Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Molecular and Biochemical Parasitology, 61 (1993) 315-320 © 1993 Elsevier Science Publishers B.V. All rights reserved. / 0166-6851/93/$06.00 315 MOLBIO02040 Short C o m m u n i c a t i o n High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction Georges S n o u n o u *'a, Suganya ViriyakbOSOla'l , Xin Ping Z hu a, William Jarra a, Lucilia Pinheiro b, Virgilio E. do Rosario , Sodsri T h a i t h o n g and K. Neil B r o w n aDivision of Parasitology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK; blnstituto de Higiene e Medicina Tropical/Centro de Malaria e outras Doen~cas Tropicais, Lisbon, Portugal; and CWHO Collaborating Centre on the Biological Characterization of Malaria Parasites, Institute of Health Research and Faculty of Science, Chulalongkorn University, Bangkok, Thailand (Received 27 April 1993; accepted 8 July 1993) Key words: Plasmodium falciparum; Plasmodium vivax; Plasmodium malariae; Plasmodium ovale; Polymerase chain reaction; Diagnosis; Mixed infection; Epidemiology Accurate knowledge of the geographical and longitudinal distribution of the four Plasmodium species infecting man is of crucial importance, since they differ greatly with respect to their biology and clinical manifestations [1,2]. When parasite levels are very low and in the detection of mixed species infections, the information obtained by microscopy is restricted, and in some cases biased, by the inability to devote the necessary amount of time to the examination of blood smears. DNA based methods for the detection of parasites, mainly the clinically significant Plasmodium falciparum, have been developed in order to overcome these limitations [3,4]. We have previously described a PCR method for the sensitive detection of the four human malaria parasite species based on the sequence of their ~ponding author. Tel. 081-959 3666; Fax: 081-906 4477. i Present address: University of California San Diego, Infectious Diseases Section, Medical Services (11 IF), Veterans Administration Medical Center, 3350 La Jolla Village Drive, San Diego, CA 92161, USA. Abbreviations: PCR, polymerase chain reaction; ssrRNA, small subunit ribosomal RNA. small subunit ribosomal RNA (ssrRNA) genes [5]. In this article we report the attainment of higher sensitivity of detection of these four Plasmodium species, 10 parasite genomes, through the use of nested PCR amplification. We also present a simplified method for the preparation of the PCR amplification template from field blood samples. The amplification scheme employed as well as the sequence of the oligonucleotides used, which are all based on the ssrRNA genes [6-9], are presented in Fig. 1. Two genus-specific primers rPLU5 and rPLU6, are used for the first cycle of amplification. An aliquot of the product thus obtained is used for a second amplification cycle, in which each parasite species is detected separately using speciesspecific primers. Experimental details are given in the legend to Fig. 1. The presence of amplification product is detected by simple ethidium bromide staining following agarose gel electrophoresis. A specific PCR product is only obtained when DNA from the corresponding species is present in the reaction (Fig. 2A). No amplification is observed with human DNA alone. The size of the specific PCR product is different for each of the species: 205 316 First Amplification Reaction rPLU 6 4-- rPLU 5 ca 1200 bp 5' rPLU 6 I-rAAAA'rFG'I-I'GCAGTTAAAACG rPLU 5 CCTGTTGTTGCC'i-FAAAC'R'C S e c o n d Amplification Reactions ,,abw t Jl. 22211E22ZNE rFAL 1 TTAAACTGG ! I 1GGGAAAACCAAATATAI-r rVIV 1 CGCTTCTAGCTTAATCCACATAACTGATAC rFAL 2 rVIV 2 ACTTCCAAGCCGAAGCAAAGAAAGTCC'rI'A ACACAATGAACTCAATCATGACTACCCGTC rMAL 1 ATAACATAGTTGTACGTTAAGAATAACCGC rOVA 1 ATCTCl I I IGCTAI I I I I IAGTATTGGAGA rMAL 2 AAAATTCCCATGCATAAAAAATTATACAAA rOVA 2 GGAAAAGGACACA'I-rAA"CIGTATCCTAGTG Fig. 1. Schematic representation of Plasmodium ssrRNA genes and the nested PCR protocol used. The species-specific oligonucleotide primers were designed to hybridise to the genes coding for only one of the two ssrRNA types present in the Plasmodium genome [6-9]. rOVA2 was obtained from an upublished partial sequence of the ssrRNA gene (kindly provided by Dr A. Waters, Leiden University, The Netherlands). Synthesis of the oligonucleotides was performed on a 380B DNA Synthesizer (Applied Biosystems, Foster City, USA). All PCR reactions were carried out in a total volume of 20/A. In all cases amplification was performed in 2 mM MgCI2/50 mM KC1/10 mM Tris pH 8.3 (HC1)/0.1 mg ml n gelatin/125 #M of each of the four deoxyribonucleotide triphosphates/ 250 nM of each oligonucleotide primer/ 0.4 unit of AmpliTaq Polymerase (Perkin Elmer Cetus, USA). 1 #1 of the purified template D N A was used for the first reaction, in which the fragment spanned by rPLU5 and rPLU6 is amplified. A 1-#1 aliquot from the product of the first PCR reaction was then used as a template in each of the four separate reactions in which the species-specific primer pairs are employed. The PCR assays were performed using a heating block (PTC-100, MJ Research Inc., USA). The cycling parameters for the first amplification reaction were as follows. Step 1, 95°C for 5 min; step 2, annealing at 58°C for 2 min; step 3, extension at 72°C for 2 min; step 4, denaturation at 94°C for 1 rain; repeat steps 2-4 24 times, then step 2, and finally step 3 for 5 min. On termination of the amplification cycle, the temperature was reduced to 20°C. For the subsequent four species-specific amplification reactions, 30 cycles were performed as above. bp for P. falciparum, 120 bp for Plasmodium vivax, 144 bp for Plasmodium malariae and approx. 800 bp for Plasmodium ovale. A fragment of approx. 1.2 kb which is observed in all reactions corresponds to the product of the first amplification reaction. For P. ovale the level of non-specific amplification is relatively higher than that obtained for the other three species. It is, however, only observed in the presence of P. ovale DNA. Selection of the primers specific for P. ovale was restricted, since;only a partial sequence of this parasite's ssrRNA gene was known [9], the unpublished sequence of another portion of the gene was very kindly made available by Dr. Andy Waters of Leiden University (The Netherlands). A fainter band (Fig. 2) observed with all four species, of a slightly higher molecular weight than the specific product, is an artifact resulting from the presence of an excess of target D N A (Fig. 2C). In order to establish the minimum number of parasites that could be detected, samples with known numbers of P. falciparum parasites were employed. These were generated from a ten-fold serial dilution of highly synchronous, 317 Fig. 2. Specificity and sensitivity of the PCR detection assay. (A) Nested PCR amplification for the demonstration of the specificity of the primers employed. Control genomic DNA from P. falciparum (F), P. vivax (V), P. malariae (M), P. ovale (0) and human blood (H) were prepared as in [5]. Molecular size markers, a 100-bp ladder, flank the experimental lanes. (B) Nested PCR assay for the detection of in vitro cultured P. falciparum ring stage parasites. The numbers of parasites per aliquot assayed is given above each lane. (C) Nested PCR amplification using diluted control DNAs. (D) Product of amplification of diluted control DNAs, using the PCR assay previously described [5]. The control DNAs used in C and D are diluted as indicated between these two panels, the undiluted stocks for these DNAs have been used for the reactions presented in panel A. The species-specific oligonucleotide primer pairs used are given for each panel. Electrophoresis of product was perfomed in 3% (3:1) Nusieve agarose/Agarose gels [5]. ring stage, in vitro cultured parasites, using whole blood as diluent. Accurate erythrocyte counts, obtained by flow cytometry, and the exact parasitaemia in the sample, were used to calculate the number of parasites per #1 of the original culture aliquot. PCR template was prepared by the boiling method described later in this article. The result of the nested PCR detection of P. falciparum in these samples is presented in Fig. 2B. A specific amplification product was observed in all the samples in which the expected number of parasites was one or higher. A constant quantity of specific product was observed for samples containing decreasing numbers of parasites. Thus, nested PCR amplification results in an 'all or none' detection of parasites in a given sample. Blood samples from P. vivax, P. malariae or P. ovale infected patients were not available. However, the approximate parasite levels present in the infected chimpanzee blood samples from which control DNA was purified [5], were known. The pattern of amplification (Fig. 2C) obtained for the dilution series of these DNAs (including a series from P. falciparum purified DNA), was observed to be comparable to that obtained with the defined P. falciparum samples. A similar sharp cut-off in the generation of the specific PCR products, indicating a similar 'all or none' detection of the three species, at levels corresponding to between 50 and 0.1 parasites per sample, was 318 also observed. Since the number of parasite genomes present in each sample cannot be accurately determined, we conservatively conclude that the presence of ten parasites can be detected by the nested PCR method presented here. Using the same diluted DNA templates, we observe an increased sensitivity of detection by nested PCR (10-fold for P. vivax and P. malariae, 100-fold for P. ovale), as compared to that obtained by the previously published PCR assay (Fig. 2, Panel D). In contrast to the nested PCR protocol, the intensity of the amplified fragment obtained by the original method decreases as the parasite numbers in the samples diminish. As a result of the very high sensitivity as well as the 'all or none' effect of the nested PCR assay, irreproducibility in parasite detection was observed when aliquots from samples with very low numbers of parasites (an average of 1 parasite #1-1 or lower) were analyzed. Successful amplification is only achieved when the aliquot contains parasite D N A harbouring the targeted ssrRNA gene. Detection of a particular parasite species was also obtained from samples in which a minimum amount of DNA from this species was mixed with a large excess of D N A from the three other species as well as human DNA (data not shown). Attempts to include all the species-specific primers in one reaction (duplex PCR) resulted in the failure to detect the expected specific amplification products from samples harbouring DNA from the four malaria species. Preparation of template DNA by phenol extraction and ethanol precipitation [5] might be considered unsuitable because of the hazardous nature of the reagents and the cost in time and materials it necessitates. A simplified method for the preparation of PCR template which lacks these disadvantages has been described [10]. Modifications to this method, in which the parasites are boiled to release the DNA, were introduced, and duplicate samples from 25 of the blood samples obtained from patients attending the Malaria Clinic at Borai, a village in Chantaburi province, Thailand [5], were used to assess the new procedure. For the boiling method TABLE I Detection of parasites from blood samples collected in the Malaria Clinic at Borai (Thailand) Sample N ° TD TD TD TD TD TD TD TD TD TD TD TD TD TD TD TD TD TD TD TD TD TD TD TD TD 271 272 273 274 275 276 277 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 Single PCR a Nested PCR Phenol/ ethanol b purification Phenol/ ethanol b purification Boilingc F FM V F F F FVMO V FV FVO FV F FVMO V F O F F - FV F F F F FV F F F F F V F FV F FV - - - F F F F F F M F F F F F F FM M F = P. f a l c i p a r u m , V = P. v i v a x , M = P. m a l a r i a e and O = P. ovale. aAliquots of these DNA samples had been analyzed by the previously described PCR assay [5]. bThe results obtained in these two columns were derived using the DNA templates prepared by phenol extraction/ ethanol precipitation from whole blood kept cold following collection [5]. ~At the end of the 48 hour period of storage of the blood samples at room temperature, saponin was added to a final concentration of 0.05%. The parasites released from the lysed erythrocytes were collected by centrifugation (6000 x g for 5 rain. at room temperature). The supernate was discarded and the parasite and leucocyte pellet resuspended in 25/tl PCR buffer with MgC12 omitted. The mixture was overlaid with mineral oil and subjected to 99°C for 10 min. The nested PCR assay described above was then performed with a 5 #1 aliquot of the boiled solution, and in a parallel reaction with an equivalent quantity of D N A purified by phenol extraction/ethanol precipitation from blood simultaneously collected from the same patients. described here (see Table I), a 25 #1 aliquot from each whole blood sample (approx. 1 ml) collected from 25 patients, was taken and thoroughly mixed with 1 ml of culture medium 319 with no added serum and in the presence of heparin, immediately following vene puncture. Many villages in endemic areas are only accessible on foot, thus storage of the collected samples at low temperatures is often impractical. Also, return to the laboratory on the day of blood collection is often not possible. In order to reproduce these circumstances, these 25 samples were left, following collection, for 48 h at room temperature, which was 25-35°C, before processing by the boiling method (Table I). The tube contents were mixed by inversion 6 times during the storage period. The remainder of the samples taken from the same 25 patients were processed as previously described [5]. Briefly, the samples were kept at 4°C immediately after collection, and stored at - 7 0 ° C upon return to the laboratory on the same day. DNA from these samples was prepared by phenol exctraction and ethanol precipitation. The results from the analysis of the two sets of samples are presented in Table I. Thus, the results presented in the first two columns are derived from DNA samples prepared as in [5], and therefore provide a comparison between the efficiency of detection using the nested PCR method with that of the single PCR assay. The results of the last column were obtained by nested PCR analysis of the DNA template obtained by the boiling method. Parasites were detected in 15 samples, with one case of mixed infection (P. malariae with P. falciparum), when phenol/ethanol purified template was analysed by the single PCR assay (first column). Using nested PCR amplification with the same DNA templates, 17 samples were found to be positive for Plasmodium, mixed species infections were brought to light in eight patients, with a triple species infection in one case and all four species present in another (second column). When nested PCR amplification was performed on the templates obtained by the boiling method, 17 Plasmodium positive samples were also obtained (third column). However, in this instance a mixed infection was only observed in two cases. Failure to detect P. falciparum was observed in three cases and P. vivax in 5 cases. In one case P. falciparum had not been detected when the phenol/ethanol purified DNA was used as a template. Since very low parasite numbers were detected following boiling (Fig. 2B), it is unlikely that failure to amplify the parasite DNA from the field samples is a consequence of template preparation by the boiling method. It is probably due to the storage of the blood at room temperature before processing. In all cases, the species that was not detected following the 48 h storage was present in low numbers, since it had not been detected by the previously performed single PCR procedure. The loss of sensitivity might be explained by the fact that P. vivax cannot be maintained in continuous culture, and some lines of P. falciparum do not grow in vitro. It is thus felt that the parasites originally present in the collected blood were lost during the storage period before template preparation. However, in the one case (TD 281, Table I) where P. falciparum was only detected following storage, it is conceivable that maturation of the parasites throughout the 48-h period at close to physiological temperature, could have resulted in an increase of the parasites' DNA content to the detection threshold. Maturation of the parasite to the late trophozoite stages, when DNA is replicated in preparation for merozoite formation, might result in improved sensitivity. Therefore, although it is advisable to process the samples as quickly as possible following collection, storage at room temperature for 12-24 h before DNA template preparation, or cold storage, should not result in an appreciable loss of sensitivity. The results obtained by PCR were mostly confirmed by careful and, for some samples, lengthy microscopic examination of blood smears obtained at the time of collection. In two cases TD 273 and TD 276, the nested PCR diagnosis of P. vivax and P. ovale could not be confirmed by microscopy, nor could the PCR detection of P. falciparum and P. vivax be similarly demonstrated in TD 282 blood smears. It is felt that this aconsequence of the very sensitivity of the nested PCR assay, in which approx. 200-fold more blood cells are examined for the presence of parasites than by conventional microscopy. 320 No evidence of cross-contamination was observed in any of the reactions, which were repeated more than twice and with the sample order altered at each duplication. The efficiency of detection of low parasitaemias can be further improved by the screening of a larger volume of blood in each reaction. In a separate experiment, PCR templates were obtained from field samples by boiling as described above. These templates were then left at room temperature for 6 days before use in the nested PCR assay, without any deleterious effect on the sensitivity of parasite detection (data not shown). In conclusion we show that the use of nested primers allows the detection and identification of very low numbers of the four human malaria parasites, without the requirement for further blotting and hybridisation of the PCR amplification product. The addition of a PCR amplification step, is justified because of the resulting high sensitivity of detection. Thus, by comparison to the original report [5], it was found that a greater incidence of the parasites species, and in particular their presence in mixed infections, might characterise the malaria epidemiological situation at the Thai - Cambodian border region. The use of the boiling method for template preparation should allow consideration of this technique for use in a wider variety of epidemiological and clinical investigations. The use of centrifuges not requiring mains electricity might allow sample processing to be started under adverse field conditions. A re-evaluation of the epidemiological data and the methods of detection employed is clearly indicated in the light of these results. Acknowledgements This work was funded by a grant from the Commission of European Communities, ECAsean Scientific and Technical Cooperation, Contract number Cl*0634/UK/SMA. We thank the Malaria Division, Ministry of Health (Bangkok, Thailand) for their cooperation. We are grateful for the hospitality and generous collaboration of the staff of Malaria Region 5 and the Malaria Clinic in Borai, (Trad Province, Thailand), especially Mr. Chartchai Palanant and Mr. Dokrak Thongkong. We are also indebted to the members of staff at the WHO Collaborating Centre for the Biological Characterization of Malaria Parasites, Chulalongkorn University (Bangkok, Thailand) for all their help, and in particular to Miss Napaporn Siripoon for the consistently excellent technical assistance she has provided. L.P. and V.E. do R. were supported by The Gulbenkian Foundation, JNICT/ Ci~ncia and INIC (Portugal). References 1 Brumpt, E. (1949) The human parasites of the genus Plasmodium. In: Malariology, a comprehensive survey of all aspects of this group of diseases from a global standpoint. (Boyd, M.F., ed), pp. 65 121. W.B. Saunders, Philadelphia and London. 2 Garnham, P.C.C. (1966) Malaria parasites and other Haemosporidia. Blackwell, Oxford. 3 Tirasophon, W., Ponglikitmongkol, M., Wilairat, P., Boonsaeng, V. and Panyim, S. (1991) A novel detection of a single Plasmodium falciparum in infected blood. Biochem. Biophys. Res. Commun. 175, 179 184. 4 Barker, R.H.Jr., Banchongaksorn, T., Courval, J.M., Suwonkerd, W., Rimwungtragoon, K. and Wirth D.F. (1992) A simple method to detect Plasmodiumfalciparum directly from blood samples using the polymerase chain reaction. Am. J. Trop. Med. Hyg. 46, 416426. 5 Snounou, G., Viriyakosol, S., Jarra, W., Thaithong, S. and Brown, K.N. (1993) Identification of the four human malaria parasite species in field samples by the Polymerase Chain Reaction and detection of a high prevalence of mixed infections. Mol. Biochem. Parasitol. 58, 283 292. 6 McCutchan, T.F., de la Cruz, V.F., Lal, A.A., Gunderson, J.H., Elwood, H.J. and Sogin, M.L. (1988) Primary sequences of two small subunit ribosomal RNA genes from Plasmodium jalciparum. Mol. Biochem. Parasitol. 28, 63 68. 7 Waters, A.O. and McCutchan, T.F. (1989) Partial sequence of the asexually expressed SU rRNA gene of Plasmodium vivax. Nucleic Acids Res. 17, 2135. 8 Goman, M., Mons, B. and Scaife, J. (1991) The complete sequence of a Plasmodium malariae SSUrRNA gene and its comparison to other plasmodial SSUrRNA genes. Mol. Biochem. Parasitol. 45, 281 288. 9 Waters, A.P. and McCutchan T.F. (1989) Rapid, sensitive diagnosis of malaria based on ribosomal RNA. Lancet i, 1343 1346. 10 Foley, M., Ranford-Cartwright, L.C. and Babiker, H.A. (1992) Rapid and simple method for isolating malaria DNA from fingerprick samples of blood. Mol. Biochem. Parasitol. 53, 241 244.