes, in particular involved in mismatch repair (MMR) pathway, frequently occur in primary colorectal (CRC) tumors. However, little is known about (epi)genetic changes of these genes in precancerous and early stages of CRC. The aim of this pilot study was to analyze expression profile and promoter methylation status of important tumor suppressor and DNA repair genes in the early stages of experimentally induced colorectal carcinogenesis. Rats were treated with azoxymethane (AOM), dextran sodium sulphate (DSS) or with their combination, and sacrificed 1 or 4 months posttreatment period. The down-regulation of Apc expression in left colon, detectable in animals treated with DSS–AOM and sacrificed 1 month after the end of treatment, represents most early marker of the experimental colorectal carcinogenesis. Significantly reduced gene expressions V. Polakova Vymetalkova P. Prochazka J. Slyskova L. Vodickova L. Bielik P. Vodicka (&) Institute of Experimental Medicine, Academy of Sciences of the Czech Republic, Videnska 1083, 14200 Prague 4, Czech Republic e-mail: [email protected] V. Polakova Vymetalkova P. Prochazka J. Slyskova L. Vodickova L. Bielik P. Vodicka First Faculty of Medicine and General Teaching Hospital, Institute of Biology and Medical Genetics, Charles University, Prague, Czech Republic L. Vannucci M. Burocziova P. Rossmann Institute of Microbiology, Academy of Sciences of the Czech Republic, Prague, Czech Republic V. Korenkova V. Rusnakova Institute of Biotechnology, Academy of Sciences of the Czech Republic, Prague, Czech Republic were also found in 5 out of 7 studied MMR genes (Mlh1, Mlh3, Msh3 Pms1, Pms2), regarding the sequential administration of DSS–AOM at 4 months since the treatment. Strong down-regulation was also discovered for Apc, Apex1, Mgmt and TP53. Tumors developed in rectumsigmoid region displayed significantly lower Apc and Pms2 expressions. The decreased expression of studied genes was not in any case associated with aberrant methylation of promoter region. Present data suggest that down-regulation of Apc and MMR genes are prerequisite for the development of CRC. In this study we addressed for the first time early functional alterations of tumor suppressor genes with underlying epigenetic mechanisms in experimentally induced CRC in rats. Keywords Colorectal cancer Rats mRNA expression Mismatch repair genes Promoter methylation Introduction Colorectal cancer (CRC), an example of multistage human carcinogenesis, is hallmarked by a sequence of events during which normal colonic epithelium gradually transforms into carcinoma tissue, often via the development of colorectal adenomas [1]. Genomic sequencing of human CRCs has revealed frequent somatic mutations and deletions in a spectrum of tumor-related genes [1, 2]. Recently, epigenetic factors have been implicated in the development of polyps and CRC. Alterations of gene expression, often due to epigenetic inactivation of Apc and DNA mismatch repair (MMR) genes by aberrant DNA methylation, may be involved in the progression and metastasis of CRC [3–5]. However, the causal role of 123 5922 aberrant DNA methylation in the process of cancer initiation and promotion is presently poorly understood [6]. It has been postulated that the aberrant hypermethylation of tumor suppressor genes can result in their transcriptional silencing (lower mRNA expression), a mechanism through which DNA methylation is believed to promote cancer formation. There is lack of information about the precise timing of these epigenetic alterations in the transition from normal colon epithelium to malignant cells through the adenoma-carcinoma sequence. The lack of mechanistic data linking the promoter methylation with ultimate gene expression levels in human colon carcinogenesis [6, 7] highlights the need to closely examine this phenomenon in controlled animal experiments. A commonly used model to investigate the development of colon cancer in rodents is administration of azoxymethane (AOM) [6]. AOM is a potent carcinogen causing a high incidence of colon cancer in rodents [8]. Colon cancer also represents the most serious complication associated with chronic inflammatory bowel disease (IBD) [9]. The risk of CRC increases with the extent and duration of the IBD, and putative mechanisms of chronic or repeated mucosal inflammation in CRC tumorigenesis have recently been proposed [10, 11]. To explore an association of IBD with CRC, the most frequently used model is the induction of colon inflammation in mice and rats by dextran sodium sulphate (DSS) administration [12]. The DSS induces chronic colitis, which ultimately results in epithelial malignant neoplasia [10, 11]. Recently, Lin and collaborators identified changes in DNA methylation associated with the two major IBD subtypes, Crohn’s disease and ulcerative colitis [13]. In our study of early stages of experimentally-induced CRC, we have analyzed mRNA expression levels and possible epigenetic alterations of tumor suppressor candidate genes Apc, Mlh1, Mlh3, Msh2, Msh3, Pms1, Pms2, Exo1, Mgmt, Apex1, p16, TP53, and Cdh1 in conventional (CV) rats. Animals were treated with AOM and/or DSS to discern possible environment-independent markers of the CRC evolution. The aim of this pilot study was to characterize mRNA expressions in tumor suppressor genes during various time points in the early stages of experimental CRC development. Materials and methods Animals The study was conducted on inbred male Wistar-AVN rats ([70 generations, at the starting of the experiments the animals were 6–8 weeks old), obtained from the Institute of Physiology, Academy of Sciences of the Czech Republic 123 Mol Biol Rep (2013) 40:5921–5929 (ASCR) v.v.i., Prague, Czech Republic and reared under standard conditions in the animal facility of the Institute of Microbiology, ASCR v.v.i, Prague, Czech Republic. Rats received standard diet and free water intake. All animal experiments were approved by the Laboratory Animal Care and Use Committee of the Institute of Microbiology v.v.i., ASCR, according to the Animal Protection Act of the ASCR and the European Convention for the Care and Use of Laboratory Animals. Generation of AOM-induced tumors and DDS-induced colitis A total of 24 animals were used in this pilot experiment. Animals were divided into four sub-groups according to the treatment: six untreated control animals, six animals treated with AOM (Sigma-Aldrich, St. Louis, MO, USA), six animals treated with DSS (MP Biomedicals, Santa Ana, CA, USA), and six animals treated with both DSS and AOM in sequence. DSS (sterilized 3 % solution in drinking water) was supplied orally ad libitum for about 10 days until appearance of acute symptoms of colitis (anal edema, diarrhea and rectal bleeding). The animals received a total of three courses with 1 week interruption between them (the average time for recovery from the acute symptoms). A second group received AOM (9 mg/kg body weight, subcutaneously), administered once a week for 4 consecutive weeks. In the DSS–AOM group, three courses of DSS treatment were followed by AOM treatment performed once a week for 4 weeks. The study was designed to follow the development of early stages of carcinogenesis, therefore three animals in each of four sub-groups were sacrificed respectively at 1 and 4 months after the end of treatment. AOM induces bulky cancers in a period of 6–8 months. Characteristics of tumor development and appearance in the rat model of colorectal carcinogenesis have been described in our earlier studies [14–16]. Tissue harvesting At the sacrifice, a complete autopsy was performed and the large bowel was totally removed, longitudinally opened in all its length and washed from stools. Then, colonic mucosa was collected by gently scraping with a glass slide. Samples of colonic mucosa (right and left colon) were collected into cryocentrifuge tubes, snap-frozen and stored at -80 °C. Presence of tumors was macroscopically evaluated and representative sampling of colon and tumors was performed before the removal of the mucosa, for regular histological diagnosis. Samples were fixed in formalin 5 % and then embedded in paraffin to prepare 4 lm sections to Mol Biol Rep (2013) 40:5921–5929 be stained with hematoxylin-eosin and pricrosirius (staining for collagen fibers) according to the standard protocols. ‘‘In blind’’ evaluation of the stained sections was performed by an expert pathologist. 5923 Table 1 Primers used in the MSP analysis and for verification of methylation by MS-HRM Gene Tm (°C) Primers Apc 58.37 MF: AGGTTTTGGTTTTAGTTTTTGAGAC 59.47 MR: TAAAAATTCCACAACTTCGATACG 57.95 UF: AGGTTTTGGTTTTAGTTTTTGAGAT 57.31 UR: AAAAATTCCACAACTTCAATACATT 60.8 HRM F: GTGGATGTTTGATATGAATAGATGTT 60.2 HRM R: AACAACCCATACCCTACCTCTA 59.19 59.80 MF: GTTGTAGGTATGTGGAGGGTTTTAC MR: ACAACGTAACCTCCAAAACGAT 58.40 UF: GTAGGTATGTGGAGGGTTTTATGA 58.83 UR: TACACAACATAACCTCCAAAACAAT 58.43 MF: GGGTATATAACGTTAGGTTAAACGG 59.53 MR: ACAAAAAACTCCATACTACTCCGAA 54.55 UF: GGGTATATAATGTTAGGTTAAATGG 59.13 UR: TATCTACAAAAAACTCCATACTACTCCAA 59.67 MF: GTCGAGTTTTGAGGTCGTAGTAAAC 59.95 MR: TCTCTAACCAATAAAAACGAAAACG 57.60 UF: GTTGAGTTTTGAGGTTGTAGTAAATG 57.81 UR: TCTAACCAATAAAAACAAAAACACC 59.19 MF: CGGGTTATGTTTGTGTGTGTATC 59.02 MR: CACTCCTCACTCCTAAACTACGAA 58.73 UF: AGTGGGTTATGTTTGTGTGTGTATT 58.89 60.4 UR: CCACTCCTCACTCCTAAACTACAA HRM F: TAGTTTAGGAGTGAGGAGTGGAG DNA and RNA isolation and the quality control Total RNA and DNA were isolated using AllPrep DNA/ RNA mini kit according to the manufacturer protocol (Qiagen, Czech Republic). Quantity and purity of both RNA and DNA were measured using ASP-3700 Microvolume UV–Vis Spectrophotometer (Avans-Biotechnology, Taiwan). OD260/280 ratios for all samples were between 1.8 and 2.0. After the isolation DNA and RNA were stored at -80 °C. RNA integrity number (RIN) was measured using capillary electrophoresis performed on Agilent Bioanalyzer 2100, with RNA 6000 Nano Assay (Agilent Technologies, Palo Alto, CA). RINs of all collected samples were not lower than 6.5 and thus the samples were appropriate for further analyses. Cdh1 p16 Mlh1 Methylation-specific PCR (MSP) Msh2 Methylation in promoter region was analyzed in 7 genes, namely in tumor suppressors Apc and Cdh1, DNA repair genes Mlh1, Msh2, Pms2 and Mgmt and cell cycle regulator p16. Isolated genomic DNA from leukocytes was treated with SssI methyltransferase (New England Biolabs, Beverly, MA, USA) in order to generate a positive control for methylation analysis. As reference samples we used two aliquots of genomic DNA, the former methylated as above and the latter without enzymatic SssI methylation. Sodium bisulfite conversion of DNA was performed using the Epitect Bisulfite Kit (Qiagen, Valencia, CA, USA) following the producer’s protocol. MSP analysis of bisulfitetreated DNA was carried out using the methylated and unmethylated primer sets (Table 1), which were designed using MethPrimer software (http://www.urogene.org/ methprimer/). MSP reactions were performed as previously described [17]. Methylation-sensitive high resolution melting (MS-HRM) MS-HRM was performed in order to verify positive findings obtained by MSP for Apc and Msh2 genes, as well as to quantify the extent of cytosine methylation. Real-time PCR followed by HRM was carried out by high-performance Eco Real-Time PCR system (Illumina, Inc., San Diego, CA, USA). Primers specific for bisulfiteconverted DNA (Table 1) were designed using Methyl Primer Express Software v1.0 (Applied Biosystems, Foster Pms2 Mgmt 60.5 HRM R: CTACCCTTCCACAATAATCCAT 58.52 MF: GTAGTTAATGGGTGGTTTAGGAGAC 58.43 MR: ACCGAAAACTCTATAAAAAATACGC 58.09 UF: GTAGTTAATGGGTGGTTTAGGAGAT 57.25 UR: AATACCAAAAACTCTATAAAAAATACACC 57.58 MF: TTGTTTATTAGGTTTCGTTTTACGT 57.77 MR: ATCTCCCTAAACTCTAAACTTCGAC 53.65 UF: TTGTTTATTAGGTTTTGTTTTATGT 55.77 UR: ATCTCCCTAAACTCTAAACTTCAAC Tm melting temperature, MF methylated primers forward, MR methylated primers reverse, UF unmethylated primers forward, UR unmethylated primers reverse, HRM F primers forward designed for MS-HRM, HRM R primers reverse optimized for MS-HRM City, CA, USA). The reaction mixture in final volume of 10 lL consisted of 10 ng of bisulfite converted template DNA, 19 EpiTect HRM Master Mix (Qiagen) and 300 nmol/L of each primer. PCR was initiated by incubation step at 95 °C for 5 min, followed by 50 cycles at 95 °C for 10 s in case of Apc, and 57 or 58 °C for 20 s in case of Msh2, and finalized by 72 °C for 10 s. Melting thermal profile was set up according to the manufacturer’s recommendation (Qiagen). For each assay, a standard dilution series of Rat High Methylated DNA control and Rat Low Methylated DNA control (EpigenDx, Worcester, 123 5924 Mol Biol Rep (2013) 40:5921–5929 MA, USA) was run in parallel to assess the quantitative properties and sensitivity of the assay. Fluorescence data were converted into melting peaks by the Eco Software (Illumina, Ver. 3.0.16.0). in the mastermix was used ROX. Data were collected using BioMark Data Collection Software 2.1.1., built 20090519.0926 (Fluidigm, USA). Expression experiments were performed following MIQE guidelines [18]. Gene expression analysis Data pre-processing and analysis Reverse transcription Obtained data were inspected for the correct baseline and threshold and exported from BioMark Real-Time PCR Analysis software (Fluidigm, USA). Data set contained tested samples, interplate calibrator, NTC, positive control and reference assays. Data were preprocessed in Genex software (MultiD, version 5.1). Missing data were filled with highest value in gene column ?1, which represented one half of the lowest measured expression. All values higher than value of NTC were removed. Positive control was checked for positivity in all assays. The Grub’s test for identification of outliers was performed on mean values of technical replicates and outliers were removed. Interplate calibration within all 5 plates was performed. Samples, which were negative for at least one of their reference gene, were removed from analysis (3 colon samples). Each data set was normalized with appropriate reference genes: Gapdh, Ubc. At the end, data were recalculated to relative quantities with the lowest expression being set to 1, and transformed to log2 scale. Assays and samples with more than 12 % of missing data were removed from the dataset. It concerns particularly Cdh1 gene. Complementary DNA (cDNA) was synthesized from 1 lg of total RNA by using RevertAidTM First strand cDNA synthesis kit (MBI Fermentas, Vilnius, Lithuania) with random hexamer primers in a final volume of 40 lL following manufacturer’s instructions. cDNA was stored at -20 °C. Before use, cDNA was diluted ten times. BioMarkTM qPCR analysis and gene specific preamplification In all tested samples, target gene assays together with selected reference genes (described below), were run using qPCR high throughput platform BioMarkTM HD System (Fluidigm, USA). As reference genes, Gapdh and Ubc were selected on the basis of a geNormTM reference gene selection kit of 12 genes with PerfectProbeTM and analyzed by both Genorm and Normfinder algorithms (GenEx Professional, MultiD Analyses AB, Göteborg, Sweden). The cut off value for the level of stability of expression M was 0.15 and average pairwise variation was 2/3. All samples were preamplified because of the need of highly concentrated cDNA for use on 48.48 Gene Expression Dynamic Arrays (Fluidigm, USA). Preamplification was performed with TaqmanÒ PreAmp Master Mix (Applied Biosystems) with 2.5 lL of transcribed cDNA according to the manufacturer protocol in volume of 10 lL per reaction. Preamplified cDNA was stored at -20 °C. Samples were distributed in four 48.48 Gene Expression Dynamic Arrays (Fluidigm, USA). Each chip included no template control (NTC), positive control and interplate calibrator. The interplate calibrator was a mixture of rat qPCR products. Each sample was run in triplicate. Five microlitre sample premix consisted of 2.25 lL of 59 diluted preamplified cDNA, 0.25 lL of 209 GE sample loading reagent (Fluidigm, USA) and 2.5 lL of Taqman universal mastermix II without UNG (Applied Biosystems). Each sample premix was combined with 5 lL assay premix, which was assembled from FAM-MGB custom designed 209 PrimerdesignÒ gene expression assay (Primer Design Ltd., Southampton, UK) and 29 Assay loading reagent (Fluidigm, USA). The reaction volume for a single qPCR reaction was 6.7 nL. The thermal protocol for the qPCR reaction was: 95 °C for 10 min followed by 45 cycles 15 s long at 95 , and 50 °C for 60 s. As a passive reference dye 123 Statistical analysis Investigated parameters were normally distributed in the study population (by Kolmogorov–Smirnov test). The relationships between variables of interest at the bivariate level were studied by means of two-tailed t test. All statistical tests were conducted at a 95 % confidence level; expression data were corrected for multiple testing. Results Tumor occurrence All animals treated with DSS had developed colitis with typical symptoms. Macroscopically, the colon mucosa showed a more pronounced vascular design, hypertrophy of the lymphatic plaques, as a sign of immune activation by persistent inflammatory stimulation. Microscopic examination showed typical inflammatory infiltrate in the mucosa and submucosa, hypotrophy of crypts and increase in collagen fiber accumulation (fibrosis), well evident at 4 months. Malignancies were not detected either macroscopically or, in the taken samples, microscopically. Mol Biol Rep (2013) 40:5921–5929 5925 We did not observe any tumor development in animals treated only with AOM, irrespectively to the sacrifice time, neither macroscopically nor microscopically, while aberrant crypts were present at the 4 month (not shown). Animals treated with DSS and AOM in sequence and sacrificed 1 month after the end of treatment resulted negatively for colonic tumors at the inspection and microscopy. However, at the fourth month evaluation, all animals treated with DSS–AOM sequence had developed multiple polypoid tumors of various dimensions (ranging from 1 up to 6 mm in diameter and in a number from 10 up to 21 per rat). They were located exclusively in the lowest tract of left colon including the rectum-sigmoid tract. Microscopy confirmed the presence of infiltrating adenocarcinomas in a chronic colitis context. Gene expression Gene expression profile was analyzed for 12 tumor suppressor genes, including Apc, p16, TP53, involved in cell cycle regulation, Mlh1, Mlh3, Msh2, Msh3, Pms1, Pms2, and Exo1 involved in DNA MMR pathway, and Mgmt and Apex1 genes, acting in direct reversal and base excision repair pathways. We did not observe any significant differences in expression of investigated genes in colon tissue of animals treated with AOM, irrespective of observation time (the overall gene expression data are summarized in Tables 2, 3). In animals sacrificed 4 months after the end of DSS treatment, approximately twofold decrease in expressions of Pms2 in right colon mucosa and of Mlh1 in left colon mucosa have been recorded (Table 3). The only significant change in the expression profile in animals treated with the combination of DSS–AOM and sacrificed 1 month after the treatment was striking (nearly 30-fold) decrease in the expression of Apc in the left colon. Regarding the animals treated with the combination of DSS–AOM and sacrificed 4 months since the end of treatment, a significant (more than twofold) decrease of mRNA levels of Apc gene was observed in the right colon. Table 2 Expression levels of tumor suppressor genes in the colon of animals sacrificed after 1 month (all expressions expressed as log2) Gene Mlh1 Tissue Control AOM Mean ± SD Mean ± SD DSS P Mean ± SD AOM ? DSS P Mean ± SD P RCM 6.98 ± 0.50 7.82 ± 0.53 0.570 8.27 ± 0.95 0.353 7.63 ± 1.22 0.776 LCM 6.40 ± 1.82 7.05 ± 1.34 0.857 7.01 ± 0.25 0.877 7.32 ± 0.42 0.761 Mlh3 RCM 11.54 ± 0.16 11.84 ± 0.59 0.873 11.79 ± 0.21 0.933 11.61 ± 0.85 0.998 LCM 10.62 ± 0.65 11.04 ± 0.97 0.776 10.97 ± 0.26 0.844 10.58 ± 0.01 0.999 Msh2 RCM 2.49 ± 0.53 3.64 ± 0.81 0.491 2.93 ± 0.32 0.937 3.66 ± 1.85 0.539 LCM 2.75 ± 1.15 3.27 ± 0.85 0.659 2.36 ± 0.40 0.879 2.74 ± 0.05 0.999 Msh3 RCM LCM 2.47 ± 0.93 2.92 ± 1.29 3.27 ± 0.59 3.12 ± 0.80 0.819 0.981 2.50 ± 0.29 2.14 ± 0.20 0.999 0.556 3.70 ± 2.45 1.81 ± 0.33 0.652 0.389 Pms1 RCM 1.46 ± 0.47 2.64 ± 0.51 0.679 1.70 ± 0.47 0.995 3.59 ± 2.90 0.369 LCM 2.61 ± 1.41 2.14 ± 1.02 0.894 1.35 ± 0.44 0.347 1.52 ± 0.13 0.529 Pms2 RCM 1.65 ± 0.97 2.64 ± 0.50 0.784 1.83 ± 0.48 0.998 3.60 ± 2.88 0.439 LCM 3.27 ± 1.87 2.38 ± 0.77 0.894 1.48 ± 0.37 0.198 1.23 ± 0.20 0.190 Exo1 RCM 4.61 ± 2.58 7.07 ± 0.58 0.546 4.96 ± 0.21 0.933 7.66 ± 4.35 0.466 LCM 7.41 ± 2.54 6.44 ± 0.72 0.770 5.50 ± 0.75 0.334 5.83 ± 0.05 0.547 Mgmt RCM 1.91 ± 0.49 2.57 ± 0.80 0.947 1.62 ± 0.76 0.996 3.54 ± 3.56 0.677 LCM 3.12 ± 2.54 3.05 ± 0.66 0.999 1.30 ± 0.61 0.877 0.32 ± 0.45 0.168 Apex1 RCM 1.55 ± 1.15 2.76 ± 0.76 0.646 1.84 ± 0.40 0.992 3.51 ± 2.48 0.395 LCM 2.85 ± 1.87 2.30 ± 1.14 0.899 1.79 ± 0.28 0.592 2.12 ± 0.03 0.845 Cdkn2a (p16) RCM 9.24 ± 1.83 9.97 ± 2.46 0.995 4.86 ± 6.87 0.627 11.59 ± 5.20 0.896 LCM 12.11 ± 3.52 10.55 ± 1.44 0.881 7.99 ± 1.85 0.335 6.62 ± 5.87 0.223 TP53 RCM 5.49 ± 1.51 7.27 ± 1.28 0.411 7.00 ± 0.40 0.595 7.80 ± 1.85 0.305 Apc LCM RCM 6.09 ± 2.02 1.70 ± 0.08 6.92 ± 1.80 1.70 ± 0.19 0.842 0.963 6.06 ± 0.69 1.09 ± 0.46 0.999 0.914 7.09 ± 0.14 2.28 ± 2.62 0.813 0.923 LCM 2.10 ± 0.70 1.45 ± 0.55 0.405 1.07 ± 0.49 0.130 0.33 – 0.12 0.024 P value was used for comparison of means between control and treated animals RCM right colon mucosa, LCM left colon mucosa Significant P-values (P \ 0.05) are in bold 123 5926 Mol Biol Rep (2013) 40:5921–5929 Table 3 Expression levels of tumor suppressor genes in the respective colon tissues and tumors of animals sacrificed after 4 months (all expressions expressed as log2) Gene Mlh1 Tissue Control AOM Mean ± SD Mean ± SD DSS P AOM ? DSS Mean ± SD P Mean ± SD Tumors P Mean ± SD P RCM 7.92 ± 0.31 8.13 ± 0.59 0.958 8.09 ± 0.33 0.983 8.11 ± 0.83 0.968 – LCM 8.47 ± 0.33 8.51 ± 0.25 0.998 7.21 – 0.60 0.022 5.98 – 0.26 0.001 8.37 ± 0.71 0.831 Mlh3 RCM LCM 12.10 ± 0.16 11.93 ± 0.14 12.08 ± 0.31 11.00 ± 2.27 0.999 0.749 11.94 ± 0.81 10.65 ± 0.64 0.966 0.633 10.67 – 0.47 10.57 ± 0.01 0.036 0.592 – 10.48 – 0.80 0.014 Msh2 RCM 3.86 ± 0.38 4.29 ± 0.46 0.680 4.22 ± 0.85 0.804 3.84 ± 0.32 0.999 – LCM 4.22 ± 0.11 4.45 ± 1.05 0.972 3.00 ± 1.07 0.327 3.24 ± 0.73 0.479 4.70 – 0.26 Msh3 RCM 3.84 ± 0.23 3.55 ± 0.22 0.599 3.32 ± 0.47 0.281 2.86 – 0.19 0.028 – LCM 3.81 ± 0.17 3.68 ± 1.15 0.992 2.80 ± 0.24 0.335 2.32 ± 0.06 0.124 2.85 – 0.31 Pms1 RCM 3.57 ± 0.18 3.71 ± 0.21 0.931 3.61 ± 0.65 0.997 2.58 – 0.26 0.043 – LCM 3.51 ± 0.32 3.98 ± 0.63 0.520 3.03 ± 0.07 0.602 1.82 – 0.56 0.020 3.10 ± 0.29 Pms2 RCM 4.50 ± 0.10 4.17 ± 0.30 0.381 3.29 – 0.20 0.007 2.58 – 0.26 0.001 – 0.017 0.008 0.078 LCM 3.59 ± 0.29 4.10 ± 0.63 0.471 3.03 ± 0.07 0.481 1.82 – 0.56 0.020 3.10 – 0.29 Exo1 RCM 8.51 ± 0.30 8.26 ± 0.88 0.948 6.90 ± 0.75 0.107 6.69 – 0.41 0.050 – LCM 7.37 ± 0.61 7.85 ± 0.90 0.927 6.92 ± 2.43 0.953 4.82 ± 0.68 0.127 7.40 ± 0.69 Mgmt RCM 5.50 ± 0.33 4.62 ± 0.90 0.542 3.08 ± 0.92 0.061 2.72 – 0.89 0.024 – LCM 3.65 ± 0.56 4.61 ± 0.38 0.599 3.29 ± 2.41 0.969 3.11 ± 0.38 0.907 2.83 ± 0.80 Apex1 RCM 3.34 ± 0.11 3.68 ± 0.22 0.415 3.00 ± 0.11 0.470 2.49 – 0.39 0.028 – 3.35 ± 0.25 10.85 ± 0.40 3.67 ± 0.70 10.39 ± 1.13 0.773 0.993 2.96 ± 0.49 8.22 ± 3.50 0.748 0.607 1.32 – 0.36 7.37 ± 3.37 0.011 0.968 3.96 ± 0.44 – 0.051 Cdkn2a (p16) LCM RCM LCM 8.49 ± 1.89 10.18 ± 1.32 0.798 8.38 ± 4.89 0.999 6.78 ± 3.30 0.855 9.58 ± 1.88 0.393 TP53 RCM 7.92 ± 0.39 8.76 ± 0.11 0.399 8.44 ± 0.56 0.752 7.70 ± 1.00 0.963 – LCM 8.64 ± 0.29 8.32 ± 1.61 0.963 8.15 ± 0.15 0.915 5.02 – 0.77 0.018 8.65 ± 0.89 Apc RCM 3.00 ± 0.59 2.59 ± 0.14 0.671 2.10 ± 0.65 0.225 1.37 – 0.52 0.022 – LCM 2.77 ± 0.15 2.59 ± 0.67 0.963 1.78 ± 0.45 0.240 2.05 ± 0.91 0.453 0.59 – 0.30 0.036 0.953 0.144 0.982 0.0001 P value was used for comparison of means between corresponding tissues from control and treated animals or those from tumors, respectively RCM right colon mucosa, LCM left colon mucosa Significant P-values (P \ 0.05) are in bold In the same animals, significant down-regulation of gene expression was found in 5 out of 7 studied DNA MMR genes, in comparison with control untreated rats (Table 3). As expected, the down-regulation of DNA MMR genes Mlh3, Msh3, Pms1 and Pms2 occurred predominantly in the right colon mucosa. Interestingly, Mlh1 was significantly down-regulated in the left colon mucosa as well, so were Pms1 and Pms2, respectively. The expression level of Mgmt gene was fourfold lower in the right colon, two- to sixfold down-regulation of Apex1 was observed in both the right and left colon. A significant threefold down-regulation of the TP53 gene was recorded only in the left colon when compared to right colon and to control animals. Some genes, such as Apc, Mlh3, Msh3 and Pms2 were further reduced in their transcription level in tumor tissue, when compared to healthy tissue from the same colon sequence. Only Msh2 was observed to be increased in tumor samples (Table 3). 123 Methylation status Methylation status was analyzed by MSP and all samples providing positive signals (Apc and Msh2 genes) were reanalyzed by MS-HRM in order to obtain higher specificity. None of the samples showed any aberrant methylation in the promoter region of analyzed genes. Discussion The etiology of sporadic CRC is polygenic [19]. Currently, functional variability in genes responsible for DNA repair mechanisms and control of the cell cycle in the presence of carcinogen-mediated cell damage is believed to be an attractive mechanism for explaining interindividual variation in CRC susceptibility [2]. Mol Biol Rep (2013) 40:5921–5929 Analyses of phenotype concordance in monozygotic twin CRC cases suggest that inherited susceptibility underlies 35 % of all CRCs. However, only 6 % of CRCs occur in the context of a known high-penetrance cancer predisposition syndrome, such as Familial Adenomatous Polyposis or Lynch Syndrome with characteristic mutations in DNA MMR genes Mlh1, Msh2, Msh6, or Pms2 [20]. Although, alterations of gene function, often due to epigenetic inactivation of relevant tumor suppressor genes by aberrant DNA methylation, may be involved in the onset, progression and metastasis of CRC [3–5], most of the genetic risks for CRC remain unknown. In the present study we addressed for the first time early functional alterations of tumor suppressor genes with underlying epigenetic mechanisms in experimentally induced CRC in rats. The considerable down-regulation of the key tumor suppressor gene Apc in the left colon of animals treated with the combination of DSS–AOM and sacrificed 1 month after the treatment suggests its critical role in early stages of carcinogenesis. In later stages of experiment, Apc gene expression in the non-malignant left colon non-significantly returns to the control levels, but in arising tumors and in the right colon significantly decreases. These results suggest different pathways leading to colon cancer in both bowel segments with preferential early Apc down-regulation in the distal colon and MMR deficient tumors in the proximal (right) colon, as described by [21]. Although Apc inactivation has important role in evolution of precancerous adenomas and in tumorigenesis, colorectal neoplasias may also occur irrespectively of Apc inactivation or deregulation of Wnt pathway signaling, with possible contribution of colonic bacterial environment [22]. In our case, the Apc down-regulation was apparently not due to methylation of Apc promoter region. However, aberrant methylation of Apc gene is not very frequent (around 20 %) in human gastrointestinal cancers [23, 24]. Contemporary study hypothesizes that the lack of gross genetic alterations (such as mutations, loss of heterozygosity, copy number changes etc.) may not necessarily underlie Apc down-regulation in animal model [25]. Apparently, mechanisms of early colorectal carcinogenesis in controlled environment, animal models require further investigation. Significantly reduced gene expression was found in 5 out of 7 studied MMR genes in relation to the combined DSS–AOM treatment. The aberrant expression of DNA mismatch genes occurred predominantly in the right colon mucosa and these findings are in accord with the human studies [26]. However, down-regulations in Mlh1 (the major DNA MMR gene), Pms1 and Pms2 in the left colon are in agreement with the finding of Svrcek et al. [27], who described heterogeneous MMR defects (with no preference to proximal colon), involving Mlh1, Msh2, Msh6 and Pms2 5927 in patients with IBD. Alterations in expression profiles of MMR genes may be associated with a cascade of changes in inflammatory cells (such as a production of reactive oxygen and nitrogen species) which can modify regulation of tumor suppressor genes, transcription factors, or signaling proteins [28]. The expression level of Mgmt gene, which is responsible for the removal of methyl moieties on O6-position of guanine, was four-fold lower in the right colon, indirectly suggesting the role of the suppression of this repair mechanism in right-sided colon carcinogenesis. Interestingly, Apex1 gene, which encodes apurinic site endonuclease and is involved in base excision repair, was downregulated two-to six-fold in both colonic segments. Apex1, in cooperation with Ogg1, is also responsible for the removal of oxidative DNA damage, often induced by inflammatory processes. The suppression of Apex1 expression, more pronounced in the left colon, may be an additional contributing factor in multifactorial colorectal carcinogenesis. Interestingly, the sequential treatment with DSS–AOM with a sacrifice at 4 months was characterized by a significant three-fold down-regulation of the important tumor suppressor gene, TP53 in the left colon. Apparently, a relative accumulation of oxidative DNA damage (as a consequence of sequential DSS–AOM treatment) due to incomplete DNA repair may escape the surveillance by TP53, a key gene regulating cell cycle, cell survival and involved in DNA damage sensing, thus giving rise to double-strand breaks and subsequent chromosomal instability. On the other hand, in human CRC Miladi-Abdennadher et al. [29] observed TP53 over-expression, which was significantly correlated with distal (left) tumor location. It was also demonstrated in recent review by Van Wezel et al. [30] that a loss of 17p (harboring TP53) in human CRC is associated with predominant distal location. Whereas, Perraud et al. [31] detected that TP53 protein expression decreased progressively with CRC stage, suggesting that this protein is important marker of advanced tumor stages. We did not find any aberrant methylation in promoter regions of any investigated tumor suppressor genes by using two independent methods, as recommended by Kristensen et al. [32]. The lack of aberrant methylation even in the tumor tissues represents an interesting observation, since gene silencing based on aberrant methylation of promoters in tumor suppressor genes is an important mechanism in carcinogenesis [19]. Nevertheless, the recent clinical studies in humans CRC patients indeed showed that only a small fraction of patients have a hypermethylation in any particular tumor suppressor genes; varying between 15 % for RASSF1A and around 29 % for p14 and p16 and 27 % for Apc genes [33]. However, the interaction between the 123 5928 Mol Biol Rep (2013) 40:5921–5929 epigenetic characteristics and inflammation in the tumor development must be further investigated. For instance, absence of hypermethylation in p16 and Mlh1 tumor suppressor genes was observed in association with colon cancer arising on the inflammatory background [34, 35]. The results of our pilot study imply different pathways leading to colon cancer in both bowel segments with preferential early Apc down-regulation in the distal colon and MMR deficient tumors in the proximal (right) colon, as described by [21]. Due to the lack of altered tumor suppressor gene expressions in purely chemical carcinogenesis (AOM treatment), further attention shall be dedicated to the interactions between the inflammatory and bacterial factors in the cell transformation process as it appears driving force of the carcinogenic processes. A lack of association between methylation in tumor suppressor genes (representing rather low-frequency events) and their corresponding expressions could be due to the current design of the study. Above aspect emerges therefore as a main limitation of the present pilot study. Acknowledgments The study was supported by grant GAAV IAA500200917, IRC MBU RVO 61388971 and for IEM, GA CR P304/ 11/P715, AVOZ50390703, AVOZ 50390512 and AV0Z50520701. Conflict of interest of interest. The authors declare that there are no conflicts References 1. Schnekenburger M, Diederich M (2012) Epigenetics offer new horizons for colorectal cancer prevention. Curr Colorectal Cancer Rep 8(1):66–81. doi:10.1007/s11888-011-0116-z116 2. Tang NP, Wu YM, Wang B, Ma J (2010) Systematic review and meta-analysis of the association between P53 codon 72 polymorphism and colorectal cancer. Eur J Surg Oncol 36(5):431–438. doi:10.1016/j.ejso.2010.03.010 3. Takayama T, Miyanishi K, Hayashi T, Sato Y, Niitsu Y (2006) Colorectal cancer: genetics of development and metastasis. J Gastroenterol 41(3):185–192. doi:10.1007/s00535-006-1801-6 4. Worthley DL, Whitehall VL, Spring KJ, Leggett BA (2007) Colorectal carcinogenesis: road maps to cancer. World J Gastroenterol 13(28):3784–3791 5. Birnbaum DJ, Laibe S, Ferrari A, Lagarde A, Fabre AJ, Monges G, Birnbaum D, Olschwang S (2012) Expression profiles in stage II colon cancer according to APC gene status. Transl Oncol 5(2):72–76 6. Borinstein SC, Conerly M, Dzieciatkowski S, Biswas S, Washington MK, Trobridge P, Henikoff S, Grady WM (2010) Aberrant DNA methylation occurs in colon neoplasms arising in the azoxymethane colon cancer model. Mol Carcinog 49(1):94–103. doi:10.1002/mc.20581 7. Rashid A, Shen L, Morris JS, Issa JP, Hamilton SR (2001) CpG island methylation in colorectal adenomas. Am J Pathol 159(3):1129–1135. doi:S0002-9440(10)61789-0 8. Lijinsky W, Saavedra JE, Reuber MD (1985) Organ-specific carcinogenesis in rats by methyl and ethylazoxyalkanes. Cancer Res 45(1):76–79 123 9. Itzkowitz SH, Yio X (2004) Inflammation and cancer IV. Colorectal cancer in inflammatory bowel disease: the role of inflammation. Am J Physiol Gastrointest Liver Physiol 287(1):G7–G17. doi:10.1152/ajpgi.00079.2004 10. Rosenberg DW, Giardina C, Tanaka T (2009) Mouse models for the study of colon carcinogenesis. Carcinogenesis 30(2):183–196. doi:10.1093/carcin/bgn267 11. Tanaka T, de Azevedo MB, Duran N, Alderete JB, Epifano F, Genovese S, Tanaka M, Curini M (2010) Colorectal cancer chemoprevention by 2 beta-cyclodextrin inclusion compounds of auraptene and 40 -geranyloxyferulic acid. Int J Cancer 126(4):830–840. doi:10.1002/ijc.24833 12. Vetuschi A, Latella G, Sferra R, Caprilli R, Gaudio E (2002) Increased proliferation and apoptosis of colonic epithelial cells in dextran sulfate sodium-induced colitis in rats. Dig Dis Sci 47(7):1447–1457 13. Lin Z, Hegarty JP, Cappel JA, Yu W, Chen X, Faber P, Wang Y, Kelly AA, Poritz LS, Peterson BZ, Schreiber S, Fan JB, Koltun WA (2011) Identification of disease-associated DNA methylation in intestinal tissues from patients with inflammatory bowel disease. Clin Genet 80(1):59–67. doi:10.1111/j.1399-0004.2010.01546.x 14. Macejova D, Brtko J (2001) Chemically induced carcinogenesis: a comparison of 1-methyl-1-nitrosourea, 7,12-dimethylbenzanthracene, diethylnitroso-amine and azoxymethan models (minireview). Endocr Regul 35(1):53–59 15. Vannucci L, Fiserova A, Horvath O, Rossmann P, Mosca F, Pospisil M (2004) Cancer evolution and immunity in a rat colorectal carcinogenesis model. Int J Oncol 25(4):973–981 16. Vannucci L, Stepankova R, Kozakova H, Fiserova A, Rossmann P, Tlaskalova-Hogenova H (2008) Colorectal carcinogenesis in germ-free and conventionally reared rats: different intestinal environments affect the systemic immunity. Int J Oncol 32(3):609–617 17. Petko Z, Ghiassi M, Shuber A, Gorham J, Smalley W, Washington MK, Schultenover S, Gautam S, Markowitz SD, Grady WM (2005) Aberrantly methylated CDKN2A, MGMT, and MLH1 in colon polyps and in fecal DNA from patients with colorectal polyps. Clin Cancer Res 11(3):1203–1209. doi:11/3/ 1203 18. Bustin SA (2010) Why the need for qPCR publication guidelines? The case for MIQE. Methods 50(4):217–226. doi:10.1016/j. ymeth.2009.12.006 19. Feinberg AP (2005) A genetic approach to cancer epigenetics. Cold Spring Harb Symp Quant Biol 70:335–341. doi:10.1101/ sqb.2005.70.027 20. Valentin MD, da Silva FC, dos Santos EM, Lisboa BG, de Oliveira LP, Ferreira Fde O, Gomy I, Nakagawa WT, Aguiar Junior S, Redal M, Vaccaro C, Valle AD, Sarroca C, Carraro DM, Rossi BM (2011) Characterization of germline mutations of MLH1 and MSH2 in unrelated south American suspected Lynch syndrome individuals. Fam Cancer 10(4):641–647. doi:10.1007/s10689011-9461-y 21. Albuquerque C, Baltazar C, Filipe B, Penha F, Pereira T, Smits R, Cravo M, Lage P, Fidalgo P, Claro I, Rodrigues P, Veiga I, Ramos JS, Fonseca I, Leitao CN, Fodde R (2010) Colorectal cancers show distinct mutation spectra in members of the canonical WNT signaling pathway according to their anatomical location and type of genetic instability. Genes Chromosomes Cancer 49(8):746–759. doi:10.1002/gcc.20786 22. Sun J (2010) Enteric bacteria and cancer stem cells. Cancers (Basel) 3(1):285–297. doi:10.3390/cancers3010285 23. Esteller M, Sparks A, Toyota M, Sanchez-Cespedes M, Capella G, Peinado MA, Gonzalez S, Tarafa G, Sidransky D, Meltzer SJ, Baylin SB, Herman JG (2000) Analysis of adenomatous polyposis coli promoter hypermethylation in human cancer. Cancer Res 60(16):4366–4371 Mol Biol Rep (2013) 40:5921–5929 24. Hosoya K, Yamashita S, Ando T, Nakajima T, Itoh F, Ushijima T (2009) Adenomatous polyposis coli 1A is likely to be methylated as a passenger in human gastric carcinogenesis. Cancer Lett 285(2):182–189. doi:10.1016/j.canlet.2009.05.016 25. Amos-Landgraf JM, Clipson L, Newton MA, Dove WF (2012) The many ways to open the gate to colon cancer. Cell Cycle 11(7):1261–1262. doi:10.4161/cc.19888 26. Markowitz SD, Bertagnolli MM (2009) Molecular origins of cancer: molecular basis of colorectal cancer. N Engl J Med 361(25):2449–2460. doi:10.1056/NEJMra0804588 27. Svrcek M, El-Bchiri J, Chalastanis A, Capel E, Dumont S, Buhard O, Oliveira C, Seruca R, Bossard C, Mosnier JF, Berger F, Leteurtre E, Lavergne-Slove A, Chenard MP, Hamelin R, Cosnes J, Beaugerie L, Tiret E, Duval A, Flejou JF (2007) Specific clinical and biological features characterize inflammatory bowel disease associated colorectal cancers showing microsatellite instability. J Clin Oncol 25(27):4231–4238. doi:10.1200/JCO. 2007.10.9744 28. Ullman TA, Itzkowitz SH (2011) Intestinal inflammation and cancer. Gastroenterology 140(6):1807–1816. doi:10.1053/j. gastro.2011.01.057 29. Miladi-Abdennadher I, Abdelmaksoud-Damak R, Ayadi L, Khabir A, Amouri A, Frikha F, Ellouz S, Frikha M, SellamiBoudawara T, Mokdad-Gargouri R (2011) Expression of p16INK4a, alone or combined with p53, is predictive of better prognosis in colorectal adenocarcinoma in Tunisian patients. Appl Immunohistochem Mol Morphol 19(6):562–568. doi:10. 1097/PAI.0b013e3182143380 5929 30. van Wezel T, Middeldorp A, Wijnen JT, Morreau H (2011) A review of the genetic background and tumour profiling in familial colorectal cancer. Mutagenesis 27(2):239–245. doi:10.1093/ mutage/ger071 31. Perraud A, Akil H, Nouaille M, Petit D, Labrousse F, Jauberteau MO, Mathonnet M (2011) Expression of p53 and DR5 in normal and malignant tissues of colorectal cancer: correlation with advanced stages. Oncol Rep 26(5):1091–1097. doi:10.3892/or. 2011.1404 32. Kristensen LS, Nielsen HM, Hansen LL (2009) Epigenetics and cancer treatment. Eur J Pharmacol 625(1–3):131–142. doi: 10.1016/j.ejphar.2009.10.011 33. Nilsson TK, Lof-Ohlin ZM, Sun XF (2013) DNA methylation of the p14ARF, RASSF1A and APC1A genes as an independent prognostic factor in colorectal cancer patients. Int J Oncol 42(1):127–133. doi:10.3892/ijo.2012.1682 34. Maia L, Dinis J, Cravo M, Claro I, Baltazar C, Fonseca I, Veloso T, Capelinha AF, Carneiro F, Nobre-Leitao C (2005) Who takes the lead in the development of ulcerative colitis-associated colorectal cancers: mutator, suppressor, or methylator pathway? Cancer Genet Cytogenet 162(1):68–73. doi:10.1016/j.cancergencyto. 2005.02.017 35. Sanchez JA, Dejulius KL, Bronner M, Church JM, Kalady MF (2011) Relative role of methylator and tumor suppressor pathways in ulcerative colitis-associated colon cancer. Inflamm Bowel Dis 17(9):1966–1970. doi:10.1002/ibd.21526 123