Download Universal DNA primers amplify bacterial DNA

Molecular Human Reproduction Vol.11, No.10 pp. 761–766, 2005
Advance Access publication October 27, 2005
doi:10.1093/molehr/gah234
Universal DNA primers amplify bacterial DNA from human
fetal membranes and link Fusobacterium nucleatum with
prolonged preterm membrane rupture
R.J.Cahill1, S.Tan2, G.Dougan3, P.O’Gaora1, D.Pickard1, N.Kennea2,
M.H.F.Sullivan4,5, R.G.Feldman2 and A.D.Edwards2
1
Department of Biological Sciences, Centre for Molecular Microbiology and Infection, Flowers Building, 2Department of Paediatrics,
Imperial College London, Hammersmith Campus, Du Cane Road, London, 3The Wellcome Trust Sanger Institute, Wellcome Trust
Genome Campus, Hinxton, Cambridge and 4Department of Obstetrics & Gynaecology, Imperial College London, Hammersmith Campus,
Du Cane Road, London, UK
5
To whom correspondence should be addressed at: Department of Obstetrics & Gynaecology, Institute of Reproductive &
Developmental Biology, Imperial College London, Hammersmith Hospital, Du Cane Road, London W12 0NN, UK.
E-mail: [email protected]
A large number of bacterial species have been identified in fetal membranes after preterm labour (PTL) associated with intrauterine infection by microbiological culture. In this study, we have investigated a molecular and bioinformatic approach to organism identification which surmounts the need for specific and diverse microbiological culture conditions required by conventional
methods. Samples of fetal membranes were taken from 37 preterm infants, and 6 normal term controls delivered by caesarean
section, in which bacteria had been detected by in situ hybridization of 16S ribosomal RNA using a generic probe. Degenerate
primers were designed to amplify bacterial 16S ribosomal DNA by PCR and used to amplify bacterial DNA from human fetal
membranes. Amplicons were cloned, sequenced and bacteria were identified bioinformatically by comparison of sequences with
known bacterial DNA genomes. In situ hybridization using an organism specific probe was then used to confirm the presence of
the commonest identified organism in tissue samples. Bacterial DNA amplified from 15/43 samples, all from preterm deliveries,
and the bioinformatic approach identified organisms in all cases. Multiple bacteria were identified including Mycoplasma hominis, Pasturella multocida, Pseudomonas PH1, Escherichia coli and Prevotella bivia. The commonest organism Fusobacterium
nucleatum was found in 9/15 (60%) of samples. Ten of the 12 samples obtained after prolonged membrane rupture were positive
for bacterial DNA, and 7 of these (70%) contained DNA from F. nucleatum. Bacteria from fetal membranes may be identified by
molecular and bioinformatic methods. Further work is warranted to investigate the apparent linkage between F. nucleatum, fetal
membrane rupture and preterm delivery.
Key words: 16S rDNA/fetal membranes/F. nucleatum/PTL
Introduction
Many studies have associated intrauterine infection with preterm
labour (PTL) and a series of fetal pathologies. The wide range of
organisms found suggests a general inflammatory response to any
organisms rather than a specific effect of pathogenic species (Romero
et al., 1989a) although recent studies have identified a link between
poor oral hygiene and poor pregnancy outcome and implicated oral
pathogens in PTL (Hill, 1998; Offenbacher et al., 1998; Carta et al.,
2004; Goepfert et al., 2004). Pregnancies from which organisms are
detected by microbiological culture often also show chorioamnionitis
(inflammatory changes in the fetal membranes) to the extent that the
latter has been used as a surrogate marker of the former (Steinborn
et al., 1996). Our recent data show that this simple relationship is not
tenable, as bacteria may be visualized by fluorescence in situ hybridization with a generic DNA probe to bacterial 16S ribosomal RNA in
the majority of term and preterm fetal membranes (Steel et al., 2005). The
term tissues showed no evidence of chorioamnionitis (Steel et al., 2005),
indicating that the mere presence of bacteria may not be sufficient to
cause an inflammatory response, suggesting that the link between bacteria and intrauterine inflammation is more complex than previously
suspected.
Different organisms may have different effects on fetal membranes,
but our study (Steel et al., 2005) provided no information on the species of bacteria present. For many years, identification of bacteria was
a complex process; a multitude of specific reagents would be needed
for immunohistochemistry, and microbiological culture can be complicated by the different growth requirements of bacteria and also by
the difficulty in growing some bacteria resulting in false-negative
data. A series of papers have shown that PCR-based methods, in
which DNA primers are selected to amplify defined parts of the bacterial genome can be used to identify organisms in a range of tissues and
samples (Greisen et al., 1994; Jalava et al., 1996; Hitti et al., 1997;
Gardella et al., 2004; Rinttila et al., 2004).
The first aim of this study was to identify a pair of primers that
would amplify DNA from many species of bacteria, which would be a
more generic approach than species-specific primers. We then aimed
© The Author 2005. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For
Permissions, please email: [email protected]
761
R.J.Cahill et al.
to apply the method to archive fetal membrane tissue, identify the bacteria present, and attempt to relate the data to pregnancy outcome.
Methods
Design of degenerate 16s rRNA PCR primers
The GenBank® nucleotide sequence database was searched using the Ovid
platform (Ovid, New York, NY, USA) for complete 16s rRNA sequences.
These sequences were aligned using ClustalW (Thompson et al., 1994).
Regions of variation were identified and marked within the sequences. The
conserved DNA sequences flanking these regions of DNA variation were then
used to design degenerate primers. Primers were designed with lengths ranging
from 14 to 25 bp. The primers designed were then analysed using the BLAST
programme and those primers sequences that recognized over 100 16s rRNA
sequences in the BLAST database were generated for use by ThermoHybaid
(MA, USA). Control non-degenerate 16s rRNA primers designed against conserved regions of 16s rRNA and used previously in clinical studies were also
generated (Parkhill et al., 2001). Previously validated and published primers
for human β-actin were also used in this study (Ace and Okulicz, 1995).
PCR methodology
The PCR primers used in the study are shown in Figure 1 and the exact
sequences in Table I. To standardize the location of the selected 16s rRNA
primers within the 16s rRNA, each primer sequence was mapped to the
Escherichia coli 16s rRNA gene. All PCR were optimized for the primer set and
carried out according to standard protocols in 50 ul reactions, using a reaction
mixture of 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris–HCl (pH 8.3), 200 μM of
each deoxynucleotide triphosphate and 2 U of Amplitaq DNA polymerase (PE
Applied Biosystems). Amplification reactions were carried out using an
ABgene® thermocycler (Epsom, Surrey, UK) employing the following conditions; 95°C × 1´, 35 cycles of 95°C × 30´, 50°C × 30´ and 72°C × 1´ and a final
elongation of 72°C × 5´. Control reactions were carried out for each PCR with
double distilled H2O replacing DNA to assess bacterial DNA contamination.
Cloning and sequencing of PCR amplicons
The PCR products were resolved by agarose gel electrophoresis and the amplicon of required size was extracted using the Qiaex II gel extraction kit (Quiagen) according to the manufacturers protocols. The resulting DNA was ligated
into the PCR®-TOPO® TA vector (Invitrogen) and transformed into One
Shot® Top 10 chemically competent E. coli (Invitrogen). Twelve clones per
sample were sequenced using ABI 3100 sequencing service at the Advanced
Biotechnology Centre (ABC, Imperial College, London, UK); previous experience indicates that this is sufficient to identify the main bacteria present. To
confirm this, 50 clones from one sample were sequenced, and no additional
sequences were found other than those in the first 12 samples sequenced. All
sequencing results obtained were analysed using the BLAST programme and
the resulting alignments analysed (Altschul et al., 1990).
Isolation of bacterial DNA
Bacterial-type strains were obtained from the NCTC, and clinical isolates were
provided by Microscience, Reading, UK, and Mr Michael Quail of the Pathogen Sequencing Unit at The Wellcome Trust Sanger Institute, Cambridge, UK.
Each bacterial strain was cultured as per individual requirements. DNA was
isolated using the DNeasy Tissue DNA extraction kit (Quiagen) modified for
Gram-negative and Gram-positive bacteria as per manufacturers’ instructions.
Figure 1. Schematic of 16S ribosomal DNA gene, showing location of primers and generic probe relative to the genome of Escherichia coli.
762
Patient samples
Approval for this study was obtained from the Hammersmith Hospitals Trust
Research Ethics Committee, and all parents gave consent. Fetal membranes
(amnion, chorion and adherent decidua) from 43 women (6 women after
uncomplicated term deliveries by caesarean section, 37 women after preterm
delivery) were obtained within 30 min of delivery and placed in phosphatebuffered saline (PBS) supplemented with penicillin-streptomycin to limit further bacterial growth. Tissue samples (∼200 mg) were frozen in liquid nitrogen
and kept at –80°C until further study, and matched samples were fixed in formalin and stored in 70% ethanol : 30% water. Data from these pregnancies are
summarized in Table II. The preterm delivery groups are defined as follows:
preterm not in labour (PNIL), infants delivered by caesarean section, for worsening maternal or fetal health due to pre-eclampsia (with or without fetal
growth restriction); PTL, infants delivered from women in PTL but no evidence of fetal membrane rupture and prolonged rupture of fetal membranes
(PROM), infants delivered from women in PTL at least 24 h after rupture of
fetal membranes. Women in PTL were all treated with augmentin, and women
with PROM were treated with erthyromycin.
A single fixed fetal membrane sample was processed for histological assessment, with a positive diagnosis of chorioamnionitis based on the presence of at
least 10 polymorphonuclear leukocytes per 400-power field in the fetal membrane sample. All methods to isolate, amplify and sequence bacterial DNA
were carried out using aseptic technique, filtered tips and sterile reagents to
avoid contamination with environmental bacteria. DNA was extracted from the
membrane tissue using the DNeasy tissue extraction kit (Quiagen) according to
the manufacturers’ instructions. The DNA was resuspended in 200 μl of
double distilled H2O and stored at –20°C.
The integrity of the human DNA from these extractions was confirmed by
amplification of β-actin using specific primers (Table I), and this was successful in all cases. Bacterial DNA was amplified by PCR using the degenerate
generic primers identified in the first part of the study: the Forward primer was
CCTACGGRSGCAGCAG (16s2F) and the Reverse primer was GGACTACCMGGGNTATCTAATCCKG (16s4R). PCR products were ligated into the
PCR®-TOPO® TA vector (Invitrogen), cloned and sequenced as described
above. All sequencing results obtained were analysed using the BLAST programme and the resulting alignments analysed (Altschul et al., 1990).
Fluorescent in-situ hybridization for bacteria
Flourescent in-situ hybridization (FISH) was used to demonstrate the presence
of bacteria in fetal membranes, using the method described previously (Steel
et al., 2005). In brief, fixed paraffin-embedded tissues were cut using a sterile
approach and the sections mounted on poly-L-lysine coated slides. Sections
were treated with proteinase K before incubation with a generic probe to 16S
ribosomal RNA (5´-F-ACTGCTGCCTCCCGTAGGAGTTTATTCCTT). A
subset of fetal membrane samples were also used for FISH with a specific
probe to the most common organism, Fusobacterium nucleatum. This probe
was designed using the ARB software and ARB database (ARB—a software
environment for sequence data, http://www.arb-home.de). The sequence used
was CGCAAAGCTCTCTCACAG, and the technique was the same as with
the generic probe (Steel et al., 2005).
Results
The primer sequences identified from the databases were tested on
bacterial DNAs, with the results summarized in Table III. Only the
combination of 16s2F and 16s4R amplified DNA from the 12 species
tested and showed no additional bands. This pair of primers was used
to test DNA from a further 25 species, all of which were amplified
successfully (Bacteroides fragilis, Citrobacter rodentium, Clostridium perfringens, Escherichia coli K12, F. nucleatum, Mycoplasma
bovis, Niesseria meningitides, Salmonella paratyphi, Streptococcus
pneumoniae, Bordellata pertussis, Burkholderia cepacia, Campylobacter jejuni, Chlamydia trachomitis, Clavibacter michagenanesis,
Erwinia amylovara, Haemophilus influenzae, Helicobacter mustalae,
Photorhabus asymbiotica, Proteus mirabilis, Rhizobium leguminosarum, Shigella sonnei, Staphylococcus aureus MSSA, Streptomyces
scabies, Vibrio salmoncida and Yersinnia enterocolitica). To confirm
Molecular identification of organisms in fetal membranes
Table I. Summary of primers investigated in this study (reference)
Primer name
Location
Sequence 5´–3´
Actin F (15)
Actin R (15)
16sRNA1 (14) Salmonella typhi
16sRNA2 (14) Salmonella typhi
16s1F
16s2F
16s4R
16s5R
16s6R
16s7R
–
–
GCACACTTTAGCCGTGTTATTTGCACTTCT
AGGCGTACAGGGATAGCACAGCCTGGATAG
GTGAAATGCGTAGAGATCTGGAGG
CGAGCTGACGACAGCCATGC
GTGCSAGCANGCCGCGGTAATAC
CCTACGGRSGCAGCAG
GGACTACCMGGGNTATCTAATCCKG
CATTYCTTTRAGTT
GAGCTGACGACAGCCATGC
GACGTCNTCCCCACCTTCC
648–671
1011–1031
58–78
299–320
741–764
866–880
1011–1030
1131–1151
Location is relative to Escherichia coli 16S rRNA gene.
Table II. Summary of clinical information from pregnancies included in this study
Gestation at
Delivery (weeks)
Birthweight (g)
Delivery type
Pre-eclampsia
IUGR
Membrane
Rupture (h)†
Dexamethasone
Chorioamnionitis
Term (6)
PNIL (11)
PTL (14)
PROM (12)
Term*
Normal*
CS (6)
0
0
26.2–32.0
602–1668
CS (11)
11 (4 with IUGR)
0
23.3–31.0
478–2040
CS (4), V (10)
2 (1 with IUGR)
1
23.5–31.2
652–1530
CS (7), V (5)
0
0
0
0
0/6
0
11
0/11
0
14
6/14
30–816
12
11/12‡
CS, caesarean section; IUGR, intrauterine growth restriction; PNIL, preterm delivery not in labour; PROM, prolonged
rupture of fetal membranes; PTL, preterm labour; V, vaginal delivery.
Ranges are given for gestational ages and birthweights of preterm deliveries.
*Gestational age and birthweight were not specifically recorded from term deliveries but known to be within normal
ranges.
†The period of time from membrane rupture until delivery of the infant.
‡P < 0.05 by χ2 compared with other preterm delivery groups.
Table III. Comparison of primer sets designed to amplify bacterial 16s rDNA using a range of bacterial species
Bacterial species
Source RNA1 + RNA2 16s1F + 16s5R 16s2F + 16s5R 16s1F + 16s4R 16s2F + 16s4R 16s2F + 16s6R 16s2F + 16s7R
Enteropathogenic Escherichia coli
Enterohaemorrhagic Escherichia coli
Salmonella typhi
Citrobacter rodentium
Helicobacter pylori
Group A Streptococcus (NC8191)
Neisseria meningitidis (MC38)
Pasteurella multocida
Salmonella enteriditis
Staphylococcus epidermis (SL61)
Group B Streptococcus (A909)
Staphylococcus aureus (MH20)
Control (no DNA)
DNA
DNA
DNA
DNA
DNA
DNA
DNA
DNA
DNA
Culture
Culture
Culture
–
+
+
+
+ (+)
+ (+)
+
+ (++)
+ (++)
+ (++)
+ (++)
+
+ (++)
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
+
–
–
–
+
+
+
+
–
+
–
+
–
+
+
+
+
+
+
+
+
+
+
+
+
–
+
+
–
–
+
+
+
+
–
+
+
+
–
–
+
–
–
+
+
+
+
+
+
–
+
–
The results are expressed as + or – based on the presence of an amplicon of predicted size. The number of non-specific amplicons is shown within parentheses. +, 1;
++, 2 non-specific bands.
that the amplified DNA was of the correct sequence, two separate
clones from five bacteria (Citrobacter rodentium, Enterohaemorrhagic E. coli, F. nucleatum, Pasteurella multocida and Salmonella
enterica serovar Typhimurium) were sequenced. All sequences
obtained showed 100% homology with the database sequences, indicating that correct amplification had been achieved.
DNA was extracted from 43 fetal membrane samples as indicated
above. PCR with the β-actin primers succeeded for all samples, indicating that the human DNA had not been damaged during extraction.
Bacterial 16S rDNA sequences were amplified from 15 of the 43 samples investigated, as summarized in Table IV. Most of the samples
from which bacterial DNA was amplified were from pregnancies with
PROM (Table IV). Reorganization of the data revealed that there was
a close correlation between chorioamnionitis and the success of PCR
(Table IV).
F. nucleatum was the most commonly detected organism, being present
in 9 of the 15 samples (60%) that contained bacterial DNA (Table IV).
DNA from other organisms (Mycoplasma hominis, P. multocida,
763
R.J.Cahill et al.
Table IV. Histological and 16s rDNA PCR amplification results from human fetal membrane tissues
Study group
n
Chorioamnionitis
positive [n (%)]
Positive 16s rDNA
[n (%)]
Term/preterm no labour
Preterm labour no PROM
17
14
0 (0)
7 (50)
1 (6)
4 (28)
Preterm labour PROM
12
11 (92)
10 (83)*
Histological chorioamnionitis
18
18 (100)
13 (72)*
No histological chorioamnionitis
24
0 (0)
2 (8)
Bacteria identified
Fusobacterium nucleatum/Mycoplasma hominis (1)
Mycoplasma hominis (2)
Pseudomonas (1)
Fusobacterium nucleatum/Mycoplasma hominis (1)
Fusobacterium nucleatum (6)
Pseudomonas (1)
Escherichia coli (1)
Prevotella bivia (1)
Fusobacterium nucleatum/Mycoplasma hominis/Pasturella multocida (1)
Fusobacterium nucleatum (6)
Mycoplasma hominis (2)
Pseudomonas (1)
Escherichia coli (1)
Prevotella bivia (1)
Fusobacterium nucleatum/Mycoplasma hominis (1)
Fusobacterium nucleatum/Mycoplasma hominis/Pasturella multocida (1)
Fusobacterium nucleatum/Mycoplasma hominis (1)
Pseudomonas (1)
PROM, prolonged rupture of fetal membranes.
Chorioamnionitis positive is defined as a minimum of 10 polymorphonuclear lymphocytes/400 power field. Positive PCR is defined as PCR which resulted in
amplification and sequencing of bacterial 16s DNA.
*P < 0.05 by χ2 compared with other patient groups.
Pseudomonas PH1, E. coli and Prevotella bivia) was detected less frequently as shown. Three samples revealed polymicrobial infection
(Table IV); all three contained F. nucleatum and M. hominis, and one
also contained P. multocida. Seven of the nine samples (77.8%) which
contained DNA for F. nucleatum (alone or with other organisms) were
from tissues obtained after prolonged membrane rupture (P < 0.05
by χ2 compared with the incidence in tissues from pregnancies not
complicated by prolonged membrane rupture).
The presence of bacteria in the fetal membranes was confirmed by
FISH with the generic probe used in our recent study.7 All the samples
used contained organisms, and typical data are shown in Figure 2a.
FISH with a specific probe was also used to localize F. nucleatum in
fetal membranes and typical data are shown in Figure 2b. Three different fetal membrane samples obtained after PROM that were positive for F. nucleatum by PCR and sequencing were also positive by
FISH. No positive hybridization with the F. nucleatum-specific probe
was observed in five different tissue samples (both term and preterm)
that were negative for F. nucleatum by PCR and sequencing; these
samples were positive for bacteria by generic FISH.
Discussion
We describe methods that may be used to amplify DNA from many
different species of micro-organisms, and use this DNA to identify the
organisms present in human fetal membrane tissues. The bioinformatics proved to be extremely reliable; submission of each DNA
sequence obtained provided a positive match with a known bacterial
16S rDNA, and in three cases showed polymicrobial infection.
All the tissues studied were positive for bacteria by FISH, but PCR
succeeded only in 15 of the 43 samples (35%). Eschenbach and
coworkers have used similar methods to show the presence of bacteria
(Hitti et al., 1997) and identify bacteria (Gardella et al., 2004) in
amniotic fluid, but not all their samples were positive by PCR and
sequencing. More work seems to be needed to improve the efficiency
Figure 2. Fluorescence in-situ hybridization (FISH) with a generic probe to bacterial 16S rRNA (a) or with a probe specific for Fusobacterium nucleatum (b).
Organisms stain strongly positive (arrowheads) against background autofluorescence. Scale bar, 10 μM.
764
Molecular identification of organisms in fetal membranes
of this stage of the analysis, although reasons for this should be considered. One possibility is a ‘mass-effect’, whereby a minimum
number of organisms are needed to obtain a PCR amplicon, in contrast to the visualization of single organisms by FISH. A quantitative
study has shown that real-time quantitative PCR has a detection limit
of 30–4500 bacterial genomes when specific DNA primers are used
(Rinttila et al., 2004), indicating that there may be a limit to this type
of approach. The human DNA was of sufficient quality in all samples
for PCR with primers for β-actin to succeed, so it seems unlikely that
bacterial DNA has been lost.
All the organisms we identified (F. nucleatum, M. hominis, P. multocida, Pseudomonas PH1, E. coli and P. bivia) from the sequence databases have been reported previously in tissues obtained after PTL,
indicating that our data are consistent with previous data. Bacterial 16S
ribosomal DNA was successfully sequenced from PROM and some
PTL tissues, but less frequently from preterm no labour (1/11) and term
tissues (0/6) (Table IV). The close relationship between identifying bacterial DNA and chorioamnionitis (Table IV) reflects previous studies
linking ‘infection’ with chorioamnionitis (Steinborn et al., 1996). The
most common organism identified was F. nucleatum. Many papers have
reported that this organism is commonly found in tissues with chorioamnionitis (Altshuler and Hyde, 1985, 1988), as well as after PTL
(Romero et al., 1992; Bearfield et al., 2002), but this seems to be the
clearest link with PROM reported so far. The haematogenous spread of
F. nucleatum can cause PTL in mice (Han et al., 2004), a finding which
mirrors the proposed impact of this organism in human pregnancy.
The detailed mechanisms through which F. nucleatum causes PTL
have not been addressed in this study, and this requires further investigation. It should be noted that F. nucleatum is a Gram-negative organism
which will therefore have an outer layer of lipopolysaccharide (LPS).
LPS (usually from E. coli) is a potent activator of prostaglandin and
cytokine production from human fetal membranes (Rajasingam et al.,
1998; Alvi et al., 1999) and from the constituent amnion, chorion and
decidua (Romero et al., 1989b; Dudley et al., 1992a,b, 1993; Mitchell
et al., 1993), and live bacteria can have similar effects (Rajasingam et al.,
1998). We anticipate that live F. nucleatum and LPS from these organisms will induce type-2 cyclo-oxygenase (and hence prostaglandin production), and inflammatory cytokine output from fetal membranes,
which will parallel the changes observed in these factors during labour.
It is interesting to note that many studies have implicated Ureaplasma urealyticum as a common cause of PTL and subsequent complications (McDonald and Chambers, 2000; Berger et al., 2003; Gerber
et al., 2003), but we did not detect it, even though Gerber and coworkers used a very similar molecular approach to ours. We suggest that this
is because U. urealyticum is primarily an organism found in fluids (e.g.
urine, amniotic fluid), and the cells contacting them, rather than within
tissues. Our samples would have mostly organisms within the tissues,
rather than those on the surface of the amniotic epithelium, and this may
explain the difference between the earlier study and our findings.
This new molecular and bioinformatics approach provides a new
method to investigate the associations between particular intrauterine
organisms and pregnancy outcome, avoiding the need for multiple
microbiological culture. F. nucleatum was associated with prolonged
fetal membrane rupture before delivery, and this apparent linkage
requires further study.
Acknowledgements
We thank MicroScience for funding this study.
References
Ace CI and Okulicz WC (1995) Differential gene regulation by estrogen and
progesterone in the primate endometrium. Mol Cell Endocrinol 115,95–103.
Altschul SF, Gish W, Miller W, Myers EW and Lipman DJ (1990) Basic local
alignment search tool. J Mol Biol 215,403–410.
Altshuler G and Hyde S (1985) Fusobacteria. An important cause of chorioamnionitis. Arch Pathol Lab Med 109,739–743.
Altshuler G and Hyde S (1988) Clinicopathologic considerations of fusobacteria chorioamnionitis. Acta Obstet Gynecol Scand 67,513–517.
Alvi SA, Rajasingam D, Brown NL, Bennett PR, Elder MG and Sullivan MHF
(1999) The production of interleukin-1β from human fetal membranes is not
obligatory for increased prostaglandin output. Immunology 97,249–256.
Bearfield C, Davenport ES, Sivapathasundaram V and Allaker RP (2002) Possible association between amniotic fluid micro-organism infection and
microflora in the mouth. BJOG 109,527–533.
Berger A, Witt A, Haiden N, Kretzer V, Heinze G and Kohlhauser C (2003)
Microbial invasion of the amniotic cavity at birth is associated with adverse
short-term outcome of preterm infants. J Perinat Med 31,115–121.
Carta G, Persia G, Falciglia K and Iovenitti P (2004) Periodontal disease and
poor obstetrical outcome. Clin Exp Obstet Gynecol 31,47–49.
Dudley DJ, Trautman MS, Araneo BA, Edwin SS and Mitchell MD (1992a)
Decidual cell biosynthesis of interleukin-6: regulation by inflammatory
cytokines. J Clin Endocrinol Metab 74,884–889.
Dudley DJ, Trautman MS, Edwin SS, Lundin-Schiller S and Mitchell MD
(1992b) Biosynthesis of interleukin-6 by cultured human chorion laeve
cells: regulation by cytokines. J Clin Endocrinol Metab 75,1081–1086.
Dudley DJ, Trautman MS and Mitchell MD (1993) Inflammatory mediators
regulate interleukin-8 production by cultured gestational tissues: evidence
for a cytokine network at the chorio-decidual interface. J Clin Endocrinol
Metab 76,404–410.
Gardella C, Riley DE, Hitti J, Agnew K, Krieger JN and Eschenbach D (2004)
Identification and sequencing of bacterial rDNAs in culture-negative amniotic fluid from women in premature labor. Am J Perinatol 21,319–323.
Gerber S, Vial Y, Hohlfeld P and Witkin S (2003) Detection of Ureaplasma
urealyticum in second-trimester amniotic fluid by polymerase chain reaction correlates with subsequent preterm labor and delivery. J Infect Dis
187,518–521.
Goepfert AR, Jeffcoat MK, Andrews WW, Faye-Petersen O, Cliver SP,
Goldenberg RL and Hauth JC (2004) Periodontal disease and upper genital
tract inflammation in early spontaneous preterm birth. Obstet Gynecol
104,777–783.
Greisen K, Loeffelholz M, Purohit A and Leong D (1994) PCR primers and
probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol 32,335–351.
Han YW, Redline RW, Li M, Yin L, Hill GB and McCormick TS (2004) Fusobacterium nucleatum induces premature and term stillbirths in pregnant mice:
implication of oral bacteria in preterm birth. Infect Immun 72,2272–2279.
Hill GB (1998) Preterm birth: associations with genital and possibly oral
microflora. Ann Periodontol 3,222–232.
Hitti J, Riley DE, Krohn MA, Hillier SL, Agnew KJ, Krieger JN and Eschenbach DA (1997) Broad-spectrum bacterial rDNA polymerase chain reaction
assay for detecting amniotic fluid infection among women in premature
labor. Clin Infect Dis 24,1228–1232.
Jalava J, Mantymaa ML, Ekblad U, Toivanen P, Skurnik M, Lassila O and
Alanen A (1996) Bacterial 16S rDNA polymerase chain reaction in the
detection of intra-amniotic infection. Br J Obstet Gynaecol 103,664–669.
McDonald HM and Chambers HM (2000) Intrauterine infection and spontaneous midgestation abortion: is the spectrum of microorganisms similar to that
in preterm labor? Infect Dis Obstet Gynecol 8,220–227.
Mitchell MD, Trautman MS and Dudley DJ (1993) Cytokine networking in the
placenta. Placenta 14,249–275.
Offenbacher S, Jared HL, O’Reilly PG, Wells SR, Salvi GE, Lawrence HP,
Socransky SS and Beck JD (1998) Potential pathogenic mechanisms of periodontitis associated pregnancy complications. Ann Periodontol 3,233–250.
Parkhill J, Dougan G, James KD, Thomson NR, Pickard D, Wain J, Churcher
C, Mungall KL, Bentley SD, Holden MT et al. (2001) Complete genome
sequence of a multiple drug resistant Salmonella enterica serovar Typhi
CT18. Nature 413,848–852.
Rajasingam D, Bennett PR, Alvi SA, Elder MG and Sullivan MHF (1998)
Stimulation of prostaglandin production from intact human fetal membranes
by bacteria and bacterial products. Placenta 19,301–306.
Rinttila T, Kassinen A, Malinen E, Krogius L and Palva A (2004) Development of an extensive set of 16S rDNA-targeted primers for quantification of
pathogenic and indigenous bacteria in faecal samples by real-time PCR. J
Appl Microbiol 97,1166–1177.
Romero R, Sirtori M, Oyarzun E, Avila C, Mazor M, Callahan R, Sabo V,
Athanassiadis AP and Hobbins JC (1989a) Infection and labor. V. Prevalence,
765
R.J.Cahill et al.
microbiology, and clinical significance of intraamniotic infection in
women with preterm labor and intact membranes. Am J Obstet Gynecol
161,817–824.
Romero R, Wu YK, Brody DT, Oyarzun E, Duff GW and Durum SK (1989b)
Human decidua: a source of interleukin-1. Obstet Gynecol 73,31–34.
Romero R, Gonzalez R, Sepulveda W, Brandt F, Ramirez M, Sorokin Y,
Mazor M, Treadwell MC and Cotton DB (1992) Infection and labor. VIII.
Microbial invasion of the amniotic cavity in patients with suspected cervical
incompetence: prevalence and clinical significance. Am J Obstet Gynecol
167,1086–1091.
Steel JH, Malatos S, Kennea N, Edwards AD, Miles L, Duggan P, Reynolds
PR, Feldman RG and Sullivan MHF (2005) Bacteria and inflammatory
766
cells in fetal membranes do not always cause preterm labour. Pediatr Res
57,404–411.
Steinborn A, Gunes H, Roddiger S and Halberstadt E (1996) Elevated placental cytokine release, a process associated with preterm labor in the absence
of intrauterine infection. Obstet Gynecol 88,534–539.
Thompson JD, Higgins DG and Gibson TJ (1994) CLUSTAL W: improving
the sensitivity of progressive multiple sequence alignment through sequence
weighting, positions-specific gap penalties and weight matrix choice.
Nucleic Acids Res 22,4673–4680.
Submitted on July 18, 2005; revised on September 19, 2005; accepted on
September 22, 2005