Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
JOURNAL OF THE AMERICAN COLLEGE OF CARDIOLOGY VOL. 66, NO. 10, 2015 ª 2015 BY THE AMERICAN COLLEGE OF CARDIOLOGY FOUNDATION ISSN 0735-1097/$36.00 PUBLISHED BY ELSEVIER INC. http://dx.doi.org/10.1016/j.jacc.2015.06.1329 The Classically Cardioprotective Agent Diazoxide Elicits Arrhythmias in Type 2 Diabetes Mellitus Chaoqin Xie, MD, Jun Hu, PHD, Lukas J. Motloch, MD, PHD, Basil S. Karam, BS, Fadi G. Akar, PHD ABSTRACT BACKGROUND Type 2 diabetes mellitus (T2DM) is associated with an enhanced propensity for ventricular tachyarrhythmias (VTs) under conditions of metabolic demand. Activation of mitochondrial adenosine triphosphatesensitive potassium (KATP) channels by low-dose diazoxide (DZX) improves hypoglycemia-related complications, metabolic function, and triglyceride and free fatty acid levels and reverses weight gain in T2DM. OBJECTIVES In this study, we hypothesized that DZX prevents ischemia-mediated arrhythmias in T2DM via its putative cardioprotective and antidiabetic property. METHODS Zucker obese diabetic fatty (ZO) rats (n ¼ 43) with T2DM were studied. Controls consisted of Zucker lean (ZL; n ¼ 13) and normal Sprague-Dawley (SprD; n ¼ 30) rats. High-resolution optical action potential mapping was performed before and during challenge with no-flow ischemia for 12 min. RESULTS Electrophysiological properties were relatively stable in T2DM hearts at baseline. In contrast, ischemia uncovered major differences between groups, because action potential duration (APD) in T2DM failed to undergo progressive adaptation to ischemic challenge. DZX promoted the incidence of arrhythmias, because all DZX-treated T2DM hearts exhibited ischemia-induced VTs that persisted on reperfusion. In contrast, untreated T2DM and controls did not exhibit VT during ischemia. Unlike DZX, pinacidil promoted ischemia-mediated arrhythmias in both control and T2DM hearts. Rapid and spatially heterogeneous shortening of APD preceded the onset of arrhythmias in T2DM. DZX-mediated proarrhythmia in T2DM was not related to changes in the messenger ribonucleic acid expression of Kir6.1, Kir6.2, SUR1A, SUR1B, SUR2A, SUR2B, or ROMK (renal outer medullary potassium channel). CONCLUSIONS Ischemia uncovers a paradoxical resistance of T2DM hearts to APD adaptation. DZX reverses this property, resulting in rapid and heterogeneous APD shortening. This promotes reentrant VT during ischemia. DZX should be avoided in diabetic patients at risk of ischemic events. (J Am Coll Cardiol 2015;66:1144–56) © 2015 by the American College of Cardiology Foundation. T ype 2 diabetes mellitus (T2DM) is a mul- Because T2DM affects multiple organ systems, its tifactorial disease process that encompasses pharmacological management is fraught with cardio- hyperglycemia, dyslipidemia, and hyper- vascular complications (3,4). One promising strategy insulinemia. Collectively, these factors produce a is the use of the potassium channel agonist diazoxide malignant environment marked by oxidative stress (DZX), which improves the metabolic function of (1). Although patients with T2DM are more vulnerable Otsuka Long-Evans Tokushima fatty rats by restoring to ischemic injury than nondiabetic people (2), the their triglyceride and free fatty acid levels and detailed electrophysiological substrate of T2DM reversing their weight gain and diabetes status (5). hearts and their response to ischemia are poorly The antidiabetic efficacy of DZX is linked to preser- defined. vation of pancreatic beta cells through promotion of From the Cardiac Bioelectricity Research Laboratory, Cardiovascular Institute, Icahn School of Medicine at Mount Sinai, New York, New York. The authors have reported that they have no relationships relevant to the contents of this paper to disclose. Drs. Xie and Hu contributed equally to this work. William Stevenson, MD, served as the Guest Editor for this paper. Listen to this manuscript’s audio summary by JACC Editor-in-Chief Dr. Valentin Fuster. Manuscript received June 26, 2014; revised manuscript received June 6, 2015, accepted June 23, 2015. JACC VOL. 66, NO. 10, 2015 Xie et al. SEPTEMBER 8, 2015:1144–56 Diazoxide-Mediated Arrhythmias in Diabetes 1145 beta cell rest and inhibition of apoptosis (5). These 12- to 16-week-old male Zucker obese diabetic ABBREVIATIONS mechanistic studies in animal models are being fatty (fa/fa) rats (ZO) (n ¼ 43) as a standard AND ACRONYMS rapidly translated to humans. In a proof-of-principle model of established insulin resistance and trial, DZX T2DM. This model faithfully recapitulates (4 mg/kg) exhibited a 30% decrease in glucose pro- hallmark features of the clinical disease, duction, with no difference in the rate of glucose including uptake compared with placebo-treated counterparts and healthy people who received oral hyperinsulinemia, hyperglycemia (21). APD = action potential duration APD75 = action potential dyslipidemia, Age- and duration at 75% of sex- repolarization (6). Moreover, DZX reversed weight gain in pre- matched Zucker lean (ZL) (n ¼ 13) and CV = conduction velocity diabetic obese, hyperinsulinemic people (7,8). The normal Sprague-Dawley (SprD) (n ¼ 30) rats DZX = diazoxide therapeutic utility of DZX was also tested in patients were also used. In a subset of experiments KATP channel = adenosine with type 1 diabetes mellitus (T1DM) (9) and in those involving 6 ZL and 7 SprD rats, we found no triphosphate-sensitive undergoing coronary bypass surgery (10). Radtke significant differences in electrophysiological et al. (9) reported that treatment of newly diagnosed parameters, including action potential dura- T1DM patients with DZX for 6 months improved their tion at 50%, 75% (APD75), and 90% of repo- glycemic control without affecting their beta cell larization function. Finally, in a double-blinded randomized Marked hyperglycemia and weight gain in the ribonucleic acid study, supplementation of cardioplegia with low- absence of hypertrophy were confirmed in PCL = pacing cycle length dose DZX protected cardiac mitochondria, meta- T2DM compared with control rats (Table 1). bolism, and function in patients undergoing cardiac OPTICAL ACTION POTENTIAL MAPPING OF reaction EX VIVO PERFUSED HEARTS. Hearts were ROMK = renal outer medullary bypass surgery (10). and conduction velocity potassium channel mKATP = mitochondrial adenosine triphosphatesensitive potassium (CV). mRNA = messenger PCR = polymerase chain potassium channel excised rapidly and Langendorff perfused SEE PAGE 1157 with These highly encouraging clinical findings likely stem from the activation of cardioprotective signaling Tyrode’s solution containing SprD = Sprague-Dawley 121.7 T1DM = type 1 diabetes mmol/l NaCl, 25.0 mmol/l NaHCO 3, 2.74 mellitus mmol/l MgSO 4 , 4.81 mmol/l KCl, 5.0 mmol/l T2DM = type 2 diabetes dextrose, and 2.5 mmol/l CaCl 2 (pH 7.40; 95% mellitus via mitochondrial adenosine triphosphate-sensitive O2 /5% CO 2). Atria were removed to avoid potassium (mKATP ) channels by DZX (11–19). Howev- competitive stimulation of the ventricles. tachyarrhythmia Perfusion pressure was maintained at 60 to ZL = Zucker lean (rat) er, at high concentrations (300 m mol/l), DZX was shown to promote arrhythmias in coronary-perfused 70 mm Hg by regulating coronary perfusion atria and ventricles from failing and nonfailing hu- flow. man hearts by activating sarcolemmal (as opposed to mitochondrial) KATP channels (20). VT = ventricular ZO = Zucker obese diabetic fatty (rat) Preparations were placed in a custom-built tissue bath and pressed gently against a glass imaging We hypothesized that owing to its dual nature as window by a stabilizing piston (22–26). Movement an antidiabetic and cardioprotective agent, low-dose was suppressed by perfusion with blebbistatin 10 (30 m mol/l) DZX may be particularly useful in suppressing ischemia-related arrhythmias in T2DM mmol/l for 10 to 15 min. To avoid surface cooling, preparations were immersed in the coronary effluent without altering basal electrophysiology. Contrary maintained at a physiological temperature by a heat to our original hypothesis, we uncovered a potent exchanger assembly (22). Cardiac rhythm was moni- proarrhythmic effect of DZX exclusively in T2DM tored continuously via silver electrodes connected to hearts during challenge with ischemia. Our findings an electrocardiogram amplifier. Cardiac rhythm, raise major concerns regarding the safety profile of perfusion mK ATP channel activation in T2DM patients at risk of continuously during each experiment. pressure, and flow were monitored ischemic injury. METHODS T A B L E 1 Average BW, HW, Ratio of BW to HW, and Blood Glucose Levels of T2DM and Control Animals EXPERIMENTAL RAT MODEL OF T2DM. All pro- T2DM Control 410 65 283 29 cedures involving animal handling were approved by BW (g) the Animal Care and Use Committee of the Icahn HW (g) 1.6 0.1 1.2 0.1 School of Medicine at Mount Sinai and adhered to the HW/BW, mg/g 3.9 0.3 4.3 0.2 Guide for the Care and Use of Laboratory Animals Glucose, mg/dl 408 119 128 14 published by the U.S. National Institutes of Health. Age, weeks 13–16 13–14 All animals were purchased from the Charles River Laboratory (Wilmington, Massachusetts). We used BW ¼ body weight; HW ¼ heart weight; T2DM ¼ type 2 diabetes mellitus. 1146 Xie et al. JACC VOL. 66, NO. 10, 2015 Diazoxide-Mediated Arrhythmias in Diabetes SEPTEMBER 8, 2015:1144–56 Optical action potentials were measured with an amplitude were quantified. Action potential duration 80 80-pixel charge-coupled device camera coupled (APD) was defined as the temporal difference be- to an imaging macroscope that contained a high tween the repolarization and activation times at each numerical aperture lens, a dichroic mirror, excita- site. tion and emission filters, a beam splitter, and a REAL-TIME light-collimating tube. Excitation light was provided MEASUREMENTS. Tissue specimens from SprD (n ¼ 3), POLYMERASE CHAIN REACTION by a low-noise, high-power tungsten-halogen lamp ZL (n ¼ 3), and ZO (n ¼ 3) hearts were used to measure and directed in an epifluorescence configuration onto messenger the heart through a side port of the macroscope in a levels of the alpha (Kir6.1, Kir6.2) and beta (SUR1A, manner that minimized heterogeneity of incident SUR1B, SUR2A, SUR2B) subunits that constitute light across the mapped 8 8 mm 2 region. Emitted light was collected by the front lens of the macroscope, filtered, and directed onto the charge-coupled ribonucleic acid (mRNA) expression the K ATP channel, as well as the 2 cardiac isoforms of the renal outer medullary potassium channel (ROMK1 and ROMK2). Total ribonucleic acid was device detector. High-resolution optical action po- extracted by acid guanidinium thiocyanate-phenol- tentials were measured simultaneously from 6,400 chloroform using TRIzol reagent (Life Technologies, sites during each recording. To improve signal qual- Carlsbad, California). One microgram of total ribo- ity, spatial binning was performed, which yielded an nucleic acid was reverse transcribed into first-strand array of 400 (20 20) high-fidelity optical action complementary deoxyribonucleic acid by use of a potentials that were amenable to accurate automated high-capacity complementary deoxyribonucleic acid analyses. reverse transcription kit with ribonuclease inhibitor. from control Real-time polymerase chain reactions (PCR) were (SprD, ZL) and T2DM (ZO) rats underwent steady- performed with the Applied Biosystems 7500 system state pacing at a wide range of pacing cycle lengths and Power SYBR Green PCR Master Mix (Applied (PCLs) (300 to 100 ms, in 20-ms decrements) during Biosystems, Waltham Massachusetts) in triplicate. baseline perfusion. Subsequently, hearts underwent High-resolution melting curves were generated to ischemia-reperfusion injury while being paced at a confirm the specificity of PCR products. Threshold EXPERIMENTAL PROTOCOL. Hearts PCL of 300 ms. We chose a 12-min global no-flow cycle (CT ) values were determined after rectification ischemia challenge because we found in a pilot by the passive reference dye Rox within the master study that this protocol gave rise to sustained post- mix. mRNA expression levels were evaluated by the ischemic arrhythmias within 1 min of reperfusion in 2 - DCT method. Levels of K ATP channel subunits were w50% of hearts. This rate of post-ischemic arrhyth- normalized to those of the internal control, beta- mias allows one to examine whether a given drug actin. decreases or increases the incidence of arrhythmias. STATISTICAL ANALYSES. Summary data are pre- Untreated hearts were perfused with normal Tyrode’s sented as mean SD. Welch’s unpaired t test was solution throughout the entire protocol, except for used to detect differences in blood glucose levels the 12-min ischemia phase. DZX-treated hearts were between T2DM and controls. The Student t test was initially perfused with normal Tyrode’s solution, fol- used to compare electrophysiological parameters be- lowed by Tyrode’s containing DZX 30 m mol/l. tween T2DM and control hearts. The paired t test was ELECTROPHYSIOLOGICAL MEASUREMENTS. C o n d u c t i o n used to compare groups before and after drug treat- v e l o c i t y . As detailed previously (23,24), conduction delays were assessed by recording action potentials during steady-state pacing. Local activation time at each site was defined as the maximum first derivative ment. One-way analysis of variance was used to compare differences between more than 2 groups. A Fisher exact test was used to compare differences in susceptibility to arrhythmias. Differences were during the upstroke of the action potential. Velocity considered significant at p < 0.05. vectors (magnitude and direction) were derived from RESULTS the activation times of each pixel relative to those of its neighbors. CV was measured by averaging the BASAL ELECTROPHYSIOLOGICAL PROPERTIES OF magnitude of the velocity vectors along the longitu- T2DM AND CONTROL ANIMALS. Figure 1 shows dinal and transverse axes. The anisotropic ratio was representative optical action potentials recorded defined as the ratio of fast (longitudinal) divided by from control (SprD, ZL) and T2DM (ZO) rats during slow (transverse) CV. steady-state pacing at a PCL of 300 ms. On average, A c t i o n p o t e n t i a l d u r a t i o n . Repolarization times at ZO rat hearts exhibited a trend toward prolonged 75% and 90% relative to the action potential (by 18.5%; p ¼ 0.052) APD 75 compared with controls JACC VOL. 66, NO. 10, 2015 Xie et al. SEPTEMBER 8, 2015:1144–56 Diazoxide-Mediated Arrhythmias in Diabetes F I G U R E 1 Baseline Electrophysiological Properties of T2DM and Control Hearts Control A SprD T2DM ZL Average APD75 100 (PCL=300ms) 200ms C APD Heterogeneity (PCL=300ms) 40 Control 20 50ms p = 0.052 0 n=6 n=6 Control T2DM 20 10 0 n=6 n=6 Control T2DM E SprD 2 SprD 4 Base Control SprD 3 CV (cm/sec) D SprD 1 ZO 2 ZO 3 ZO 4 T2DM ZO 1 p = 0.863 6 30 60 40 APD75 Std Dev 8 p = 0.632 (ms) T2DM (ms) 80 APD75 Range (ms) B ZO 4 2 0 150 n=6 n=6 Control T2DM Longitudinal 100 50 n=6 0 n=4 15 ms RV Anisotropic Ratio Apex 0 8mm n=6 n=4 Control T2DM Control T2DM 4 LV Transverse Depolarization Time (ms) Ratio 3 2 1 0 n=6 n=4 Control T2DM (A) Representative optical action potentials recorded during steady-state pacing of hearts from control rats (Sprague-Dawley [SprD] and Zucker lean [ZL]) and rats with type 2 diabetes mellitus (T2DM) (Zucker obese diabetic fatty [ZO]). (B) Average action potential duration measured at 75% of repolarization (APD75) at pacing cycle length (PCL) of 300 ms. Analysis is based on 6 ZL and 6 ZO rats. (C) Range and standard deviation (Std Dev) of APD75 values measured across the mapping field as independent indices of APD heterogeneity. (D) Representative isochrone maps illustrating the elliptical spread of the impulse across the epicardial surface. (E) Average longitudinal and transverse conduction velocities and the anisotropic ratio of control and T2DM hearts. CV ¼ conduction velocity; LV ¼ left ventricle; RV ¼ right ventricle. (Figure 1B). No significant differences (p ¼ 0.65) in or their ratio (p ¼ 0.13) between T2DM and control APD 75 were found between ZL (46.1 7.0 ms) and hearts (Figure 1E). Finally, programmed electrical SprD (47.9 3.0 ms) hearts. APD heterogeneity stimulation with single premature stimuli (S2) was indexed by the range and standard deviation of APD 75 performed in a subset of 4 ZO hearts. S2 coupling values over an 8 8 mm 2 region of each heart intervals were initially varied in 10-ms decrements, revealed no significant differences between T2DM followed by 2-ms increments to resolve local refrac- and controls for either metric (Figure 1C). toriness. No arrhythmias were observed when this Figure 1D shows representative isochrone maps protocol was used (not shown). depicting the elliptical spread of the action potential ELECTROPHYSIOLOGICAL RESPONSE OF T2DM HEARTS wave front across the epicardium in control and TO ISCHEMIA. Patients with T2DM are highly suscep- T2DM hearts. There were no significant differences in tible to ischemic injury. We therefore tested whether longitudinal CV (p ¼ 0.205), transverse CV (p ¼ 0.156), ischemia-mediated electrophysiological remodeling 1147 Xie et al. JACC VOL. 66, NO. 10, 2015 Diazoxide-Mediated Arrhythmias in Diabetes SEPTEMBER 8, 2015:1144–56 F I G U R E 2 Differential APD Response to Ischemia in Control Versus T2DM Hearts APD Response to Ischemia SprD T2DM ZL Control B SprD T2DM ZO ZL ZO 75 65 Baseline Ischemia (12 min) Base 55 35 25 200ms Control C T2DM LV D 120 7 min 90 APD90 (ms) 6 min 9 min 8mm RV Ischemia (12 min) Baseline 8 min 45 Apex Ischemia (12 min) APD75 (ms) Control Baseline A Ischemia 1148 50ms T2DM (n=4) 60 30 Control (n=9) 10 min 0 11 min 0 6 8 12 10 Time of Ischemia (min) 12 min 200ms (A) Representative action potential traces before and 12 min after ischemia in control hearts (purple) and hearts of rats with T2DM (red). (B) Representative APD75 contour maps measured before and after 12 min of ischemia from control and T2DM hearts. (C) Representative action potential traces recorded at baseline and during no-flow ischemia. (D) Average action potential duration measured at 90% of repolarization (APD90) in control and T2DM hearts showing sustained shortening in the former group (purple) and a biphasic response in the latter (red). Superimposed action potential traces from representative T2DM (red) and control (purple) hearts at 12 min of ischemia. Controls consisted of SprD (n ¼ 3) and ZL (n ¼ 6) animals; T2DM was ZO animals (n ¼ 4). APD ¼ action potential duration; other abbreviations as in Figure 1. was more severe in hearts from T2DM rats compared We next investigated potential differences in with control animals. Figures 2A and 2B show repre- ischemia-mediated sentative action potential traces and APD contour groups. Figure 3A shows isopotential contour maps conduction slowing between maps measured from control (SprD, ZL) and T2DM recorded at 1-ms intervals before (baseline) and 12 min (ZO) hearts before and 12 min after no-flow ischemia. after ischemia in control (SprD, ZL), and T2DM (ZO) As expected, no-flow ischemia resulted in significant hearts. Figure 3B shows representative action poten- APD shortening in hearts from control animals tial upstrokes (first derivatives) measured from equi- (Figures 2A to 2C). In sharp contrast, hearts from distant sites. Figure 3C presents average CV during T2DM animals did not undergo progressive APD baseline perfusion and after ischemic challenge. As adaptation in response to an identical ischemic expected, ischemia resulted in significant CV slowing challenge (Figures 2A to 2C). Instead, they exhibited a in all groups. Interestingly, a trend toward a greater biphasic response, because early APD shortening was percentage reduction of CV by ischemia was noted for fully reversed during the latter phase (9 to 12 min) of T2DM rats than for controls (Figure 3D); however, this ischemia (Figure 2D). trend did not reach statistical significance (p ¼ 0.243). JACC VOL. 66, NO. 10, 2015 Xie et al. SEPTEMBER 8, 2015:1144–56 Diazoxide-Mediated Arrhythmias in Diabetes F I G U R E 3 Conduction Slowing in Response to Ischemia in Control and T2DM Hearts Control A T2DM SprD ZO ZL baseline Ischemia baseline Ischemia baseline 0 0 Ischemia 0 48ms 48ms 48ms B SprD C P = 0.0019 80 ZO 20ms D % Change In CV P = 0.0004 P = 0.0002 60 0 40 20 20 n=3 n=3 n=6 n=6 n=4 n=4 Is (1 che 2 m m ia in ) Ba se lin e Is (1 che 2 m m ia in ) e m mia in ) Ba se lin e (1 2 ch Is Ba se lin e 0 % CV (cm/sec) ZL SprD ZL ZO n=3 n=6 n=4 40 60 P=0.243 80 (A) Representative series of isopotential contour maps recorded at 1-ms intervals indicate the sequential spread of depolarization before and after the ischemic challenge in SprD, ZL, and ZO hearts. Each frame is 8 8 mm2. (B) Representative action potential first derivatives recorded from equidistant sites across the mapping field. (C) Average CV measurements at baseline and after 12 min of ischemia in control and T2DM hearts. (D) Percentage change in CV after 12 min of ischemia relative to baseline in control and T2DM (ZO) hearts. Controls were SprD (n ¼ 3) and ZL (n ¼ 6) animals; T2DM was ZO animals (n ¼ 4). Abbreviations as in Figure 1. Finally, after the 12-min ischemia protocol, 4 of which discounts a role for nonischemic activation of 9 control and 3 of 5 T2DM hearts underwent sus- sarcolemmal KATP channels. tained arrhythmias within 1 min of reperfusion We next investigated potential differences in the (not shown). response of untreated and DZX-treated T2DM hearts DZX PARADOXICALLY PROMOTES ARRHYTHMIAS IN to ischemia. Although APD 75 of untreated T2DM T2DM. The main purpose of our study was to deter- hearts failed to shorten progressively in response to mine whether low-dose DZX, which improves meta- ischemia (Figure 4B), DZX treatment caused rapid and bolic in sustained APD shortening during the course of humans, would prevent arrhythmias in T2DM. We ischemia (Figure 4B). On average, APD 75 of DZX- therefore examined its effects on key electrophysio- treated T2DM hearts was shorter by 32.6% (p < 0.01) logical properties before and during challenge of after 6 min of ischemia compared with their un- T2DM hearts with ischemia. treated counterparts (Figure 4B). function in experimental models and Figure 4A shows the average APD75 rate relation- The heightened sensitivity of DZX-treated T2DM ships in untreated and DZX-treated T2DM hearts hearts to ischemia-induced APD shortening was likely during baseline perfusion. Clearly, DZX 30 m mol/l did significant, because all 7 DZX-treated but none of the not alter baseline APD values at any PCL (Figure 4A), 5 untreated T2DM hearts exhibited onset of sustained 1149 1150 Xie et al. JACC VOL. 66, NO. 10, 2015 Diazoxide-Mediated Arrhythmias in Diabetes SEPTEMBER 8, 2015:1144–56 F I G U R E 4 Proarrhythmic Effect of DZX in T2DM A C 80 Incidence of VT during ischemia T2DM (untreated, n=4) Control APD75 (ms) VT (+) T2DM (DZX, n=6) 60 40 20 0 160 200 240 280 T2DM 120 PCL (ms) 80 DZX Untreated DZX * * * * T2DM (untreated) 60 * 40 T2DM (DZX, n=6) 20 APD75 (ms) * APD before onset of VT or end of ischemia 80 T2DM (untreated, n=4) 60 APD75 (ms) Untreated D B VT (-) 40 T2DM (DZX) 20 0 0 0 6 8 10 12 0 Ischemia (min) 8 9 10 Ischemia (min) 11 12 (A) Treatment of hearts with 30 mmol/l diazoxide (DZX) did not alter baseline APD75 in T2DM hearts. (B) Average APD75 at PCL of 300 ms in untreated (red) and DZX-treated (blue) T2DM hearts during ischemia. (C) Summary of ventricular tachyarrhythmia (VT) propensity during ischemia in untreated and DZX-treated control and T2DM hearts. Only DZX-treated T2DM hearts exhibited VT during 12 min of no-flow ischemia. (D) APD75 at end of ischemia or before onset of VT in untreated (red) and DZX-treated (blue) T2DM hearts, respectively. Each asterisk indicates that the red dot is significantly different (greater) than the blue dot. APD ¼ action potential duration; other abbreviations as in Figure 1. ventricular tachyarrhythmia (VT) during the latter hearts. Whereas on average, DZX-treated T2DM hearts phase (10 to 12 min) of ischemia (Figure 4C). More- exhibited a minor trend toward longer APD75 values over, none of the 9 untreated or 7 DZX-treated control during ischemia than DZX-treated controls, differ- hearts exhibited VT during ischemia (Figure 4C). ences were not statistically significant (Figure 5A). In As such, DZX provoked VT exclusively in T2DM hearts contrast, APD heterogeneity, as indexed by the stan- during ischemia (Figure 4C). Figure 4D shows indi- dard deviation and range of APD75 values across the vidual measurements of APD 75, either before the mapping field, was more than 2-fold greater in DZX- onset of VT in DZX-treated T2DM hearts or at the end treated T2DM than in DZX-treated control hearts at of the 12-min ischemic challenge in untreated T2DM 8 and 10 min of ischemia (Figure 5A). Figure 5B shows hearts. In all cases, APD 75 of untreated T2DM hearts representative APD contour maps that illustrate the was longer after 12 min of ischemia than that of DZX- greater APD heterogeneity at 8 min of ischemia in treated T2DM hearts, which underwent a 26% to 56% DZX-treated T2DM than in control hearts. Figure 5C reduction before the onset of VT. shows representative histograms that illustrate the We investigated the potential mechanism underly- wider distribution of APD 75 values in individual DZX- ing the selective proarrhythmic effect of DZX on T2DM treated T2DM hearts than in their control counterparts. JACC VOL. 66, NO. 10, 2015 Xie et al. SEPTEMBER 8, 2015:1144–56 Diazoxide-Mediated Arrhythmias in Diabetes 1151 F I G U R E 5 APD Response to DZX Treatment in Control and T2DM Hearts Average APD APD Heterogeneity A DZX-treated DZX-treated P = 0.0039 Ischemia (10 min) 6 P = 0.0008 5 10 n=5 n=6 n=5 n=6 1 n=5 0 Co T2 nt ro l DM l ro Co T2 nt DM l ro nt Co T2 n=5 n=6 n=5 0 DM l ro nt Co DM T2 Co nt ro l 0 n=6 DM n=6 2 T2 n=5 3 l 20 20 4 ro 40 n=6 P = 0.0049 nt P = 0.087 APD Std. Dev. (ms) APD Range (ms) 30 P = 0.106 P = 0.045 Co 60 APD75 (ms) Ischemia (8 min) 40 DM 80 Ischemia (10 min) DZX-treated Ischemia (10 min) T2 Ischemia (8 min) Ischemia (8 min) DZX-treated C Ischemia (8 min) 40 25 30 35 40 APD75 (ms) 45 Count 45 0 20 50 0 20 10 25 30 35 40 APD75 (ms) 45 50 30 35 40 APD75 (ms) 45 50 APD75 30 Count 20 25 40 APD75 Count Count Count T2DM 30 35 40 APD75 (ms) 30 10 2 mm 25 40 30 20 10 0 20 50 APD75 30 20 20 10 40 20 30 Count Count Count 20 0 20 40 APD75 30 10 50 ms T2DM 40 APD75 30 Control Control 40 APD75 Count DZX-treated Ischemia (8 min) Count B 20 10 0 20 25 30 35 40 APD75 (ms) 45 50 0 20 25 30 35 40 APD75 (ms) 45 50 (A) Average APD75, APD75 range, and APD75 standard deviation at 8 min and 10 min of ischemia in DZX-treated control and T2DM hearts. (B) Representative APD75 contour maps from control and T2DM hearts at 8 min of ischemia. (C) Representative histograms showing the distribution of APD75 values across the mapping field in individual DZX-treated control and DZX-treated T2DM hearts at 8 min of ischemia. Controls were 3 ZL and 3 SprD rats; T2DM was 5 ZO rats. APD ¼ action potential duration; other abbreviations as in Figures 1 and 3. We next compared the electrophysiological ef- control and T2DM hearts (Figure 6B), whereas DZX fects of DZX with those of the classic SUR2A activator only pinacidil. Unlike DZX, which did not affect base- (Figure 5). Profound action potential shortening was exerted a proarrhythmic effect in T2DM line APD 75 in either group, pinacidil 100 m mol/l evident by 5 min of ischemia in pinacidil-treated caused significant APD75 shortening in T2DM hearts control and T2DM hearts (Figure 5C). (p ¼ 0.047) and a strong trend toward shorter levels in EXPRESSION controls (p ¼ 0.069) during baseline perfusion determine whether the proarrhythmic effect of DZX (Figure 6A). Pinacidil also promoted the rapid (within in T2DM hearts was related to altered expression of 6 to 7 min) onset of VT during ischemia in both KATP channels, we measured the mRNA expression OF KATP CHANNEL SUBUNITS. To Xie et al. JACC VOL. 66, NO. 10, 2015 Diazoxide-Mediated Arrhythmias in Diabetes SEPTEMBER 8, 2015:1144–56 F I G U R E 6 Effects of Pinacidil on Control and T2DM Hearts A DZX Control T2DM 60 APD75 (ms) APD75 (ms) 60 40 20 n=6 n=6 n=4 n=4 Baseline DZX Baseline DZX 20 Control VT (+) Untreated Pinacidil Untreated T2DM P = 0.069 P = 0.047 n=4 n=4 n=4 n=4 Baseline PIN Baseline PIN 0 C Incidence of VT during ischemia Control 40 0 B Pinacidil 80 80 T2DM 1152 Control T2DM VT (-) Baseline Pinacidil Ischemia 5 min Pinacidil 200ms (A) Average APD75 values for control (n ¼ 4) and T2DM (n ¼ 4) hearts before and after treatment with DZX (30 mmol/l) or pinacidil (100 mmol/l). (B) Summary of VT propensity during ischemia in untreated and pinacidil-treated control and T2DM hearts. Arrhythmogenesis during early ischemia was provoked by pinacidil treatment in both control and T2DM hearts. (C) Representative action potential traces revealing profound action potential shortening at 5 min of ischemia in pinacidil-treated control and T2DM hearts. PIN ¼ pinacidil; other abbreviations as in Figures 1 and 3. levels of all known KATP channel subunits using real- that are expressed in the heart. We found no sig- time PCR. Figure 7A shows the normalized (to beta- nificant differences in the expression levels of actin) mRNA expression of the alpha (Kir6.1 and either isoform between groups (Figure 7B). Primers Kir6.2) and beta (SUR1A, SUR1B, SUR2A, and SUR2B) used subunits of the KATP channel in SprD, ZL, and ZO Figure 7C. for mRNA measurements are shown in hearts. We found that samples from ZL and ZO animals exhibited a trend toward increased expres- DISCUSSION sion of most K ATP channel subunits compared with their SprD counterparts (Figure 7A); however, We this apparent up-regulation only reached statistical quences of ischemia in T2DM and tested whether low- significance in the case of SUR2B between ZO and dose DZX, a potent activator of cardioprotective SprD animals (Figure 7A). Importantly, there were no signaling (11–19), could improve electrical function in significant differences in the expression of any of that setting. Our major findings were as follows: these subunits between ZL and ZO hearts (Figure 7A). 1) during normoxic perfusion, T2DM hearts are stable, As such, none of the observed changes could explain exhibiting only minor electrophysiological changes; the proarrhythmic effect that was exclusive to ZO 2) in response to ischemia, T2DM hearts are charac- animals. terized by repolarization resistance, because their A recent study highlighted the potential impor- investigated the electrophysiological conse- average APD fails to exhibit progressive shortening; tance of ROMK (KCNJ1) in formation of the mK ATP 3) channel (27). We therefore measured the mRNA clusively in T2DM hearts by promoting rapid and DZX treatment levels of the 2 ROMK isoforms (ROMK1 and ROMK2) heterogeneous APD exacerbates shortening arrhythmias during ex- ischemia JACC VOL. 66, NO. 10, 2015 Xie et al. SEPTEMBER 8, 2015:1144–56 Diazoxide-Mediated Arrhythmias in Diabetes F I G U R E 7 K ATP Channel Subunit Expression in Control and T2DM Hearts B SprD (n=3) 4 ZL (n=3) ZO (n=3) 3 4 P < 0.05 mRNA Expression Level mRNA Expression Level A 2 1 3 2 1 0 0 Kir6.1 C Kir6.2 Sur1A Sur1B Sur2A ROMK1 Sur2B ROMK2 Gene name Forward primer (5’-3’) Reverse primer (5’-3’) beta-Actin Kir6.1 Kir6.2 SUR1A SUR1B SUR2A SUR2B ROMK1 ROMK2 CCTCTATGCCAACACAGTGCTGTCT AGCTGGCTGCTCTTCGCTATCA CAACGTCGCCCACAAGAACATC AGCATGCGTGGTACTCATC TGCCTCTCTCTTCCTCACA GGAGTGCGATACTGGTCCAAACCT CATAGCTCATCGGGTTCACACCATT AGTGAGCCAGCCAATCAGTGACA CCAAGGCACTGGGCACCTTTAGC GCTCAGGAGGAGCAATGATCTTGA CCCTCCAAACCCAATGGTCACT CCAGCTGCACAGGAAGGACATG GCTGAGAGCTCCCTGTGTAG GTTGGATCTCCATGTCTGC CCCGATGCAGAGAACGAGACACT GCATCGAGACACAGGTGCTGTTGT TGGACCCAGACTCAGACAAAGGC TGCCGGGAACGCCCAAATATGTG (A) Messenger RNA (mRNA) expression of Kir6.1, Kir6.2, SUR1A, SUR1B, SUR2A, and SUR2B measured by real-time polymerase chain reaction (RT-PCR) in SprD (n ¼ 3), ZL (n ¼ 3), and ZO (n ¼ 3) animals. (B) mRNA expression of ROMK1 and ROMK2 measured by RT-PCR in SprD (n ¼ 3), ZL (n ¼ 3), and ZO (n ¼ 3) animals. (C) Primers used for RT-PCR measurements. Beta-actin was used as a normalizing control. KATP ¼ adenosine triphosphate-sensitive potassium channel; other abbreviations as in Figure 1. (Central Illustration); and 4) changes in the mRNA speculated that acute ischemia might unmask the expression of KATP channel subunits do not cause electrophysiological vulnerability of these hearts. A these phenotypic differences. major finding of the present report was the failure of STABILITY ELECTROPHYSIOLOGICAL T2DM hearts to exhibit progressive APD adaptation PROPERTIES IN T2DM. Our initial objective was to (shortening) in response to 12 min of no-flow define the electrophysiological substrate of hearts ischemia. The mechanism underlying this repolari- from obese T2DM animals. We focused on conduction zation resistance will require additional investiga- slowing and APD prolongation as potentially impor- tion, tant features of pathological electrical remodeling. sarcolemmal K ATP channels, resulting from either Surprisingly, we found only modest changes in APD reduced expression or function of these channels. and CV in this established model of obesity and Interestingly, Ren et al. (29) found a marked reduc- T2DM. As such, our present findings discount a major tion in SUR2A mRNA expression in a model of T1DM. role for these basal electrophysiological properties in We measured the transcript levels of all known alpha OF BASAL although it suggests down-regulation of the proarrhythmic vulnerability of the diabetic heart. and beta subunits of K ATP channels, including Kir6.1, Our present findings are reminiscent of our previous Kir6.2, SUR1A, SUR1B, SUR2A, SUR2B, ROMK1, and findings in a guinea pig model of streptozotocin- ROMK2. An important advantage of our experimental induced T1DM, in which arrhythmias were only design was the use of 2 different control groups that encountered on depletion of the scavenging capacity were functionally identical but genetically distinct. of the heart (28). Specifically, ZL controls share a common genetic ALTERED APD ADAPTATION DURING ISCHEMIA: background with their ZO counterparts but are func- REPOLARIZATION RESISTANCE IN T2DM? Because tionally identical (in terms of electrophysiology, heart patients with T2DM are highly susceptible to the weight, body weight, and blood glucose levels) to complications age-matched SprD animals. By measuring changes in of coronary artery disease, we 1153 1154 Xie et al. JACC VOL. 66, NO. 10, 2015 Diazoxide-Mediated Arrhythmias in Diabetes SEPTEMBER 8, 2015:1144–56 C EN T RA L IL LUSTR AT I ON DZX-Mediated Arrhythmias in T2DM: Proarrhythmic Effect of DZX in Rats Xie, C. et al. J Am Coll Cardiol. 2015; 66(10):1144–56. The proarrhythmic effect of mitochondrial adenosine triphosphate-sensitive potassium (mKATP) channel activation by low-dose diazoxide (DZX) in hearts from rats with type 2 diabetes mellitus (T2DM) is illustrated. Electrophysiological properties were stable at baseline but revealed impaired adaptation to increased metabolic demand during acute ischemia in diabetic (red) compared with nondiabetic (blue) rats. The classically cardioprotective agent DZX caused paradoxical exacerbation of arrhythmias in diabetic but not normal animals, owing to a rapid and spatially heterogeneous shortening of action potentials across the heart, which in turn, created a substrate for reentrant ventricular tachyarrhythmia. APD ¼ action potential duration; APD75 ¼ action potential duration at 75% of repolarization. the mRNA expression of K ATP channel subunits in all 3 underlying impaired APD adaptation of T2DM hearts groups, we were able to determine whether a given to ischemia warrants investigation. change was functionally important. Surprisingly, we DZX FOR TREATMENT OF DIABETES MELLITUS. In a only found a significant change in the expression of recent clinical study, DZX suppressed endogenous SUR2B between ZO and SprD animals. Therefore, our glucose production (6). The presumed antidiabetic data indicate that the unique functional response of efficacy of DZX has been linked to preservation of T2DM hearts to ischemia is unrelated to the transcript pancreatic beta cells through promotion of beta cell levels of K ATP channel subunits. This suggests rest and inhibition of apoptosis. Indeed, pilot clinical involvement of post-transcriptional mechanisms that trials using DZX have demonstrated improvement of regulate protein synthesis, trafficking, insertion, sta- metabolic function in pre-diabetic obese, hyper- bility, or gating of these channels. Of note, AMP- insulinemic patients and in those with T1DM (7–9). activated protein kinase (AMPK) signaling has been Numerous experimental studies have established implicated in preconditioning-induced shortening of DZX as a potent cardioprotective agent that reduces the action potential through effects on K ATP channel reperfusion injury by promoting activation of bene- activity and recruitment (30). Moreover, drugs that ficial mitochondrial pathways (11–19). Indeed, a pilot activate AMPK signaling are a mainstay of treatment study demonstrated that supplementation of car- of T2DM patients (31). Impaired AMPK in T2DM may dioplegia with DZX improved the outcome of patients contribute Clearly, undergoing coronary bypass surgery (10); however, identification of the exact molecular mechanisms the infarct-sparing efficacy of DZX in diabetes is less to repolarization resistance. JACC VOL. 66, NO. 10, 2015 Xie et al. SEPTEMBER 8, 2015:1144–56 Diazoxide-Mediated Arrhythmias in Diabetes clear, because DZX failed to reduce infarct size after (Central Illustration). Specifically, a potent proar- 30 min of left anterior descending coronary artery rhythmic effect during ischemic challenge should occlusion in T2DM animals (32). This is consistent caution against the rapid translation of DZX-based with the notion that cardioprotective stimuli (such as therapies for the treatment of T2DM patients, who ischemic preconditioning), which likely depend on are indeed at high risk of coronary artery disease, mK ATP channels, are defective in diabetes (33). acute myocardial infarction, and silent myocardial Although the infarct-sparing effects of DZX have ischemia (4,34–36). been widely studied, there are no reports of its role in the modulation of electrophysiological properties of REPRINT REQUESTS AND CORRESPONDENCE: Dr. T2DM hearts. A major finding of the present report Fadi G. Akar, Cardiovascular Research Center, Icahn was that DZX elicited a potent proarrhythmic effect School of Medicine at Mount Sinai, One Gustave L. exclusively in the setting of diabetes, because all Levy Place, Box 1030, New York, New York 10029. DZX-treated T2DM hearts but none of the untreated E-mail: [email protected]. T2DM or control hearts exhibited sustained ischemiamediated VT. We used a widely accepted DZX concentration (30 mmol/l) that is relatively specific for the PERSPECTIVES mitochondrial pool of KATP channels (15–19). At this concentration, DZX did not alter basal electrophysi- COMPETENCY IN MEDICAL KNOWLEDGE: The mito- ological properties. The lack of effect of low-dose DZX chondrial KATP channel agonist DZX exerts salutary myocardial on baseline APD strongly discounts a role for nonse- protective effects against ischemic injury, produces vasodila- lective activation of sarcolemmal K ATP channels in the tion in hypertensive patients, and reverses hypoglycemic proarrhythmic effect that we uncovered. Unlike DZX, complications in patients with T2DM. However, in an animal the classic SUR2A-specific K ATP channel activator, model of T2DM with impaired electrophysiological adaptation pinacidil, provoked ischemia-mediated VT in all to acute ischemia, DZX elicited proarrhythmic effects because hearts (T2DM and control), consistent with previous of the rapid, heterogeneous shortening of the action potential findings in failing and nonfailing human heart prep- unrelated to transcript levels of ATP-sensitive potassium arations (20). Finally, the lack of arrhythmia protec- channels. tion by DZX in T2DM hearts on ischemic challenge is consistent with the lack of protection against TRANSLATIONAL OUTLOOK: Agents considered safe and myocardial infarction by ischemic preconditioning effective in structurally normal hearts might be associated with and DZX (33). proarrhythmic risks in the setting of diabetes mellitus. Strategies to mitigate the proarrhythmic effects of mitochondrial KATP CONCLUSIONS channel agonists should be investigated in patients with T2DM at Our current study raises important safety concerns risk of myocardial ischemia. regarding the use of DZX in diabetic patients REFERENCES 1. Candido R, Srivastava P, Cooper ME, Burrell LM. Diabetes mellitus: a cardiovascular disease. Curr Opin Investig Drugs 2003;4:1088–94. rats at prediabetic stage. J Diabetes Complications 2008;22:46–55. and autoimmunity but improves glycemic control. Diabetes Care 2010;33:589–94. 2. Ansley DM, Wang B. Oxidative stress and myocardial injury in the diabetic heart. J Pathol 6. Kishore P, Boucai L, Zhang K, et al. Activation of KATP channels suppresses glucose production in humans. J Clin Invest 2011;121: 10. Deja MA, Malinowski M, Golba KS, et al. Diazoxide protects myocardial mitochondria, metabolism, and function during cardiac sur- 2013;229:232–41. 4916–20. 3. Buse JB, Ginsberg HN, Bakris GL, et al. Primary 7. Schreuder T, Karreman M, Rennings A, Ruinemans- prevention of cardiovascular diseases in people with diabetes mellitus: a scientific statement from the American Heart Association and the American Diabetes Association. Circulation 2007;115:114–26. Koerts J, Jansen M, de Boer H. Diazoxide-mediated insulin suppression in obese men: a dose-response study. Diabetes Obes Metab 2005;7:239–45. gery: a double-blind randomized feasibility study of diazoxide-supplemented cardioplegia. J Thorac Cardiovasc Surg 2009;137:997–1004, 1004e1–2. 4. Grundy SM, Benjamin IJ, Burke GL, et al. Diabetes and cardiovascular disease: a statement for healthcare professionals from the American Heart Association [published correction appears in Circulation 2000;101:1629–1631]. Circulation 1999; 100:1134–46. 5. Guo Z, Bu S, Yu Y, et al. Diazoxide prevents abdominal adiposity and fatty liver in obese OLETF 8. van Boekel G, Loves S, van Sorge A, RuinemansKoerts J, Rijnders T, de Boer H. Weight loss in obese men by caloric restriction and high-dose diazoxide-mediated insulin suppression. Diabetes Obes Metab 2008;10:1195–203. 9. Radtke MA, Nermoen I, Kollind M, et al. Six months of diazoxide treatment at bedtime in newly diagnosed subjects with type 1 diabetes does not influence parameters of b-cell function 11. Seharaseyon J, Ohler A, Sasaki N, et al. Molecular composition of mitochondrial ATP-sensitive potassium channels probed by viral Kir gene transfer. J Mol Cell Cardiol 2000;32:1923–30. 12. Sato T, Marban E. The role of mitochondrial KATP channels in cardioprotection. Basic Res Cardiol 2000;95:285–9. 13. Sato T, Sasaki N, Seharaseyon J, O’Rourke B, Marbán E. Selective pharmacological agents implicate mitochondrial but not sarcolemmal KATP 1155 1156 Xie et al. JACC VOL. 66, NO. 10, 2015 Diazoxide-Mediated Arrhythmias in Diabetes SEPTEMBER 8, 2015:1144–56 channels in ischemic cardioprotection. Circulation 2000;101:2418–23. 14. Hu H, Sato T, Seharaseyon J, et al. Pharmacological and histochemical distinctions between molecularly defined sarcolemmal KATP channels and native cardiac mitochondrial KATP channels. Mol Pharmacol 1999;55:1000–5. 15. Carroll R, Gant VA, Yellon DM. Mitochondrial KATP channel opening protects a human atrialderived cell line by a mechanism involving free radical generation. Cardiovasc Res 2001;51: 691–700. 16. Costa AD, Jakob R, Costa CL, Andrukhiv K, West IC, Garlid KD. The mechanism by which the mitochondrial ATP-sensitive Kþ channel opening and H2O2 inhibit the mitochondrial permeability transition. J Biol Chem 2006;281:20801–8. 17. Facundo HT, de Paula JG, Kowaltowski AJ. Mitochondrial ATP-sensitive Kþ channels prevent oxidative stress, permeability transition and cell death. J Bioenerg Biomembr 2005;37:75–82. 18. Garlid KD, Paucek P, Yarov-Yarovoy V, et al. Cardioprotective effect of diazoxide and its interaction with mitochondrial ATP-sensitive Kþ channels: possible mechanism of cardioprotection. Circ Res 1997;81:1072–82. 19. Quinlan CL, Costa AD, Costa CL, Pierre SV, Dos 21. Sárközy M, Zvara A, Gyémánt N, et al. Metabolic syndrome influences cardiac gene expression pattern at the transcript level in male ZDF rats. Cardiovasc Diabetol 2013;12:16. 22. Akar FG, Aon MA, Tomaselli GF, O’Rourke B. The mitochondrial origin of postischemic arrhythmias. J Clin Invest 2005;115:3527–35. 23. Akar FG, Nass RD, Hahn S, et al. Dynamic changes in conduction velocity and gap junction properties during development of pacing-induced heart failure. Am J Physiol 2007;293:H1223–30. 24. Akar FG, Spragg DD, Tunin RS, Kass DA, Tomaselli GF. Mechanisms underlying conduction slowing and arrhythmogenesis in nonischemic dilated cardiomyopathy. Circ Res 2004;95:717–25. 25. Jin H, Chemaly ER, Lee A, et al. Mechanoelectrical remodeling and arrhythmias during progression of hypertrophy. FASEB J 2010;24: 451–63. 26. Xie C, Kauffman J, Akar FG. Functional crosstalk between the mitochondrial PTP and KATP channels determine arrhythmic vulnerability to oxidative stress. Front Physiol 2014;5:264. 27. Foster DB, Ho AS, Rucker J, et al. Mitochondrial ROMK channel is a molecular component of mitoKATP. Circ Res 2012;111:446–54. Santos P, Garlid KD. Conditioning the heart induces formation of signalosomes that interact with mitochondria to open mitoKATP channels. Am J Physiol Heart Circ Physiol 2008;295:H953–61. 28. Xie C, Biary N, Tocchetti CG, et al. Glutathione oxidation unmasks proarrhythmic vulnerability of 20. Fedorov VV, Glukhov AV, Ambrosi CM, et al. Effects of KATP channel openers diazoxide and pinacidil in coronary-perfused atria and ventricles from failing and non-failing human hearts. J Mol 29. Ren Y, Xu X, Wang X. Altered mRNA expression of ATP-sensitive and inward rectifier potassium channel subunits in streptozotocin-induced diabetic rat heart and aorta. J Pharmacol Sci 2003; Cell Cardiol 2011;51:215–25. 93:478–83. chronically hyperglycemic guinea pigs. Am J Physiol Heart Circ Physiol 2013;304:H916–26. 30. Sukhodub A, Jovanovic S, Du Q, et al. AMPactivated protein kinase mediates preconditioning in cardiomyocytes by regulating activity and trafficking of sarcolemmal ATP-sensitive Kþ channels. J Cell Physiol 2007;210:224–36. 31. Hardie DG. Role of AMP-activated protein kinase in the metabolic syndrome and in heart disease. FEBS Lett 2008;582:81–9. 32. Katakam PV, Jordan JE, Snipes JA, Tulbert CD, Miller AW, Busija DW. Myocardial preconditioning against ischemia-reperfusion injury is abolished in Zucker obese rats with insulin resistance. Am J Physiol Regul Integr Comp Physiol 2007;292: R920–6. 33. Kristiansen SB, Løfgren B, Støttrup NB, et al. Ischaemic preconditioning does not protect the heart in obese and lean animal models of type 2 diabetes. Diabetologia 2004;47:1716–21. 34. Jacoby RM, Nesto RW. Acute myocardial infarction in the diabetic patient: pathophysiology, clinical course and prognosis. J Am Coll Cardiol 1992;20:736–44. 35. Margolis JR, Kannel WS, Feinleib M, Dawber TR, McNamara PM. Clinical features of unrecognized myocardial infarction–silent and symptomatic: eighteen year follow-up: the Framingham study. Am J Cardiol 1973;32:1–7. 36. Scognamiglio R, Negut C, Ramondo A, Tiengo A, Avogaro A. Detection of coronary artery disease in asymptomatic patients with type 2 diabetes mellitus. J Am Coll Cardiol 2006;47:65–71. KEY WORDS action potentials, ischemia, mitochondria, obesity, repolarization, ventricular tachycardia