Download Positive and Negative Cis-Acting Elements Are

From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
Positive and Negative Cis-Acting Elements Are Required for Hematopoietic
Expression of Zebrafish GATA-1
By Anming Meng, Hong Tang, Baozheng Yuan, Bruce A. Ong, Qiaoming Long, and Shuo Lin
GATA-1 is a transcription factor required for development of
erythroid cells. The expression of GATA-1 is tightly restricted
to the hematopoietic lineage. Using transgene constructs
containing zebrafish GATA-1 genomic sequences and the
green fluorescent protein (GFP) reporter gene, we previously
showed that a 5.6-kb enhancer/promoter fragment is sufficient to direct erythroid-specific expression of the GFP. In
this study, we used enhancer/promoter fragments containing various deletion and point mutations to further characterize the cis-acting elements controlling tissue-specific GATA-1
expression. We report here the identification of distinct
cis-acting elements that cooperate to confer on GATA-1 its
hematopoietic expression pattern. A CACCC box, located
142 bp upstream of the translation start codon, is critical for
the initiation of GATA-1 expression. A distal double GATA
element is required for maintaining and enhancing the
hematopoietic expression of GATA-1. The erythroid-specific
activity of the GATA-1 promoter is also enhanced by a 49-bp
sequence element located 218 bp upstream of the CACCC
element and a CCAAT box adjacent to the double GATA
motif. Finally, the hematopoietic specificity of the GATA-1
promoter is secured by a negative cis-acting element that
inhibits expression in the notochord.
r 1999 by The American Society of Hematology.
E
of a GATA-1 promoter can be expressed in a mouse lacking the
GATA-1 gene,13 suggesting that other GATA factors may be
involved in the regulation of GATA-1 expression.
GATA-1 was identified through the isolation of factors that
bound to a DNA sequence motif containing the core element
WGATAR that is common to virtually all promoters of genes
that are expressed specifically in erythroid cells.2,14 Similarly,
the identification of cis-acting sequence elements required for
tissue-specific expression of GATA-1 may lead to the isolation
of upstream factors that regulate GATA-1 expression. The
zebrafish model has several advantages for in vivo identification
of cis-acting elements required for enhancer/promoter activities. By microinjecting DNA constructs containing tissuespecific promoters ligated to the green fluorescent protein
(GFP) reporter gene, one can continuously observe the dynamic
expression patterns of GFP in living transparent embryos.15
Because hundreds of embryos can be microinjected within a
single day, the transient expression of multiple constructs can be
analyzed in a short amount of time. In addition, germline
transgenic fish can be obtained from the microinjected embryos
and used for further examination of stable expression patterns.
Using this approach, we previously showed that a 5.6-kb
enhancer/promoter fragment of GATA-1 is sufficient to direct
erythroid-specific expression of the GFP in both transient and
stable germline transgenic zebrafish.16 In this study, we further
define the individual cis-acting elements required for hematopoietic expression of the GATA-1 gene. Our results show that, in
conjunction with the positive cis-elements, a negative ciselement is used to repress nonspecific expression of the
GATA-1 gene, thereby confining expression to hematopoietic
cells.
XPRESSION OF THE transcription factor GATA-1 is
restricted to hematopoietic cells, including erythroid
progenitors, erythrocytes, megakaryocytes, mast cells, and
eosinophils.1-3 Mouse embryonic stem cells with a disrupted
GATA-1 gene fail to give rise to mature red blood cells,4
indicating that GATA-1 is an essential regulator of the specification of progenitor cells to an erythroid fate. Differentiation
assays in vitro have shown that murine GATA-1- embryonic
stem cells could differentiate into erythroid precursors, but
undergo cell-cycle arrest and death at the proerythroblast
stage.5,6 This suggests that GATA-1’s function is to prevent
apoptosis of erythroid precursors.7 Selective loss of GATA-1
expression in megakaryocytes of mutant mice resulted in a
reduction in the number of platelets and produced hyperproliferation of megakaryocytes, indicating a role for GATA-1 in
regulating these cell types.8
Given the importance of GATA-1 in specifying the erythroid
lineage, defining the mechanisms underlying its tissue-specific
expression has been a central issue in the blood field. Analyses
of GATA-1 promoter activity in vitro have shown that GATA
motifs are required for high levels of GATA-1 expression in
erythroid cell lines.9-12 These data suggest that GATA-1 expression is maintained by an autoregulatory mechanism during
erythroid cell development. However, these analyses fail to
account for the molecular mechanisms that control the initial
expression of GATA-1. In addition, recent experiments have
shown that expression of a lacZ reporter gene under the control
From the Institute of Molecular Medicine and Genetics & Department of Biochemistry and Molecular Biology, Medical College of
Georgia, Augusta, GA.
Submitted August 4, 1998; accepted September 16, 1998.
Supported by grants from the American Heart Association of Georgia
and the National Institutes of Health (to S.L.). S.L. is a recipient of the
American Society of Hematology Scholar Award.
Address reprint requests to Shuo Lin, PhD, Institute of Molecular
Medicine, Medical College of Georgia, Augusta, GA 30912; e-mail:
[email protected].
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734 solely to indicate
this fact.
r 1999 by The American Society of Hematology.
0006-4971/99/9302-0009$3.00/0
500
MATERIALS AND METHODS
Generation of constructs. Plasmid G1-GM2, which contains 5,552
bp of 58 flanking sequence of the zebrafish GATA-1 gene linked to
GM2, a modified GFP,16 was used as our basal construct. For mapping
the distal control region, constructs 4967GM2, 4847GM2, 4776GM2,
4742GM2, 4683GM2, 4648GM2, 4623GM2, 4271GM2, 3590GM2,
and 2564GM2 were generated by polymerase chain reaction (PCR)
using SP6 primer specific for vector sequences in combination with
specific primers P4967, P4847, P4776, P4742, P4683, P4648, P4623,
P4271, P3590, and P2564, respectively. The numbers included in the
primer names refer to the positions of their first 58 base in the GATA-1
genomic sequence; position 11 denotes the translation start codon.
Each specific primer consists of 22 to 30 nucleotides. Constructs
Blood, Vol 93, No 2 (January 15), 1999: pp 500-508
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
Cis-ACTING ELEMENTS IN ZEBRAFISH GATA-1 LOCUS
4648m1GM2, 4648m2GM2, and 4648m3GM2 were generated by PCR
using mutant primers P4648m1 (58-ACTCCAATCTAGCCAGCTTCTTATCA-38), P4648m2 (58-ACTCCAATCTAGATAGCTTCTTCCCA38), and P4648m3 (58-ACTCGCCTCTAGATAGCTTCTTATCA-38),
respectively. Each mutant primer contains 2 to 3 altered bases (underlined). G1-GM2 was used as template in the above PCR reactions. PCR
reactions were performed using the Expand High Fidelity PCR System
(Boehringer Mannheim, Indianapolis, IN) for 25 cycles (94°C, 30
seconds; 55 to 65°C, 30 seconds; 68°C, 2 to 5 minutes). These PCR
products were gel-purified and used directly for microinjections without
subcloning.
To generate construct G1m-GM2, three DNA fragments (A-C)
derived from construct G1-GM2 were ligated together. Fragment A,
containing the distal region immediately upstream from the double
GATA motif (see Results), was amplified by PCR using a T7 primer and
the specific primer (58-TGGGGTACCTAGATTGGAGTGGGAGGTTGGG-38) and was digested with SalI/KpnI. Fragment B, containing
the proximal region immediately downstream from the double GATA
motif, was amplified by PCR using an SP6 primer and the specific
primer (58-TGGGGTACCACAGTTCAGCAGCAGCGCACA-38) and
was digested with KpnI/BamHI. Fragment C was produced by deleting
the 5.6-kb promoter region from G1-GM2 by digesting with SalI/
BamHI. For microinjections, construct G1m-GM2 was linearized with
XhoI.
In XeX-GM2, the GM2 gene was driven by a 450-bp Xenopus
elongation factor (EF) 1a enhancer/promoter sequence.17 The 150-bp
enhancer was removed by XhoI/SphI digestion to generate Xs-GM2. To
generate construct G1DE-Xs-GM2, a 2,589-bp XhoI/ClaI (blunt-ended)
fragment (from -2968 to -5552) containing the distal positive control
region of the zebrafish GATA-1 promoter was ligated to Xs-GM2.
Before microinjection, this construct was linearized with XhoI. Linearized Xs-GM2 was used as control for microinjection.
To identify proximal regulatory elements, a series of deletion
constructs with varying sizes of the middle region of the zebrafish
GATA-1 promoter was generated by PCR using G1-GM2 as template.
These constructs are DE139, DE168, DE191, DE259, DE367, DE421,
DE468, DE501, DE613, DE764, and DE1776, in which DE represents
the -5552/-4256 distal positive control region and the numbers represent
the length of the remaining proximal region (upstream from the
translation start codon). A pair of primers, RP and Pn, were used to
generate each construct. Primer RP (58-ATGAATTCCATTGAGCGTACTGTAATAT-38) is complementary to the sense strand, contains an
EcoRI site (underlined), and was used in all of the PCR reactions. The
Pn primers are complementary to the antisense strand and each one was
used in a specific PCR reaction. The PCR products were treated with 10
U Klenow fragment of DNA polymerase at 37°C for 1 hour, purified by
electrophoresis, allowed to self-ligate, and used to transform bacterial
cells. The same strategy was used to generate constructs DE168m1,
DE168m2, and DE168m3, in which primers containing base replacements were used in the PCR reactions. The three corresponding mutant
primers are P168m1 (58-CCAACCCCAAGTACCCCAACCCCACCCAT-38), P168m2 (58-CCAAAAAAAAGTACCCTTTCCCCACCCAT-38), and P168m3 (58-CCAAAAAAAAGTACCCCAACCCTTTCCAT-38) (modified bases are underlined). The promoter/GFP
inserts of these constructs were amplified using primers P4967 and SP6
to remove the vector sequence and a 585-bp unnecessary 58 distal
region of the promoter. The PCR products were purified and directly
used for microinjection unless otherwise stated. These PCR reactions
were performed using the Expand High Fidelity PCR System (Boehringer Mannheim) for 25 cycles (94°C, 30 seconds; 62°C, 30 seconds;
68°C, 3 minutes).
Microinjection of zebrafish embryos. For microinjections, the digested DNA or PCR fragments were purified using GENECLEAN III
Kit (Bio 101 Inc, Vista, CA), and resuspended in 5 mmol/L Tris, 0.5
mmol/L EDTA, 0.1 mol/L KCl at a final concentration of 50 µg/mL.
501
Approximately 0.125% tetramethyl-rhodamine dextran was included in
the DNA preparation as a microinjection control. Fertilized eggs from
wild-type zebrafish were dechorionated by pronase treatment and
microinjected at 1-cell stage.15 Each construct was microinjected
independently three to eight times to generate sufficient numbers of
surviving embryos for observation.
Fluorescent microscopic observation. The microinjected embryos
were examined for GFP expression at various developmental stages
under a fluorescein isothiocyanate (FITC) filter on a Zeiss microscope
(Germany). Live embryos were anesthetized using tricaine as described
previously.15 Embryos were considered positive for GFP expression if
they had more than five GFP-positive cells in the early hematopoietic
tissue, the intermediate cell mass (ICM), and later in the circulating
blood. The percentage of blood-specific, GFP-positive embryos after
microinjections was calculated to evaluate the GATA-1 promoter/
enhancer activities of the constructs. Data obtained from independent
microinjections with the same construct were pooled.
Transgenic fish expressing GFP were identified through fluorescent
microscopic observation. The microinjected founder fish were mated to
wild-type fish, and their progeny were observed for GFP expression.
The founder fish that produced GFP positive eggs were considered
transgenic and used to breed into homozygotes.
RESULTS
Positive erythroid-specific elements are present in the distal
58 flanking region. We previously generated a construct,
G1-GM2 (Fig 1A), by ligating a modified GFP gene (GM2) to a
5.6 kb zebrafish GATA-1 genomic fragment upstream of the
translation start codon.16 Transgenic zebrafish carrying the
G1-GM2 transgene have GFP expression in hematopoietic
progenitors and erythrocytes. The expression pattern of GFP
recapitulated that of the GATA-1 gene as shown by RNA in situ
hybridization,18 suggesting that the 5.6-kb putative GATA-1
promoter/enhancer contains all of the regulatory elements
necessary for GATA-1 expression in the erythroid lineage. To
facilitate the identification of regulatory elements, we sequenced the entire 5.6 kb promoter/enhancer. Sequence alignment analysis using computer software (DNA STAR, Madison,
WI) failed to show any highly conserved sequences between the
58 flanking region of the zebrafish GATA-1 gene and those of
mouse and human. A search of the transcription factor database
using MatInspector V2.119 showed hundreds of potential transcription factor binding sites within this 5.6 kb sequence,
including four double GATA motifs, a type of GATA site that
appears to be important for expression of many erythroidspecific genes.9-12,20,21 To determine which potential transcription factor binding sites are functionally important, a systematic
deletion analysis was performed.
Four deletion constructs, 4967GM2, 4271GM2, 3590GM2,
and 2564GM2, containing the GM2 gene under the control of
variable lengths of the GATA-1 promoter/enhancer region were
generated (Fig 1A) and used to microinject zebrafish embryos.
When the construct, 4967GM2, was microinjected, approximately 60% of the microinjected embryos had GFP expression
in embryonic circulating blood cells at 48 hours postfertilization. This result was similar to those obtained with the original
G1-GM2 construct (Fig 1B). However, in embryos microinjected with constructs 4271GM2, 3590GM2, or 2564GM2,
GFP-positive circulating blood cells were nearly absent (Fig
1B). Because these three constructs share a deletion of a 696-bp
sequence extending from -4967 to -4271, we concluded that this
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
502
MENG ET AL
Fig 1. Identification of a distal control region by PCR dissection of GATA-1 promoter. (A) A
map of construct G1-GM2 is
shown. To generate deletion constructs, a specific primer (left
arrowhead) and SP6 primer (right
arrowhead) were used to amplify
a portion of G1-GM2, as denoted
by the broken line. (B) The percentages of GFP-positive 48hour embryos obtained after microinjection of these constructs
are shown, with the number of
embryos observed for each construct indicated in parentheses.
region contains positive control elements necessary for the
expression of zebrafish GATA-1 in early embryonic circulating
blood cells.
To precisely map the 696-bp distal positive control region,
we generated six more constructs, 4847GM2, 4776GM2,
4742GM2, 4683GM2, 4648GM2, and 4623GM2 (Fig 1A), with
progressive deletions in the 696-bp sequence. After microinjection with construct 4623GM2, only seven of the 707 observed
embryos had a few circulating GFP-positive blood cells. In
contrast, microinjection with any of the other five constructs
resulted in approximately 50% of embryos expressing GFP in
circulating blood cells (Fig 1B). This suggests that a 26-bp
sequence from -4648 to -4623 positively regulates hematopoietic expression of GATA-1 gene.
A double GATA motif in the distal positive control region is
the key regulatory element. The 26-bp distal positive control
region has a sequence of ACTCCAATCTAGATAGCTTCTTATCA. A search for potential transcription factor binding
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
Cis-ACTING ELEMENTS IN ZEBRAFISH GATA-1 LOCUS
sites19 showed that this sequence contains two consensus GATA
motifs (in bold) and a CCAAT box element (underlined). The 58
GATA motif between -4635 and -4638 is separated by 6 bp from
an inverted 38 GATA motif (TATC) between -4624 and -4627.
Clusters of GATA motifs are found in humans,10 mouse,10,12 and
chicken9,11 GATA-1 promoters and in other erythroid-specific
promoters20,21 and are believed to be important regulatory
elements. The CCAAT box element is present in the regulatory
regions of many genes and often upregulates gene transcription.22-26 Therefore, deletions and mutations were generated in
the GATA and CCAAT elements to investigate their roles in
GATA-1 expression in embryonic blood cells.
A 14-bp fragment including the double GATA motifs and
extending from -4624 to -4637 was deleted from the construct
G1-GM2 to generate a new construct, G1m-GM2. A total of 250
embryos microinjected with G1m-GM2 were examined. The
microinjected embryos lacked circulating GFP-positive blood
cells at 48 hours postfertilization (Fig 2), although GFP
expression was observed in some of the microinjected embryos
before the 20 somite stage (discussed below). This suggests that
the double GATA motif is a cis-acting element essential for the
maintenance and enhancement of GATA-1 expression in circulating blood cells.
To address whether the two GATA motifs are equally
important for GATA-1 expression in blood cells, two constructs
containing mutations in each GATA site were generated.
Construct 4648m1GM2 had altered bases in the 58 GATA motif,
while 4648m2GM2 contained mutations in the 38 inverted
GATA motif. Of 136 embryos microinjected with the construct
4648m2GM2, only one embryo contained circulating GFPpositive blood cells. When construct 4648m1GM2 was microinjected, 26.7% of the embryos had GFP expression in circulating
blood cells, which was approximately half the number seen
using the parent construct 4648GM2 (Fig 2). These results
indicate that the 58 GATA motif is less important than the 38
Fig 2. Mutational analysis of the distal control elements. The
percentages of GFP-positive, 48-hour embryos obtained after microinjection of deletion constructs are presented. The result obtained with
the 4648GM2 construct is shown again as a control. Deletion of the
double GATA motif within the distal control region (construct G1mGM2) completely abolished GFP expression in circulating blood cells
of microinjected embryos.
503
inverted GATA motif in maintaining erythroid-specific expression of GATA-1.
To determine if the CCAAT box was required for hematopoietic expression of GATA-1, a mutation construct (4648m3GM2)
with CGCCT instead of CCAAT was generated. After microinjection with this construct, 25.4% of the embryos had GFP
expression in circulating blood cells. Furthermore, the number
of GFP-positive blood cells in the embryo was significantly less
than those of embryos microinjected with its parent construct,
4648GM2. These results imply that the CCAAT motif has the
ability to enhance the hematopoietic expression of GATA-1.
Activity of distal positive control elements requires its own
minimal promoter. To determine whether activity of the
GATA-1 distal positive control elements was context dependent, construct G1DE-Xs-GM2 was generated by ligating a
2,589-bp region from -2968 to -5552 containing the GATA-1
distal control elements (GATA-1 motifs and CCAAT box) to the
Xenopus elongation factor 1a minimal promoter Xs-GM2.17
Microinjection of Xs-GM2 showed that GFP was expressed in
various tissues, including muscle, enveloping layer cells, notochord, and melanocytes (data not shown). Of 283 embryos
microinjected with Xs-GM2, however, only two had GFPexpressing blood cells. Similarly, only three of 408 embryos had
circulating GFP-positive blood cells after microinjection with
G1DE-Xs-GM2. This result indicates that the distal control
elements of the GATA-1 requires its own proximal lineagespecific cis-acting elements to exert full activity. As described
below, a CACCC box in the proximal region of the GATA-1
promoter is absolutely required for hematopoietic transcription
of GATA-1. The same element is not present in the Xenopus
elongation factor 1a minimal promoter, which may explain why
the G1DE-Xs-GM2 was unable to confer high-level expression
of the reporter gene GFP in hematopoietic tissues.
A proximal CACCC box is essential for the expression of
GATA-1. To identify potential cis-acting elements in the
proximal region of GATA-1 promoter, we generated a series of
constructs that had the distal positive control region, extending
from -4256 to -5552, ligated to variable lengths of its downstream sequence followed by the reporter gene GM2 (Fig 3A).
These constructs were used to microinject one-cell zebrafish
embryos.
When constructs retaining a proximal promoter region of at
least 168 bp (construct DE168) were microinjected, more than
10% of the embryos showed GFP expression in circulating
blood cells (Fig 3B). When the retained proximal region was
shortened to 139 bp (construct DE139), no GFP-positive cells
were seen in the microinjected embryos. This suggested that the
region between -168 to -139 contained important regulatory
elements for the hematopoietic expression of zebrafish GATA-1.
This 29-bp region has a sequence of CCAAAAAAAAGTACCCCAACCCCACCCAT and is rich in purines at the 58 end and
rich in pyrimidines at the 38 end. The pyrimidine-rich region
contains a potential CACCC box (in bold) that has been shown
to play a role in transcriptional regulation of many erythroid
genes.9,10,12,27-30 To address the potential role of the CACCC box
in the regulation of GATA-1 expression, base mutations were
introduced into the CACCC box and adjacent regions, using the
construct DE168 as a template (see Materials and Methods).
Changes of CAC to TTT in the CACCC box (construct
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
504
MENG ET AL
Fig 3. Identification of proximal cis-elements in GATA-1 promoter/enhancer region. (A) Parent construct DE1776 was
generated by deleting a sequence
between -4257 and -1775 of the
GATA-1 promoter from plasmid
G1-GM2. Other constructs were
generated by deleting variable
lengths of sequence between the
distal control region and translation start codon. Deleted regions
are indicated by the bold line.
Primers P4967 and SP6 (arrowheads) were used to amplify the
region in each construct required
for microinjection (detailed in
Materials and Methods). (B) The
percentages of GFP-positive 48hour embryos obtained after microinjection of these constructs
are shown, with the number of
embryos observed for each construct indicated in parentheses.
DE168m3) completely eliminated the expression of GFP in the
circulating blood cells, whereas the other two mutations outside
the CACCC box (DE168m1 and DE168m2) did not affect GFP
expression (Fig 3B). This suggests that the CACCC box,
located from -146 to -142 in the GATA-1 locus, is absolutely
necessary for GATA-1 expression in the hematopoietic lineage.
Initiation of GATA-1 expression requires the proximal CACCC
box but not the distal double GATA element. The experiments
described above show that both the distal double GATA motif
and the proximal CACCC motif are required for zebrafish
GATA-1 expression in circulating blood cells of 48-hour
embryos. As in mouse,12,13,31 however, the question of which
motif is responsible for the initiation of GATA-1 expression is
still unresolved. In zebrafish, GATA-1 expression in hematopoietic progenitor cells starts at approximately the one somite
stage.16,18 Thus, an earlier observation of microinjected embryos should allow the identification of cis-elements that play a
role in the initiation of GATA-1 expression. Embryos microinjected with the construct G1m-GM2, which contained nearly
the entire promoter/enhancer region except the distal double
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
Cis-ACTING ELEMENTS IN ZEBRAFISH GATA-1 LOCUS
505
Fig 4. Role of proximal CACCC box in initiation of GATA-1 expression and existence of a negative control element. GFP expression patterns in
9 to 12 somite embryos microinjected with three critical GATA-1/GFP linearized constructs: (A) G1-GM2 produces strong GFP expression; (B)
G1m-GM2 produces weak GFP expression; and (C) DE139 shows no GFP expression at all. Zebrafish embryos at the 18- to 19-hour stages
transgenic for G1-GM2 (D) or DE1776 (E) show similar patterns of GFP expression. GFP is expressed in the notochord (indicated by an arrow in F)
of embryos transgenic for DE468, although GFP is also present in abundance in the hematopoietic intermediate cell mass. Similar results were
observed in germline fish transgenic for DE421 (data not shown).
GATA motif, did not show GFP expression in circulating blood
cells in 48-hour embryos. However, GFP expression was
detected at earlier developmental stages, ie, at the 2 to 20 somite
stages (Fig 4B). Microinjection of other constructs lacking the
double GATA motif, but containing the proximal CACCC box,
also produced GFP expression in embryos at earlier stages, but
it was not maintained beyond 20 hours after fertilization. This
suggests that, although the distal double GATA motif is required
to promote and maintain the level of GATA-1 expression, it is
not essential for the initiation of GATA-1 transcription. In
contrast, when embryos were microinjected either with construct DE139, which lacked the proximal CACCC box, or with
construct DE168m3, which had mutations in the CACCC box,
no GFP expression was observed at the earlier developmental
stages (Fig 4C). This shows that the CACCC box is absolutely
required for the initiation of GATA-1 expression.
Other positive and negative regulatory elements are required
for GATA-1 expression. We noted that constructs containing
both the distal double GATA motif and the proximal CACCC
box, but with varying lengths of the region between them, have
different enhancer/promoter activity (Fig 3). Microinjection of
construct DE1776, containing 1,776 bp of proximal region,
resulted in 61.4% of embryos expressing GFP in circulating
blood cells. This result was similar to that obtained with the
full-length construct G1-GM2. However, microinjection of
construct DE367, containing only 367 bp upstream from the
translation start codon, produced only 12.1% of microinjected
embryos expressing GFP in blood cells. This is significantly less
Fig 5. Cis-regulatory elements in zebrafish GATA-1 genomic locus. The proximal CACCC box element at position -146 is absolutely required
for the initiation of GATA-1 gene expression in hematopoietic cells, while the distal double GATA motif between -4635 and -4627 is necessary for
enhancing and maintaining this expression. The CCAAT box at -4643 and another 49-bp positive control region (pcr) between -421 and -366
strengthen the GATA-1 expression. The expression of GATA-1 in the notochord, a nonhematopoietic tissue, is repressed by a negative control
region (ncr) located between -1776 to -468.
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
506
MENG ET AL
than that obtained with the other six constructs (DE1776,
DE764, DE613, DE501, DE468, and DE421). In addition, less
than 5% of the GFP positive embryos had more than 10 GFP
positive blood cells. This is also significantly lower than that
obtained with the other constructs. These results suggest that the
49-bp region extending from -421 to -366 is a proximal positive
control region that can increase the blood-specific expression of
GATA-1. This region contains potential binding sites for
transcription factors such as C/EBPB, AP1, and OCT1, as
shown by analysis with MatInspector V2.1.19
When microinjected with G1-GM2, approximately 6% of the
microinjected embryos showed nonspecific expression of GFP
in notochord, muscle, skin, and other types of cells. Although
embryos microinjected with constructs containing deletions
between -1777 to -468 continued to express GFP in blood cells,
approximately 40% of the microinjected embryos exhibited
GFP expression in the notochord (data not shown). This result
suggests that a negative cis-acting element may be required to
repress nonhematopoietic expression of zebrafish GATA-1
gene.
Essential elements of the GATA-1 promoter are confirmed by
analyzing germline transgenic zebrafish. By observing GFP
expression in progeny of the microinjected founder fish, we
identified several transgenic zebrafish lines that harbor different
GATA-1/GFP constructs, as described above. One transgenic
line derived from construct DE1776 had strong GFP expression
in hematopoietic progenitors (Fig 4E) and circulating erythrocytes. This pattern is indistinguishable from that of the G1-GM2
germline transgenic zebrafish (Fig 4D).16 This observation
confirms that the 2,750-bp between position -4257 to -1775
(deleted in construct DE1776) is not required for proper
expression of GATA-1. We have also obtained transgenic
germline fish from constructs DE468 and DE421. Consistent
with results from the transient expression studies, both lines
have a hematopoietic GFP expression pattern that is identical to
G1-GM2 transgenic lines (Figs 4F and D). In addition, both
DE468 and DE421 transgenic lines have GFP expression in the
notochord. This further validates the transient assay results
suggesting that negative cis-acting elements play a role in
conferring hematopoietic expression of the zebrafish GATA-1
gene.
DISCUSSION
The transcription factor GATA-1 plays an important role in
hematopoietic development by regulating the expression of
downstream hematopoietic genes.16,32,33 Similarly, the expression of GATA-1 itself must be regulated by other lineagespecific transcription factors. Characterization of the cis-acting
elements that control the expression of GATA-1 gene should
lead to the identification of factors that act upstream of GATA-1.
To date, much of the knowledge concerning regulation of
GATA-1 gene expression has been obtained from studies of the
mouse and chicken promoters. Transient transfection assays in
cultured cells have shown that a double GATA motif, located
upstream of the first exon, is required for full promoter activity
of the mouse GATA-1 gene.10,12 In addition, it has been shown
that mutations in a CACCC box between the double GATA
motif and the first exon can reduce this promoter activity.12
Recent studies in transgenic mice have shown that the activa-
tion of GATA-1 gene expression in primitive or definitive
erythroid cells is controlled by different regulatory sequences.12,13,31 For instance, a transgene with a short proximal
mouse GATA-1 promoter could only express infrequently in
definitive erythroid cells.13 The inclusion of an upstream
sequence not only increased the expression frequency in
definitive erythroid cells, but also activated the expression of
the transgene in primitive erythroid cells. However, the specific
sequence motifs in that upstream region have not been identified. So far, the implication of CACCC boxes in the initiation of
GATA-1 expression has not been shown in the above studies.
Using transgene constructs containing zebrafish GATA-1
genomic sequences and the GFP reporter gene, we previously
demonstrated that a 5.6-kb enhancer/promoter fragment is
sufficient to direct erythroid-specific expression of the GFP.16 In
this study, we have identified individual cis-acting elements that
are required for the erythroid-specific expression of the zebrafish GATA-1 gene (Fig 5). We have found that a CACCC box
in the proximal region between -146 and -142 is critical for
initiating zebrafish GATA-1 expression, whereas a double
GATA motif in the distal region between -4635 and -4627 is
necessary for enhancing and maintaining hematopoietic expression of the GATA-1 gene. These two regulatory elements
cooperate with other positive and negative elements to confer
hematopoietic transcription of the GATA-1 gene.
Cis-regulatory sequence elements mediate transcription specificity and activation by binding to specific proteins. Our studies
suggest that factors binding to the CACCC box could be critical
for the initiation of GATA-1 expression during embryonic
development. The erythroid Kruppel-like factor (EKLF) is the
first identified hematopoietic-specific transcription factor that
binds to the CACCC box.34 However, it is unlikely that the
EKLF is required for GATA-1 expression because GATA-1 is
still able to express in murine EKLF-/- embryos.35 BKLF, a
second erythroid CACCC-box-binding transcription factor,
shows a high-affinity with many CACCC motifs present in the
promoters of erythroid-specific genes including GATA-1 in an
in vitro assay.36 Whether BKLF or other unidentified erythroid
Kruppel-like factors can bind to the CACCC box in vivo and
activate the expression of GATA-1 in zebrafish remains to be
determined.
Studies in other species showed that a functional GATA motif
in the proximal region of GATA-1 promoters was able to be
bound by GATA-1.10-12 Based on such observations, a positive
autoregulatory mechanism was proposed for increasing and
maintaining GATA-1 expression during differentiation and
cellular maturation. McDevitt et al (1997) showed that GATA-1
is not required for activation and maintenance of GATA-1 gene
expression because a GATA-1/lacZ transgene could express in a
GATA-1- background.13 Our studies establish an essential role
for the double GATA cis-acting element in maintaining hematopoietic expression of GATA-1. However, which member of the
GATA family does this is yet to be identified.
Although the CCAAT box was reported to be involved in
blood-specific gene expression,22,24-26,37 its importance in
GATA-1 expression has not been determined. We show that a
mutation in the CCAAT box immediately upstream of the distal
double GATA site significantly reduces GATA-1 expression.
Considering the short distance between the CCAAT box and the
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
Cis-ACTING ELEMENTS IN ZEBRAFISH GATA-1 LOCUS
double GATA motif, factors binding to the CCAAT box might
function through interactions with a GATA factor to influence
the transcription level of the GATA-1 gene. This kind of
interaction may involve multiple factors as suggested by the
study of Wadman et al,38 in which an erythroid specific
DNA-binding complex including TAL1, E47, GATA-1, and
Ldb1/NLI proteins was shown to interact with closely linked
GATA and CAGGTG sites.
To the best of our knowledge, this study represents the first
report describing a negative regulatory mechanism for bloodspecific gene expression. The expression of GATA-1 in the
notochord is apparently suppressed through an interaction
between a negative regulatory element in the GATA-1 promoter
and notochord-derived negative factors. This type of regulation
has been reported to repress the expression of neuron-specific
genes in nonneuronal tissues.39,40
We identified the cis-acting elements important for GATA-1
promoter activity through a transient, whole zebrafish embryonic reporter gene assay. The data obtained by transient assays
have been confirmed by expression patterns obtained in germline transgenic zebrafish. By ligating essential elements of the
zebrafish GATA-1 promoter, we generated stable transgenic
zebrafish with GFP expression comparable to that obtained by
using a full-length promoter. These results validate the zebrafish
as a whole embryo system for the efficient identification of
those cis-acting elements playing critical roles in modulating
the expression of developmentally regulated genes.
ACKNOWLEDGMENT
We thank Jason R. Jessen, Scott Marty, Billie Moore, and Han Wang
for helpful discussions and comments on the manuscript.
REFERENCES
1. Martin DI, Zon LI, Mutter G, Orkin SH: Expression of an
erythroid transcription factor in megakaryocytic and mast cell lineages.
Nature 344:444, 1990
2. Tsai SF, Martin DI, Zon LI, D’Andrea AD, Wong GG, Orkin SH:
Cloning of cDNA for the major DNA-binding protein of the erythroid
lineage through expression in mammalian cells. Nature 339:446, 1989
3. Zon LI, Yamaguchi Y, Yee K, Albee EA, Kimura A, Bennett JC,
Orkin SH, Ackerman SJ: Expression of mRNA for the GATA-binding
proteins in human eosinophils and basophils: Potential role in gene
transcription. Blood 81:3234, 1993
4. Pevny L, Simon MC, Robertson E, Klein WH, Tsai SF, D’Agati V,
Orkin SH, Costantini F: Erythroid differentiation in chimaeric mice
blocked by a targeted mutation in the gene for transcription factor
GATA-1. Nature 349:257, 1991
5. Pevny L, Lin CS, D’Agati V, Simon MC, Orkin SH, Costantini F:
Development of hematopoietic cells lacking transcription factor GATA-1.
Development 121:163, 1995
6. Weiss MJ, Keller G, Orkin SH: Novel insights into erythroid
development revealed through in vitro differentiation of GATA-1
embryonic stem cells. Genes Dev 8:1184, 1994
7. Weiss MJ, Orkin SH: Transcription factor GATA-1 permits
survival and maturation of erythroid precursors by preventing apoptosis. Proc Natl Acad Sci USA 92:9623, 1995
8. Shivdasani RA, Fujiwara Y, McDevitt MA, Orkin SH: A lineageselective knockout establishes the critical role of transcription factor
GATA-1 in megakaryocyte growth and platelet development. EMBO J
16:3965, 1997
9. Hannon R, Evans T, Felsenfeld G, Gould H: Structure and
507
promoter activity of the gene for the erythroid transcription factor
GATA-1. Proc Natl Acad Sci USA 88:3004, 1991
10. Nicolis S, Bertini C, Ronchi A, Crotta S, Lanfranco L, Moroni E,
Giglioni B, Ottolenghi S: An erythroid specific enhancer upstream to
the gene encoding the cell-type specific transcription factor GATA-1.
Nucleic Acids Res 19:5285, 1991
11. Schwartzbauer G, Schlesinger K, Evans T: Interaction of the
erythroid transcription factor cGATA-1 with a critical auto-regulatory
element. Nucleic Acids Res 20:4429, 1992
12. Tsai SF, Strauss E, Orkin SH: Functional analysis and in vivo
footprinting implicate the erythroid transcription factor GATA-1 as a
positive regulator of its own promoter. Genes Dev 5:919, 1991
13. McDevitt MA, Fujiwara Y, Shivdasani RA, Orkin SH: An
upstream, DNase I hypersensitive region of the hematopoieticexpressed transcription factor GATA-1 gene confers developmental
specificity in transgenic mice. Proc Natl Acad Sci USA 94:7976, 1997
14. Evans T, Reitman M, Felsenfeld G: An erythrocyte-specific
DNA-binding factor recognizes a regulatory sequence common to all
chicken globin genes. Proc Natl Acad Sci USA 85:5976, 1988
15. Meng A, Tang H, Ong BA, Farrell MJ, Lin S: Promoter analysis
in living zebrafish embryos identifies a cis-acting motif required for
neuronal expression of GATA-2. Proc Natl Acad Sci USA 94:6267,
1997
16. Long Q, Meng A, Wang H, Jessen JR, Farrell MJ, Lin S: GATA-1
expression pattern can be recapitulated in living transgenic zebrafish
using GFP reporter gene. Development 124:4105, 1997
17. Johnson AD, Krieg PA: pXeX, a vector for efficient expression of
cloned sequences in Xenopus embryos. Gene 147:223, 1994
18. Detrich HWr, Kieran MW, Chan FY, Barone LM, Yee K,
Rundstadler JA, Pratt S, Ransom D, Zon LI: Intraembryonic hematopoietic cell migration during vertebrate development. Proc Natl Acad Sci
USA 92:10713, 1995
19. Quandt K, Frech K, Karas H, Wingender E, Werner T: MatInd
and MatInspector: New fast and versatile tools for detection of
consensus matches in nucleotide sequence data. Nucleic Acids Res
23:4878, 1995
20. Martin DI, Orkin SH: Transcriptional activation and DNA
binding by the erythroid factor GF-1/NF-E1/Eryf 1. Genes Dev 4:1886,
1990
21. Orkin SH: GATA-binding transcription factors in hematopoietic
cells. Blood 80:575, 1992
22. Huang MN, Hung HL, Stanfield-Oakley SA, High KA: Characterization of the human blood coagulation factor X promoter. J Biol
Chem 267:15440, 1992
23. McKnight S, Tjian R: Transcriptional selectivity of viral genes in
mammalian cells. Cell 46:795, 1986
24. Myers RM, Tilly K, Maniatis T: Fine structure genetic analysis
of a beta-globin promoter. Science 232:613, 1986
25. Ronchi A, Berry M, Raguz S, Imam A, Yannoutsos N, Ottolenghi
S, Grosveld F, Dillon N: Role of the duplicated CCAAT box region in
gamma-globin gene regulation and hereditary persistence of fetal
haemoglobin. EMBO J 15:143, 1996
26. Uzan G, Prenant M, Prandini MH, Martin F, Marguerie G:
Tissue-specific expression of the platelet GPIIb gene. J Biol Chem
266:8932, 1991
27. Epperly BR, Bergenham NC, Venta PJ, Tashian RE: Characterization of the genes encoding carbonic anhydrase I of chimpanzee and
gorilla: Comparative analysis of 58 flanking erythroid-specific promoter
sequences. Gene 131:249, 1993
28. Frampton J, Walker M, Plumb M, Harrison PR: Synergy between
the NF-E1 erythroid-specific transcription factor and the CACCC factor
in the erythroid-specific promoter of the human porphobilinogen
deaminase gene. Mol Cell Biol 10:3838, 1990
29. Max-Audit I, Eleouet JF, Romeo PH: Transcriptional regulation
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
508
of the pyruvate kinase erythroid-specific promoter. J Biol Chem
268:5431, 1993
30. Orkin SH: Regulation of globin gene expression in erythroid
cells. Eur J Biochem 231:271, 1995
31. Onodera K, Takahashi S, Nishimura S, Ohta J, Motohashi H,
Yomogida K, Hayashi N, Engel JD, Yamamoto M: GATA-1 transcription is controlled by distinct regulatory mechanisms during primitive
and definitive erythropoiesis. Proc Natl Acad Sci USA 94:4487, 1997
32. Orkin SH: Transcription factors and hematopoietic development.
J Biol Chem 270:4955, 1995
33. Shivdasani RA, Orkin SH: The transcriptional control of hematopoiesis [see comments]. Blood 87:4025, 1996
34. Miller IJ, Bieker JJ: A novel, erythroid cell-specific murine
transcription factor that binds to the CACCC element and is related to
the Kruppel family of nuclear proteins. Mol Cell Biol 13:2776, 1993
35. Nuez B, Michalovich D, Bygrave A, Ploemacher R, Grosveld F:
Defective haematopoiesis in fetal liver resulting from inactivation of the
EKLF gene. Nature 375:316, 1995
36. Crossley M, Whitelaw E, Perkins A, Williams G, Fujiwara Y,
MENG ET AL
Orkin SH: Isolation and characterization of the cDNA encoding
BKLF/TEF-2, a major CACCC-box-binding protein in erythroid cells
and selected other cells. Mol Cell Biol 16:1695, 1996
37. Tang DC, Ebb D, Hardison RC, Rodgers GP: Restoration of the
CCAAT box or insertion of the CACCC motif activates [corrected]
delta-globin gene expression [erratum appears in Blood 90:2120, 1997].
Blood 90:421, 1997
38. Wadman IA, Osada H, Grutz GG, Agulnick AD, Westphal H,
Forster A, Rabbitts TH: The LIM-only protein Lmo2 is a bridging
molecule assembling an erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and Ldb1/NLI proteins. EMBO J
16:3145, 1997
39. Schoenherr CJ, Anderson DJ: The neuron-restrictive silencer
factor (NRSF): A coordinate repressor of multiple neuron-specific
genes. Science 267:1360, 1995
40. Quinn JP: Neuronal-specific gene expression — the interaction
of both positive and negative transcriptional regulators. Prog Neurobiol
50:363, 1996
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
1999 93: 500-508
Positive and Negative Cis-Acting Elements Are Required for Hematopoietic
Expression of Zebrafish GATA-1
Anming Meng, Hong Tang, Baozheng Yuan, Bruce A. Ong, Qiaoming Long and Shuo Lin
Updated information and services can be found at:
http://www.bloodjournal.org/content/93/2/500.full.html
Articles on similar topics can be found in the following Blood collections
Hematopoiesis and Stem Cells (3446 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.