Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Unique Kir2.x Properties Determine Regional and Species Differences in the Cardiac Inward Rectifier Kⴙ Current Amit S. Dhamoon, Sandeep V. Pandit, Farzad Sarmast, Keely R. Parisian, Prabal Guha, You Li, Suveer Bagwe, Steven M. Taffet, Justus M.B. Anumonwo Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017 Abstract—The inwardly rectifying potassium (Kir) 2.x channels mediate the cardiac inward rectifier potassium current (IK1). In addition to differences in current density, atrial and ventricular IK1 have differences in outward current profiles and in extracellular potassium ([K⫹]o) dependence. The whole-cell patch-clamp technique was used to study these properties in heterologously expressed Kir2.x channels and atrial and ventricular IK1 in guinea pig and sheep hearts. Kir2.x channels showed distinct rectification profiles: Kir2.1 and Kir2.2 rectified completely at potentials more depolarized than ⫺30 mV (I⬇0 pA). In contrast, rectification was incomplete for Kir2.3 channels. In guinea pig atria, which expressed mainly Kir2.1, IK1 rectified completely. In sheep atria, which predominantly expressed Kir2.3 channels, IK1 did not rectify completely. Single-channel analysis of sheep Kir2.3 channels showed a mean unitary conductance of 13.1⫾0.1 pS in 15 cells, which corresponded with IK1 in sheep atria (9.9⫾0.1 pS in 32 cells). Outward Kir2.1 currents were increased in 10 mmol/L [K⫹]o, whereas Kir2.3 currents did not increase. Correspondingly, guinea pig (but not sheep) atrial IK1 showed an increase in outward currents in 10 mmol/L [K⫹]o. Although the ventricles of both species expressed Kir2.1 and Kir2.3, outward IK1 currents rectified completely and increased in high [K⫹]o-displaying Kir2.1-like properties. Likewise, outward current properties of heterologously expressed Kir2.1-Kir2.3 complexes in normal and 10 mmol/L [K⫹]o were similar to Kir2.1 but not Kir2.3. Thus, unique properties of individual Kir2.x isoforms, as well as heteromeric Kir2.x complexes, determine regional and species differences of IK1 in the heart. (Circ Res. 2004;94:1332-1339.) Key Words: Kir2 䡲 extracellular potassium 䡲 heteromerization 䡲 rectification the effect of high [K⫹]o on outward currents of Kir2.x isoforms has also not been compared. It is possible that the properties of Kir2.x isoforms, existing either as homomers or heteromers, determine regional IK1 differences in the heart. Although recent studies have shown that Kir2.x subunits heteromerize,12–14 the rectification and [K⫹]o dependence of heteromeric Kir2.x channels have not yet been studied. In this study, we show that individual Kir2.x isoforms have unique outward current profiles as well as differential responses to elevated [K⫹]o. We also demonstrate differences in Kir2.x expression patterns in the atria and ventricles of the sheep and guinea pig. Our results show that the rectification profile and [K⫹]o sensitivity of IK1 in these species are determined by the expression patterns of the underlying Kir2.x isoforms in the atria and the ventricle. We also demonstrate that the rectification and [K⫹]o sensitivity of the Kir2.1 isoform determine IK1 properties when heteromeric complexes are formed. Part of this work has been presented in abstract form.8,15 I n the heart, the inwardly rectifying potassium (Kir) current (IK1) stabilizes the resting membrane potential and plays a major role during the final phase of action potential (AP) repolarization.1–3 The Kir2.x channels mediate cardiac IK1.3 Previous studies have demonstrated that IK1 properties are different in atrial and ventricular myocytes.1,3– 6 First, IK1 current density is higher in the ventricles than in the atria.6,7 Second, ventricular IK1 has been described as having a more prominent negative slope conductance at depolarized potentials than atrial IK1 (ie, atrial IK1 does not rectify completely).1,4,5 Also, the outward component of the background potassium current (IB; consisting mainly of IK1) is significantly increased in high extracellular potassium ([K⫹]o) in ventricular but not atrial myocytes.1 The molecular mechanisms underlying these IK1 differences are unknown. The Kir2.x channel expression patterns may determine outward IK1 properties.8,9 Outward currents through Kir channels may play an important role in the dynamics of atrial and ventricular fibrillation, as studied in the sheep10 and guinea pig,11 respectively. However, outward current profiles of the individual Kir2.x isoforms have not been comparatively studied. Moreover, Materials and Methods Detailed descriptions of the approaches used in the experiments are presented in the expanded Materials and Methods section in the Original received May 17, 2002; first resubmission received March 31, 2003; second resubmission received January 15, 2004; revised resubmission received April 1, 2004; accepted April 7, 2004. From the Department of Pharmacology and Institute for Cardiovascular Research, State University of New York Upstate Medical University, Syracuse. Correspondence to Justus M.B. Anumonwo, PhD, Department of Pharmacology, State University of New York Upstate Medical University, 766 Irving Ave, Syracuse, NY 13210. E-mail [email protected] © 2004 American Heart Association, Inc. Circulation Research is available at http://www.circresaha.org DOI: 10.1161/01.RES.0000128408.66946.67 1332 Dhamoon et al Kir2.x Isoforms Determine IK1 Properties 1333 Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017 Figure 1. I-V relations of Kir2.x channels expressed in HEK293 cells. A, Comparison of ramp (⫺100 to 0 mV)-generated, bariumsensitive currents in cells expressing Kir2.x channels. Current in an untransfected cell is superimposed. B, Average data for cells expressing Kir2.1 (n⫽6), Kir2.2 (n⫽6), and Kir2.3 (n⫽4) channels. Data were normalized (norm) to current at ⫺100 mV. C, Average relative (rel) current (ratio of actual current measured and the current predicted assuming a linear unblocked current) as a function of voltage. Data were fit with a single (Kir2.1 and Kir2.2) or a double (Kir2.3) Boltzmann function. online data supplement available at http://circres.ahajournals.org. Guinea pig Kir2.1, Kir2.2, and Kir2.3, and sheep Kir2.3 were cloned using the polymerase chain reaction and transiently transfected into human embryonic kidney 293 (HEK293) cells using the Qiagen Effectene protocol. Guinea pig and sheep cardiac myocytes were enzymatically dissociated using the Langendorff-retrograde perfusion method as described previously.11 Inwardly rectifying currents were recorded using the whole-cell and cell-attached patch-clamp techniques. Kir2.x mRNA was measured using the ribonuclease (RNase) protection assay,16 and Kir2.x protein was measured using the Western blot technique. A mathematical model of the human atrial myocyte AP17 was implemented in C language on a SUN Ultra-10 workstation platform. Results Properties of Outward Currents Through Heterologously Expressed Kir2.x Channels Figure 1A shows representative current-voltage (I-V) relationships of Kir2.1, Kir2.2, and Kir2.3 currents measured in HEK293 cells, as well as I-V relations in an untransfected cell. A voltage-clamp ramp protocol from ⫺100 to 0 mV was used and barium-sensitive currents are shown. The data show marked differences in the rectification profiles of the expressed Kir2.x channels. The trace recorded from an untransfected HEK293 cell was almost indistinguishable from the x axis, showing that endogenous and leak currents contribute virtually no component to the barium-sensitive current. Figure 1B illustrates the rectification profiles of Kir2.x channels normalized to current at ⫺100 mV. Outward current peaked at similar voltages for Kir2.1 (⫺68.2⫾1.9 mV; n⫽6) and Kir2.2 (⫺74.2⫾1.7 mV; n⫽6). However, outward current in Kir2.3 channels peaked at a more positive potential (⫺54.7⫾3.1 mV; n⫽4; P⬍0.05) than the other 2 isoforms. There were no significant differences in the reversal potential (Erev) of the different isoforms (Kir2.1 ⫺86⫾1.1 mV; Kir2.2 ⫺86⫾1.2 mV; Kir2.3 ⫺85⫾1.2 mV; ANOVA). To quantify the degree of rectification of the Kir2.x channels, we ana- lyzed relative current (ratio of actual current measured and the current predicted assuming a linear unblocked current)18 by fitting with the Boltzmann equation. As shown in Figure 1C, a single Boltzmann function was sufficient to fit Kir2.1 and Kir2.2 currents. Kir2.2 currents showed stronger voltage dependence of rectification (z⫽3.66⫾0.43; n⫽6) than Kir2.1 currents (z⫽2.5⫾0.07; n⫽6; P⬍0.05). In contrast, Kir2.3 currents could only be fit by a double Boltzmann function (z1⫽1.31⫾0.05; z2⫽10.9⫾1.1; n⫽4). Properties of Outward Cardiac IK1 Based on the differences in the rectification profiles of the Kir2.x channels shown above, we examined outward atrial and ventricular IK1 properties in the guinea pig and sheep. We also correlated our data with Kir2.x mRNA and protein expression in the 2 species. Guinea Pig Atrial and Ventricular IK1 A comparative analysis of inward rectification properties in guinea pig atrial and ventricular myocytes has been described previously, but in the study,1 IK1 was not isolated from the IB. In Figure 2A, average barium-sensitive I-V relations of guinea pig atrial (n⫽6) and ventricular IK1 (n⫽4) are shown. Peak inward current density (Ip), measured at ⫺100 mV was ⫺4.76⫾0.53 pA/pF for atrial cells and was significantly greater (⫺9.18⫾1.3 pA/pF; P⬍0.05) in ventricular cells. The outward currents peaked at similar voltages (⫺67⫾2.4 mV versus ⫺61⫾2.6 mV), and the Erev was not significantly different (⫺82.9⫾1.8 mV versus ⫺81.9⫾1.3 mV) for atrial and ventricular cells, respectively. Note that IK1 rectified completely for both atrial and ventricular myocytes. We developed an RNase Protection Assay (RPA) to examine Kir2.x expression patterns in the guinea pig heart. Kir2.4 was not studied because there is evidence that these channels are only expressed in neuronal cells of the heart and 1334 Circulation Research May 28, 2004 Figure 2. Properties of IK1 in guinea pig atrial and ventricular cells. A, Current density-voltage (I-V) relationships of guinea pig atrial (n⫽6) and ventricular (n⫽4) IK1. I-V relationships in this as well as in subsequent figures were analyzed as barium-sensitive, ramp (⫺100 to 0 mV)-generated currents. B, Concentrations of Kir2.1 and Kir2.3 mRNA, normalized to cyclophilin, in the atria and the ventricle of the guinea pig. ND, not detected. *P⬍0.05. C, Western blot analysis in the guinea pig heart. Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017 not in cardiac myocytes.19 Figure 2B shows the relative concentrations of Kir2.1, Kir2.2, and Kir2.3 mRNA in the atria and the ventricle of the guinea pig, normalized per unit of cyclophilin. The ventricle expressed significant mRNA levels of both Kir2.1 and Kir2.3, whereas only Kir2.1 was present in the atria. Kir2.1 mRNA expression was 5-fold greater in the ventricle compared with the atria. Also, Kir2.2 mRNA was undetectable in both the atria and the ventricle but was detected in the brain. Figure 2C is the Western blot analysis of Kir2.1 (top) and Kir2.3 (bottom) in the guinea pig heart for atrial (left lane) and ventricular (right lane) tissue samples. The data are representative of analysis performed in 3 membrane preparations of guinea pig hearts. The blots show that Kir2.1 and Kir2.3 proteins are expressed in the guinea pig ventricles and that the atria express Kir2.1 but not Kir2.3. Sheep Atrial and Ventricular IK1 Given that there are important species-dependent differences in ion channel expression,20 we studied cardiac IK1 properties in the sheep, a commonly used animal model to study cardiac fibrillation in this and other laboratories. Properties of freshly isolated sheep cardiac myocytes are shown in the online data supplement. Figure 3A illustrates the I-V relationships for atrial (n⫽7) and ventricular (n⫽4) IK1. Ip was ⫺1.7⫾0.24 pA/pF in atrial cells and was significantly greater (⫺5.27⫾2.07 pA/pF; P⬍0.05) in ventricular cells. Note that at depolarized potentials, ventricular IK1 rectified completely, whereas atrial IK1 did not. Furthermore, peak outward IK1 in the atria was measured at ⫺41⫾3.5 mV compared with ⫺68⫾0.32 mV in the ventricle. Values for Erev in atrial (⫺82.3⫾1.5 mV) and ventricular (⫺87.3⫾1.4 mV) cells were not significantly different. Figure 3B illustrates atrial and ventricular IK1 after normalization to Ip. The I-V relationships of sheep atrial and ventricular IK1 are very similar to heterologously expressed Kir2.3 and Kir2.1 channels, respectively (Figure 1B). These data were correlated with Kir2.x mRNA and protein analysis. Figure 3C shows relative Kir2.x mRNA levels in the sheep atria and ventricles. The sheep ventricle expressed significant amounts of Kir2.1 and Kir2.3 mRNA. Furthermore, similar levels of Kir2.3 mRNA were expressed in the sheep atria and ventricle, whereas atrial Kir2.1 mRNA expression was only 10% of that measured in the ventricle. Kir2.2 mRNA was not detected in the sheep heart but was detected in the brain. Figure 3D is the Western blot analysis Figure 3. Properties of IK1 in sheep atrial and ventricular cells. A, I-V relationships of atrial (n⫽7) and ventricular (n⫽4) IK1 B, Atrial and ventricular IK1 normalized (norm) to peak inward current at ⫺100 mV. C, Concentrations of Kir2.1, Kir2.2, and Kir2.3 mRNA in the atria and the ventricle. mRNA amounts have been normalized to cyclophilin concentrations in each lane. ND, not detected. D, Western blot analysis. Dhamoon et al Kir2.x Isoforms Determine IK1 Properties 1335 Figure 4. Single-channel analysis of sheep Kir2.3 channels and sheep atrial and ventricular IK1, in cell-attached patches. The [K⫹] in the pipette and the bath solutions was 140 mmol/L, and the transmembrane potential was ⫺120 mV for all of the recordings. In all panels, calibration bars are 1 pA and 500 ms. A, Top, Trace of a representative recording of Kir2.3 channel, and the corresponding all-points histogram. Bottom, Events histogram of averaged unitary conductance data of Kir2.3 channels. B, Top, Trace of unitary IK1 recording from an atrial myocyte and the corresponding all-points histogram. Bottom, Events histogram of averaged unitary conductance data of atrial IK1. C, Top, Representative trace of unitary IK1 events in a ventricular myocyte and the corresponding amplitude histogram. Bottom, Events histogram of averaged unitary conductance data of ventricular IK1. Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017 of Kir2.1 (top) and Kir2.3 (bottom) in the sheep heart performed using atrial (left lane) or ventricular (right lane) tissue samples. The data are representative of analysis performed in 3 hearts. Our results show that whereas the Kir2.1 and Kir2.3 proteins are expressed in the sheep ventricles, Kir2.3 is the predominant Kir2.x isoform expressed in the sheep atria. Single-Channel Analyses Unlike studies in the guinea pig,19 unitary conductance properties of Kir2.x channels have not been correlated to IK1 channels expressed in the sheep myocardium. The trace in Figure 4A (top) is a cell-attached recording in a cell transfected with sheep Kir2.3 and the corresponding all-points histogram (top), which shows a single transition level from baseline. The bottom in Figure 4A is an events histogram showing a mean unitary conductance of 13.1⫾0.1 pS from a total of 232 transitions obtained from 15 patches. Figure 4B (top) is a cell-attached recording from an isolated sheep atrial cell and the corresponding all-points histogram. Note the presence of a distinct peak in the events histogram (Figure 4B, bottom). The mean unitary conductance was 9.9⫾0.1 pS, obtained from a total of 336 events in 32 patches in cells isolated from 5 sheep hearts. The data in Figure 4C were obtained from cell-attached recordings in sheep left ventricular myocytes. The all-points histogram (top) was obtained from the first 2.5 seconds of the trace shown. In contrast to the data in Figure 4A and 4B, the trace and the histogram in Figure 4C show multilevel transitions (n⫽270) that represent multiple conductance levels in 23 cell-attached patches from ventricular cells isolated from 5 sheep hearts. Outward Current Profiles and [Kⴙ]o The regulation of potassium channels by [K⫹]o has important physiological implications.3 Therefore, we were interested in determining how the outward current profiles of Kir2.x channels in high [K⫹]o correlate with changes in IK1 under similar conditions. Kir2.x Channels We characterized the whole-cell [K⫹]o dependence of outward Kir2.1 and Kir2.3 currents. Figure 5A shows I-V relationships of Kir2.1 channels (n⫽5) recorded in normal [K⫹]o (5.4 mmol/L [K⫹]o) and elevated [K⫹]o (10 mmol/L [K⫹]o). Currents were normalized to peak inward current recorded in normal [K⫹]o. Increasing [K⫹]o from 5.4 to 10 mmol/L resulted in a Nernstian shift in the Erev from ⫺82.9⫾1.6 mV to ⫺69.4⫾1.1 mV (P⬍0.05), a 3.2-fold increase in Ip and a 2-fold increase in the peak outward current through Kir2.1 channels. To compare the magnitude of outward current changes, we used the integration voltage, or the area under the curve (AUC) to describe outward currents from Erev to 0 mV. Elevation of [K⫹]o resulted in an increase in AUC from 6.15 to 13.9 U of normalized Figure 5. [K⫹]o dependence of Kir2.1 and Kir2.3 channels expressed in HEK293 cells. A, I-V relationships of Kir2.1 channels (n⫽5) recorded in 5.4 mmol/L [K⫹]o and in 10 mmol/L [K⫹]o. Data were normalized (norm) to peak inward current recorded in 5.4 mmol/L [K⫹]o. B, I-V relationships of sheep Kir2.3 channels (n⫽4) recorded in 5.4 mmol/L [K⫹]o and in 10 mmol/L [K⫹]o. Data were normalized to peak inward current recorded in 5.4 mmol/L [K⫹]o. 1336 Circulation Research May 28, 2004 Figure 6. [K⫹]o dependence of atrial and ventricular IK1 in the sheep and the guinea pig. A, I-V relationships of sheep ventricular IK1 recorded in 5.4 mmol/L [K⫹]o (n⫽4) and in 10 mmol/L [K⫹]o (n⫽3). B, I-V relationships of sheep atrial IK1 recorded in 5.4 mmol/L [K⫹]o (n⫽7) and in 10 mmol/L [K⫹]o (n⫽4). C, I-V relationships of guinea pig (GP) ventricular IK1 recorded in 5.4 mmol/L [K⫹]o (n⫽4) and in 10 mmol/L [K⫹]o (n⫽4). D, I-V relationships of GP atrial IK1 recorded in 5.4 mmol/L [K⫹]o (n⫽6) and in 10 mmol/L [K⫹]o (n⫽5). Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017 current䡠mV. Figure 5B shows I-V relationships of Kir2.3 channels recorded in normal and high [K⫹]o (n⫽4). Similar to Kir2.1 channels, high [K⫹]o resulted in a right shift of Erev from ⫺79⫾2.8 mV to ⫺61.7⫾5.4 mV (P⬍0.05) as well as a 2.8-fold increase in inward currents. Importantly, however, there was no increase in the magnitude of outward currents for Kir2.3 channels in elevated [K⫹]o. Sheep Cardiac Myocytes Figure 6A shows the I-V relationships of sheep ventricular IK1 in normal [K⫹]o (data from figure 4A) and from another group of cells in 10 mmol/L [K⫹]o. Elevated [K⫹]o resulted in a right shift of Erev from ⫺87.3⫾1.45 mV (n⫽4) to ⫺69.3⫾1.31 mV (n⫽3; P⬍0.05). Additionally, there was an increase in Ip from ⫺5.27⫾2.07 pA/pF to ⫺35.7⫾1.47 pA/pF (P⬍0.05), as well as an increase in AUC from 67.8⫾11.9 pA䡠mV/pF to 160.6⫾26.4 pA䡠mV/pF (P⬍0.05), similar to the heterologously expressed Kir2.1 isoform. Figure 6B shows the corresponding analysis in sheep atrial IK1. Elevated [K⫹]o resulted in a right shift of Erev from ⫺82.8⫾1.47 mV (n⫽7) to ⫺68.1⫾1.04 mV (n⫽4) and an increase in Ip from ⫺1.7⫾0.24 pA/pF to ⫺4.9⫾0.8 pA/pF. Importantly, similar to heterologously expressed Kir2.3 channels in high [K⫹]o, there was no increase in peak outward current for sheep atrial IK1. Guinea Pig Cardiac Myocytes Figure 6C illustrates the I-V relationships of ventricular IK1 in normal [K⫹]o (data from Figure 2A) and in elevated (10 mmol/L) [K⫹]o conditions. Elevation of [K⫹]o resulted in a right shift of Erev from ⫺81.9⫾1.28 mV (n⫽4) to ⫺68.7⫾0.26 mV (n⫽4; P⬍0.05), an increase in Ip from ⫺9.18⫾1.26 pA/pF to ⫺18.2⫾1.37 pA/pF (P⬍0.05), and an increase in AUC from 108.4⫾19.7 pA䡠mV/pF to 233.7⫾21.6 pA䡠mV/pF (P⬍0.05). Figure 6D is the I-V relationship of atrial IK1 in normal [K⫹]o (data from Figure 2A) and in high [K⫹]o. Ip in atrial cells increased from ⫺4.76⫾0.53 pA/pF (n⫽6) to ⫺18.9⫾2.2 pA/pF (n⫽5; P⬍0.05), and Erev shifted from ⫺82.9⫾1.79 mV to ⫺69.4⫾1.57 mV (P⬍0.05) as [K⫹]o was elevated. The AUC was significantly greater for guinea pig atrial IK1 (34.7⫾10.7 pA䡠mV/pF versus 93.8⫾21.5 pA䡠mV/pF; P⬍0.05) as [K⫹]o was increased. Rectification and [Kⴙ]o Sensitivity of Heteromeric Kir2.x Channels Heteromeric Kir2.x channels were studied by examining the properties of coexpressed Kir2.1 and Kir2.3 and concatenated Kir2.1-Kir2.3 subunits.12 Figure 7A shows the rectification profile and [K⫹]o dependence of coexpressed Kir2.1-Kir2.3 channels. Barium-sensitive I-V relationships (data not illustrated) showed virtually complete rectification from ⫺30 to 0 mV. Relative currents from coexpressed Kir2.1-Kir2.3 subunits were fit with the Boltzmann equation and z⫽2.34⫾0.12 (n⫽3), similar to Kir2.1 (2.5⫾0.07; n⫽6). Figure 7A also compares I-V relationships of coexpressed Kir2.1 and Kir2.3 subunits (n⫽3) in 5.4 mmol/L [K⫹]o and 10 mmol/L [K⫹]o. Increasing [K⫹]o resulted in a shift in Erev from ⫺83.6⫾0.9 mV to ⫺70.6⫾1.1 mV, a 3-fold increase in Ip and a 42% increase in peak outward current. An elevation of [K⫹]o resulted in an increase in AUC from 11.2 to 14.1 U of normalized current䡠mV. Figure 7B shows current density-voltage relationships of barium-sensitive currents through Kir2.1-Kir2.3 concatemers in 5.4 mmol/L [K⫹]o (n⫽4) and another group of cells in 10 mmol/L [K⫹]o (n⫽3). The covalently linked Kir2.1-Kir2.3 constructs displayed a prominent negative slope conductance Dhamoon et al Kir2.x Isoforms Determine IK1 Properties 1337 Figure 7. [K⫹]o dependence of Kir2.1Kir2.3 heteromeric channels expressed in HEK293 cells. A, I-V relationships of coexpressed Kir2.1 and Kir2.3 subunits in the pIRES vector (n⫽3) recorded in 5.4 mmol/L [K⫹]o and in 10 mmol/L [K⫹]o. Data were normalized to peak inward current recorded in 5.4 mmol/L [K⫹]o. B, Barium-sensitive current density-voltage relationships of Kir2.1-Kir2.3 concatemers recorded in 5.4 mmol/L [K⫹]o (n⫽4) and in 10 mmol/L [K⫹]o (n⫽3). Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017 and passed virtually no outward current at depolarized potentials. Relative currents from Kir2.1-Kir2.3 concatamers were fit with the Boltzmann equation and z⫽3.34⫾0.37. Elevating [K⫹]o resulted in a shift in Erev from ⫺85.2⫾1.3 mV to ⫺74.2⫾0.3 mV, a 4-fold increase in Ip and a 2.6-fold increase in peak outward current. Elevating [K⫹]o resulted in an increase in the AUC from 76.7⫾12.2 pA䡠mV/pF to 207⫾37 pA䡠mV/pF (P⬍0.05). These data suggest that the [K⫹]o dependence of outward currents through heteromeric Kir2.1Kir2.3 channels is determined by Kir2.1 and not Kir2.3 subunits. Discussion A major finding of this study is that outward currents in individual Kir2.x channel isoforms display distinct whole-cell rectification profiles and are modulated differently by elevated [K⫹]o. Our results demonstrate significant differences in regional Kir2.x expression patterns in the sheep and guinea pig. Species- and tissue-dependent differences in these IK1 properties are determined primarily by the specific Kir2.x isoforms expressed in the tissue. These data provide novel insight into the properties of IK1 channels, which shape the cardiac AP and play a role in various pathophysiological states.3,11,21 Outward Currents of Kir2.x Channels Although the biophysical properties of Kir2.x channels19,22–24 have been extensively examined, differences in outward currents within this subfamily have not been studied comparatively. Our data show that Kir2.1 and Kir2.2 channels displayed a prominent negative slope conductance and rectified completely at ⬇40 mV positive to the Erev. In contrast, Kir2.3 channels did not rectify completely at these depolarized potentials. The relatively weaker rectification of the Kir2.3 isoform has been observed previously but not discussed.14,24 Interestingly, heteromeric Kir2.1-Kir2.3 channels rectified completely at depolarized potentials, suggesting that Kir2.1 rectification properties are dominant in a Kir2.1Kir2.3 heteromeric complex. Recent evidence suggests that Kir2.x channels have differences in spermine sensitivity as well as in unblocking kinetics,25 which may contribute to their different rectification profiles. IK1 Properties in Atrial Cells Similar to previous studies, our data show that atrial IK1 has lower current density than ventricular IK1.1,4 – 6 Consistent with this, our RPA results in the guinea pig and sheep show lower overall expression of Kir2.x mRNA in the atria compared with the ventricle. Our data demonstrate striking differences in the atrial IK1 rectification profiles in these species. Our results show that Kir2.3 is the predominant Kir2.x isoform expressed in the sheep atria. Correspondingly, the rectification profile, [K⫹]o dependence, and single-channel conductance of sheep atrial IK1 are reminiscent of Kir2.3 channel properties. The smaller value of the single-channel conductance in native cells (9.9⫾0.1 pS) compared with Kir2.3 (13.1⫾0.1 pS) may be attributable to interactions with scaffolding proteins as described previously.19,26 In guinea pig atrial cells, our expression studies as well as rectification and [K⫹]o properties suggest that Kir2.1 plays a major role in determining atrial IK1. In a previous investigation,1 IK1 was not isolated from the background conductance, and complete rectification of guinea pig atrial IK1 was not evident. We explored the functional significance of the different rectification profiles in atrial IK1 by using a previously published mathematical model of the human atrial AP.17 The parameters in the equation for IK1 were modified to obtain fits to the normalized I-V plots for Kir2.1 and Kir2.3, as shown in Figure 8A. Figure 8B depicts APs and the underlying IK1 currents obtained by fits to Kir2.1 and Kir2.3 data. The AP based on Kir2.3-like IK1 characteristics displays a shorter AP duration compared with the corresponding Kir2.1 AP. Our results show that IK1 with Kir2.1-like properties is important only during the terminal phase of repolarization. In contrast, IK1 with Kir2.3-like characteristics contributes to a repolarizing current during the plateau phase of the AP, in addition to the terminal phase of repolarization. This suggests that differences in the IK1 rectification profile may be important for determining the relative role of IK1 in cardiac repolarization (see also Nichols et al27). IK1 Properties in Ventricular Cells In both sheep and guinea pig ventricles, IK1 has a prominent negative slope conductance, which is consistent with relatively high levels of Kir2.1 subunits expressed in these tissues. The ventricles also express significant levels of 1338 Circulation Research May 28, 2004 Figure 8. Simulation of atrial AP (see online text for model details). A, The equation for IK1 was modified to obtain fits to the normalized I-V relationships of Kir2.1 and Kir2.3 shown in Figure 1B. B, Top, Steady-state APs obtained by running the model for 13 seconds at 1 Hz. Bottom, Underlying Kir2.x currents using Kir2.1 and Kir2.3 I-V relationships. Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017 Kir2.3 mRNA and protein. Although regulated by many factors,24,28,29 the role of Kir2.3 subunits in this tissue is not clear because the rectification and [K⫹]o properties of this isoform are not apparent in the ventricles. Our data suggest that the properties of Kir2.3 subunits are not evident in the ventricles because in a heteromeric complex, Kir2.1 properties are dominant. Although in our study sheep and guinea pig ventricular IK1 displayed similar rectification characteristics, previous work has shown that there are species-specific differences in the rectification properties of ventricular IK1 in other species.30 Our single-channel data of the sheep ventricles show that there are wide distributions of conductances, which may correspond to homomeric Kir2.1 and Kir2.3 channels as well as heteromeric channels. Clearly, further work is required to understand the regulation of heteromeric Kir2.x channels and their role in native IK1. The results of our RPA do not show any measurable expression of Kir2.2 mRNA in the guinea pig atria or ventricles. In contrast, Liu et al suggested that Kir2.2 is the major guinea pig ventricular isoform underlying IK1.19 This conclusion was primarily based on correlation of singlechannel conductances and barium sensitivities of heterologously expressed Kir2.x channels with native guinea pig myocytes. Similarities in barium sensitivities of Kir2.2 and native IK1 can be interpreted in other ways. For instance, Schram et al14 have shown that the barium sensitivity of coexpressed Kir2.1 and Kir2.3 channels is very similar to native IK1 and to homomeric Kir2.2 channels but is very different from that of homomeric Kir2.1 and Kir2.3 channels. Commercially available Kir2.2 antibodies designed against a rat epitope are available through Alomone labs (Jerusalem, Israel). These antibodies did not detect Kir2.2 protein in sheep or guinea pig tissue or transfected cells, perhaps because the corresponding guinea pig Kir2.2 epitope only has 12 of 19 residues identical to the rat epitope. The homology of sheep Kir2.2 to the rat epitope is unknown because this gene has not yet been cloned. Nevertheless, our mRNA results clearly show that Kir2.2 is expressed in the brain but not in the heart of sheep or guinea pigs using species-specific antisense probes. [Kⴙ]o Dependence of Outward Currents in Kir2.x Channels and IK1 [K⫹]o is elevated during pathophysiological states such as in ischemia, tachycardia, and fibrillation.31 K⫹ ions can accumulate in either intercellular clefts or t-tubules of cardiac myocytes, which is particularly relevant because Kir2.x subunits are expressed in t-tubules6,32 and the intercalated disks6 of cardiac myocytes. Yet, differences in the effect of high [K⫹]o on outward currents in Kir2.x isoforms have not been described comparatively. We have shown that increasing [K⫹]o resulted in a Nernstian shift of Erev and an increase in inward currents for Kir2.1 and Kir2.3 channels. However, whereas Kir2.1 channels showed an increase in outward currents in high [K⫹]o, Kir2.3 channels did not. Accordingly, sheep atria, which predominantly express Kir2.3 channels, did not exhibit an increase in the outward component of IK1 in high [K⫹]o. In contrast, guinea pig atrial IK1, mediated mainly by Kir2.1, showed an increase in outward current in high [K⫹]o. Curiously, guinea pig atrial IK1 showed a more prominent secondary hump at depolarized potentials in high [K⫹]o. Also, guinea pig and sheep ventricles, which express both Kir2.1 and Kir2.3 subunits, showed an increase in outward currents in high [K⫹]o, attributable to the dominant role of Kir2.1 in a heteromeric complex. Potential Limitations Although our data show that differential expression of Kir2.x isoforms play an important role in determining the rectification properties of native IK1, other factors, such as differences in levels of polyamines in different tissues and species, may also be important in modulating rectification properties. The single-channel properties (ie, unitary conductance and open probability) of heteromeric Kir2.x channels are unknown, therefore, it is difficult to correlate unitary conductance values of heterologously expressed homomeric Kir2.x isoforms with IK1 unitary events in the ventricle, which are presumably determined by heteromeric Kir2.x complexes. In conclusion, our studies show that heterologously expressed Kir2.x channels display important differences in their whole-cell outward current profiles, as well as the [K⫹]o dependence of their outward currents. The results also show Dhamoon et al that Kir2.1 rectification properties and [K⫹]o sensitivity are dominant in a heteromeric Kir2.x complex. Tissue and species-specific expression of these isoforms determine the biophysical and regulatory properties of IK1 in the heart. Acknowledgments This work was supported by grants PO1 HL39707 and HL60843 from the National Heart, Lung, and Blood Institute and a predoctoral fellowship from the American Heart Association (to A.D.). We would like to thank Drs José Jalife and Mario Delmar for critically reading this manuscript, Jiang Jiang for his expert technical assistance, and Dr Eduardo Solessio for his insight. Also, we would like to thank Regina Preisig-Muller for the Kir2.1-Kir2.3 concatemers. References Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017 1. Hume JR, Uehara A. Ionic basis of the different action potential configurations of single guinea-pig atrial and ventricular myocytes. J Physiol. 1985;368:525–544. 2. Shimoni Y, Clark RB, Giles WR. Role of an inwardly rectifying potassium current in rabbit ventricular action potential. J Physiol. 1992; 448:709 –727. 3. Lopatin AN, Nichols CG. Inward rectifiers in the heart: an update on i(k1). J Mol Cell Cardiol. 2001;33:625– 638. 4. Giles WR, Imaizumi Y. Comparison of potassium currents in rabbit atrial and ventricular cells. J Physiol. 1988;405:123–145. 5. Koumi S, Backer CL, Arentzen CE. Characterization of inwardly rectifying K⫹ channel in human cardiac myocytes. Alterations in channel behavior in myocytes isolated from patients with idiopathic dilated cardiomyopathy. Circulation. 1995;92:164 –174. 6. Melnyk P, Zhang L, Shrier A, Nattel S. Differential distribution of Kir2.1 and Kir2.3 subunits in canine atrium and ventricle. Am J Physiol Heart Circ Physiol. 2002;283:H1123–H1133. 7. Wang Z, Yue L, White M, Pelletier G, Nattel S. Differential distribution of inward rectifier potassium channel transcripts in human atrium versus ventricle. Circulation. 1998;98:2422–2428. 8. Dhamoon AS, Bagwe S, Guha P, Anumonwo J, Taffet SM, Jalife J. Differential expression and whole-cell current rectification profiles of guinea pig Kir2.x channels. Biophys J. 2002;82(1):587a Abstract. 9. Warren M, Guha PK, Berenfeld O, Zaitsev A, Anumonwo JM, Dhamoon AS, Bagwe S, Taffet SM, Jalife J. Blockade of the inward rectifying potassium current terminates ventricular fibrillation in the guinea pig heart. J Cardiovasc Electrophysiol. 2003;14:621– 631. 10. Sarmast F, Kolli A, Zaitsev A, Parisian K, Dhamoon AS, Guha PK, Warren M, Anumonwo JM, Taffet SM, Berenfeld O, Jalife J. Cholinergic atrial fibrillation: I(K,ACh) gradients determine unequal left/right atrial frequencies and rotor dynamics. Cardiovasc Res. 2003;59:863– 873. 11. Samie FH, Berenfeld O, Anumonwo J, Mironov SF, Udassi S, Beaumont J, Taffet S, Pertsov AM, Jalife J. Rectification of the background potassium current: a determinant of rotor dynamics in ventricular fibrillation. Circ Res. 2001;89:1216 –1223. 12. Preisig-Muller R, Schlichthorl G, Goerge T, Heinen S, Bruggemann A, Rajan S, Derst C, Veh RW, Daut J. Heteromerization of Kir2.x potassium channels contributes to the phenotype of Andersen’s syndrome. Proc Natl Acad Sci U S A. 2002;99:7774 –7779. 13. Zobel C, Cho HC, Nguyen TT, Pekhletski R, Diaz RJ, Wilson GJ, Backx PH. Molecular dissection of the inward rectifier potassium current (IK1) in rabbit cardiomyocytes: evidence for heteromeric co-assembly of Kir2.1 and Kir2.2. J Physiol. 2003;550:365–372. 14. Schram G, Pourrier M, Wang Z, White M, Nattel S. Barium block of Kir2 and human cardiac inward rectifier currents: evidence for subunit- Kir2.x Isoforms Determine IK1 Properties 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 1339 heteromeric contribution to native currents. Cardiovasc Res. 2003;59: 328 –338. Dhamoon AS, Pandit S, Anghel T, Sarmast F, Anumonwo J, Taffet SM, Jalife J. Differential expression of individual Kir2.x isoforms determines differences in action potential shape and [K⫹]o dependence of IK1 in atrial and ventricular myocytes. Pacing Clin Electrophysiol. 2003;26(4):956 Abstract. Vaidya D, Tamaddon HS, Lo CW, Taffet SM, Delmar M, Morley GE, Jalife J. Null mutation of connexin43 causes slow propagation of ventricular activation in the late stages of mouse embryonic development. Circ Res. 2001;88:1196 –1202. Courtemanche M, Ramirez RJ, Nattel S. Ionic mechanisms underlying human atrial action potential properties: insights from a mathematical model. Am J Physiol. 1998;275:H301–H321. Shyng SL, Sha Q, Ferrigni T, Lopatin AN, Nichols CG. Depletion of intracellular polyamines relieves inward rectification of potassium channels. Proc Natl Acad Sci U S A. 1996;93:12014 –12019. Liu GX, Derst C, Schlichthorl G, Heinen S, Seebohm G, Bruggemann A, Kummer W, Veh RW, Daut J, Preisig-Muller R. Comparison of cloned Kir2 channels with native inward rectifier K⫹ channels from guinea-pig cardiomyocytes. J Physiol. 2001;532:115–126. Nerbonne JM. Molecular basis of functional voltage-gated K⫹ channel diversity in the mammalian myocardium. J Physiol. 2000;525:285–298. Plaster NM, Tawil R, Tristani-Firouzi M, Canun S, Bendahhou S, Tsunoda A, Donaldson MR, Iannaccone ST, Brunt E, Barohn R, Clark J, Deymeer F, George AL, Fish FA, Hahn A, Nitu A, Ozdemir C, Serdaroglu P, Subramony SH, Wolfe G, Fu Y, Ptacek LJ. Mutations in kir2.1 cause the developmental and episodic electrical phenotypes of Andersen’s syndrome. Cell. 2001;105:511–519. Kubo Y, Baldwin TJ, Jan YN, Jan LY. Primary structure and functional expression of a mouse inward rectifier potassium channel. Nature. 1993; 362:127–133. Lopatin AN, Makhina EN, Nichols CG. The mechanism of inward rectification of potassium channels: “long-pore plugging” by cytoplasmic polyamines. J Gen Physiol. 1995;106:923–955. Liu Y, Liu D, Heath L, Meyers DM, Krafte DS, Wagoner PK, Silvia CP, Yu W, Curran ME. Direct activation of an inwardly rectifying potassium channel by arachidonic acid. Mol Pharmacol. 2001;59:1061–1068. Panama B, Mclerie M, Lopatin AN. Differential spermine sensitivity in Kir2 inward rectifier potassium channels. Biophys J. 2004;86(1):125a Abstract. Nehring RB, Wischmeyer E, Doring F, Veh RW, Sheng M, Karschin A. Neuronal inwardly rectifying K(⫹) channels differentially couple to PDZ proteins of the PSD-95/SAP90 family. J Neurosci. 2000;20:156 –162. Nichols CG, Makhina EN, Pearson WL, Sha Q, Lopatin AN. Inward rectification and implications for cardiac excitability. Circ Res. 1996; 78:1–7. Zhu G, Chanchevalap S, Cui N, Jiang C. Effects of intra- and extracellular acidifications on single channel Kir2.3 currents. J Physiol (Lond). 1999; 516:699 –710. Zhu G, Qu Z, Cui N, Jiang C. Suppression of Kir2.3 activity by protein kinase C phosphorylation of the channel protein at threonine 53. J Biol Chem. 1999;274:11643–11646. Martin RL, Koumi S, Ten Eick RE. Comparison of the effects of internal [Mg2⫹] on IK1 in cat and guinea pig cardiac ventricular myocytes. J Mol Cell Cardiol. 1995;27:673– 691. Sejersted OM, Sjogaard G. Dynamics and consequences of potassium shifts in skeletal muscle and heart during exercise. Physiol Rev. 2000;80: 1411–1481. Clark RB, Tremblay A, Melnyk P, Allen BG, Giles WR, Fiset C. T-tubule localization of the inward-rectifier K(⫹) channel in mouse ventricular myocytes: a role in K(⫹) accumulation. J Physiol. 2001;537:979 –992. Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017 Unique Kir2.x Properties Determine Regional and Species Differences in the Cardiac Inward Rectifier K + Current Amit S. Dhamoon, Sandeep V. Pandit, Farzad Sarmast, Keely R. Parisian, Prabal Guha, You Li, Suveer Bagwe, Steven M. Taffet and Justus M.B. Anumonwo Circ Res. 2004;94:1332-1339; originally published online April 15, 2004; doi: 10.1161/01.RES.0000128408.66946.67 Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231 Copyright © 2004 American Heart Association, Inc. All rights reserved. Print ISSN: 0009-7330. Online ISSN: 1524-4571 The online version of this article, along with updated information and services, is located on the World Wide Web at: http://circres.ahajournals.org/content/94/10/1332 Data Supplement (unedited) at: http://circres.ahajournals.org/content/suppl/2004/05/16/94.10.1332.DC1 Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: http://www.lww.com/reprints Subscriptions: Information about subscribing to Circulation Research is online at: http://circres.ahajournals.org//subscriptions/ Solutions Whole Cell Recordings HEK293 cells: Tyrode’s solution: (mmol/L) NaCl 140, KCl 5.4, CaCl2 1.8, NaH2PO4 0.33, HEPES 5.0; pH 7.4 (NaOH). When [K+]o was increased to 10 mmol/L [K+]o, we carried out equimolar substitution by decreasing extracellular NaCl by 4.6 mmol/L. The concentrations of other ions were not changed. For experiments in which BaCl2 was used to block inwardly rectifying channels, 0.25-1 mmol/L BaCl2 was added to the Tyrode’s solution. The cells were superfused with this solution until IK1 channels were completely blocked. Pipette filling solution: (mmol/L) KCl 20, K-aspartate 90, KH2PO4 10, EDTA 5.0, K2ATP 1.9, HEPES 5.0 and Mg2+ 7.9; pH 7.2 (KOH). With the above concentration of EDTA, Mg2+ concentration is expected to be 1.1 mmol/L.1 Guinea pig and sheep myocytes: Ca2+-free cardioplegic: (mmol/L) Glucose 280, KCl 13.44, NaHCO3 12.6, Mannitol 34. Tyrode’s solution: (mmol/L) NaCl 148, KCl 5.4, MgCl2 1.0, CaCl2 1.8, NaH2PO4 0.4, Glucose 5.5, HEPES 15; pH 7.4 (NaOH). When [K+]o was increased to 10 mmol/L [K+]o, we carried out equimolar substitution by decreasing extracellular NaCl by 4.6 mmol/L. The concentrations of other ions were not changed. Low Ca2+ solution: (mmol/L) NaCl 148, KCl 5.4, MgCl2 1.0, NaH2PO4 0.4, Glucose 5.5, HEPES 15, Albumin 1 mg/mL; pH 7.2 (NaOH). Enzyme solution: Same as the Low Ca2+ solution, but in addition, contains collagenase (100 units/mL, Worthington, type II (Lakewood, NJ) for guinea pig and 200 units/mL, Worthington, type II (Lakewood, NJ) for sheep hearts). KB Solution: (mmol/L) KCl 80, MgSO4 5, KH2PO4 30, Glucose 20, EGTA 0.25, Creatine 5, β-Hydroxybutyric acid 5, Taurine 20, Pyruvic acid 5, ATP 5; pH 7.4 (KOH). Pipette filling solution: (mmol/L) KCl 148, MgCl2 1, EGTA 5, HEPES 5, Creatine 2, ATP 5, Phosphocreatine 5; pH 7.2 (KOH). For IK1 measurement, 5 µmol/L nifedipine was added to block ICaL channels and the Ca2+sensitive ICl. BaCl2 (0.4-1 mmol/L) was used to isolate IK1 from other background currents. Single Channel Recordings Bath solution for cell-attached recordings: (mmol/L) KCl 140, CaCl2 1.8, HEPES 5, NaH2PO4 0.33; pH 7.4 (KOH). Pipette solution for cell-attached recordings: (mmol/L) KCl 140, CaCl2 1, HEPES 5; pH 7.4 (KOH). Single-channel events were recorded from and to baseline. For cell-attached recordings, 1-5 µmol/L BaCl2 was added to the pipette solution to reduce open probability (Po) and increase the number of transitions. It has been previously demonstrated that 1 µM BaCl2 does not change the unitary conductance of IK1 channels compared to control.2-4 Also, the single channel conductance for Kir2.3 channels was not statistically different with 1 µmol/L BaCl2 (13.4 pS; n = 24) or 5 µmol/L BaCl2 (13.1 pS; n = 208) in the pipette filling solution and therefore, these data were combined. Similarly, recordings in 1 and 5 µmol/L BaCl2 were combined for sheep atrial cell recordings as well as for ventricular cell single-channel recordings. Enzymatic dissociation of cardiac myocytes Guinea pig myocytes were isolated using the Langendorff retrograde perfusion method, the details of which have been previously described.5,6 Isolated atrial and ventricular cells were separately kept at 37°C in KB solution for 30 minutes for recovery. In this study, ventricular cells were only taken from the left ventricle. The KB solution (including the cells) was gradually brought up to 10 mL using normal Tyrode’s solution. This process was carried out in 5-minute steps, with an increasing volume of the Tyrode’s solution. Cells were kept at room temperature until use. Sheep atrial and ventricular myocytes were similarly isolated using the Langendorff method. Sheep (15-17 kg) were anesthetized with sodium pentobarbital (30 mg/kg I.V.). Following thoracotomy, hearts were retrogradely perfused (160 mL/min) with Tyrode’s solution at 37°C until the effluent was clear of blood and then with the Ca2+-free solution for 10 minutes. The enzyme solution was perfused for 40 minutes. This was followed with the perfusion of the KB storage solution for 10 minutes. Sections of the heart were removed from both the atria and the left ventricle and transferred into separate 100 mL flasks containing 20 mL of KB solution. The isolated cells were kept at 37°C in KB solution for another 30 minutes for recovery. The 20 mL KB solution (including the cells) was gradually brought up to 100 mL with an increasing volume of Tyrode’s solution. Cells were kept at room temperature until use. Cloning of Kir2.x channels We cloned the cDNA for Kir2.1, 2.2, and 2.3 channels from guinea pig DNA using the polymerase chain reaction (PCR). Primer pairs for PCR were designed based on the guinea pig Kir2.x sequences in the Genbank database (AF187872, AF187873, AF187874, AF187875). We obtained PCR products for Kir2.1, 2.2 and 2.3 and their DNA sequences were confirmed. The sequences of our guinea pig Kir2.2 and 2.3 clones were not identical to the published sequences.4 All of our Kir2.2 clones had a serine at amino acid position 196 while the published sequence had an aspartate. We believe that our sequence is correct and the submitted sequence is in error. This conclusion was reached upon comparing our sequence with the human, rat and mouse Kir2.2 sequences which all had a serine at this site. Likewise, all of our Kir2.3 sequences had two amino acid differences with the published sequence. Our sequencing results showed an asparagine and a valine at amino acid positions 243 and 244, respectively, that were consistent with the human, rat, and mouse sequences. Once again we believe that our clones are the correct sequence. Kir2.1, 2.2 and 2.3 cDNA have each been subcloned into the bicistrionic mammalian expression vector, pIRES-hrGFP (Stratagene, La Jolla, CA), which allowed for the simultaneous expression of the Kir2.x protein and the green fluorescent protein marker. We cloned the cDNA for sheep Kir2.3 channels from sheep genomic DNA using PCR. The forward (5’-ATGCACGGACACAGCCGCAAC GGGCAG-3’) and reverse (5’TCAGATGGCAGACTCCCTGCG-3’) primers are based on the consensus sequence of the first and last twenty nucleotides from the Kir2.3 sequence from several different species. We obtained PCR product and its DNA sequence was confirmed. Figure 1 shows the nucleotide sequence and the expected protein sequence of sheep Kir2.3. The first and last six amino acids are based upon the consensus sequence of the forward and reverse primers from other species. Sheep Kir2.3 cDNA was subcloned into the pIRES-hrGFP (Stratagene, La Jolla, CA), similar to the guinea pig Kir2.x experiments. We subcloned the guinea pig Kir2.1 and 2.3 cDNA into the bicistrionic pIRES vector (Clontech, Palo Alto, CA). Co-expression of Kir2.1 and 2.3 protein was confirmed by western blot. Concatemers of Kir2.1 and 2.3 in pCDNA3 were a generous gift from C. Derst.7 The electrophysiological properties of Kir2.1-2.3 concatemers were indistinguishable from the properties of Kir2.3-2.1 concatemers7 and data from the two constructs were pooled. Cell culture and transfection procedures HEK293 cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum. We used the Effectene (Qiagen, Valencia, CA) protocol to transiently transfect HEK293 cells following manufacturer’s instructions. In order to visualize transfected cells for patch-clamping, the pIRES and pCDNA3 vectors were cotransfected with pEGFP-N1 (Clontech, Palo Alto, CA). RNase Protection Assay RNase protection assay was carried out as described previously.8 Briefly, total RNA was extracted from the atria and ventricles of six guinea pigs (300g) and three sheep (15-17 kg) hearts using Tri Reagent (MRC Inc., Cincinnati, OH) following manufacturer’s instructions. Antisense probes were designed to recognize coding regions of guinea pig Kir2.x channels. Separate antisense probes were designed for the sheep Kir2.x clones. A probe for the housekeeping gene, cyclophilin, was used as a control. In vitro transcribed full-length Kir2.x mRNA and guinea pig brain RNA extracts were used as positive controls for the guinea pig experiments. In vitro transcribed portions of sheep Kir2.x coding regions as well as sheep brain RNA extracts were used as positive controls for sheep RPA experiments. The RPA was performed using the Riboquant RPA kit (Pharmingen, San Diego, CA). Total mRNA from the atria and ventricle was hybridized to antisense radioactive probes against various Kir2.x isoforms and cyclophilin. Hybridized RNA was digested with ribonuclease and the protected, labeled RNA was resolved on an acrylamide gel and visualized by phosphorimager, which allows for quantification of the radioactive signal. The band density in each lane was normalized to the cyclophilin band intensity and averaged. Phosphorimager (Molecular Dynamics/Amersham, Piscataway, NJ) Kir2.x RPA signals were quantified as a percentage of the cyclophilin signal using Imagequant (Molecular Dynamics/Amersham, Piscataway, NJ) software. Figure 2 shows that antisense guinea pig Kir2.x probes were able to detect their respective RNA species in the brain of the guinea pig. We were not able to detect Kir2.2 in the heart, but we were able to detect Kir2.2 RNA in the brain. Figure 3 shows that antisense sheep Kir2.x probes were able to detect their respective RNA species in the brain. Like the guinea pig, Kir2.2 was detected in the brain of the sheep, but was not found to be expressed in the heart. Western blots Guinea pig and sheep membrane proteins were isolated as described previously.9 Three separate guinea pig and sheep membrane preparations were analyzed. Each guinea pig membrane preparation consisted of atrial and ventricular tissues combined from two animals. Guinea pig and sheep atrial and ventricular membrane proteins (~20 µg) were resolved by 10% SDS-PAGE and then probed by Western blot analysis with anti-Kir2.1 (Alomone labs, Jerusalem, Israel) and anti-Kir2.3 (Chemicon International, Tenecula, CA) antibodies. Immunoreactivity was visualized by ECL reagent (Amersham Pharmacia Biotech, Piscataway, NJ). Electrophysiology Whole-cell patch-clamp recordings were carried out as previously described.10,11 Wholecell and cell-attached recordings were obtained using Axopatch 1D and 200B amplifiers (Axon Instruments, Union City, CA). The data were acquired and analyzed using the pCLAMP 8 suite of programs (Axon Instruments, Union City, CA). Recordings in cardiac myocytes were performed at 37 ± 0.5 °C. Recordings from HEK293 cells were done at room temperature (21-22 °C). Electrophysiology on HEK293 cells was commenced 24-48 h after transfection by Kir2.x cDNA. Pipette resistance was 2-3 MΩ for whole-cell IK1 recordings in normal [K+]o. For recordings in 10 mmol/L [K+]o in which currents were significantly larger, pipette resistance was reduced to 1-2 MΩ in order to minimize voltage clamp error. For cell-attached single-channel recordings pipette resistance was 8-12 MΩ. For recording whole-cell IK1 currents, voltage-clamp ramps were applied from –100 to 0 mV. For native cardiac myocytes, a slow ramp protocol (1.6 mV/sec) was utilized in order to minimize possible activation of other currents. For recording Kir2.x currents in HEK293 cells, the ramp rate was 30 mV/sec. Data Analysis for Kir2.x isoforms The degree of rectification for the Kir2.x isoforms was estimated as the relative chord conductance (Gc) in accordance with an earlier study.12 Gc was calculated as the ratio of the actual current and current predicted by assuming a linear unblocked current (Data for Gc near the reversal potential were discarded from analysis since the ratio of current to voltage approaches “0/0” near this potential). Gc relationships obtained for Kir2.1 and 2.2 were fitted by a single Boltzmann equation: Vm = [1.0/ {1.0 + exp(-λ1(V – V1))}] Equation 1. The Gc relationship for Kir2.3 was fitted by a sum of two Boltzmann equations described by: Vm = [A1/ {1.0 + exp(-λ1(V – V1))} + A2/ {1.0 + exp(-λ2(V – V2))}] Equation 2. The sum of their respective amplitudes A1 and A2 were normalized to 1.0 (A1 + A2 = 1.0). V is the membrane potential, V1,2 represent parameters, and λ1,2 = zF/RT, where z stands for the effective valency or steepness of rectification, F is Faraday’s constant, R is the gas constant, and T is the absolute temperature. Computer Simulations A mathematical model of the human atrial myocyte13 was implemented in C, on a SUN Ultra-10 workstation platform. The diferential equations in this model were integrated using a fixed time step (∆t = 0.005 msec) Euler method, to simulate the atrial action potential. This model was then used to assess the functional significance of the differential rectification profiles of Kir2.1 and Kir2.3 in modulating the action potential waveform. The parameters in the equation for IK1 in the atrial model were modified to obtain fits to the normalized I-V plots for Kir2.1 and Kir2.3. These fits were then scaled so that the absolute current magnitude of the equations used to fit the Kir2.1 and Kir2.3 data at –100 mV was identical to that of the original value of IK1 in the human atrial model (~-80 pA). These new equations for IK1 were then incorporated into the whole-cell human atrial model, and then steady-state action potentials were obtained by running the model for 13 seconds at 1.0 Hz. Statistical Analysis All experimental results were presented as mean ± SEM. The significance of differences between the means was evaluated by one-way ANOVA or student’s t-test as appropriate. A value of P ≤ 0.05 was used as the criterion for significance. FIGURE LEGENDS Figure 1 Sheep Kir2.3 sequence. A. cDNA sequence of sheep Kir2.3. The first and last 29 bases (six amino acids) are defined from the polymerase chain reaction primers, which are based on the consensus sequence of cloned Kir2.3 sequences. B. Predicted amino acid sequence based on the above cDNA. Figure 2 Guinea pig RNase protection assay positive controls. Examples of Kir2.x mRNA protection signals obtained from representative heart and brain samples. For Kir2.1, 2.2, and 2.3, lanes with the undigested probe show the location of the unprotected length of the probe. The location of the size of the protected probe (designated by arrows) was determined by using in vitro transcribed positive control mRNA (data not shown). Kir2.x signals were normalized with cyclophilin mRNA as internal control. Note the absent Kir2.2 signal in the heart, but a clear signal in the brain. Figure 3 Sheep RNase protection assay positive controls. Examples of Kir2.x mRNA protection signals obtained from representative heart and brain samples. For Kir2.1, 2.2, and 2.3, lanes with the undigested probe show the location of the unprotected length of the probe. The location of the size of the protected probe (designated by arrows) was determined by using in vitro transcribed positive control mRNA (data not shown). Kir2.x signals were normalized with cyclophilin mRNA as internal control. Note the absent Kir2.2 signal in the heart, but a clear signal in the brain. Figure 4 Representative RPAs of guinea pig and sheep mRNA. A. Guinea pig Kir2.1 and 2.3 RPA gels using atrial and ventricular tissue. Note that Kir2.1 is the predominant Kir2.x isoform in the sheep atria. B. Sheep Kir2.1 and 2.3 RPA gels using atrial and ventricular tissue. Note that Kir2.3 is the predominant Kir2.x isoform in the sheep atria. Figure 5 Representative western blots of guinea pig and sheep atria and ventricles. Figure 6 Current-voltage relations of Kir2.1 and Kir2.3 channels expressed in HEK293 cells recorded at 37o C. Average data of ramp (-100 mV to 0 mV)-generated, barium-sensitive currents for cells expressing Kir2.1 (n = 3) and Kir2.3 (n = 3) channels. Data were normalized to current at –100 mV. Figure 7 Representative current-voltage relations of the background current recorded from guinea pig and sheep atrial and ventricular myocytes. A. Ramp (-100 mV to 0 mV)-generated guinea pig atrial and ventricular background current. B. Ramp (-100 mV to 0 mV)generated sheep atrial and ventricular background current. Table 1 Properties of freshly isolated sheep atrial and ventricular cells. Reference List 1. Fabiato A, Fabiato F. Calculator programs for computing the composition of the solutions containing multiple metals and ligands used for experiments in skinned muscle cells. J Physiol (Paris). 1979;75:463-505. 2. Kubo Y, Baldwin TJ, Jan YN, Jan LY. Primary structure and functional expression of a mouse inward rectifier potassium channel. Nature. 1993;362:127-133. 3. Makhina EN, Kelly AJ, Lopatin AN, Mercer RW, Nichols CG. Cloning and expression of a novel human brain inward rectifier potassium channel. J Biol Chem. 1994;269:20468-20474. 4. Liu GX, Derst C, Schlichthorl G, Heinen S, Seebohm G, Bruggemann A, Kummer W, Veh RW, Daut J, Preisig-Muller R. Comparison of cloned Kir2 channels with native inward rectifier K+ channels from guinea-pig cardiomyocytes. J Physiol. 2001;532:115-126. 5. Morley GE, Anumonwo JM, Delmar M. Effects of 2,4-dinitrophenol or low [ATP]i on cell excitability and action potential propagation in guinea pig ventricular myocytes. Circ Res. 1992;71:821-830. 6. Anumonwo JM, Freeman LC, Kwok WM, Kass RS. Delayed rectification in single cells isolated from guinea pig sinoatrial node. Am J Physiol. 1992;262:H921-H925. 7. Preisig-Muller R, Schlichthorl G, Goerge T, Heinen S, Bruggemann A, Rajan S, Derst C, Veh RW, Daut J. Heteromerization of Kir2.x potassium channels contributes to the phenotype of Andersen's syndrome. Proc Natl Acad Sci U S A. 2002;99:7774-7779. 8. Vaidya D, Tamaddon HS, Lo CW, Taffet SM, Delmar M, Morley GE, Jalife J. Null mutation of connexin43 causes slow propagation of ventricular activation in the late stages of mouse embryonic development. Circ Res. 2001;88:1196-1202. 9. Pond AL, Scheve BK, Benedict AT, Petrecca K, Van Wagoner DR, Shrier A, Nerbonne JM. Expression of distinct ERG proteins in rat, mouse, and human heart. Relation to functional I(Kr) channels. J Biol Chem. 2000;275:5997-6006. 10. Anumonwo JM, Horta J, Delmar M, Taffet SM, Jalife J. Proton and zinc effects on HERG currents. Biophys J. 1999;77:282-298. 11. Samie FH, Berenfeld O, Anumonwo J, Mironov SF, Udassi S, Beaumont J, Taffet S, Pertsov AM, Jalife J. Rectification of the background potassium current: a determinant of rotor dynamics in ventricular fibrillation. Circ Res. 2001;89:12161223. 12. Shyng SL, Sha Q, Ferrigni T, Lopatin AN, Nichols CG. Depletion of intracellular polyamines relieves inward rectification of potassium channels. Proc Natl Acad Sci U S A. 1996;93:12014-12019. 13. Courtemanche M, Ramirez RJ, Nattel S. Ionic mechanisms underlying human atrial action potential properties: insights from a mathematical model. Am J Physiol. 1998;275:H301-H321. Figure 1 ATGCACGGACACAGCCGCAACGGGCAGGCCCACGTGCCCCGGCGGAAGCGCCGCAACCGC TTCGTGAAAAAGAACGGCCAATGCAACGTCTACTTCGCCAACCTGAGCAACAAGTCGCAG CGCTACATGGCGGACATCCTCACCACCTGCGTGGACACGCGCTGGCGCTACATGCTCATG ATCTTCTCCGCGGCCTTCCTCGTCTCCTGGCTCTTTTTCGGCCTCCTCTTCTGGTGCATC GCCTTCTTCCACGGTGACCTGGAGGCCGGCCCGGCGGGGACCGCGGCAGGGACCGCGGCG GGAGGCGGCGGGGCGGCACCGGTGGCTCCCAAGCCCTGCATTATGCACGTGAATGGCTTC CCGGGCGCCTTCCTCTTCTCGGTGGAGACGCAGACGACCATCGGCTACGGGTTCCGGTGC GTGACGGAGGAGTGCCCGCTGGCGGTCATCGCCGTGGTGGTCCAGTCTATCGTGGGCTGT GTCATCGACTCCTTCATGATTGGCACCATCATGGCCAAGATGGCCCGGCCCAAGAAGCGG GCGCAGACGTTGCTGTTCAGCCACCACGCCGTCATCTCGGTGCGCGACGGCAAGCTCTGC CTCATGTGGCGCGTGGGCAACCTACGCAAGAGCCACATTGTGGAGGCCCATGTGCGGGCC CAGCTCATCAAGCCCTACATGACCCAGGAGGGCGAGTACCTGCCGCTGGATCAGCGGGAC CTCAACGTGGGCTCTGACATCGGCCTGGACCGCATCTTCCTGGTCTCGCCCATCATCATT GTCCACGAGATCGATGAGGACAGCCCGCTCTACGGCATGGGCAAGGAGGAGCTGGAGTCG GAGGACTTCGAGGTCGTGGTCATCCTGGAGGGTATGGTGGAGGCCACGGCCATGACCACC CAGGCCCGCAGCTCCTACCTGGCCAGCGAGATCCTGTGGGGCCACCGCTTCGAGCCTGTG GTCTTCGAGGAGGAGAGCCACTACAAGGTGGACTACTCGCGCTTCCACAAGACCTACGAG GTGGCCGGCACGCCCTGCTGCTCTGCCCGGGAGCTGCAGGAGAGCAAGATCACCGTGCTG CCCGCCCCGCCGCCCCCGCCCAGTGCCTTCTGCTACGAGAACGAGCTGGCCCTCATGAGC CAGGAGGAAGAGGAGATGGAGGAGGAGGCTGCGGCCGCTGCCGCTGTGGCTGCGGGCCTG GGCCTGGAGGCGGGCTCCAAGGAGGAGGCGGGCATCATCCGGATGCTGGAGTTTGGCAGC CACCTGGATCTGGAGCGCATGCAAGCCACCCTCCCGCTGGACAACATCTCCTACCGCAGG GAGTCTGCCATCT 1 51 101 151 201 251 301 351 401 MHGHSRNGQA VDTRWRYMLM GGGGAAPVAP AVVVQSIVGC LMWRVGNLRK RIFLVSPIII QARSSYLASE ELQESKITVL GLEAGSKEEA HVPRRKRRNR IFSAAFLVSW KPCIMHVNGF VIDSFMIGTI SHIVEAHVRA VHEIDEDSPL ILWGHRFEPV PAPPPPPSAF GIIRMLEFGS FVKKNGQCNV LFFGLLFWCI PGAFLFSVET MAKMARPKKR QLIKPYMTQE YGMGKEELES VFEEESHYKV CYENELALMS HLDLERMQAT YFANLSNKSQ AFFHGDLEAG QTTIGYGFRC AQTLLFSHHA GEYLPLDQRD EDFEVVVILE DYSRFHKTYE QEEEEMEEEA LPLDNISYRR RYMADILTTC PAGTAAGTAA VTEECPLAVI VISVRDGKLC LNVGSDIGLD GMVEATAMTT VAGTPCCSAR AAAAAVAAGL ESAI Figure 5 210 kDa 125 kDa 125 kDa 101 kDa 101 kDa Kir2.1 Kir2.3 56 kDa Abbreviations: GP = guinea pig LV = left ventricle RV = right ventricle LA = left atrium RA = right atrium 56 kDa Sheep LV Sheep LA Sheep RA GP LV GP RV Kir2.1 Kir2.3 210 kDa GP atria Kir2.3 GP atria Sheep RA GP LV GP RV Sheep LV Sheep RV Sheep LA Kir2.1 Kir2.3 Kir2.1 0.5 -120 -100 -80 -60 -40 -20 20 -0.5 -1.0 -1.5 -120 -100 -80 -60 -40 8 8 4 4 -20 20 -120 -100 -80 -60 -40 -20 20 -4 -4 -8 -8 -12 -12 -16 -16 Table 1. Atrial Cells Length (mM) Width (mM) Surface area (mM2) Ventricular Cells 122.2 ± 2.0 (n = 150) 155.8 ± 2.9 (n = 58) 11.1 ± 0.2 (n = 150) 14.4 ± 0.3 (n = 58) 4499.9 ± 116.7 (n = 150) 7361.4 ± 195.3 (n = 58) Input Resistance (GW) 0.20 ± 0.01 (n = 20) 0.04 ± 0.003 (n = 12) Cell Capacitance (pF) 78.7 ± 3.9 (n = 20) 90.0 ± 5.9 (n = 10) -73.4 ± 1.0 (n = 32) -81.3 ± 1.3 (n = 10) RMP (mV) Properties of freshly isolated sheep atrial and ventricular cells. Myocytes were isolated from the free walls of the atria and from the left ventricle. Surface area was calculated by assuming the shape of a right cylinder for the isolated myocytes. Surface area was calculated from 2πr(L+r). L; length, r; cell radius (half of cell width). Data are Mean and ± SEM.