Download A Prospective Study of Transfusion-Transmitted GB Virus C Infection

From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
A Prospective Study of Transfusion-Transmitted GB Virus C Infection:
Similar Frequency but Different Clinical Presentation Compared With
Hepatitis C Virus
By Jin-Town Wang, Feng-Chiao Tsai, Cha-Ze Lee, Pei-Jer Chen, Jin-Chuan Sheu, Teh-Hong Wang,
and Ding-Shinn Chen
To study the incidence and outcome of GB virus C (GBV-C)
infection in blood recipients. Serum samples collected in a
prospectivestudy were examinedforGBV-CRNA
by a
nested polymerasechainreactionassay.Among
the 400
adults who underwent cardiac surgery,40 were positive for
GBV-C RNA, including six whose pretransfusion sera were
already positive and seven coinfected
with hepatitis C virus
(HCV) during transfusion.The risk of transmission was estimated to be -0.46% per donor. GBV-C viremiawas detectable 1 week after transfusion and could persist for 8 years.
However, no evident symptomsor signs were noted in the
25 patients infected by GBV-C alone, and the average peak
serum alanine aminotransferase activity was 31 IU/L only
(range, 12 to 123). with persistently normal levels in 20 patients. In the seven patients coinfectedwith HCV, the clinical
courses of posttransfusion hepatitis were similar to those
infected by HCV alone.
In eight patientswith posttransfusion
non-A-E hepatitis, only one was positive for GBV-C RNA.
Sixty samples were chosen to test hepatitis G virus (HGV)
sequences, 26 of the 30 GBV-C positives were positive for
HGVRNA in contrast to noneof the 30 GBV-Cnegative
samples. In conclusion, GBV-C canbe transmitted by transfusion in -9% of patients who underwent cardiac surgery.
Nevertheless,this virus doesnot seem to cause classic hepatitis in most instances.
0 1996 by The American Societyof Hematology.
M
transaminase (ALT) during this 6-month period were followed every
month for 1 year and then every 3 months for as long as possible.
Blood samples were obtained during each visit and kept frozen at
-80°C until tested. Additional samples beside the follow-up schedule were obtained in some patients who were checked for blood
tests due to their underlying disease. The samples were carefully
handled and aliquoted to avoid contamination and degradation of
viral nucleic acid.’’ As of June 1994, a total of 1,038 patients were
enrolled. Of them, 910 recipients completed the 6-month follow-up,
while128 patients were lost to follow-up at the 6-month period.
Among the 910 recipients, 665 received transfusion when anti-HCV
was not screened in blood donors, and 245 patients were transfused
after anti-HCV screening that was initiated on July 1, 1992. Most
of the blood recipients were patients receiving cardiac surgery and
had a mean donor number of 18.6 2 14.6 (range, 1 to 97). For the
GBV-C study, 400 recipients were enrolled. They included the first
250 consecutive patients transfused since 1987 and before anti-HCV
screening was implemented in blood donors and the first 150 patients
transfused after the anti-HCV screening. Of the 400 recipients tested
for GBV-C, 24 were infected by HCV and eight were diagnosed as
posttransfusion non-A-E hepatitis by serologic assays and PCR for
hepatitis B and C viruses as previously described.” All the 24 HCV
infections were detected before anti-HCV screening. After testing
of GBV-C RNA, 30 GBV-C positive recipients and 30 GBV-C
negative recipients were selected and tested for HGV RNA by PCR
including: (1) the pretransfusion sample and two posttransfusion
samples of all the eight non-A-E hepatitis patients (24 samples,
OLECULAR CLONING of the hepatitis viruses and
rapid progress in serologic assays have enabled us
to diagnose the etiology in the majority of posttransfusion
hepatitis (PTH) cases. However, after screening for the antibody to hepatitis C virus (anti-HCV) in blood donors, there
are still 2%to 3% of patients whose posttransfusion hepatitis
cannot be attributed to hepatitis A, B, C, D, or E viruses.’.2
Among the candidate non-A-E hepatitis viruses, a wellknown one that has been characterized extensively in animal
models, is the GB hepatitis agent.3Recently two GB hepatitis
agent-like viruses, GBV-A and GBV-B, have been identified
and isolated from the inoculated tamarins, butboth seem
absent in human^.^.^ After further study, novel GBV-like
sequences, designated GBV-C, were isolated from serum
samples of some non-A-E hepatitis patients in western Africa and North A m e r i ~ aPreliminary
.~
data have shown viremia in humans. However, the modes of transmission and the
clinical significance of GBV-C infection remain ~ n k n o w n . ~
As we have conducted a prospective study of posttransfusion
hepatitis in Taiwan since 1987,’ the serial serum samples
collected from these prospectively followed recipients can
be used to study the risk of GBV-C transmission through
blood transfusion, as well as the clinical course of those who
are infected. Accordingly, we investigated the presence of
GBV-C genome in these recipients by using a nested polymerase chain reaction (PCR) assay, and the clinical correlation of hepatitis was analyzed. After testings of GBV-C RNA
were completed in our study, a closely related agent, hepatitis G virus (HGV) was identified.’ We, therefore, also tested
HGV RNA in some of our samples.
MATERIALSANDMETHODS
Blood recipients. From June 1987, we conducted a prospective
study of posttransfusion hepatitis in the National Taiwan University
Hospital.’ Interim results for hepatitis viruses infection and human
T-cell lymphotropic virustype I (HTLV-I) have been reported in
detail before.”.” Briefly, patients who received blood transfusion
and met the following criteria were recruited: normal liver function
tests before transfusion; no transfusion in the past year; no previous
history of liver diseases, alcoholism, drug addiction, or exposure to
hepatotoxic drugs. After transfusion, the recipients were followedup every 2 to 4 weeks for 6 months. Patients with elevated alanine
Blood, Vol 88, No 5 (September l), 1996:pp 1881-1886
Fromthe Departments of Bacteriology and Intern1 Medicine,
School of Medicine, College of Medicine, National Taiwan University: Taipei; andthe Hepatitis Research Center, National Taiwan
University Hospital, Taipei, Taiwan.
Submitted March 8, 1996, accepted April 22, 1996.
Supported by grants from the Department of Health and the National Science Council, Executive Yuan, Taiwan, Republic of China.
Address reprint requests to Ding-Shinn Chen, MD, Hepatitis Research Center, National Taiwan University Hospital, I , Chang-Te
St, Taipei, Taiwan 10016.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1996 by The American Society of Hematology.
0006-4971/96/8805-00IO$3.00/0
1881
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
1882
two of them were GBV-C RNA positive), (2) two posttransfusion
samples of 18 randomly selected patients without hepatitis (36 samples; 28 of them were GBV-C RNA positive).
Donors. The blood or blood components used were donated by
volunteers negative for hepatitis B surface antigen, antibody to human immunodeficiency virus, and with serum ALT activities <4S
I U L (normal, <31 IUL). Antibody to HCV by a second generation
assay was added to the screening list in July 1992. Plasma samples
of donors were also collected from transfused fresh frozen plasma
or whole blood before transfusion as completely as possible.
PCR assay. To screen GBV-C viral RNA, the pretransfusion,
and the 6-month posttransfusion serum samples from these 400 recipients were tested by a nested PCR. We had tested GBV-C in 104
patients in both first and 6-month posttransfusion samples. Of them,
seven were positive at both first and 6-month posttransfusion samples, three were positive at 6 months, and one was positive at the
first posttransfusion samples only. Therefore, to avoid including recipients with carry-over rather than true infection and to save the
resources and time of so manyPCR experiments, we tested the
6-month posttransfusion sample in the subsequent patients. Serial
posttransfusion samples of a given recipient were tested if the 6month posttransfusion sample was positive and the pretransfusion
sample was negative. Plasma samples from 200 volunteer blood
donors unrelated to this study were tested as controls. The initial
PCR screening was done by pooling 10 to 15 pL of serum specimens
from seven to 10 patients. The outer primer pair was GBV-C-SI and
GBV-C-al, inner primers were GBV-C.4-s1 and GBV-C.4-al, or
GBV-C.5-sl andGBV-C.5-al.’ Nucleic acidwas extracted from
100 pL of serum, reverse transcribed, and subjected to a nested
PCR, as described previously.” Ten microliters of the PCR products
were electrophoresed in a 2% agarose gel and stained with ethidium
bromide. Positive samples were then broken down by testing GBVC RNA in each individual sample by the same method. Negative
samples were tested again by adding a GBV-C RNA positive serum
sample to exclude the presence of reaction inhibitor. The PCR assay
has been proven tobe specific for detecting serum GBV-C RNA
after sequencing the PCR products from more than 10 patients. For
each PCR assay, a weak positive serum sample, which was positive
only after nested PCR by both inner primers, was used as positive
control. Serum samples from healthy subjects that were collected
during a routine physical check-up and were proven to be negative
for GBV-C RNA with all of the above-mentioned GBV-C primers
(they also tested negative for HGV RNA after HGV sequences were
available) were used as negative controls. For each experiment, a
negative serum sample, as well as regents without template, were
used as negative control. To detect HGV RNA by PCR, two primer
pairs from the HGV genome were used: the outer primer pair was
HGV-F1 S‘aggtgtcttcaaagaccggaagg;HGV-R1 S’tcagaggccagagcgtatagctc; the inner primer pair was HGV-F2 S‘ggacttccggatagctgaaaagct; HGV-R2 5‘gcgccacacagatggcgca? The procedures were the
same as those for GBV-C RNA.
DNAsequencing.
DNA sequences were determined in PCR
products from recipients positive for GBV-C RNA to confirm the
specificity. For sequencing reaction, 40 mL of the specific biotinylated amplification product (amplified by primer GBV-4sl and 4al
or GBV-5sl and 5al) were used to generate single-stranded template
for sequencing by Dynabeads M280 streptavidin (Dynal AS, Oslo,
Norway). The single-stranded, biotinylated PCR products were directly sequenced using a cycle sequencing protocol and reagents
supplied with the Taq Dye Terminator Cycle Sequencing Kit (ABI,
Foster City, CA). The thermal cycling condition of GBV-C sequencing were 35 cycles at 94°C for SO seconds 60°C for 50 seconds and
72°C for SO seconds after the initial denaturation step at 94°C for S
minutes. After PCR, the reaction mixtures were extracted with phenoUchloroform (4: 1) twice and precipitated with 95% (vol/vol) etha-
WANG ET AL
nol and 3 m o a sodium acetate, pH 5.2. Following centrtfugation
for 25 minutes, each pellet was dried in a speed-Vac (Savant, NY)
and stored at -20°C until electrophoresis. Dried pellets were resuspendedin 4 mL of loading buffer [S:1 (vollvol) deionized formamide/SO rnmol/L EDTA pH 8.01 and were heated at 95°C for 3
minutes to loading onto a 6% (wthol) polyacrylamide gel containing
7 molL urea. Electrophoresis was performed on an AB1 373 automated sequencer (ABI).
Southern blot. To further confirm the specificity of thenested
PCR, 30 random samples were checked by southern blot. The PCR
products from a sequenced sample amplified by primer pair GBV4al and 4sl were purifiedandusedas
the probe. The probe was
labeled using a enhanced chemiluminescence kit (Amersham, Buckinghamshire, UK) according to the manufacturer’s instructions.
Southern hybridization was performed as previously described.”
Briefly, the PCR products were electrophoresed and transferred to
a nylon membrane (Oncor, Gaithersburg, MD). The filterswere
prehybridized with a rapid hybridization buffer (Amersham) at 65°C
for 1 to 2 hours and hybridized with the probe at 65°C for 2 hours.
Filters were then washed with 0.1% sodium dodecyl sulfate (SDS)
and 0.Sx SSC (1 X SSC is 0.1S m o a NaCl plus 0.015 mol/L sodium
citrate) at 42°C for 20 minutes twice and then washed with 0 . 1 8
SDS and 0.1 X SSC for 20 minutes. The film was exposed for I
minute after treating with the substrate.
Statisticalmethods.
Student’s t-test and Chi-square testwere
used for statistical analysis.
RESULTS
None of the pooled negative samples showed reaction
inhibitor after repeat testing. On repeat testings for each
individual after initial screening, 39 of the posttransfusion
samples (39 of 400 = 8.6%, 95% confidence intervals = 6.8
to 12.7), six of the pretransfusion samples of the 400 recipients (6 of 400 = I S % , 95% confidence intervals = 0.3 to
2.7)and four of the 200 donors were positive for serum
GBV-C RNA, respectively. All six pretransfusion samples
and 34 of the posttransfusion samples were positive for both
primers (Fig 1A). All of the samples checked by Southern
blot specifically hybridized to the probe (Fig 1B). Four of
the five patients were positive by GBV-SsUSal primer, while
one was positive by GBV-4s1/4al only. Samples positive
for only one primer pair were considered positive if more
than two of the serial samples were positive. Two of these
samples were sequenced and confirmed to be GBV-C RNA
by a homology of 85% and 87% in 82 nucleotides with the
reported sequences,’ respectively. Five of the six patients
positive for GBV-C RNA in pretransfusion samples were
still positive on the posttransfusion samples. Therefore, 40
recipients were positive on either pre- or posttransfusion
samples. The positive rates for the recipients and donors
were 40 of 400 and 4 of 200, respectively. Of the 34 recipients (34 of 394 = 8.6%, 95% confidence intervals = 5.8 to
11.4) with new posttransfusion GBV-C viremia, 22 (8.8%)
were transfused before, while 12 (8.0%) were transfused
after anti-HCV screening (22 of 250 v 12 of 150, P > . l ).
Seven (20.6%) of the 34 recipients were coinfected with
HCV during blood transfusion. The number of donors in
these 34 patients wassignificantly higher than those not
infected with GBV-C (24.2v 17.6, P < .01). Two recipients,
each carrying HCV and HTLV-I, were superinfected by
GBV-C during transfusion. Therefore, 25 recipients were
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
TRANSFUSION-TRANSMITTED
!
A
B
1 2 3 4 5
1 2 3 4 5
Fig 1. PCR products of a patient infected with GBV-C. Lane 1, marker: 11x174 DNA digested with Haelll; lane 2, PCR products amplified
with primer GBV-C 5.q.. and 5.,; lane 3, PCR products amplified with primer GBV-C 4,, and 4.,; lane 4, a negative control; and lane 5, marker
100 bp ladder. (A) Gel electrophoresis. (B) Southern blot:
infected by GBV-C alone. These 25 recipients had a mean
peak serum ALT of 3 1 IU/L (Table 1 ), 20 did not have any
ALT elevation during the 6-month follow-up (Fig 2A), three
had mild ALT elevation (less than twofold the upper limit
of normal), and two were found to have elevated ALT levels
more than twofold the upper limit (peak ALT value 101 and
123 IU/L, respectively). Among these five recipients with
elevated serumALT activities, the elevation was so mild
that only one fit the criteria of posttransfusion hepatitis."
Except for those coinfected withHCV, all the GBV-C
infected subjects were asymptomatic during the acute stage.
In the follow-up period of 1 to 8 years, they appeared clinically well, and there was no evidence of hepatitis or other
systemic diseases. The clinical course and laboratory data in
the seven HCV coinfected recipients was similar to those
infected byHCV only (Table l). All seven patients developed chronic hepatitis, two of them died6 years after transfusion due to underlying heart disease, and another patient was
foundto have unexplained iron deficiency anemia (Hb =
9.2 to 9.8 gm/dL) 7 years after transfusion. The results of
serial testings showed that GBV-C viremia appeared as early
Table 1. Clinical Data of Patients With Posttransfusion GBV-C
Infection Compared With HCV Infection
GBV-C
Alone
n = 25
Mean age
Sex (male:female)
Mean donor number*
Mean peak ALT, IU/L
Chronicity rate
Jaundice
44.1
169
21.2
31
38% (5/13)
0
With HCV
Coinfection
n = 7
55.6
3:4
28.4
442
100% (7/7)t
28% (2/7)
HCV Alone
n = 17
46.2
11:6
20.4
501
88% (15/17)t
35% (6/17)
Excluding one HCV carrier and one HTLV-1 carrier, both had mild
ALT elevation.
Significantly larger than recipients without GBV-C infection ( P <
.01, Student's t-test).
t For HCV infection.
as 1 week after transfusion and remained detectable for as
long as 8 years. In three patients coinfected by GBV-C and
HCV, HCV RNA could be detected in most of their serial
serum samples, while GBV-C RNA was detectable intermittently during the follow-up period (Fig 2B).
Of 22 patients (13 GBV-Cinfected alone, seven with
HCV coinfection, one HCV carrier, and one HTLV-l carrier)
whohadtwo or moreserum samples available 6 months
after transfusion. eight had GBV-C RNA detectable. The
number of samples tested for persistent infection in each
patient was 5.6 (range 2 to 20) and the time of sampling
ranged from 9 months to 8 years after transfusion. Therefore,
if defined by the presence of GBV-C RNA for >6 months
after infection, the persistent infection rate of acute GBV-C
infection acquired after blood transfusion was estimated to
be 36% (8 of 22).
In the eight patients with posttransfusion non-A-E hepatitis, only one ( I 2.5%) had serum GBV-C RNA. The patient
with acute non-A-E PTH became GBV-C positive 1 month
after transfusion (Fig 2C). The GBV-C viremia persisted for
2 years, while ALT became normal 3 months after transfusion.
In the 30 GBV-C positive samples, 26 were positive for
HGV, while none of the 30 GBV-C negative samples were
positive for HGV sequences. The patient with acute non-AE PTH and GBV-C positivity was positive for HGV sequences.
DISCUSSION
Blood transfusion is a vital therapeutic intervention in
daily clinical practice, but it always carries the risk of bloodtransmitted viral infections, including human hepatitis viruses and retroviruses.'".'' The recently cloned human GBhepatitis like virus, GBV-C,' promptedour concern. Because
GBV-C viremia has been demonstrated in man, it maybe
transmitted through blood-borne infection and studying recipients of blood transfusion is the most likely way to document this possibility.
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
1884
WANG ET AL
The recently cloned HGV is closely related to GBV-C by
the high nucleotide and amino acid homologybetween these
two viruses.' In the same series of serum samples, our data
alsoshowed a high consistency of viremia of thesetwo
A
62
-
-
+
+
+
+
o ' , , , ,
OM
+
+
3M
6M
B
"
,
,
,
,
3Y
I
1
7Y
Time after trclarlhsion
I ;;;
B
1
700
-
-+-
++++++
-
i
600500
"_
+
-
100
0
OM
3M
6M
5Y 6Y
4YI 3Y
Y 2Y 3Y 4Y
Time after transfusion
c
RNA
-
-
+
++ +
1241
0 Iwk
4wk
viruses in different patients. These results suggested GBVC and HGV are probably identical.
When clinicalpresentations of posttransfusion GBV-C infection were compared with those of HCV, GBV-C seemed
not to cause evident hepatitis as that by HCV. The majority
(20 of 25, 80%) of posttransfusion GBV-C infected recipients had persistently normal levels of serum ALT, and most
(7 of 8, 87.5%) patientswhohaddocumented
non-A-E
hepatitis in our posttransfusion hepatitis study were negative
In the one patientwithnon-Afor serum GBV-C RNA.
E hepatitis and posttransfusion GBV-C/HGV infection, the
hepatitis was mild, and ALT didnot elevate duringa followup period of 2 years. Taken together, the results suggested
that GBV-C/HGV may not be a classic hepatotropic agent,
like hepatitis viruses A-E. However, caution must be taken
in interpreting these data because the casesinfected by GBVC/HGV in our series were limited in number, and GBV-C/
HGV may cause severe hepatitis in only a small proportion
ofinfectedpatients,as
was shown in arecent study that
this virus has been claimed to be associated with fulminant
hepatitis of unknown etiology.'' Another important implication of the low GBV-C/HGV positivity rate in posttransfusion non-A-E hepatitis is that perhaps there exists another
non-A-E, non-GBV-C/HGV hepatitis agent(s)
that can be
transmitted through blood transfusion.
In our study, we found a prevalence of GBV-C viremia
in 10% of the blood recipients. Because currently no serologictests are available, emergence of GBV-C viremiais
the only clue for acuteinfection of this virus. Although there
could be subjects with chronic intermittent viremia as shown
in the case depicted in Fig 2B and thus ostensibly fulfilled
the criterion, the low PCR positivity rate before transfusion
(1 S% v 9.8% posttransfusion, P < .O I ) suggested that most
of them were indeed infected through blood transfusion. On
the other hand,defining acute GBV-C infection by screening
the 6-month posttransfusion samples could miss some patients whose viremia were cleared within this short period.
However, theproportion seemed small as shown by our
preliminary results, and detection of viremia atan early stage
couldincludeGBV-CRNA
carried overfrom the donor
without true infection in the recipients. Taken together, the
infection rate in our study should be close to the real incidence, although serological testing is necessary to clarify it
in the future.
In those with posttransfusion GBV-C infection, the viral
genome was detected in the first serum sample 1 week posttransfusion and couldthenpersist
for as longas 8 years.
3M
4M
hM
Time aRer transfusion
+
+
Fig 2. Viremia and serum ALT levels of three patients with post0, pretransfusion. (A) A 43-year-old
transfusionGBV-Cinfection.
woman infectedwith GBV-C afterblood transfusion. Note thepersistently normal ALT levels (<31 IUIL) deeppite GBV-C viremia for up to
7 years. (B1 A 68-year-old woman coinfected with GBV-C and HCV
after blood transfusion. Note the intermittent GBV-C viremia and
persistent HCV viremia. The serum ALT levels are similar to those
infected by HCValone showing biphasicpeaks. (C) A49-year-old
male with non-A-E hepatitis and GBV-C infaction alone. Note the
transient mild ALT elevations of serum ALT levels that decrease to
normal range despite persistent GBV-C viremia.
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
TRANSFUSION-TRANSMITTED GBV-C INFECTION
This indicates that GBV-C may cause a chronic infection.
The chronicity rate was estimated to be 36% by the presence
of viremia for more than 6 months. However, the actual rate
might be lower if seroconversion instead of viremia at the
6-month sample after transfusion was adopted to diagnose
acute infection. The only risk factor associated with GBVC infection in our study was the number of blood donors.
Screening of anti-HCV inblood donors did not seem to
reduce the risk of GBV-C infection (8.8% v 8.0%, P > .l),
although many were coinfected by HCV and GBV-C before
the anti-HCV screening. We also found a 1.5% and 2%
GBV-C prevalence rate of viremia in the pretransfusion samples of the recipients and volunteer blood donors, respectively. The prevalence of GBV-C carriage in the Taiwanese
adult population should be close to this range. The risk of
transfusion-associated transmission in Taiwan was estimated
tobe approximately 0.46% per donor [34/(400 X 18.6) =
0.00461. However, because there could be a recipient receiving blood or its products from multiple GBV-C viremic donors, the actual risk could have been higher than this estimate. Because only donors from transfused plasmaand
whole blood were collected and the PCR assay might be
more sensitive than in vivo infectivity,” we did not calculate
the risk of transmission from the prevalence rate of viremic
donors.
The inapparent clinical symptoms and signs in the acute
GBV-C infected patients did not preclude the necessity for
further screening for this virus, as serious sequelae could
happen only in a small proportion of patients with chronic
viral infections. For example, the risk of anemia happened
in only some of those infected with parvovirus B19.l8 The
risk of the development of a tropical spastic paraparesis/
HTLV-I-associated myelopathy and adult T-cell leukemia
has been well documented in patients with HTLV-I infection,
yet onlya small proportion of those with long-standing infection had these complications.’9-23
In summary, we have documented the transmission of
GBV-CMGV through blood transfusion. Although we could
not find definite associations of this viral infection with hepatitis, we have shown chronicity of transfusion-acquired acute
GBV-CMGV infections. Some might develop significant sequelae after prolonged carriage of the virus. Therefore, a
longer follow-up in more GBV-CMGV infected subjects is
warranted. On the other hand, GBV-C/HGV infection in
patients with different hepatic and nonhepatic diseases
should also be studied to clarify other possible clinical implications of this infection. In the meantime, serologic assays
for markers of GBV-CMGV infection should also be developed to ravel the true frequencies of GBV-CMGV infection,
as well as for clinical diagnosis and, perhaps, also for donor
screening in the future.
REFERENCES
1. Japanese Red Cross Non-A, Non-B Hepatitis Research Group:
Effect of screening for hepatitis C virus antibody and hepatitis B
virus core antibody on incidence of posttransfusion hepatitis. Lancet
338:1040, 1991
2. Donahue JG, Munoz A, Ness PM, Brown DE Jr, Yawn DH,
McAllister HA Jr, Reitz BA, Nelson KE: The declining risk of
1885
posttransfusion hepatitis C virus infection. N Engl J Med 327:369,
1992
3. Deinhardt F, Holmes AW, Capps, R B , Popper H: Studies on
the transmission of disease of human viral hepatitis to marmoset
monkeys. I. Transmission of disease, serial passages and description
of liver lesions. J Exp Med 125:673, 1967
4. Simons JN, Pilot-Matias TJ, Leary TP, Dawson GJ, Desai SM,
Schlauder GG, Muerhoff AS, Erker JC, Bujik SI, Chalmers ML,
VanSant CL, Mushahwar IK: Identification of two flavivirus-like
genomes in the GBhepatitis agent. Proc Natl AcadSci USA 92:3401,
1995
5. Schlauder GG, Dawson GJ, Simons JN, Pilot-Matias TJ,
Gutierrez RA, Heynen CA, Knigge MF, Kurpiewski GS, Bujik SL,
Leary TP, Muerhoff AS, Desai SM, Mushahwar IK: Molecular and
serologic analysis in the transmission of the GB hepatitis agents. J
MedVirol46231, 1995
6. Muerhoff AS, Leary TP, Simons JN, Pilot-Matias TJ, Dawson
GI, Erker JC, Chalmers ML, Schlauder GG, Desai SM, Mushahwar
IK: Genomic organization of GB viruses A and B: Two new members of the Flaviviridae associated with GB agent hepatitis. J Virol
69:5621, 1995
7. Simons JN, Leary TP, Dawson GJ, Pilot-Matias TJ, Muerhoff
AS, Schlauder GG, Desai SM, Mushahwar IK: Isolation of novel
virus-like sequences associated with human hepatitis. Nature Med
1:564, 1995
8. Wang TH, Wang JT, Lin JT, Sheu JC, Sung JL, Chen DS: A
prospective study of posttransfusion hepatitis in Taiwan. J Hepatol
13:38, 1991
9. Linnen J, Wages J Jr, Zhang-Keck ZY, Fry KE, Krawczynski
KZ, Alter H, Koonin E, Gallagher M, Alter M, Hadziyannis S,
Karayiannis P, Fung K, Nakatsji Y, Shih JW-K, Young L, Piatak
M Jr. Hoover C, Fernandez J, Chen S, Zou J-C, Moms T, Hyams
KC, Ismay S, Lifson JD, Hess G, Foung SKH, Thomas H, Bradley
D, Margolis H, Kim J P Molecular cloning and disease association
of hepatitis G virus: A transfusion-transmissible agent. Science
271:505, 1996
10. Wang JT, Wang TH, Sheu JC, Lin JT, Wang CY, Chen DS:
Posttransfusion hepatitis revisited by hepatitis C antibody assays and
polymerase chain reaction. Gastroenterology 103:609, 1992
11. Wang JT, Lin MT, Chen PJ, Sheu JC, LinJT, Wang TH,
Chen DS: Transfusion-transmitted human T-cell lymphotropic virus
type I infection in Taiwan: A true risk and occasional coinfection
with hepatitis C virus shown in a prospective study. Blood 84:934,
1994
12. Wang JT, Wang TH, Sheu JC, Lin SM, Lin JT, Chen DS:
Effects of anticoagulants and storage of blood samples on efficacy
of the polymerase chain reaction assay for hepatitis C virus. J Clin
Microbiol 30:750, 1992
13. Wang JT, Wang TH, Sheu JC, Shih LN, Lin JT, Chen DS:
Detection of hepatitis B virus DNA by polymerase chain reaction
in plasma of volunteer blood donors negative for hepatitis B surface
antigen. J Infect Dis 163:397, 1991
14. Sayers MH: Transfusion-transmitted viral infections other
than hepatitis and human immunodeficiency virus infection, cytomegalovirus, Epstein-Barr virus, human herpesvirus 6, and human
parvovirus B19. Arch Path Lab Med 118:346, 1994
15. Wylie BR: Transfusion transmitted infection: viral and exotic
disease. Anaesth Intensive Care 21:24, 1993
16. Yoshiba M, Okamoto H, Mishiro S: Detection of the GBVC hepatitis virus genome inserum from patients with fulminant
hepatitis of unknown aetiology. Lancet 346:1131, 1995
17. Ulrich PP, Bhat RA, Seto B, Mack D, Sninsky J, Vyas GN:
Enzymatic amplication of hepatitis B virus DNA inserum compared
with infectivity testing in chimpanzees. J Infect Dis 160:37, 1989
18. Brown KE, Green SW, Antunez de Mayolo J, Bellanti JA,
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
1886
S m i t h SD, Smith TJ, Young NS: Congenital anaemia after transplacental B19 parvovirus infection. Lancet 343:895, 1994
19. Tokudome S , Tokunaga 0, Shimamoto Y, Miyamoto Y, Sumida I, Kikuchi M, Takeshita M, Ikeda T, Fujiwara K, Yoshihara
M: Incidence of adult T-cell leukernidlymphoma among human Tlymphotrophic virus type I carriers in Saga, Japan. Cancer Res
49:226, 1989
20. Hjelle B: Human T-cell leukemidlymphoma viruses. Life
cycle, pathogenecity, epidemiology, and diagnosis. Arch Pathol Lab
Med 115:440, 1991
21. Manns A, Blattner WA: The epidemiology of the human T-
WANG ET AL
cell lymphotropic virus type I and type 11: Etiologic role in human
disease. Transfusion 31 :67, 1991
22.Gout 0, Baulac M,Gessain A, Semah F, Saal F,Peries J,
Cabrol C, Foucault-Fretz C, LaplaneD,Sigaux F, deTheG:Rapid
development of myelopathy afterHTLV-I infection acquiredby transfusion during cardiac transplantation. N Engl J Med 322:383, 1990
23. Kaplan JE, Litchfield B, Rouault C, Lairmore MD, Luo CC,
Williams L, BrewBJ, Price RW, Janssen R, Stoneburner R, Ou
CY, Folks T, De B: HTLV-I-associated myelopathy associated with
blood transfusion in the United States: Epidemiologic and molecular
evidence linking donor and recipient. Neurology 41:192, 1991
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
1996 88: 1881-1886
A prospective study of transfusion-transmitted GB virus C infection:
similar frequency but different clinical presentation compared with
hepatitis C virus
JT Wang, FC Tsai, CZ Lee, PJ Chen, JC Sheu, TH Wang and DS Chen
Updated information and services can be found at:
http://www.bloodjournal.org/content/88/5/1881.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.