Download Analysis of forkhead and snail expression reveals

Developmental Biology 275 (2004) 389 – 402
www.elsevier.com/locate/ydbio
Analysis of forkhead and snail expression reveals epithelial–mesenchymal
transitions during embryonic and larval development of
Nematostella vectensis
Jens H. Fritzenwanker1, Michael Saina1, Ulrich Technau*,1
Molecular Cell Biology, Institute for Zoology, Darmstadt University of Technology, 64287 Darmstadt, Germany
Received for publication 22 June 2004, revised 10 August 2004, accepted 12 August 2004
Available online 16 September 2004
Abstract
The winged helix transcription factor Forkhead and the zinc finger transcription factor Snail are crucially involved in germ layer formation
in Bilateria. Here, we isolated and characterized a homolog of forkhead/HNF3 (FoxA/group 1) and of snail from a diploblast, the sea
anemone Nematostella vectensis. We show that Nematostella forkhead expression starts during late Blastula stage in a ring of cells that
demarcate the blastopore margin during early gastrulation, thereby marking the boundary between ectodermal and endodermal tissue. snail,
by contrast, is expressed in a complementary pattern in the center of forkhead-expressing cells marking the presumptive endodermal cells
fated to ingress during gastrulation. In a significant portion of early gastrulating embryos, forkhead is expressed asymmetrically around the
blastopore. While snail-expressing cells form the endodermal cell mass, forkhead marks the pharynx anlage throughout embryonic and larval
development. In the primary polyp, forkhead remains expressed in the pharynx. The detailed analysis of forkhead and snail expression
during Nematostella embryonic and larval development further suggests that endoderm formation results from epithelial invagination,
mesenchymal immigration, and reorganization of the endodermal epithelial layer, that is, by epithelial–mesenchymal transitions (EMT) in
combination with extensive morphogenetic movements. snail also governs EMT at different processes during embryonic development in
Bilateria. Our data indicate that the function of snail in Diploblasts is to regulate motility and cell adhesion, supporting that the triggering of
changes in cell behavior is the ancestral role of snail in Metazoa.
D 2004 Elsevier Inc. All rights reserved.
Keywords: Nematostella; Cnidaria; Forkhead; Snail; Gastrulation; Endoderm; Mesoderm; Epithelial–mesenchymal transition
Introduction
In most Bilateria, the formation of the two inner germ
layers, endoderm and mesoderm, is intimately linked
during the process of gastrulation. In vertebrates, endodermal and mesodermal cells immigrate or invaginate
together as endomesoderm and become separated morpho* Corresponding author. Molecular Cell Biology, Institute for Zoology,
Darmstadt University of Technology, Schnittspahnstr. 10, 64287 Darmstadt,
Germany. Fax: +49 6151 166077.
E-mail addresses: [email protected],
[email protected] (U. Technau).
1
Present address: Sars International Centre for Marine Molecular
Biology, Thormbhlensgt. 55, N-5008 Bergen, Norway.
0012-1606/$ - see front matter D 2004 Elsevier Inc. All rights reserved.
doi:10.1016/j.ydbio.2004.08.014
logically only later during gastrulation. The evolutionary
origin of the mesoderm is currently a matter of intense
investigation, but still not clear (reviewed in Martindale et
al., 2002; Technau, 2001; Technau and Scholz, 2003).
Some evidence from the two major diploblastic phyla,
Cnidaria and Ctenophora, support the view of an endodermal origin of the mesoderm (Martindale and Henry,
1999; Martindale et al., 2004; Spring et al., 2000, 2002;
Technau and Bode, 1999; Wikramanayake et al., 2003).
However, other molecular data suggest that the third germ
layer arose from the blastopore region with contributions
from both ectoderm and endoderm (Scholz and Technau,
2003; Technau and Bode, 1999; for review, see Technau,
2001; Technau and Scholz, 2003).
390
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
The evolution of the bilaterian foregut is also debated.
Textbook knowledge postulates that foregut (and mouth)
formation in Protostomes and Deuterostomes is fundamentally different and evolved convergently (Grobben, 1908;
Nielsen, 1995). However, similar expression of conserved
transcription factors in the foregut anlage of basal
deuterostome and protostome ciliary larva challenged this
view and suggested a conserved molecular regulation of
mouth development and homology of the foregut in
Bilateria (Arendt et al., 2001). The foregut is of great
interest because it is the boundary between ectoderm and
endoderm. In insects, both foregut (stomodeum) and
hindgut (proctodeum) are regarded as an ectodermal
derivative because in the adult these structures have a
chitinized cuticula.
One of the crucial conserved genes for mesoderm
formation in Bilateria codes for the zinc finger transcription factor Snail (reviewed by Nieto, 2002). In insects,
snail has been shown to repress the expression of
neuroectodermal genes thereby marking the boundary
between mesodermal and neurogenic region in the
Drosophila embryo (Ip et al., 1992; Leptin, 1991). In
vertebrates, snail function has been implicated in epithelial–mesenchymal transitions of migrating cells of the
developing mesoderm and of the neural crest (Cano et al.,
2000; Carver et al., 2001; Ikenouchi et al., 2003; Linker et
al., 2000; reviewed by Savagner, 2001). Snail has also
been isolated from Podocoryne carnea, a hydrozoan
cnidarian and from the coral Acropora millepora (Hayward
et al., 2004; Spring et al., 2002). Podocoryne snail is
expressed in the entocodon of the developing medusa bud,
suggesting a role in muscle development of the medusa
(Spring et al., 2002), while Acropora snail is expressed in
the endoderm during embryogenesis indicating a role in
germ layer specification (Hayward et al., 2004).
A conserved marker gene for the foregut in Bilateria
codes for the winged helix transcription factor Forkhead.
The founder member forkhead is expressed in the foregut
and hindgut anlage in Drosophila (Weigel et al., 1989).
Forkhead belongs to the group 1/HNF3/FoxA subfamily. In
vertebrates, three highly related HNF3 genes, alpha, beta,
and gamma, exist which differ by the timing and location of
expression (reviewed by Kaestner et al., 1994; Lai et al.,
1993). In particular, HNF-3beta plays a crucial role during
early vertebrate development. In mice and frogs, HNF-3beta
is expressed in the organizer (node) and in the derivatives,
the notochord but also the floor plate (Ang and Rossant,
1994; Dirksen and Jamrich, 1992; Knöchel et al., 1992;
Ruiz i Altaba and Jessell, 1992; Sasaki and Hogan, 1993).
HNF-3beta is involved in formation of the dorsoventral
axis, as HNF-3beta / mice mutants have defects in the
DV patterning of the neural tube and of the dorsal
mesoderm (Ang and Rossant, 1994; Ruiz i Altaba and
Jessell, 1992; reviewed by Cunliffe and Ingham, 1999;
McMahon, 1994). It also has a conserved role in mesoderm
formation in a dose-dependent manner and acts synergisti-
cally with brachyury to specify axial mesoderm in chordates
(O’Reilly et al., 1995; Shimauchi et al., 2001).
In insects, forkhead plays a conserved role in terminal
patterning and formation of the foregut and hindgut anlage
(Hoch and Pankratz, 1996; Kusch and Reuter, 1999;
Schröder et al., 2000; Weigel et al., 1989). The first
forkhead homolog, from a diploblast, budhead, was isolated
from the hydrozoan Hydra (Martinez et al., 1997). budhead
is expressed in the hypostome, the polyps’ mouth and
appears to have a role in axial patterning (Martinez et al.,
1997). The role of forkhead during cnidarian embryogenesis, however, is unknown. Since Hydra embryogenesis
is highly derived and not easily accessible at all stages
(Martin et al., 1997), we turned to a new model organism,
the anthozoan Nematostella vectensis. Anthozoa are
regarded as the basal group among Cnidaria (Bridge et al.,
1992, 1995; Collins, 2002) and embryogenesis in Nematostella is inducible and readily accessible (Hand and
Uhlinger, 1992; Fritzenwanker and Technau, 2002). Here,
we report the isolation and characterization of forkhead and
snail homologs from Nematostella vectensis. Our analysis
shows that forkhead is expressed at the blastopore margin,
that is, the boundary between ectoderm and endoderm and it
marks the presumptive pharynx of the primary polyp. By
contrast, snail has a virtually complementary expression
pattern and marks all ingressing endodermal cells. The
detailed analysis of forkhead and snail expression highlights that endoderm formation in this basal cnidarian is
characterized by a relatively complex cellular behavior
involving epithelial–mesenchymal transitions and morphogenetic movements.
Materials and methods
Animal culture and induction of gametogenesis
Since Nematostella vectensis lives in brackish water,
animals were kept in 1/3 artificial seawater (Hand and
Uhlinger, 1992) at 188C in the dark and fed five times a
week with brine shrimp naupliae. Induction of gametogenesis was carried out as described before (Fritzenwanker
and Technau, 2002). Oocytes were fertilized in vitro. This
resulted in synchronization of development in most embryos
and allowed a detailed staging. To get access to early
embryos, the jelly of the egg packages was dissolved in
cysteine as described (Fritzenwanker and Technau, 2002).
Developmental time until metamorphosis into primary
polyps was roughly 10–12 days at 188C.
Isolation of forkhead and snail from Nematostella
A full-length cDNA clone of Nematostella snail was
isolated in an EST screen from mixed embryonic stages
(U.T. and Thomas Holstein, unpublished). The sequence
was deposited at Genbank (accession number AY651960).
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
Embryonic first strand cDNA was used as a template to
isolate a full-length clone of forkhead by PCR with the
following nested degenerated primers and subsequent
RACE: fkh5outer CAY GCN AAR CCN CCN TA; fkh3outer
CA NCC RTT YTC RAA CAT RTT; fkh3inner TC NGG
RTG NAR NGT CCA. For 3V RACE of Nematostella
forkhead FKH1: AAGCCGCCCTATTCATATATCTC and
the nested primer FKH4a: CATGGACTTGTTTCCCTACTACA was used. For 5V RACE FKH6c: AGTGTCCAGTA A C T G C C T T T T C a n d t h e n e s t e d F K H 4 b :
GTAGTAGGGAAACAAGTCCATGA was used. For 5V
RACE we used Gene Racer kit (Invitrogen); 3V RACE was
performed according to Frohman et al. (1988) with the
appropriate primers. PCR conditions varied depending on the
experiments and can be obtained upon request from the
authors. Fragments of expected size were cloned into TA
cloning vector pGEM-T (Promega) and sequenced. The
resulting full-length cDNA was reamplified from first strand
cDNA (GenBank accession number AY457634). While this
paper was in preparation, Martindale et al. (2004) independently reported the identification of a forkhead and a
snailA homologue from Nematostella vectensis, which are
N95% identical on the nucleic acid level. The differences
probably reflect polymorphic forms of the genes.
In situ hybridization
The procedure of the in situ hybridization was based on
the protocol of Scholz and Technau (2003), with the
following changes. Specimens were fixed in 4% MEMPFA
containing 0.0625% glutaraldehyde for 10 min or 3 h, and
then stored in methanol at 208C. Hybridization was carried
out at 448C for at least 36 h, posthybridization washes were
done in 50% formamide/2 SSC/0.02% TritonX-100 over 8
h by raising the temperature gradually from 478C to 568C. A
detailed protocol can be obtained from the authors.
RT-PCR
Expression analysis was carried out by RT-PCR of oligodT-primed cDNA normalized for the expression of cytosolic
actin with specific primers. The sequences of the primers
were: Actin5: GCTAACACTGTCCTGTCT Actin3:
TGGAAGGTGGACAGGGAA. Fkh1 and Fkh6c primers
were used to amplify a forkhead fragment (see above). The
snailA primers were: SnailA5: CTACGTGTCCCTGGGTGC; SnailA3: CCTTCTAGTGATCTGTTTCG.
Results
Isolation of homologs of forkhead and snail from
Nematostella
We performed PCR with degenerate primers and RACE
to obtain a homolog of forkhead. The isolated full-length
391
clone of Nematostella forkhead is 1774 bp in length
coding for a conceptually translated protein of 286 amino
acids (Fig. 1A). The alignment with Forkhead domains
from a variety of different animals demonstrates the
extremely high degree of conservation (N95% amino acid
identity to vertebrate Forkhead; Fig. 1B). Outside the
Forkhead domain two additional smaller motifs, region II
and region III, are conserved between Nematostella and
vertebrates (Fig. 1C). These domains have been shown to
be involved in transactivation (Pani et al., 1992). In
particular, region II is diagnostic of the HNF-3 subfamily
(Pani et al., 1992).
The phylogenetic analysis by Maximum Likelihood
shows that Nematostella Forkhead belongs to the group 1
as defined by Kaufmann and Knöchel (1996), which unites
the subfamilies HNF-3alpha, -beta, and -gamma (Fig. 2).
Group 1 is characterized by several diagnostic residues in
the Forkhead domain, which are fully conserved in
Nematostella. In addition, Nematostella shares one of the
diagnostic residues with the HNF-3beta (FoxA2)-subfamily, but none with the others. It does not contain the
conserved region IV and V, which play a role in
transactivation in vertebrates, but which are also absent
from protostome homologs (Pani et al., 1992; Qian and
Costa, 1995). The analysis also shows that the Hydra
ortholog Budhead (Martinez et al., 1997) is more diverged
than the Nematostella protein (Fig. 2). Interestingly, while
the overall amino acid identity to the Hydra molecule
compares to the mouse homolog (53% and 54%, respectively), the identity of the Forkhead domain to the mouse
homolog HNF3-beta is significantly higher (95% compared to 83% identity to the Hydra Budhead). Thus, taken
together, this analysis suggests that we have isolated an
ortholog of the HNF3, most likely of the HNF3-beta gene
of vertebrates.
A full-length snailA clone was isolated from an EST
screen from mixed embryonic stages (U.T. unpublished
results). Another snail-like gene, termed snailB, has been
independently isolated by PCR and will be reported
elsewhere (Scholz and Technau, unpublished; Martindale
et al., 2004). SnailB shares only a few conserved residues
outside the SNAG and the zinc finger domain (overall
identity 43%) suggesting that the gene duplication was not a
recent event.
The snailA clone is 1066 bp and contains 5VUTR, 3VUTR
and a poly A tail and is therefore considered a full-length
clone, coding for a 265 amino acid protein. The zinc
finger domain contains five conserved zinc finger
domains. The first zinc finger is not always present in
different phyla. For instance, it is present in Drosophila
Snail, but absent from mouse Snail (Fig. 3A). Interestingly, the first zinc finger is also absent in the Snail
homologs from two other cnidarians, the coral Acropora
and the hydrozoan Podocoryne (Hayward et al., 2004;
Spring et al., 2002). Besides the zinc finger domains, a
small motif called the SNAG domain at the N-terminus of
392
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
Fig. 1. Sequence analysis of Nematostella Forkhead. (A) The schematic drawing of the proteins shows that Nematostella Forkhead is shorter than the mouse
homolog HNF3-beta, but shares three conserved domains, the DNA binding domain region I (Forkhead domain), and two regions (II and III) at the C-terminus
of the activation domain. (B) Alignment of Nematostella Forkhead domain with other animals shows the extremely high degree of conservation between
Nematostella and bilaterian Forkhead proteins. (C) Alignment of region II and region III.
the protein, is also fully conserved in Nematostella Snail
proteins (Fig. 3C). This motif is found in Snail homologs
of most Bilateria, but it is absent from Drosophila Snail
(Fig. 3A). The phylogenetic analysis confirms that the
Nematostella Snail clusters with the bilaterian Snail
proteins and is most likely an ortholog of the Acropora
snail (Fig. 4).
Expression analysis of Nematostella forkhead during
gastrulation
RT-PCR analysis shows that forkhead expression starts
at blastula stage (Fig. 5) and is then maintained
throughout embryonic and larval development until
primary polyps. First localized signals can be detected
by in situ hybridization in small patches of blastodermal
cells at the late blastula stage (around 10 h) marking the
presumptive blastopore shortly before invagination (Figs.
6A, B). The scattered patches of expression shortly later
fuse to form a ring of expression marking the margin of
cells that start to invaginate (Fig. 6C). As gastrulation
proceeds, forkhead becomes more strongly expressed, yet
always constricted to the ectodermal margin of the
blastopore (Figs. 6D, E). The form of the blastopore also
changed from a broad round invagination to a more slit-
like or triangular shape (Figs. 6E, F). However, it should
be noted that the shape of blastopore varies considerably
from embryo to embryo (Figs. 6E–I), yet does not reflect
any developmental defect as N80% of all eggs in an egg
mass develop into primary polyps. Interestingly, in a
significant fraction (60–70%) of early gastrulating
embryos, forkhead expression is excluded from one
portion of the blastopore. In the majority of all asymmetrically expressing embryos (60%), expression cannot
be detected in one of the longitudinal ends of the slit-like
blastopore (Fig. 6G), however, sometimes expression is
absent from a broad side of the blastopore (Fig. 6H) or
from the tip of the triangular blastopore (Fig. 6F). The
other fraction (30–40%) expresses forkhead in a ring
around the blastopore (Fig. 6F).
Side views of whole mount in situ hybridization of
gastrulating Nematostella embryos show that gastrulation
starts out as an involution of the epithelial layer of the
blastula at one pole (Fig. 7A). At this time, forkhead
expression is restricted to the outer margin of the
blastopore. Yet, shortly later, involuting endodermal cells
that do not express forkhead become bottle-shaped and
seem to loose their epithelial organization (Fig. 7B), start
to detach and migrate through the blastocoel to the other
side of the embryo (Fig. 7C). During that process, the
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
393
rated stages of development or two orthogonal views of
the same pattern.
Forkhead expression and the morphogenetic movements
during metamorphosis
Fig. 2. Phylogenetic analysis of Forkhead domains using the Maximum
Likelihood program PUZZLE (Schmidt et al., 2002). Note that Nematostella Forkhead clusters with group 1 (groups defined by Kaufmann and
Knöchel, 1996). Members of group 5 were used as an outgroup. Numbers
are percent statistical support for the corresponding nodes. JTT was used as
a substitution model, for heterogeneous evolutionary rate the alpha
parameter 8 was used in the gamma rate distribution, 1000 replica were
calculated. Accession numbers of the sequences used in the analysis are as
follows: Mm_fkh-2, CAA50742.1; Dm_FD3, AAA28534.1; Xl_XFD-5/
FoxB2, CAD31848; Mm _ fkh4/Foxb2, NP _ 032049.1; Ce _ lin-31,
AAA28104.1; Dm_ FD-5, AF02178.1; Hv _budhead, AAO92606.1;
Nv_forkhead, AY457634; Dm_fork head, AAA28535.1; Bm_sgf-1,
BAA07523.1; Dr _ axial/foxa2, NP _ 571024.1; Mm _ HNF-3beta,
AAA03161.1; Xl_pintallavis, CAA46290.1; Xl_XFKH1, AAB22027.1;
Mm _ HNF-3gamma, CAA52892.1; Hs _ FKH H3, AAA58477.1;
Mm_HNF-3alpha, CAA52890.1; Xl_FKH2, AA17050.1.
ectodermal marginal cells of the blastopore that express
forkhead also involute, yet maintain their epithelial
organization (Fig. 7C). The mesenchymal cells that have
migrated to the other side of the blastocoel, start to
reorganize an epithelial layer, the pre-endoderm, and
possibly separated from the ectodermal layer by a thin
mesogloea (Fig. 7D). In the following, endodermal cells
again seem to leave the epithelial sheet and start to fill the
gastrocoel until it forms a complete mass of cells in the
endoderm (Figs. 7E–I). The forkhead expressing ectodermal part of the blastopore, however, that has partly
involuted, maintains the epithelial integrity as judged from
the columnar organization of the cells. After gastrulation,
in the early planula larva, forkhead expression is detected
in a domain that seems to reach from the ectodermal
margin of the blastopore to the endoderm in a restricted
manner (Fig. 7I). In planula larvae of days 4–10 of
development, two patterns can be observed: (i) a pattern
with two stripes in the center of the planula (Figs. 7J, K)
and (ii) a central block of expression with two opposing
bwingsQ of expression (Fig. 7L). It is unclear at present
whether these two patterns reflect two temporally sepa-
Initiation of metamorphosis is marked by the beginning
reorganization of the endodermal cell mass into an
endodermal epithelial layer. At this point, the forkheadexpressing cells are located at the inner side of the former
blastopore, yet form a continuum with the ectodermal
layer of the planula. These forkhead-expressing cells mark
the future pharynx of the primary polyp (Fig. 8A).
Epithelialization appears to start at the aboral side of the
forkhead-expressing domain and continues at the lateral
sides towards the oral end. At this early stage, the
endodermal mass close to the presumptive pharynx
organizes into eight radii forming the anlage for the future
mesenteries in adult polyps that are attached to the
pharynx (Fig. 8F). During the process of metamorphosis
the pharynx anlage ingresses, until it even contacts the
inner side of the aboral pole of the larva (Figs. 8A–C).
However, during elongation of the developing primary
polyp and formation of the tentacles this part is pulled up
again towards the oral pole (Fig. 8C–E), until it takes the
final position of the pharynx. We could not detect
significant expression of forkhead in the first pair of
mesenteries, that grow out from two opposing poles of the
blastopore (Figs. 8E–H). An optical cross-section through
the pharynx region shows that forkhead expression
remains restricted to the ectodermal layer of the pharynx
(Fig. 8F), which is the most interior tissue due to the
inverted structure of the pharynx.
Snail expression during gastrulation
Snail is a crucial regulator of gastrulation and other
morphogenetic processes in bilaterian development. We
therefore wished to analyze the expression pattern of the
snail homolog in Nematostella vectensis. Like for forkhead, first snail expression was detected at the late
blastula stage (Fig. 5), however, in a contiguous patch of
cells that marks the presumptive endoderm (Fig. 9). The
comparison with the early ring-like expression pattern of
forkhead suggests that the snail patch is in the center of
the forkhead ring. During gastrulation, snail is exclusively expressed in immigrating endodermal cells. In
contrast to the forkhead-expressing cells, the snailexpressing cells loose their epithelial organization during
gastrulation and start immigrating into the blastocoel
(Figs. 9D, E) until they form the pre-endoderm (Fig. 9F).
In the planula, snail remains expressed in the endoderm,
yet excluded from the forkhead expressing pharynx
anlage (Figs. 9G, H). Finally, snail expression is
maintained at somewhat lower level in the primary polyp
in the endoderm (Figs. 5; 9I).
394
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
Fig. 3. Sequence analysis of Nematostella Snail. (A) The schematic drawing of the proteins shows that Nematostella Snail contains five zinc fingers (I–V) and
the conserved N-terminal SNAG domain. The SNAG domain is missing in the Drosophila homolog, while the first zinc finger is lacking in Acropora and
mouse Snail homologs. (B) Alignment of Nematostella Snail zinc finger domain with other animals shows the extremely high degree of conservation between
Nematostella and bilaterian Snail proteins. (C) Alignment of the SNAG domain. Abbreviations: Nv, Nematostella vectensis; Dm, Drosophila melanogaster.
Forkhead forms a synexpression group with brachyury in
Nematostella
We recently isolated a brachyury homolog, Nembra1,
from Nematostella (Scholz and Technau, 2003). In vertebrates, forkhead and brachyury act synergistically in defining
the dorsal mesoderm (O’Reilly et al., 1995). To compare the
expression pattern of forkhead and brachyury in Nematostella, we therefore reexamined brachyury expression in more
detail. Fig. 10 shows that the spatio-temporal expression
pattern of Nembra1 is virtually identical to that of forkhead.
Brachyury expression starts out in few spots of cells at the late
blastula stage and later marks the ectodermal part of the
blastopore throughout gastrulation. In the late planula larva,
Nembra1-expressing cells become internalized and mark the
future pharynx and mesenteries. Thus, brachyury and forkhead form a synexpression group in Nematostella vectensis,
raising the possibility that they might act together in the
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
Fig. 4. Phylogenetic analysis of Snail zinc finger domains using the
Maximum Likelihood program PUZZLE (Schmidt et al., 2002). Note, that
Nematostella SnailA clusters with Snail homolog from Acropora within the
Snail subfamily. The Snail-related zinc finger protein Scratch was used as
an outgroup. JTT was used as a substitution model, for heterogeneous
evolutionary rate the alpha parameter 8 was used in the gamma rate
distribution, 1000 replica were calculated. Accession numbers of the
sequences used in the analysis are as follows: Scratch Drosophila,
AAA91035; Scratch Homo, Q9BWW7; Worniu Drosophila, AAF12733;
SnailB Nematostella, AAQ23385; escargot Drosophila, P25932; Snail
Branchiostoma, AAC35351; Snail Lytechinus, AAB67715; Snail3 Homo,
XP_370995; Snail Podocoryne, CAD21523; Sna1 Zebrafish, NP_571141;
slug Xenopus, Q91924; Snail Xenopus, P19382; Sna2 Patella, AAL12167;
Sna1 Patella AAL06240; SnailA Acropora, AAS99630; SnailA Nematostella, AY651960; Snail Anopheles, XP_317196; Snail Drosophila,
AAL90312.
regulation of gastrulation and metamorphosis and in the
formation of pharynx and mesenteries.
395
(Kaufmann and Knöchel, 1996). In a refined analysis of
chordate sequences, 15 different subfamilies of Fox (forkhead box) genes have been defined (Kaestner et al., 2000).
Group 1 (which corresponds to FoxA) is characterized by
five diagnostic residues in the Forkhead domain (A9, L43,
Q51, N92, C98). Since these residues are all conserved in
the isolated forkhead clone from Nematostella, we conclude that we have isolated a member of group 1 forkhead
genes. Group 1 is further subdivided into four subgroups,
group 1a–d, which have two to four characteristic residues.
Nematostella Forkhead shares one (T7) of two diagnostic
residues of group 1a (T7, F46), but none of the residues
characteristic for the other subgroups. In addition, Nematostella Forkhead has two short conserved motifs at the
C-terminus, called regions II and III. Phylogenetic analysis
of Forkhead domains from several organisms further
supports a close relationship of Nematostella Forkhead to
group 1, although a clear clustering with group 1a is not
statistically significant (Fig. 2). Hence, if no other Forkhead proteins of the group 1 exist in Nematostella, the
gene presented in this paper may closely resemble the
evolutionary predecessor of group 1 molecules. Among
these, group 1a proteins (i.e., HNF3-beta in rodents and
frogs) have retained most of these ancestral features.
Nematostella forkhead is, however, unlikely to represent
the precursor of all forkhead genes, since several other
forkhead genes have been isolated which clearly cluster
with specific subfamilies (U.T. unpublished). Thus, Nematostella forkhead is a homolog of group 1 forkhead genes
and most closely resembles HNF3-beta.
The detailed sequence analysis of the zinc finger motif
of the Nematostella Snail homolog clearly shows that it
belongs to the Snail subfamily of Zinc finger transcription
factors. Interestingly, despite a considerable degree of
conservation, the first zinc finger is not present in mouse
Snail, and in the Snail homologs from two other
cnidarians, Podocoryne and Acropora (Hayward et al.,
2004; Spring et al., 2002). This shows that this zinc finger
was independently lost during evolution and may not be
Discussion
A homolog of forkhead/HNF3/beta and snail in the
diploblast Nematostella vectensis
Since the identification of the founder member from
Drosophila (Weigel et al., 1989), a large number of related
genes have been isolated from a wide range of species.
These forkhead genes form a large family of 10–15
subfamilies (Kaestner et al., 2000; Kaufmann and Knöchel,
1996), with diverse functions in development (reviewed by
Carlsson and Mahlapuu, 2002; Gajiwala and Burley, 2000;
Kaestner et al., 1994; Kaufmann and Knöchel, 1996; Lai et
al., 1993; McMahon, 1994). All share a highly conserved
DNA binding motif of 110 amino acids, the Forkhead
domain. Ten groups of the Forkhead protein family were
defined on the basis of several diagnostic residues
Fig. 5. Temporal expression profile of Nematostella forkhead and snail by
RT-PCR. RNA from defined stages was prepared and the cDNA normalized
with Actin, EF-2, Hsp70 (not shown). UE (unfertilized eggs); B (10 h
Blastula); G (28 h Gastrula); 3dP (3 day Planula larva); 6dP (6 day Planula
larva); PP (primary polyp). The experiment was carried out in three
replicates with identical results.
396
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
Fig. 6. View on the blastopore of gastrulating Nematostella embryos. (A–D) 20–22 h blastula; (E–F) 25–30 h gastrula. Note that forkhead marks the future
blastopore and remains expressed around the blastopore. (F–H) Arrows indicate the side of lacking forkhead expression at the blastopore. Scale bar is 100 Am.
functionally relevant in all species. By contrast, the four
C-terminal zinc finger domains are always strongly
conserved in all animals examined. The comparison with
the neural-specific Scratch protein shows that the zinc
finger domains II and V most likely provide the
specificity to the molecule, since they contain specific
residues diagnostic of Snail proteins and distinct of
Scratch which are all conserved in Nematostella SnailA
(Fig. 3B). By comparison, zinc finger domains III and IV
of Snail and Scratch proteins are virtually identical,
suggesting that they are only characteristic of Snail-related
proteins (Fig. 3B).
Forkhead and snail expression reveal
epithelial–mesenchymal transitions during gastrulation
Animals of different phyla gastrulate by at first glance
very different cellular mechanisms, such as epithelial
invagination and epiboly, multipolar and polar immigration and delamination (reviewed in Technau and Scholz,
2003). The precise mechanism appears to depend on
different parameters, for instance, egg size and amount of
yolk (Arendt and Nübler-Jung, 1997). Different species of
the phylum Cnidaria gastrulate by all possible mechanisms
mentioned above (reviewed in Tardent, 1978). In early
descriptions of the embryogenesis of Nematostella, gas-
trulation was described as an invagination process (Hand
and Uhlinger, 1992). The detailed analysis of forkhead
expression during gastrulation and metamorphosis reveals
now that the formation of the endodermal layer is in fact
more complex. Gastrulation starts out as an invagination
of the blastodermal epithelium, yet cells of the inner part
of the blastopore, that is, the presumptive endodermal
cells shortly later detach from the epithelium, migrate
through the blastocoel and attach on the inner side of
blastodermal epithelium to form an epithelial layer, which
we call a pre-endodermal layer. The postgastrula planula
larva, however, is filled by mesenchymal endodermal cells
that appear to have detached from the pre-endodermal
(epithelial) layer. Only during metamorphosis this mass of
cells reorganizes into the definitive endodermal layer by a
process that is not yet understood. Hence, gastrulation in
Nematostella occurs by a combination of epithelial
invagination and immigration. The formation of the
definitive endodermal epithelium is a result of cycles of
epithelial–mesenchymal transitions (EMT).
EMT has been described for instance during gastrulation
and neural crest development in vertebrates. It is characterized by the expression of the zinc finger transcription
factor snail (or the closely related slug gene, respectively),
which regulates the expression of specific cell adhesion
proteins, such as E-cadherin, notch and of marker genes
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
397
Fig. 7. Side view on gastrulae and planulae-expressing forkhead. (A) initiation of gastrulation at 26 h of development; (B) endodermal cells start immigrating
(arrow); (C) immigrated endodermal cells attach to the blastocoel roof; (D) formation of a pre-endodermal layer (arrow); (E) closure of the blastopore and
detachment of endodermal cells from pre-endodermal layer as well as from the blastopore (arrow); (F–H) continuous filling of the blastocoel with endodermal
cells; (I–L) disintegration of epithelial organization of forkhead-expressing cells during early through late planula stage. Note, the lappet-like expression
domains (K) that mark the future first pair of mesenteries. Scale bar is 100 Am.
for migratory cells, such as RhoB and HNK-1 (Cano et al.,
2000; Carver et al., 2001; del Barrio and Nieto, 2002;
Timmerman et al., 2004; reviewed in Nieto, 2002;
Savagner, 2001). In line with this, Nematostella snailA is
exclusively expressed in immigrating endodermal cells
during gastrulation (Martindale et al., 2004; this study).
This expression seems to be conserved at least in
Anthozoans, as the snailA homolog from the coral
Acropora millepora is also expressed in presumptive
endodermal cells during gastrulation (Hayward et al.,
2004). EMT was previously proposed as the ancestral
function of snail genes in Bilateria (Lespinet et al., 2002;
Nieto, 2002). Our data support and extend this idea,
suggesting that the original role of snail genes in a
diploblast eumetazoan ancestor was to govern EMT during
endoderm formation. This basic cellular function was then
apparently reused for similar cellular processes during the
development of bilaterian embryos, that is, in mesoderm
and neural crest formation in vertebrates (Knecht and
Bronner-Fraser, 2002; Langeland et al., 1998; Thisse et al.,
1995; reviewed in Nieto, 2002; Technau and Scholz, 2003)
or during EMT of ectodermal derivatives in mollusks
(Lespinet et al., 2002).
The columnar organization of the forkhead-expressing
tissue suggests that the epithelium even remains intact when
this region is involuted at the early planula stage. This
reflects the fact that the pharynx in sea anemones is
internalized, but of ectodermal origin. Thus, the internalization of the ectodermal pharynx anlage occurs already
during late gastrulation (i.e., at the early planula stage). The
398
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
Fig. 8. Forkhead expression during metamorphosis. (A) formation of endodermal epithelium in early metamorphosing planula. Forkhead expressing pharynx
anlage is internalized; (B) further retraction of pharynx anlage towards aboral pole; (C) Amphora stage of metamorphosing planula with maximally retracted
pharynx anlage; (D) elongation of developing primary polyp at the aboral pole and begin of differentiation of pharyngeal mesenteries; (E) finished elongation
of late metamorphosing planula larva and final position of pharynx; (F) cross-section through late metamorphosing planula stage showing the forkheadexpressing pharynx with the slit-like mouth opening and the eight anlage for the mesenteries attached to the pharynx; (G) primary polyp showing forkhead
expression in the pharynx; (H) close up of (G) showing that forkhead expression is restricted to the ectodermal lining of the inverted pharynx. Note the
boundary between ectoderm and endoderm (arrow). Scale bar is 100 Am.
stable forkhead-expressing domain allows to further follow
the larval development. During metamorphosis, the pharynx
anlage becomes transiently located at the aboral pole by
extensive morphogenetic movements, yet with elongation of
the body it retracts and adopts its final position in the
primary polyp. In summary, gastrulation and metamorphosis
in Nematostella, a basal representative of the Cnidaria, is
characterized by a relatively complex combination of
epithelial invagination, EMT, immigration, and epithelial
morphogenetic movements. It seems obvious that such
complex processes require a highly regulated genetic
control, which remain to be revealed by future work.
Evolutionary considerations: forkhead, brachyury, and the
blastopore
The evolution of the bilaterian gut has been studied by
comparing the expression pattern of specific marker genes
from a variety of organisms. It appears that a conserved
cassette of developmental genes, mostly transcription
factors, is expressed in fore- and hindgut primordia in all
or most bilateria (reviewed in Lengyel and Iwaki, 2002).
These include the transcription factors caudal, brachyury,
and forkhead and the signalling molecule wingless. All four
genes are expressed in the blastopore in vertebrates and
many insects, where they specify the derivatives of the
blastopore, the foregut, and the hindgut (in Drosophila, the
amnioproctodeal and the stomodeal invagination). While
comparative data on caudal expression in different organisms are still scarce, at least brachyury, forkhead and
wingless appear to have overlapping expression domains in
most animals studied, hence they form an evolutionarily
conserved synexpression (Niehrs and Pollet, 1999) group,
suggesting that they might act in concert to specify a
homologous structure in a wide range of animals. For
instance, in the cnidarian Hydra, homologs of brachyury,
Wnt3a, and forkhead have overlapping spatio-temporal
expression domains in the hypostome, which correspond
to the organizer of the polyp (Hobmayer et al., 2000;
Martinez et al., 1997; Technau and Bode, 1999). Similarly,
in Nematostella embryos, brachyury and forkhead are
coexpressed at the ectodermal margin of the blastopore
during gastrulation (Scholz and Technau, 2003; this paper).
A comparative analysis of expression patterns of these two
genes shows that they are co-expressed in all animals
analyzed (reviewed in Lengyel and Iwaki, 2002; Technau,
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
399
Fig. 9. Snail expression during gastrulation and metamorphosis. (A–C) front view on blastopore. (D–F) side view, posterior (oral) side oriented to the right. (A,
B) Late blastula stages with contiguous patch of snail-expressing cells. (C) gastrula stage. (D) early gastrula stage. (E) mid-gastrula stage. (F) late gastrula
stage. (G) early planula stage. (H) late planula stage (I) primary polyp. Stars mark the pharynx anlage (G–I), which does not express snail. Note snail is
exclusively expressed in endodermal cells and complementary to forkhead. Scale bar is 100 Am.
2001; Zaret, 1999). This suggests a close functional
relationship of these two genes during animal development
throughout metazoan evolution. Although a direct interaction of the two proteins has not been demonstrated to date,
in Xenopus, they act synergistically to form dorsal
mesoderm, in particular the notochord (O’Reilly et al.,
1995). Thus, forkhead and brachyury are an evolutionarily
ancient synexpression group in Eumetazoa.
Fig. 10. Brachyury expression during Nematostella development. (A) Late blastula stage; (B) side view on early gastrula; (C) front view on late gastrula with
slit-like blastopore; (D) 5-day planula with ectodermal and endodermal brachyury expression; (E) early primary polyp showing expression in the developing
pharyngeal mesenteries. Note that brachyury and forkhead expression domains are virtually indistinguishable. Scale bar is 100 Am.
400
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
Forkhead expression in particular is surprisingly conserved among metazoans. Together with brachyury, it
marks the future blastopore and its derivatives, that is,
foregut and hindgut. For instance, in hemichordates and
echinoderms, forkhead is expressed in the vegetal plate
cells before gastrulation, later in the involuting endoderm,
and finally most strongly in the stomodeum anlage and the
proctodeum of the Tornaria and Pluteus larva, respectively
(Harada et al., 1996; Taguchi et al., 2000). Hence, in these
lower deuterostomes, expression appears ectodermally
restricted (if proctodeum and stomodeum are defined as
ectodermal structures). Yet, at least in chordates, forkhead
expression is not germ layer specific, but rather regionand organ-specific. In mice, the forkhead homolog HNF3beta is expressed in the visceral endoderm, the node,
(which gives rise to axial mesoderm, the notochord) and
the floor plate (Ang and Rossant, 1994; Sasaki and Hogan,
1993; Weinstein et al., 1994). In the urochordates and
protochordates (Amphioxus and Ascidians), the forkhead
homolog is also expressed in gastrulating endoderm, the
notochord and the floor plate (Corbo et al., 1997; Olsen
and Jeffery, 1997; Shimauchi et al., 1997, 2001; Shimeld,
1997; Terazawa and Satoh, 1997). This suggests a close
association of endoderm and the dorsal mesoderm, the
notochord. In line with this, the notochord has been
proposed to be a derivative of the archenteron roof in
lower vertebrates, based on classical embryology (e.g.,
Siewing, 1969).
Much less information is available from Protostomes.
However, in several species the expression domains are
strikingly similar: in the Ecdysozoa, such as Drosophila, and
Tribolium and C. elegans forkhead marks and is essential for
the developing fore- and hindgut before and during
gastrulation (Gaudet and Mango, 2002; Schrfder et al.,
2000; Weigel et al., 1989). Among the Lophotrochozoa,
expression of forkhead has been studied in the mollusc
Patella vulgata. Strikingly, forkhead is expressed in the
endoderm and anterior mesoderm, deriving from the anterior
edge of the blastopore (Lartillot et al., 2002). At larval
stages, forkhead is most strongly expressed in the stomodeum and somewhat weaker in the endoderm, reminiscent of
the situation of vertebrates, where forkhead is also expressed
in the prechordal plate (Filosa et al., 1997). Based on our
expression data of forkhead in Nematostella vectensis, we
propose that forkhead has an ancestral role in defining the
blastopore and one derivative, the ectodermally derived
pharynx. The evolutionary conservation of the synexpression group of brachyury, forkhead and several other genes
suggest an establishment and coevolution of a cassette of
conserved transcription factors in the blastopore during early
metazoan evolution (reviewed in Lengyel and Iwaki, 2002;
Scholz and Technau, 2003; Technau, 2001). Since forkhead
and other node-specific genes also play important roles in
dorsal–ventral axis formation in vertebrates, we propose that
the blastopore evolved as an organizer for axis formation and
mesoderm formation during early metazoan evolution.
Acknowledgments
We would like to thank Thomas Holstein for critically
reading the manuscript. This work was supported by the
DFG (Te-311/1-3).
References
Ang, S.L., Rossant, J., 1994. HNF-3 is essential for notochord formation in
mouse development. Cell 78, 561 – 574.
Arendt, D., Nqbler-Jung, K., 1997. Dorsal or ventral: similarities in fate
maps and gastrulation patterns in annelids, arthropods and chordates.
Mech. Dev. 61, 7 – 21.
Arendt, D., Technau, U., Wittbrodt, J., 2001. Evolution of the bilaterian
larval foregut. Nature 409, 81 – 85.
Bridge, D., Cunningham, C.W., Schierwater, B., DeSalle, R., Buss, L.W.,
1992. Class-level relationships in the phylum Cnidaria: evidence from
mitochondrial genome structure. Proc. Natl. Acad. Sci. U. S. A. 89,
8750 – 8753.
Bridge, D., Cunningham, C.W., DeSalle, R., Buss, L.W., 1995. Class-level
relationship in the phylum Cnidaria: molecular and morphological
evidence. Mol. Biol. Evol. 12, 679 – 698.
Cano, A., Perez-Moreno, M.A., Rodrigo, I., Locascio, A., Blanco, M.J.,
del Barrio, M.G., Portillo, F., Nieto, M.A., 2000. The transcription
factor Snail controls epithelial–mesenchymal transitions by repressing
E-cadherin expression. Nat. Cell Biol. 2, 76 – 83.
Carlsson, P., Mahlapuu, M., 2002. Forkhead transcription factors: key players
in development and metabolism. Dev. Biol. 250, 1 – 23.
Carver, E.A., Jiang, R., Lan, Y., Oram, K.F., Gridley, T., 2001. The mouse
snail gene encodes a key regulator of the epithelial–mesenchymal
transition. Mol. Cell. Biol. 21, 8184 – 8188.
Collins, A.G., 2002. Evaluating multiple alternative hypotheses for the
origin of Bilateria: an analysis of 18S rRNA molecular evidence. Proc.
Natl. Acad. Sci. U. S. A. 95, 15258 – 15463.
Corbo, J.C., Erives, A., Di Gregorio, A., Chang, A., Levine, M., 1997.
Dorsoventral patterning of the vertebrate neural tuve is conserved in
a protochordate. Development 124, 2335 – 2344.
Cunliffe, V.T., Ingham, P.W., 1999. Switching on the notochord. Genes
Dev. 164, 3 – 6.
del Barrio, M.G., Nieto, M.A., 2002. Overexpression of Snail family
members highlights their ability to promote chick neural crest
formation. Development 129, 1583 – 1593.
Dirksen, M.L., Jamrich, M., 1992. A novel, activin-inducible, blastopore
lip-specific gene of Xenopus laevis contains a fork head DNA-binding
domain. Genes Dev. 6, 599 – 608.
Filosa, S., Rivera-Perez, J.A., Gomez, A.P., Gansmuller, A., Sasaki, H.,
Behringer, R.R., Ang, S., 1997. Goosecoid and HNF-3b genetically
interact to regulate neural tube patterning during mouse embryogegesis.
Development 124, 2843 – 2854.
Fritzenwanker, J.H., Technau, U., 2002. Induction of gametogenesis in the
basal cnidarian Nematostella vectensis (Anthozoa). Dev. Genes Evol.
212, 99 – 103.
Frohman, M.A., Dush, M.K., Martin, G.R., 1988. Rapid production of fulllength cDNAs from rare transcripts: amplification using a single genespecific oligonucleotide primer. Proc. Natl. Acad. Sci. U. S. A. 85,
8998 – 9002.
Gajiwala, K., Burley, S.K., 2000. Winged helix proteins. Curr. Opin. Struct.
Biol. 10, 110 – 116.
Gaudet, J., Mango, S.E., 2002. Regulation of organogenesis by the
Caenorhabditis elegans FoxA protein PHA-4. Science 15, 2470 – 2482.
Grobben, K., 1908. Die systematische Einteilung des Tierreichs. Verh.
Zool. -Bot. Ges. Wien. 58, 491 – 511.
Hand, C., Uhlinger, K.R., 1992. The culture, sexual and asexual
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
reproduction, and growth of the sea anemone Nematostella vectensis.
Biol. Bull. 182, 169 – 176.
Harada, Y., Akasaka, K., Shimada, H., Peterson, K.J., Davidson, E.H.,
Satoh, N., 1996. Spatial expression of a forkhead homologue in the sea
urchin embryo. Mech. Dev. 60, 163 – 173.
Hayward, D.C., Miller, D.J., Ball, E.E., 2004. Snail Expression during
Embryonic Development of the Coral Acropora: Blurring the Diploblast/Triploblast Divide?
Hobmayer, B., Rentzsch, F., Kuhn, K., Happel, C.M., von Laue, C.C.,
Snyder, P., Rothbacher, U., Holstein, T.W., 2000. WNT signalling
molecules act in axis formation in the diploblastic metazoan Hydra.
Nature 407, 186 – 189.
Hoch, M., Pankratz, M.J., 1996. Control of gut development by fork head
and cell signaling molecules in Drosophila. Mech Dev. 58, 3 – 14.
Ikenouchi, J., Matsuda, M., Furuse, M., Tsukita, S., 2003. Regulation of
tight junctions during the epithelium–mesenchyme transition: direct
repression of the gene expression of claudins/occludin by Snail. J. Cell
Sci. 116, 1959 – 1967.
Ip, Y.T., Park, R.E., Kosman, D., Yazdanbakhsh, K., Levine, M., 1992.
Dorsal-twist interactions establish snail expression in the
presumptive mesoderm of the Drosophila embryo. Genes Dev. 6,
1518 – 1530.
Kaestner, K.H., Hiemisch, H., Luckow, B., Schqtz, G., 1994. The HNF-3
gene family of transcription factors in mice: gene structure, cDNA
sequence, and mRNA distribution. Genomics 20, 377 – 385.
Kaestner, K.H., Knfchel, W., Martinez, D.E., 2000. Unified nomenclature
for the winged helix/forkhead transcription factors. Genes Dev. 14,
142 – 146.
Kaufmann, E., Knfchel, W., 1996. Five years on the wings of fork head.
Mech. Dev. 57, 3 – 20.
Knecht, A.K., Bronner-Fraser, M., 2002. Induction of the neural crest: a
multigene process. Nat. Rev., Genet. 3, 453 – 461.
Knfchel, S., Lef, J., Clement, J., Klocke, B., Hille, S., Koster, M., Knfchel,
W., 1992. Activin A induced expression of a fork head related gene in
posterior chordamesoderm (notochord) of Xenopus laevis embryos.
Mech. Dev. 38, 157 – 165.
Kusch, T., Reuter, R., 1999. Functions for Drosophila brachyenteron and
forkhead in mesoderm specification and cell signalling. Development
123, 3991 – 4003.
Lai, E., Clark, K.L., Burley, S.K., Darnell, J.E., 1993. Hepatocyte nuclear
factor 3/fork head or bwinged helixQ proteins: a family of transcription
factors of diverse biologic function. Proc. Natl. Acad. Sci. U. S. A. 90,
10421 – 10423.
Langeland, J.A., Tomsa, J.M., Jackman, W.R., Kimmel, C.B., 1998. An
amphioxus snail gene: expression in paraxial mesoderm and neural
plate suggests a conserved role in patterning the chordate embryo. Dev.
Genes Evol. 208, 569 – 577.
Lartillot, N., Le Gouar, M., Adoutte, A., 2002. Expression patterns of fork
head and goosecoid homologues in the mollusc Patella vulgata support
the ancestry of the anterior mesendoderm across Bilateria. Dev. Genes
Evol. 212, 551 – 561.
Lengyel, J.A., Iwaki, D.D., 2002. It takes guts: the Drosophila hindgut as a
model system for organogenesis. Dev Biol. 243, 1 – 19.
Leptin, M., 1991. Twist and snail as positive and negative regulators during
Drosophila mesoderm development. Genes Dev. 5, 1568 – 1576.
Lespinet, O., Nederbragt, A.J., Cassan, M., Dictus, W.J., Van Loon, A.E.,
Adoutte, A., 2002. Characterisation of two snail genes in the gastropod
mollusc Patella vulgata. Implications for understanding the ancestral
function of the snail-related genes in Bilateria. Dev. Genes Evol. 212,
186 – 195.
Linker, C., Bronner-Fraser, M., Mayor, R., 2000. Relationship between
gene expression domains of Xsnail, Xslug, Xtwist and cell movement in the prospective neural crest of Xenopus. Dev. Biol. 224,
215 – 225.
Martin, V.J., Littlefield, C.L., Archer, W.E., Bode, H.R., 1997. Embryogenesis in hydra. Biol. Bull. 192, 345 – 363.
Martindale, M.Q., Henry, J.Q., 1999. Intracellular fate mapping in a basal
401
metazoan, the ctenophore Mnemiopsis leidyi, reveals the origins of
mesoderm and the existence of indeterminate cell lineages. Dev. Biol.
214, 243 – 257.
Martindale, M.Q., Finnerty, J.R., Henry, J.Q., 2002. The Radiata and the
evolutionary origins of the bilaterian body plan. Mol. Phylogenet. Evol.
24, 358 – 365.
Martindale, M.Q., Pang, K., Finnerty, J.R., 2004. Investigating the origins
of triploblasty: dmesodermalT gene expression in a diploblastic animal,
the sea anemone Nematostella vectensis (phylum Cnidaria; class,
Anthozoa). Development 131, 2463 – 2474.
Martinez, D.E., Dirksen, M.-L., Bode, P.M., Jamrich, M., Steele, R.E.,
Bode, H.R., 1997. Budhead, a Fork Head/HNF-3 homologue, is
expressed during axis formation and head specification in Hydra. Dev.
Biol. 192, 523 – 536.
McMahon, A.P., 1994. Mouse development. Winged-helix in axial
patterning. Curr. Biol. 4, 903 – 905.
Niehrs, C., Pollet, N., 1999. Synexpression groups in eucaryotes. Nature
402, 483 – 487.
Nielsen, C., 1995. Animal Evolution. Interrelationships of the Living Phyla.
Oxford Univ. Press, Oxford.
Nieto, M.A., 2002. The snail superfamily of zinc-finger transcription
factors. Nat. Rev., Mol. Cell Biol. 3, 155 – 166.
Olsen, C.L., Jeffery, W.R., 1997. A forkhead gene related to HNF-3b is
required for gastrulation and axis formation in the ascidian embryo.
Development 124, 3609 – 3616.
O’Reilly, M.A., Smith, J.C., Cunliffe, V., 1995. Patterning of the mesoderm
in Xenopus: dose-dependent and synergistic effects of Brachyury and
Pintallavis. Development 121, 1351 – 1359.
Pani, L., Overdier, D.G., Porcella, A., Qian, X., Lai, E., Costa, R.H., 1992.
Hepatocyte Nuclear Factor 3b contains two transcriptional activation
domains, one of which Is novel and conserved with the Drosophila
Fork Head protein. Mol. Cell. Biol. 12, 3723 – 3732.
Qian, X., Costa, R.H., 1995. Analysis of hepatocyte nuclear factor-3b
protein domains required for transcriptional activation and nuclear
targeting. Nucleic Acids Res. 23, 1184 – 1191.
Ruiz i Altaba, A., Jessell, T.M., 1992. Pintallavis, a gene expressed in the
organizer and midline cells of frog embryos: involvement in the
development of the neural axis. Development 116, 81 – 93.
Sasaki, H., Hogan, B.L.M., 1993. Differential expression of multiple fork
head related genes during gastrulation and axial pattern formation in the
mouse embryo. Development 118, 47 – 59.
Savagner, P., 2001. Leaving the neighborhood: molecular mechanisms
involved during epithelial–mesenchymal transition. BioEssays 23,
912 – 923.
Schmidt, H.A., Strimmer, K., Vingron, M., von Haeseler, A., 2002. TREEPUZZLE: maximum likelihood phylogenetic analysis using quartets
and parallel computing. Bioinformatics 18, 502 – 504.
Scholz, C.B., Technau, U., 2003. The ancestral role of Brachyury:
expression of Nembra1 in the basal cnidarian Nematostella vectensis
(Anthozoa). Dev. Genes Evol. 212, 563 – 570.
Schrfder, R., Eckert, C., Wolff, C., Tautz, D., 2000. Conserved and
divergent aspects of terminal patterning in the beetle Tribolium
castaneum. Proc. Natl. Acad. Sci. 97, 6591 – 6596.
Shimauchi, Y., Yasuo, H., Satoh, N., 1997. Autonomy of ascidian fork
head/HNF-3 gene expression. Mech. Dev. 69, 143 – 154.
Shimauchi, Y., Chiba, S., Satoh, N., 2001. Synergistic action of HNF-3 and
Brachyury in the notochord differentiation of ascidian embryos. Int. J.
Dev. Biol. 45, 643 – 652.
Shimeld, S.M., 1997. Characterisation of amphioxus HNF-3 genes:
conserved expression in the notochord and floor plate. Dev. Biol.
183, 74 – 85.
Siewing, R., 1969. Lehrbuch der vergleichenden Entwicklungsgeschichte
der Tiere. Paul Parey, Hamburg.
Spring, J., Yanze, N., Middel, A.M., Stierwald, M., Groger, H., Schmid, V.,
2000. The mesoderm specification factor twist in the life cycle of
jellyfish. Dev. Biol. 228, 363 – 375.
Spring, J., Yanze, N., Josch, C., Middel, A.M., Winninger, B., Schmid, V.,
402
J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402
2002. Conservation of Brachyury, Mef2, and Snail in the myogenic
lineage of jellyfish: a connection to the mesoderm of bilateria. Dev.
Biol. 244, 372 – 384.
Taguchi, S., Tagawa, K., Humphreys, T., Nishino, A., Satoh, N., Harada, Y.,
2000. Characterization of a hemichordate fork head/HNF-3 gene
expression. Dev. Genes Evol. 210, 11 – 17.
Tardent, P., 1978. Coelenterata. Cnidaria. VEB Gustav Fischer, Jena.
Technau, U., 2001. Brachyury, the blastopore and the evolution of the
mesoderm. BioEssays 23, 788 – 794.
Technau, U., Bode, H.R., 1999. HyBra1, a Brachyury homologue, acts
during head formation in Hydra. Development 126, 999 – 1010.
Technau, U., Scholz, C.B., 2003. Origin and evolution of endoderm and
mesoderm. Int. J. Dev. Biol. 47, 531 – 539.
Terazawa, K., Satoh, N., 1997. Formation of the chordamesoderm in the
amphioxus embryo: analysis with Brachyury and fork head/HNF-3
genes. Dev. Genes Evol. 207, 1 – 11.
Thisse, C., Thisse, B., Postlethwait, J.H., 1995. Expression of snail2, a
second member of the zebrafish snail family, in cephalic mesendoderm
and presumptive neural crest of wild-type and spadetail mutant
embryos. Dev. Biol. 172, 86 – 99.
Timmerman, L.A., Grego-Bessa, J., Raya, A., Bertran, E., Perez-Pomares,
J.M., Diez, J., Aranda, S., Palomo, S., McCormick, F., IzpisuaBelmonte, J.C., de la Pompa, J.L., 2004. Notch promotes epithelial–
mesenchymal transition during cardiac development and oncogenic
transformation. Genes Dev. 18, 99 – 115.
Weigel, D., Jqrgens, G., Kqttner, F., Seifert, E., J7ckle, H., 1989. The
homeotic gene fork head encodes a nuclear protein and is
expressed in the terminal region of the Drosophila embryo. Cell
57, 645 – 658.
Weinstein, D.C., Ruiz i Altaba, A., Chen, W.S., Hoodless, P., Prezioso,
V.R., Jessel, T.M., Darnell, J.E., 1994. The winged-helix transcription
factor HNF-3 beta is required for notochord development in the mouse
embryo. Cell 78, 575 – 588.
Wikramanayake, A.H., Hong, M., Lee, P.N., Pang, K., Byrum, C.A., Bince,
J.M., Xu, R., Martindale, M.Q., 2003. An ancient role for nuclear betacatenin in the evolution of axial polarity and germ layer segregation.
Nature 426, 446 – 450.
Zaret, K., 1999. Developmental competence of the gut endoderm: genetic
potentiation by GATA and HNF3/Fork head proteins. Dev. Biol. 209,
1 – 10.