Download Unique Kir2.x Properties Determine Regional and Species

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Jatene procedure wikipedia , lookup

Heart arrhythmia wikipedia , lookup

Atrial fibrillation wikipedia , lookup

Ventricular fibrillation wikipedia , lookup

Arrhythmogenic right ventricular dysplasia wikipedia , lookup

Transcript
Unique Kir2.x Properties Determine Regional and Species
Differences in the Cardiac Inward Rectifier Kⴙ Current
Amit S. Dhamoon, Sandeep V. Pandit, Farzad Sarmast, Keely R. Parisian, Prabal Guha, You Li,
Suveer Bagwe, Steven M. Taffet, Justus M.B. Anumonwo
Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017
Abstract—The inwardly rectifying potassium (Kir) 2.x channels mediate the cardiac inward rectifier potassium current
(IK1). In addition to differences in current density, atrial and ventricular IK1 have differences in outward current profiles
and in extracellular potassium ([K⫹]o) dependence. The whole-cell patch-clamp technique was used to study these
properties in heterologously expressed Kir2.x channels and atrial and ventricular IK1 in guinea pig and sheep hearts.
Kir2.x channels showed distinct rectification profiles: Kir2.1 and Kir2.2 rectified completely at potentials more
depolarized than ⫺30 mV (I⬇0 pA). In contrast, rectification was incomplete for Kir2.3 channels. In guinea pig atria,
which expressed mainly Kir2.1, IK1 rectified completely. In sheep atria, which predominantly expressed Kir2.3 channels,
IK1 did not rectify completely. Single-channel analysis of sheep Kir2.3 channels showed a mean unitary conductance of
13.1⫾0.1 pS in 15 cells, which corresponded with IK1 in sheep atria (9.9⫾0.1 pS in 32 cells). Outward Kir2.1 currents
were increased in 10 mmol/L [K⫹]o, whereas Kir2.3 currents did not increase. Correspondingly, guinea pig (but not
sheep) atrial IK1 showed an increase in outward currents in 10 mmol/L [K⫹]o. Although the ventricles of both species
expressed Kir2.1 and Kir2.3, outward IK1 currents rectified completely and increased in high [K⫹]o-displaying
Kir2.1-like properties. Likewise, outward current properties of heterologously expressed Kir2.1-Kir2.3 complexes in
normal and 10 mmol/L [K⫹]o were similar to Kir2.1 but not Kir2.3. Thus, unique properties of individual Kir2.x
isoforms, as well as heteromeric Kir2.x complexes, determine regional and species differences of IK1 in the heart. (Circ
Res. 2004;94:1332-1339.)
Key Words: Kir2 䡲 extracellular potassium 䡲 heteromerization 䡲 rectification
the effect of high [K⫹]o on outward currents of Kir2.x isoforms
has also not been compared. It is possible that the properties of
Kir2.x isoforms, existing either as homomers or heteromers,
determine regional IK1 differences in the heart. Although recent
studies have shown that Kir2.x subunits heteromerize,12–14 the
rectification and [K⫹]o dependence of heteromeric Kir2.x channels have not yet been studied.
In this study, we show that individual Kir2.x isoforms have
unique outward current profiles as well as differential responses
to elevated [K⫹]o. We also demonstrate differences in Kir2.x
expression patterns in the atria and ventricles of the sheep and
guinea pig. Our results show that the rectification profile and
[K⫹]o sensitivity of IK1 in these species are determined by the
expression patterns of the underlying Kir2.x isoforms in the atria
and the ventricle. We also demonstrate that the rectification and
[K⫹]o sensitivity of the Kir2.1 isoform determine IK1 properties
when heteromeric complexes are formed. Part of this work has
been presented in abstract form.8,15
I
n the heart, the inwardly rectifying potassium (Kir) current
(IK1) stabilizes the resting membrane potential and plays a
major role during the final phase of action potential (AP)
repolarization.1–3 The Kir2.x channels mediate cardiac IK1.3
Previous studies have demonstrated that IK1 properties are
different in atrial and ventricular myocytes.1,3– 6 First, IK1
current density is higher in the ventricles than in the atria.6,7
Second, ventricular IK1 has been described as having a more
prominent negative slope conductance at depolarized potentials than atrial IK1 (ie, atrial IK1 does not rectify completely).1,4,5 Also, the outward component of the background
potassium current (IB; consisting mainly of IK1) is significantly
increased in high extracellular potassium ([K⫹]o) in ventricular but not atrial myocytes.1 The molecular mechanisms
underlying these IK1 differences are unknown.
The Kir2.x channel expression patterns may determine outward IK1 properties.8,9 Outward currents through Kir channels
may play an important role in the dynamics of atrial and
ventricular fibrillation, as studied in the sheep10 and guinea pig,11
respectively. However, outward current profiles of the individual
Kir2.x isoforms have not been comparatively studied. Moreover,
Materials and Methods
Detailed descriptions of the approaches used in the experiments are
presented in the expanded Materials and Methods section in the
Original received May 17, 2002; first resubmission received March 31, 2003; second resubmission received January 15, 2004; revised resubmission
received April 1, 2004; accepted April 7, 2004.
From the Department of Pharmacology and Institute for Cardiovascular Research, State University of New York Upstate Medical University, Syracuse.
Correspondence to Justus M.B. Anumonwo, PhD, Department of Pharmacology, State University of New York Upstate Medical University, 766 Irving
Ave, Syracuse, NY 13210. E-mail [email protected]
© 2004 American Heart Association, Inc.
Circulation Research is available at http://www.circresaha.org
DOI: 10.1161/01.RES.0000128408.66946.67
1332
Dhamoon et al
Kir2.x Isoforms Determine IK1 Properties
1333
Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017
Figure 1. I-V relations of Kir2.x channels expressed in HEK293 cells. A, Comparison of ramp (⫺100 to 0 mV)-generated, bariumsensitive currents in cells expressing Kir2.x channels. Current in an untransfected cell is superimposed. B, Average data for cells
expressing Kir2.1 (n⫽6), Kir2.2 (n⫽6), and Kir2.3 (n⫽4) channels. Data were normalized (norm) to current at ⫺100 mV. C, Average relative (rel) current (ratio of actual current measured and the current predicted assuming a linear unblocked current) as a function of voltage. Data were fit with a single (Kir2.1 and Kir2.2) or a double (Kir2.3) Boltzmann function.
online data supplement available at http://circres.ahajournals.org.
Guinea pig Kir2.1, Kir2.2, and Kir2.3, and sheep Kir2.3 were cloned
using the polymerase chain reaction and transiently transfected into
human embryonic kidney 293 (HEK293) cells using the Qiagen
Effectene protocol. Guinea pig and sheep cardiac myocytes were
enzymatically dissociated using the Langendorff-retrograde perfusion method as described previously.11 Inwardly rectifying currents
were recorded using the whole-cell and cell-attached patch-clamp
techniques. Kir2.x mRNA was measured using the ribonuclease
(RNase) protection assay,16 and Kir2.x protein was measured using
the Western blot technique. A mathematical model of the human
atrial myocyte AP17 was implemented in C language on a SUN
Ultra-10 workstation platform.
Results
Properties of Outward Currents Through
Heterologously Expressed Kir2.x Channels
Figure 1A shows representative current-voltage (I-V) relationships of Kir2.1, Kir2.2, and Kir2.3 currents measured in
HEK293 cells, as well as I-V relations in an untransfected
cell. A voltage-clamp ramp protocol from ⫺100 to 0 mV was
used and barium-sensitive currents are shown. The data show
marked differences in the rectification profiles of the expressed Kir2.x channels. The trace recorded from an untransfected HEK293 cell was almost indistinguishable from the x
axis, showing that endogenous and leak currents contribute
virtually no component to the barium-sensitive current. Figure 1B illustrates the rectification profiles of Kir2.x channels
normalized to current at ⫺100 mV. Outward current peaked
at similar voltages for Kir2.1 (⫺68.2⫾1.9 mV; n⫽6) and
Kir2.2 (⫺74.2⫾1.7 mV; n⫽6). However, outward current in
Kir2.3 channels peaked at a more positive potential
(⫺54.7⫾3.1 mV; n⫽4; P⬍0.05) than the other 2 isoforms.
There were no significant differences in the reversal potential
(Erev) of the different isoforms (Kir2.1 ⫺86⫾1.1 mV; Kir2.2
⫺86⫾1.2 mV; Kir2.3 ⫺85⫾1.2 mV; ANOVA). To quantify
the degree of rectification of the Kir2.x channels, we ana-
lyzed relative current (ratio of actual current measured and
the current predicted assuming a linear unblocked current)18
by fitting with the Boltzmann equation. As shown in Figure
1C, a single Boltzmann function was sufficient to fit Kir2.1
and Kir2.2 currents. Kir2.2 currents showed stronger voltage
dependence of rectification (z⫽3.66⫾0.43; n⫽6) than Kir2.1
currents (z⫽2.5⫾0.07; n⫽6; P⬍0.05). In contrast, Kir2.3
currents could only be fit by a double Boltzmann function
(z1⫽1.31⫾0.05; z2⫽10.9⫾1.1; n⫽4).
Properties of Outward Cardiac IK1
Based on the differences in the rectification profiles of the
Kir2.x channels shown above, we examined outward atrial
and ventricular IK1 properties in the guinea pig and sheep. We
also correlated our data with Kir2.x mRNA and protein
expression in the 2 species.
Guinea Pig Atrial and Ventricular IK1
A comparative analysis of inward rectification properties in
guinea pig atrial and ventricular myocytes has been described
previously, but in the study,1 IK1 was not isolated from the IB.
In Figure 2A, average barium-sensitive I-V relations of
guinea pig atrial (n⫽6) and ventricular IK1 (n⫽4) are shown.
Peak inward current density (Ip), measured at ⫺100 mV was
⫺4.76⫾0.53 pA/pF for atrial cells and was significantly
greater (⫺9.18⫾1.3 pA/pF; P⬍0.05) in ventricular cells. The
outward currents peaked at similar voltages (⫺67⫾2.4 mV
versus ⫺61⫾2.6 mV), and the Erev was not significantly
different (⫺82.9⫾1.8 mV versus ⫺81.9⫾1.3 mV) for atrial
and ventricular cells, respectively. Note that IK1 rectified
completely for both atrial and ventricular myocytes.
We developed an RNase Protection Assay (RPA) to
examine Kir2.x expression patterns in the guinea pig heart.
Kir2.4 was not studied because there is evidence that these
channels are only expressed in neuronal cells of the heart and
1334
Circulation Research
May 28, 2004
Figure 2. Properties of IK1 in guinea pig
atrial and ventricular cells. A, Current
density-voltage (I-V) relationships of guinea
pig atrial (n⫽6) and ventricular (n⫽4) IK1. I-V
relationships in this as well as in subsequent
figures were analyzed as barium-sensitive,
ramp (⫺100 to 0 mV)-generated currents. B,
Concentrations of Kir2.1 and Kir2.3 mRNA,
normalized to cyclophilin, in the atria and the
ventricle of the guinea pig. ND, not detected.
*P⬍0.05. C, Western blot analysis in the
guinea pig heart.
Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017
not in cardiac myocytes.19 Figure 2B shows the relative
concentrations of Kir2.1, Kir2.2, and Kir2.3 mRNA in the
atria and the ventricle of the guinea pig, normalized per unit
of cyclophilin. The ventricle expressed significant mRNA
levels of both Kir2.1 and Kir2.3, whereas only Kir2.1 was
present in the atria. Kir2.1 mRNA expression was 5-fold
greater in the ventricle compared with the atria. Also, Kir2.2
mRNA was undetectable in both the atria and the ventricle
but was detected in the brain. Figure 2C is the Western blot
analysis of Kir2.1 (top) and Kir2.3 (bottom) in the guinea pig
heart for atrial (left lane) and ventricular (right lane) tissue
samples. The data are representative of analysis performed in
3 membrane preparations of guinea pig hearts. The blots
show that Kir2.1 and Kir2.3 proteins are expressed in the
guinea pig ventricles and that the atria express Kir2.1 but not
Kir2.3.
Sheep Atrial and Ventricular IK1
Given that there are important species-dependent differences
in ion channel expression,20 we studied cardiac IK1 properties
in the sheep, a commonly used animal model to study cardiac
fibrillation in this and other laboratories. Properties of freshly
isolated sheep cardiac myocytes are shown in the online data
supplement. Figure 3A illustrates the I-V relationships for
atrial (n⫽7) and ventricular (n⫽4) IK1. Ip was ⫺1.7⫾0.24
pA/pF in atrial cells and was significantly greater
(⫺5.27⫾2.07 pA/pF; P⬍0.05) in ventricular cells. Note that
at depolarized potentials, ventricular IK1 rectified completely,
whereas atrial IK1 did not. Furthermore, peak outward IK1 in
the atria was measured at ⫺41⫾3.5 mV compared with
⫺68⫾0.32 mV in the ventricle. Values for Erev in atrial
(⫺82.3⫾1.5 mV) and ventricular (⫺87.3⫾1.4 mV) cells
were not significantly different. Figure 3B illustrates atrial
and ventricular IK1 after normalization to Ip. The I-V relationships of sheep atrial and ventricular IK1 are very similar to
heterologously expressed Kir2.3 and Kir2.1 channels, respectively (Figure 1B).
These data were correlated with Kir2.x mRNA and protein
analysis. Figure 3C shows relative Kir2.x mRNA levels in the
sheep atria and ventricles. The sheep ventricle expressed
significant amounts of Kir2.1 and Kir2.3 mRNA. Furthermore, similar levels of Kir2.3 mRNA were expressed in the
sheep atria and ventricle, whereas atrial Kir2.1 mRNA
expression was only 10% of that measured in the ventricle.
Kir2.2 mRNA was not detected in the sheep heart but was
detected in the brain. Figure 3D is the Western blot analysis
Figure 3. Properties of IK1 in sheep atrial
and ventricular cells. A, I-V relationships
of atrial (n⫽7) and ventricular (n⫽4) IK1 B,
Atrial and ventricular IK1 normalized
(norm) to peak inward current at ⫺100
mV. C, Concentrations of Kir2.1, Kir2.2,
and Kir2.3 mRNA in the atria and the
ventricle. mRNA amounts have been normalized to cyclophilin concentrations in
each lane. ND, not detected. D, Western
blot analysis.
Dhamoon et al
Kir2.x Isoforms Determine IK1 Properties
1335
Figure 4. Single-channel analysis of sheep
Kir2.3 channels and sheep atrial and ventricular IK1, in cell-attached patches. The [K⫹] in
the pipette and the bath solutions was
140 mmol/L, and the transmembrane potential was ⫺120 mV for all of the recordings. In
all panels, calibration bars are 1 pA and 500
ms. A, Top, Trace of a representative recording of Kir2.3 channel, and the corresponding
all-points histogram. Bottom, Events histogram of averaged unitary conductance data
of Kir2.3 channels. B, Top, Trace of unitary
IK1 recording from an atrial myocyte and the
corresponding all-points histogram. Bottom,
Events histogram of averaged unitary conductance data of atrial IK1. C, Top, Representative trace of unitary IK1 events in a ventricular myocyte and the corresponding
amplitude histogram. Bottom, Events histogram of averaged unitary conductance data
of ventricular IK1.
Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017
of Kir2.1 (top) and Kir2.3 (bottom) in the sheep heart
performed using atrial (left lane) or ventricular (right lane)
tissue samples. The data are representative of analysis performed in 3 hearts. Our results show that whereas the Kir2.1
and Kir2.3 proteins are expressed in the sheep ventricles,
Kir2.3 is the predominant Kir2.x isoform expressed in the
sheep atria.
Single-Channel Analyses
Unlike studies in the guinea pig,19 unitary conductance
properties of Kir2.x channels have not been correlated to IK1
channels expressed in the sheep myocardium. The trace in
Figure 4A (top) is a cell-attached recording in a cell transfected with sheep Kir2.3 and the corresponding all-points
histogram (top), which shows a single transition level from
baseline. The bottom in Figure 4A is an events histogram
showing a mean unitary conductance of 13.1⫾0.1 pS from a
total of 232 transitions obtained from 15 patches. Figure 4B
(top) is a cell-attached recording from an isolated sheep atrial
cell and the corresponding all-points histogram. Note the
presence of a distinct peak in the events histogram (Figure
4B, bottom). The mean unitary conductance was 9.9⫾0.1 pS,
obtained from a total of 336 events in 32 patches in cells
isolated from 5 sheep hearts. The data in Figure 4C were
obtained from cell-attached recordings in sheep left ventricular myocytes. The all-points histogram (top) was obtained
from the first 2.5 seconds of the trace shown. In contrast to
the data in Figure 4A and 4B, the trace and the histogram in
Figure 4C show multilevel transitions (n⫽270) that represent
multiple conductance levels in 23 cell-attached patches from
ventricular cells isolated from 5 sheep hearts.
Outward Current Profiles and [Kⴙ]o
The regulation of potassium channels by [K⫹]o has important
physiological implications.3 Therefore, we were interested in
determining how the outward current profiles of Kir2.x
channels in high [K⫹]o correlate with changes in IK1 under
similar conditions.
Kir2.x Channels
We characterized the whole-cell [K⫹]o dependence of outward Kir2.1 and Kir2.3 currents. Figure 5A shows I-V
relationships of Kir2.1 channels (n⫽5) recorded in normal
[K⫹]o (5.4 mmol/L [K⫹]o) and elevated [K⫹]o (10 mmol/L
[K⫹]o). Currents were normalized to peak inward current
recorded in normal [K⫹]o. Increasing [K⫹]o from 5.4 to
10 mmol/L resulted in a Nernstian shift in the Erev from
⫺82.9⫾1.6 mV to ⫺69.4⫾1.1 mV (P⬍0.05), a 3.2-fold
increase in Ip and a 2-fold increase in the peak outward
current through Kir2.1 channels. To compare the magnitude
of outward current changes, we used the integration voltage,
or the area under the curve (AUC) to describe outward
currents from Erev to 0 mV. Elevation of [K⫹]o resulted in an
increase in AUC from 6.15 to 13.9 U of normalized
Figure 5. [K⫹]o dependence of Kir2.1 and
Kir2.3 channels expressed in HEK293
cells. A, I-V relationships of Kir2.1 channels (n⫽5) recorded in 5.4 mmol/L [K⫹]o
and in 10 mmol/L [K⫹]o. Data were normalized (norm) to peak inward current
recorded in 5.4 mmol/L [K⫹]o. B, I-V relationships of sheep Kir2.3 channels (n⫽4)
recorded in 5.4 mmol/L [K⫹]o and in
10 mmol/L [K⫹]o. Data were normalized
to peak inward current recorded in
5.4 mmol/L [K⫹]o.
1336
Circulation Research
May 28, 2004
Figure 6. [K⫹]o dependence of atrial and
ventricular IK1 in the sheep and the
guinea pig. A, I-V relationships of sheep
ventricular IK1 recorded in 5.4 mmol/L
[K⫹]o (n⫽4) and in 10 mmol/L [K⫹]o (n⫽3).
B, I-V relationships of sheep atrial IK1
recorded in 5.4 mmol/L [K⫹]o (n⫽7) and
in 10 mmol/L [K⫹]o (n⫽4). C, I-V relationships of guinea pig (GP) ventricular IK1
recorded in 5.4 mmol/L [K⫹]o (n⫽4) and
in 10 mmol/L [K⫹]o (n⫽4). D, I-V relationships of GP atrial IK1 recorded in
5.4 mmol/L [K⫹]o (n⫽6) and in 10 mmol/L
[K⫹]o (n⫽5).
Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017
current䡠mV. Figure 5B shows I-V relationships of Kir2.3
channels recorded in normal and high [K⫹]o (n⫽4). Similar to
Kir2.1 channels, high [K⫹]o resulted in a right shift of Erev
from ⫺79⫾2.8 mV to ⫺61.7⫾5.4 mV (P⬍0.05) as well as a
2.8-fold increase in inward currents. Importantly, however,
there was no increase in the magnitude of outward currents
for Kir2.3 channels in elevated [K⫹]o.
Sheep Cardiac Myocytes
Figure 6A shows the I-V relationships of sheep ventricular IK1
in normal [K⫹]o (data from figure 4A) and from another group
of cells in 10 mmol/L [K⫹]o. Elevated [K⫹]o resulted in a right
shift of Erev from ⫺87.3⫾1.45 mV (n⫽4) to ⫺69.3⫾1.31 mV
(n⫽3; P⬍0.05). Additionally, there was an increase in Ip from
⫺5.27⫾2.07 pA/pF to ⫺35.7⫾1.47 pA/pF (P⬍0.05), as well
as an increase in AUC from 67.8⫾11.9 pA䡠mV/pF to
160.6⫾26.4 pA䡠mV/pF (P⬍0.05), similar to the heterologously expressed Kir2.1 isoform. Figure 6B shows the
corresponding analysis in sheep atrial IK1. Elevated [K⫹]o
resulted in a right shift of Erev from ⫺82.8⫾1.47 mV (n⫽7)
to ⫺68.1⫾1.04 mV (n⫽4) and an increase in Ip from
⫺1.7⫾0.24 pA/pF to ⫺4.9⫾0.8 pA/pF. Importantly, similar
to heterologously expressed Kir2.3 channels in high [K⫹]o,
there was no increase in peak outward current for sheep atrial
IK1.
Guinea Pig Cardiac Myocytes
Figure 6C illustrates the I-V relationships of ventricular IK1 in
normal [K⫹]o (data from Figure 2A) and in elevated
(10 mmol/L) [K⫹]o conditions. Elevation of [K⫹]o resulted in
a right shift of Erev from ⫺81.9⫾1.28 mV (n⫽4) to
⫺68.7⫾0.26 mV (n⫽4; P⬍0.05), an increase in Ip from
⫺9.18⫾1.26 pA/pF to ⫺18.2⫾1.37 pA/pF (P⬍0.05), and an
increase in AUC from 108.4⫾19.7 pA䡠mV/pF to 233.7⫾21.6
pA䡠mV/pF (P⬍0.05). Figure 6D is the I-V relationship of
atrial IK1 in normal [K⫹]o (data from Figure 2A) and in high
[K⫹]o. Ip in atrial cells increased from ⫺4.76⫾0.53 pA/pF
(n⫽6) to ⫺18.9⫾2.2 pA/pF (n⫽5; P⬍0.05), and Erev shifted
from ⫺82.9⫾1.79 mV to ⫺69.4⫾1.57 mV (P⬍0.05) as
[K⫹]o was elevated. The AUC was significantly greater for
guinea pig atrial IK1 (34.7⫾10.7 pA䡠mV/pF versus 93.8⫾21.5
pA䡠mV/pF; P⬍0.05) as [K⫹]o was increased.
Rectification and [Kⴙ]o Sensitivity of Heteromeric
Kir2.x Channels
Heteromeric Kir2.x channels were studied by examining the
properties of coexpressed Kir2.1 and Kir2.3 and concatenated
Kir2.1-Kir2.3 subunits.12 Figure 7A shows the rectification
profile and [K⫹]o dependence of coexpressed Kir2.1-Kir2.3
channels. Barium-sensitive I-V relationships (data not illustrated) showed virtually complete rectification from ⫺30 to 0
mV. Relative currents from coexpressed Kir2.1-Kir2.3 subunits were fit with the Boltzmann equation and z⫽2.34⫾0.12
(n⫽3), similar to Kir2.1 (2.5⫾0.07; n⫽6). Figure 7A also
compares I-V relationships of coexpressed Kir2.1 and Kir2.3
subunits (n⫽3) in 5.4 mmol/L [K⫹]o and 10 mmol/L [K⫹]o.
Increasing [K⫹]o resulted in a shift in Erev from ⫺83.6⫾0.9
mV to ⫺70.6⫾1.1 mV, a 3-fold increase in Ip and a 42%
increase in peak outward current. An elevation of [K⫹]o
resulted in an increase in AUC from 11.2 to 14.1 U of
normalized current䡠mV.
Figure 7B shows current density-voltage relationships of
barium-sensitive currents through Kir2.1-Kir2.3 concatemers
in 5.4 mmol/L [K⫹]o (n⫽4) and another group of cells in
10 mmol/L [K⫹]o (n⫽3). The covalently linked Kir2.1-Kir2.3
constructs displayed a prominent negative slope conductance
Dhamoon et al
Kir2.x Isoforms Determine IK1 Properties
1337
Figure 7. [K⫹]o dependence of Kir2.1Kir2.3 heteromeric channels expressed in
HEK293 cells. A, I-V relationships of
coexpressed Kir2.1 and Kir2.3 subunits
in the pIRES vector (n⫽3) recorded in
5.4 mmol/L [K⫹]o and in 10 mmol/L [K⫹]o.
Data were normalized to peak inward
current recorded in 5.4 mmol/L [K⫹]o. B,
Barium-sensitive current density-voltage
relationships of Kir2.1-Kir2.3 concatemers recorded in 5.4 mmol/L [K⫹]o (n⫽4)
and in 10 mmol/L [K⫹]o (n⫽3).
Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017
and passed virtually no outward current at depolarized potentials. Relative currents from Kir2.1-Kir2.3 concatamers were
fit with the Boltzmann equation and z⫽3.34⫾0.37. Elevating
[K⫹]o resulted in a shift in Erev from ⫺85.2⫾1.3 mV to
⫺74.2⫾0.3 mV, a 4-fold increase in Ip and a 2.6-fold increase
in peak outward current. Elevating [K⫹]o resulted in an
increase in the AUC from 76.7⫾12.2 pA䡠mV/pF to 207⫾37
pA䡠mV/pF (P⬍0.05). These data suggest that the [K⫹]o
dependence of outward currents through heteromeric Kir2.1Kir2.3 channels is determined by Kir2.1 and not Kir2.3
subunits.
Discussion
A major finding of this study is that outward currents in
individual Kir2.x channel isoforms display distinct whole-cell
rectification profiles and are modulated differently by elevated [K⫹]o. Our results demonstrate significant differences in
regional Kir2.x expression patterns in the sheep and guinea
pig. Species- and tissue-dependent differences in these IK1
properties are determined primarily by the specific Kir2.x
isoforms expressed in the tissue. These data provide novel
insight into the properties of IK1 channels, which shape the
cardiac AP and play a role in various pathophysiological
states.3,11,21
Outward Currents of Kir2.x Channels
Although the biophysical properties of Kir2.x channels19,22–24
have been extensively examined, differences in outward
currents within this subfamily have not been studied comparatively. Our data show that Kir2.1 and Kir2.2 channels
displayed a prominent negative slope conductance and rectified completely at ⬇40 mV positive to the Erev. In contrast,
Kir2.3 channels did not rectify completely at these depolarized potentials. The relatively weaker rectification of the
Kir2.3 isoform has been observed previously but not discussed.14,24 Interestingly, heteromeric Kir2.1-Kir2.3 channels
rectified completely at depolarized potentials, suggesting that
Kir2.1 rectification properties are dominant in a Kir2.1Kir2.3 heteromeric complex. Recent evidence suggests that
Kir2.x channels have differences in spermine sensitivity as
well as in unblocking kinetics,25 which may contribute to
their different rectification profiles.
IK1 Properties in Atrial Cells
Similar to previous studies, our data show that atrial IK1 has
lower current density than ventricular IK1.1,4 – 6 Consistent with
this, our RPA results in the guinea pig and sheep show lower
overall expression of Kir2.x mRNA in the atria compared
with the ventricle.
Our data demonstrate striking differences in the atrial IK1
rectification profiles in these species. Our results show that
Kir2.3 is the predominant Kir2.x isoform expressed in the
sheep atria. Correspondingly, the rectification profile, [K⫹]o
dependence, and single-channel conductance of sheep atrial
IK1 are reminiscent of Kir2.3 channel properties. The smaller
value of the single-channel conductance in native cells
(9.9⫾0.1 pS) compared with Kir2.3 (13.1⫾0.1 pS) may be
attributable to interactions with scaffolding proteins as described previously.19,26 In guinea pig atrial cells, our expression studies as well as rectification and [K⫹]o properties
suggest that Kir2.1 plays a major role in determining atrial IK1.
In a previous investigation,1 IK1 was not isolated from the
background conductance, and complete rectification of
guinea pig atrial IK1 was not evident.
We explored the functional significance of the different
rectification profiles in atrial IK1 by using a previously
published mathematical model of the human atrial AP.17 The
parameters in the equation for IK1 were modified to obtain fits
to the normalized I-V plots for Kir2.1 and Kir2.3, as shown in
Figure 8A. Figure 8B depicts APs and the underlying IK1
currents obtained by fits to Kir2.1 and Kir2.3 data. The AP
based on Kir2.3-like IK1 characteristics displays a shorter AP
duration compared with the corresponding Kir2.1 AP. Our
results show that IK1 with Kir2.1-like properties is important
only during the terminal phase of repolarization. In contrast,
IK1 with Kir2.3-like characteristics contributes to a repolarizing current during the plateau phase of the AP, in addition to
the terminal phase of repolarization. This suggests that
differences in the IK1 rectification profile may be important
for determining the relative role of IK1 in cardiac repolarization (see also Nichols et al27).
IK1 Properties in Ventricular Cells
In both sheep and guinea pig ventricles, IK1 has a prominent
negative slope conductance, which is consistent with relatively high levels of Kir2.1 subunits expressed in these
tissues. The ventricles also express significant levels of
1338
Circulation Research
May 28, 2004
Figure 8. Simulation of atrial AP (see
online text for model details). A, The
equation for IK1 was modified to obtain
fits to the normalized I-V relationships of
Kir2.1 and Kir2.3 shown in Figure 1B. B,
Top, Steady-state APs obtained by running the model for 13 seconds at 1 Hz.
Bottom, Underlying Kir2.x currents using
Kir2.1 and Kir2.3 I-V relationships.
Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017
Kir2.3 mRNA and protein. Although regulated by many
factors,24,28,29 the role of Kir2.3 subunits in this tissue is not
clear because the rectification and [K⫹]o properties of this
isoform are not apparent in the ventricles. Our data suggest
that the properties of Kir2.3 subunits are not evident in the
ventricles because in a heteromeric complex, Kir2.1 properties are dominant. Although in our study sheep and guinea pig
ventricular IK1 displayed similar rectification characteristics,
previous work has shown that there are species-specific
differences in the rectification properties of ventricular IK1 in
other species.30 Our single-channel data of the sheep ventricles show that there are wide distributions of conductances,
which may correspond to homomeric Kir2.1 and Kir2.3
channels as well as heteromeric channels. Clearly, further
work is required to understand the regulation of heteromeric
Kir2.x channels and their role in native IK1.
The results of our RPA do not show any measurable
expression of Kir2.2 mRNA in the guinea pig atria or
ventricles. In contrast, Liu et al suggested that Kir2.2 is the
major guinea pig ventricular isoform underlying IK1.19 This
conclusion was primarily based on correlation of singlechannel conductances and barium sensitivities of heterologously expressed Kir2.x channels with native guinea pig
myocytes. Similarities in barium sensitivities of Kir2.2 and
native IK1 can be interpreted in other ways. For instance,
Schram et al14 have shown that the barium sensitivity of
coexpressed Kir2.1 and Kir2.3 channels is very similar to
native IK1 and to homomeric Kir2.2 channels but is very
different from that of homomeric Kir2.1 and Kir2.3 channels.
Commercially available Kir2.2 antibodies designed against a
rat epitope are available through Alomone labs (Jerusalem,
Israel). These antibodies did not detect Kir2.2 protein in
sheep or guinea pig tissue or transfected cells, perhaps
because the corresponding guinea pig Kir2.2 epitope only has
12 of 19 residues identical to the rat epitope. The homology
of sheep Kir2.2 to the rat epitope is unknown because this
gene has not yet been cloned. Nevertheless, our mRNA
results clearly show that Kir2.2 is expressed in the brain but
not in the heart of sheep or guinea pigs using species-specific
antisense probes.
[Kⴙ]o Dependence of Outward Currents in Kir2.x
Channels and IK1
[K⫹]o is elevated during pathophysiological states such as in
ischemia, tachycardia, and fibrillation.31 K⫹ ions can accumulate in either intercellular clefts or t-tubules of cardiac
myocytes, which is particularly relevant because Kir2.x
subunits are expressed in t-tubules6,32 and the intercalated
disks6 of cardiac myocytes. Yet, differences in the effect of
high [K⫹]o on outward currents in Kir2.x isoforms have not
been described comparatively. We have shown that increasing [K⫹]o resulted in a Nernstian shift of Erev and an increase
in inward currents for Kir2.1 and Kir2.3 channels. However,
whereas Kir2.1 channels showed an increase in outward
currents in high [K⫹]o, Kir2.3 channels did not. Accordingly,
sheep atria, which predominantly express Kir2.3 channels,
did not exhibit an increase in the outward component of IK1 in
high [K⫹]o. In contrast, guinea pig atrial IK1, mediated mainly
by Kir2.1, showed an increase in outward current in high
[K⫹]o. Curiously, guinea pig atrial IK1 showed a more prominent secondary hump at depolarized potentials in high [K⫹]o.
Also, guinea pig and sheep ventricles, which express both
Kir2.1 and Kir2.3 subunits, showed an increase in outward
currents in high [K⫹]o, attributable to the dominant role of
Kir2.1 in a heteromeric complex.
Potential Limitations
Although our data show that differential expression of Kir2.x
isoforms play an important role in determining the rectification properties of native IK1, other factors, such as differences
in levels of polyamines in different tissues and species, may
also be important in modulating rectification properties. The
single-channel properties (ie, unitary conductance and open
probability) of heteromeric Kir2.x channels are unknown,
therefore, it is difficult to correlate unitary conductance
values of heterologously expressed homomeric Kir2.x isoforms with IK1 unitary events in the ventricle, which are
presumably determined by heteromeric Kir2.x complexes.
In conclusion, our studies show that heterologously expressed Kir2.x channels display important differences in their
whole-cell outward current profiles, as well as the [K⫹]o
dependence of their outward currents. The results also show
Dhamoon et al
that Kir2.1 rectification properties and [K⫹]o sensitivity are
dominant in a heteromeric Kir2.x complex. Tissue and
species-specific expression of these isoforms determine the
biophysical and regulatory properties of IK1 in the heart.
Acknowledgments
This work was supported by grants PO1 HL39707 and HL60843
from the National Heart, Lung, and Blood Institute and a predoctoral
fellowship from the American Heart Association (to A.D.). We
would like to thank Drs José Jalife and Mario Delmar for critically
reading this manuscript, Jiang Jiang for his expert technical assistance, and Dr Eduardo Solessio for his insight. Also, we would like
to thank Regina Preisig-Muller for the Kir2.1-Kir2.3 concatemers.
References
Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017
1. Hume JR, Uehara A. Ionic basis of the different action potential configurations of single guinea-pig atrial and ventricular myocytes.
J Physiol. 1985;368:525–544.
2. Shimoni Y, Clark RB, Giles WR. Role of an inwardly rectifying
potassium current in rabbit ventricular action potential. J Physiol. 1992;
448:709 –727.
3. Lopatin AN, Nichols CG. Inward rectifiers in the heart: an update on
i(k1). J Mol Cell Cardiol. 2001;33:625– 638.
4. Giles WR, Imaizumi Y. Comparison of potassium currents in rabbit atrial
and ventricular cells. J Physiol. 1988;405:123–145.
5. Koumi S, Backer CL, Arentzen CE. Characterization of inwardly rectifying K⫹ channel in human cardiac myocytes. Alterations in channel
behavior in myocytes isolated from patients with idiopathic dilated cardiomyopathy. Circulation. 1995;92:164 –174.
6. Melnyk P, Zhang L, Shrier A, Nattel S. Differential distribution of Kir2.1
and Kir2.3 subunits in canine atrium and ventricle. Am J Physiol Heart
Circ Physiol. 2002;283:H1123–H1133.
7. Wang Z, Yue L, White M, Pelletier G, Nattel S. Differential distribution
of inward rectifier potassium channel transcripts in human atrium versus
ventricle. Circulation. 1998;98:2422–2428.
8. Dhamoon AS, Bagwe S, Guha P, Anumonwo J, Taffet SM, Jalife J.
Differential expression and whole-cell current rectification profiles of
guinea pig Kir2.x channels. Biophys J. 2002;82(1):587a Abstract.
9. Warren M, Guha PK, Berenfeld O, Zaitsev A, Anumonwo JM, Dhamoon
AS, Bagwe S, Taffet SM, Jalife J. Blockade of the inward rectifying
potassium current terminates ventricular fibrillation in the guinea pig
heart. J Cardiovasc Electrophysiol. 2003;14:621– 631.
10. Sarmast F, Kolli A, Zaitsev A, Parisian K, Dhamoon AS, Guha PK,
Warren M, Anumonwo JM, Taffet SM, Berenfeld O, Jalife J. Cholinergic
atrial fibrillation: I(K,ACh) gradients determine unequal left/right atrial
frequencies and rotor dynamics. Cardiovasc Res. 2003;59:863– 873.
11. Samie FH, Berenfeld O, Anumonwo J, Mironov SF, Udassi S, Beaumont
J, Taffet S, Pertsov AM, Jalife J. Rectification of the background
potassium current: a determinant of rotor dynamics in ventricular fibrillation. Circ Res. 2001;89:1216 –1223.
12. Preisig-Muller R, Schlichthorl G, Goerge T, Heinen S, Bruggemann A,
Rajan S, Derst C, Veh RW, Daut J. Heteromerization of Kir2.x potassium
channels contributes to the phenotype of Andersen’s syndrome. Proc Natl
Acad Sci U S A. 2002;99:7774 –7779.
13. Zobel C, Cho HC, Nguyen TT, Pekhletski R, Diaz RJ, Wilson GJ, Backx
PH. Molecular dissection of the inward rectifier potassium current (IK1)
in rabbit cardiomyocytes: evidence for heteromeric co-assembly of Kir2.1
and Kir2.2. J Physiol. 2003;550:365–372.
14. Schram G, Pourrier M, Wang Z, White M, Nattel S. Barium block of Kir2
and human cardiac inward rectifier currents: evidence for subunit-
Kir2.x Isoforms Determine IK1 Properties
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
1339
heteromeric contribution to native currents. Cardiovasc Res. 2003;59:
328 –338.
Dhamoon AS, Pandit S, Anghel T, Sarmast F, Anumonwo J, Taffet SM,
Jalife J. Differential expression of individual Kir2.x isoforms determines
differences in action potential shape and [K⫹]o dependence of IK1 in atrial
and ventricular myocytes. Pacing Clin Electrophysiol. 2003;26(4):956
Abstract.
Vaidya D, Tamaddon HS, Lo CW, Taffet SM, Delmar M, Morley GE,
Jalife J. Null mutation of connexin43 causes slow propagation of ventricular activation in the late stages of mouse embryonic development.
Circ Res. 2001;88:1196 –1202.
Courtemanche M, Ramirez RJ, Nattel S. Ionic mechanisms underlying
human atrial action potential properties: insights from a mathematical
model. Am J Physiol. 1998;275:H301–H321.
Shyng SL, Sha Q, Ferrigni T, Lopatin AN, Nichols CG. Depletion of
intracellular polyamines relieves inward rectification of potassium
channels. Proc Natl Acad Sci U S A. 1996;93:12014 –12019.
Liu GX, Derst C, Schlichthorl G, Heinen S, Seebohm G, Bruggemann A,
Kummer W, Veh RW, Daut J, Preisig-Muller R. Comparison of cloned
Kir2 channels with native inward rectifier K⫹ channels from guinea-pig
cardiomyocytes. J Physiol. 2001;532:115–126.
Nerbonne JM. Molecular basis of functional voltage-gated K⫹ channel
diversity in the mammalian myocardium. J Physiol. 2000;525:285–298.
Plaster NM, Tawil R, Tristani-Firouzi M, Canun S, Bendahhou S,
Tsunoda A, Donaldson MR, Iannaccone ST, Brunt E, Barohn R, Clark J,
Deymeer F, George AL, Fish FA, Hahn A, Nitu A, Ozdemir C, Serdaroglu P, Subramony SH, Wolfe G, Fu Y, Ptacek LJ. Mutations in kir2.1
cause the developmental and episodic electrical phenotypes of
Andersen’s syndrome. Cell. 2001;105:511–519.
Kubo Y, Baldwin TJ, Jan YN, Jan LY. Primary structure and functional
expression of a mouse inward rectifier potassium channel. Nature. 1993;
362:127–133.
Lopatin AN, Makhina EN, Nichols CG. The mechanism of inward rectification of potassium channels: “long-pore plugging” by cytoplasmic
polyamines. J Gen Physiol. 1995;106:923–955.
Liu Y, Liu D, Heath L, Meyers DM, Krafte DS, Wagoner PK, Silvia CP,
Yu W, Curran ME. Direct activation of an inwardly rectifying potassium
channel by arachidonic acid. Mol Pharmacol. 2001;59:1061–1068.
Panama B, Mclerie M, Lopatin AN. Differential spermine sensitivity in
Kir2 inward rectifier potassium channels. Biophys J. 2004;86(1):125a
Abstract.
Nehring RB, Wischmeyer E, Doring F, Veh RW, Sheng M, Karschin A.
Neuronal inwardly rectifying K(⫹) channels differentially couple to PDZ
proteins of the PSD-95/SAP90 family. J Neurosci. 2000;20:156 –162.
Nichols CG, Makhina EN, Pearson WL, Sha Q, Lopatin AN. Inward
rectification and implications for cardiac excitability. Circ Res. 1996;
78:1–7.
Zhu G, Chanchevalap S, Cui N, Jiang C. Effects of intra- and extracellular
acidifications on single channel Kir2.3 currents. J Physiol (Lond). 1999;
516:699 –710.
Zhu G, Qu Z, Cui N, Jiang C. Suppression of Kir2.3 activity by protein
kinase C phosphorylation of the channel protein at threonine 53. J Biol
Chem. 1999;274:11643–11646.
Martin RL, Koumi S, Ten Eick RE. Comparison of the effects of internal
[Mg2⫹] on IK1 in cat and guinea pig cardiac ventricular myocytes. J Mol
Cell Cardiol. 1995;27:673– 691.
Sejersted OM, Sjogaard G. Dynamics and consequences of potassium
shifts in skeletal muscle and heart during exercise. Physiol Rev. 2000;80:
1411–1481.
Clark RB, Tremblay A, Melnyk P, Allen BG, Giles WR, Fiset C. T-tubule
localization of the inward-rectifier K(⫹) channel in mouse ventricular
myocytes: a role in K(⫹) accumulation. J Physiol. 2001;537:979 –992.
Downloaded from http://circres.ahajournals.org/ by guest on August 1, 2017
Unique Kir2.x Properties Determine Regional and Species Differences in the Cardiac
Inward Rectifier K + Current
Amit S. Dhamoon, Sandeep V. Pandit, Farzad Sarmast, Keely R. Parisian, Prabal Guha, You Li,
Suveer Bagwe, Steven M. Taffet and Justus M.B. Anumonwo
Circ Res. 2004;94:1332-1339; originally published online April 15, 2004;
doi: 10.1161/01.RES.0000128408.66946.67
Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2004 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circres.ahajournals.org/content/94/10/1332
Data Supplement (unedited) at:
http://circres.ahajournals.org/content/suppl/2004/05/16/94.10.1332.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the
Editorial Office. Once the online version of the published article for which permission is being requested is
located, click Request Permissions in the middle column of the Web page under Services. Further information
about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at:
http://circres.ahajournals.org//subscriptions/
Solutions
Whole Cell Recordings
HEK293 cells:
Tyrode’s solution: (mmol/L) NaCl 140, KCl 5.4, CaCl2 1.8, NaH2PO4 0.33, HEPES 5.0;
pH 7.4 (NaOH).
When [K+]o was increased to 10 mmol/L [K+]o, we carried out
equimolar substitution by decreasing extracellular NaCl by 4.6 mmol/L.
The
concentrations of other ions were not changed. For experiments in which BaCl2 was used
to block inwardly rectifying channels, 0.25-1 mmol/L BaCl2 was added to the Tyrode’s
solution. The cells were superfused with this solution until IK1 channels were completely
blocked.
Pipette filling solution: (mmol/L) KCl 20, K-aspartate 90, KH2PO4 10, EDTA 5.0,
K2ATP 1.9, HEPES 5.0 and Mg2+ 7.9; pH 7.2 (KOH). With the above concentration of
EDTA, Mg2+ concentration is expected to be 1.1 mmol/L.1
Guinea pig and sheep myocytes:
Ca2+-free cardioplegic: (mmol/L) Glucose 280, KCl 13.44, NaHCO3 12.6, Mannitol 34.
Tyrode’s solution: (mmol/L) NaCl 148, KCl 5.4, MgCl2 1.0, CaCl2 1.8, NaH2PO4 0.4,
Glucose 5.5, HEPES 15; pH 7.4 (NaOH). When [K+]o was increased to 10 mmol/L
[K+]o, we carried out equimolar substitution by decreasing extracellular NaCl by 4.6
mmol/L. The concentrations of other ions were not changed.
Low Ca2+ solution: (mmol/L) NaCl 148, KCl 5.4, MgCl2 1.0, NaH2PO4 0.4, Glucose 5.5,
HEPES 15, Albumin 1 mg/mL; pH 7.2 (NaOH).
Enzyme solution: Same as the Low Ca2+ solution, but in addition, contains collagenase
(100 units/mL, Worthington, type II (Lakewood, NJ) for guinea pig and 200 units/mL,
Worthington, type II (Lakewood, NJ) for sheep hearts).
KB Solution: (mmol/L) KCl 80, MgSO4 5, KH2PO4 30, Glucose 20, EGTA 0.25, Creatine
5, β-Hydroxybutyric acid 5, Taurine 20, Pyruvic acid 5, ATP 5; pH 7.4 (KOH).
Pipette filling solution: (mmol/L) KCl 148, MgCl2 1, EGTA 5, HEPES 5, Creatine 2,
ATP 5, Phosphocreatine 5; pH 7.2 (KOH).
For IK1 measurement, 5 µmol/L nifedipine was added to block ICaL channels and the Ca2+sensitive ICl. BaCl2 (0.4-1 mmol/L) was used to isolate IK1 from other background
currents.
Single Channel Recordings
Bath solution for cell-attached recordings: (mmol/L) KCl 140, CaCl2 1.8, HEPES 5,
NaH2PO4 0.33; pH 7.4 (KOH).
Pipette solution for cell-attached recordings: (mmol/L) KCl 140, CaCl2 1, HEPES 5; pH
7.4 (KOH).
Single-channel events were recorded from and to baseline. For cell-attached recordings,
1-5 µmol/L BaCl2 was added to the pipette solution to reduce open probability (Po) and
increase the number of transitions. It has been previously demonstrated that 1 µM BaCl2
does not change the unitary conductance of IK1 channels compared to control.2-4 Also, the
single channel conductance for Kir2.3 channels was not statistically different with 1
µmol/L BaCl2 (13.4 pS; n = 24) or 5 µmol/L BaCl2 (13.1 pS; n = 208) in the pipette
filling solution and therefore, these data were combined. Similarly, recordings in 1 and 5
µmol/L BaCl2 were combined for sheep atrial cell recordings as well as for ventricular
cell single-channel recordings.
Enzymatic dissociation of cardiac myocytes
Guinea pig myocytes were isolated using the Langendorff retrograde perfusion method,
the details of which have been previously described.5,6 Isolated atrial and ventricular cells
were separately kept at 37°C in KB solution for 30 minutes for recovery. In this study,
ventricular cells were only taken from the left ventricle. The KB solution (including the
cells) was gradually brought up to 10 mL using normal Tyrode’s solution. This process
was carried out in 5-minute steps, with an increasing volume of the Tyrode’s solution.
Cells were kept at room temperature until use.
Sheep atrial and ventricular myocytes were similarly isolated using the Langendorff
method. Sheep (15-17 kg) were anesthetized with sodium pentobarbital (30 mg/kg I.V.).
Following thoracotomy, hearts were retrogradely perfused (160 mL/min) with Tyrode’s
solution at 37°C until the effluent was clear of blood and then with the Ca2+-free solution
for 10 minutes. The enzyme solution was perfused for 40 minutes. This was followed
with the perfusion of the KB storage solution for 10 minutes. Sections of the heart were
removed from both the atria and the left ventricle and transferred into separate 100 mL
flasks containing 20 mL of KB solution. The isolated cells were kept at 37°C in KB
solution for another 30 minutes for recovery. The 20 mL KB solution (including the
cells) was gradually brought up to 100 mL with an increasing volume of Tyrode’s
solution. Cells were kept at room temperature until use.
Cloning of Kir2.x channels
We cloned the cDNA for Kir2.1, 2.2, and 2.3 channels from guinea pig DNA using the
polymerase chain reaction (PCR). Primer pairs for PCR were designed based on the
guinea pig Kir2.x sequences in the Genbank database (AF187872, AF187873,
AF187874, AF187875). We obtained PCR products for Kir2.1, 2.2 and 2.3 and their
DNA sequences were confirmed. The sequences of our guinea pig Kir2.2 and 2.3 clones
were not identical to the published sequences.4 All of our Kir2.2 clones had a serine at
amino acid position 196 while the published sequence had an aspartate. We believe that
our sequence is correct and the submitted sequence is in error. This conclusion was
reached upon comparing our sequence with the human, rat and mouse Kir2.2 sequences
which all had a serine at this site. Likewise, all of our Kir2.3 sequences had two amino
acid differences with the published sequence. Our sequencing results showed an
asparagine and a valine at amino acid positions 243 and 244, respectively, that were
consistent with the human, rat, and mouse sequences. Once again we believe that our
clones are the correct sequence. Kir2.1, 2.2 and 2.3 cDNA have each been subcloned
into the bicistrionic mammalian expression vector, pIRES-hrGFP (Stratagene, La Jolla,
CA), which allowed for the simultaneous expression of the Kir2.x protein and the green
fluorescent protein marker.
We cloned the cDNA for sheep Kir2.3 channels from sheep genomic DNA using PCR.
The forward (5’-ATGCACGGACACAGCCGCAAC GGGCAG-3’) and reverse (5’TCAGATGGCAGACTCCCTGCG-3’) primers are based on the consensus sequence of
the first and last twenty nucleotides from the Kir2.3 sequence from several different
species. We obtained PCR product and its DNA sequence was confirmed. Figure 1 shows
the nucleotide sequence and the expected protein sequence of sheep Kir2.3. The first and
last six amino acids are based upon the consensus sequence of the forward and reverse
primers from other species. Sheep Kir2.3 cDNA was subcloned into the pIRES-hrGFP
(Stratagene, La Jolla, CA), similar to the guinea pig Kir2.x experiments.
We subcloned the guinea pig Kir2.1 and 2.3 cDNA into the bicistrionic pIRES vector
(Clontech, Palo Alto, CA). Co-expression of Kir2.1 and 2.3 protein was confirmed by
western blot. Concatemers of Kir2.1 and 2.3 in pCDNA3 were a generous gift from C.
Derst.7
The
electrophysiological
properties
of
Kir2.1-2.3
concatemers
were
indistinguishable from the properties of Kir2.3-2.1 concatemers7 and data from the two
constructs were pooled.
Cell culture and transfection procedures
HEK293 cells were grown in Dulbecco’s modified Eagle’s medium supplemented with
10% fetal bovine serum. We used the Effectene (Qiagen, Valencia, CA) protocol to
transiently transfect HEK293 cells following manufacturer’s instructions. In order to
visualize transfected cells for patch-clamping, the pIRES and pCDNA3 vectors were cotransfected with pEGFP-N1 (Clontech, Palo Alto, CA).
RNase Protection Assay
RNase protection assay was carried out as described previously.8 Briefly, total RNA was
extracted from the atria and ventricles of six guinea pigs (300g) and three sheep (15-17
kg) hearts using Tri Reagent (MRC Inc., Cincinnati, OH) following manufacturer’s
instructions. Antisense probes were designed to recognize coding regions of guinea pig
Kir2.x channels. Separate antisense probes were designed for the sheep Kir2.x clones. A
probe for the housekeeping gene, cyclophilin, was used as a control. In vitro transcribed
full-length Kir2.x mRNA and guinea pig brain RNA extracts were used as positive
controls for the guinea pig experiments. In vitro transcribed portions of sheep Kir2.x
coding regions as well as sheep brain RNA extracts were used as positive controls for
sheep RPA experiments. The RPA was performed using the Riboquant RPA kit
(Pharmingen, San Diego, CA). Total mRNA from the atria and ventricle was hybridized
to antisense radioactive probes against various Kir2.x isoforms and cyclophilin.
Hybridized RNA was digested with ribonuclease and the protected, labeled RNA was
resolved on an acrylamide gel and visualized by phosphorimager, which allows for
quantification of the radioactive signal. The band density in each lane was normalized to
the
cyclophilin
band
intensity
and
averaged.
Phosphorimager
(Molecular
Dynamics/Amersham, Piscataway, NJ) Kir2.x RPA signals were quantified as a
percentage of the cyclophilin signal using Imagequant (Molecular Dynamics/Amersham,
Piscataway, NJ) software. Figure 2 shows that antisense guinea pig Kir2.x probes were
able to detect their respective RNA species in the brain of the guinea pig. We were not
able to detect Kir2.2 in the heart, but we were able to detect Kir2.2 RNA in the brain.
Figure 3 shows that antisense sheep Kir2.x probes were able to detect their respective
RNA species in the brain. Like the guinea pig, Kir2.2 was detected in the brain of the
sheep, but was not found to be expressed in the heart.
Western blots
Guinea pig and sheep membrane proteins were isolated as described previously.9 Three
separate guinea pig and sheep membrane preparations were analyzed. Each guinea pig
membrane preparation consisted of atrial and ventricular tissues combined from two
animals. Guinea pig and sheep atrial and ventricular membrane proteins (~20 µg) were
resolved by 10% SDS-PAGE and then probed by Western blot analysis with anti-Kir2.1
(Alomone labs, Jerusalem, Israel) and anti-Kir2.3 (Chemicon International, Tenecula,
CA) antibodies. Immunoreactivity was visualized by ECL reagent (Amersham Pharmacia
Biotech, Piscataway, NJ).
Electrophysiology
Whole-cell patch-clamp recordings were carried out as previously described.10,11 Wholecell and cell-attached recordings were obtained using Axopatch 1D and 200B amplifiers
(Axon Instruments, Union City, CA). The data were acquired and analyzed using the
pCLAMP 8 suite of programs (Axon Instruments, Union City, CA). Recordings in
cardiac myocytes were performed at 37 ± 0.5 °C. Recordings from HEK293 cells were
done at room temperature (21-22 °C). Electrophysiology on HEK293 cells was
commenced 24-48 h after transfection by Kir2.x cDNA. Pipette resistance was 2-3 MΩ
for whole-cell IK1 recordings in normal [K+]o. For recordings in 10 mmol/L [K+]o in
which currents were significantly larger, pipette resistance was reduced to 1-2 MΩ in
order to minimize voltage clamp error. For cell-attached single-channel recordings
pipette resistance was 8-12 MΩ. For recording whole-cell IK1 currents, voltage-clamp
ramps were applied from –100 to 0 mV. For native cardiac myocytes, a slow ramp
protocol (1.6 mV/sec) was utilized in order to minimize possible activation of other
currents. For recording Kir2.x currents in HEK293 cells, the ramp rate was 30 mV/sec.
Data Analysis for Kir2.x isoforms
The degree of rectification for the Kir2.x isoforms was estimated as the relative chord
conductance (Gc) in accordance with an earlier study.12 Gc was calculated as the ratio of
the actual current and current predicted by assuming a linear unblocked current (Data for
Gc near the reversal potential were discarded from analysis since the ratio of current to
voltage approaches “0/0” near this potential). Gc relationships obtained for Kir2.1 and 2.2
were fitted by a single Boltzmann equation:
Vm = [1.0/ {1.0 + exp(-λ1(V – V1))}]
Equation 1.
The Gc relationship for Kir2.3 was fitted by a sum of two Boltzmann equations described
by:
Vm = [A1/ {1.0 + exp(-λ1(V – V1))} + A2/ {1.0 + exp(-λ2(V – V2))}]
Equation 2.
The sum of their respective amplitudes A1 and A2 were normalized to 1.0 (A1 + A2 = 1.0).
V is the membrane potential, V1,2 represent parameters, and λ1,2 = zF/RT, where z stands
for the effective valency or steepness of rectification, F is Faraday’s constant, R is the gas
constant, and T is the absolute temperature.
Computer Simulations
A mathematical model of the human atrial myocyte13 was implemented in C, on a SUN
Ultra-10 workstation platform. The diferential equations in this model were integrated
using a fixed time step (∆t = 0.005 msec) Euler method, to simulate the atrial action
potential. This model was then used to assess the functional significance of the
differential rectification profiles of Kir2.1 and Kir2.3 in modulating the action potential
waveform. The parameters in the equation for IK1 in the atrial model were modified to
obtain fits to the normalized I-V plots for Kir2.1 and Kir2.3. These fits were then scaled
so that the absolute current magnitude of the equations used to fit the Kir2.1 and Kir2.3
data at –100 mV was identical to that of the original value of IK1 in the human atrial
model (~-80 pA). These new equations for IK1 were then incorporated into the whole-cell
human atrial model, and then steady-state action potentials were obtained by running the
model for 13 seconds at 1.0 Hz.
Statistical Analysis
All experimental results were presented as mean ± SEM. The significance of differences
between the means was evaluated by one-way ANOVA or student’s t-test as appropriate.
A value of P ≤ 0.05 was used as the criterion for significance.
FIGURE LEGENDS
Figure 1
Sheep Kir2.3 sequence. A. cDNA sequence of sheep Kir2.3. The first and last 29 bases
(six amino acids) are defined from the polymerase chain reaction primers, which are
based on the consensus sequence of cloned Kir2.3 sequences. B. Predicted amino acid
sequence based on the above cDNA.
Figure 2
Guinea pig RNase protection assay positive controls.
Examples of Kir2.x mRNA
protection signals obtained from representative heart and brain samples. For Kir2.1, 2.2,
and 2.3, lanes with the undigested probe show the location of the unprotected length of
the probe. The location of the size of the protected probe (designated by arrows) was
determined by using in vitro transcribed positive control mRNA (data not shown). Kir2.x
signals were normalized with cyclophilin mRNA as internal control. Note the absent
Kir2.2 signal in the heart, but a clear signal in the brain.
Figure 3
Sheep RNase protection assay positive controls. Examples of Kir2.x mRNA protection
signals obtained from representative heart and brain samples. For Kir2.1, 2.2, and 2.3,
lanes with the undigested probe show the location of the unprotected length of the probe.
The location of the size of the protected probe (designated by arrows) was determined by
using in vitro transcribed positive control mRNA (data not shown). Kir2.x signals were
normalized with cyclophilin mRNA as internal control. Note the absent Kir2.2 signal in
the heart, but a clear signal in the brain.
Figure 4
Representative RPAs of guinea pig and sheep mRNA. A. Guinea pig Kir2.1 and 2.3
RPA gels using atrial and ventricular tissue. Note that Kir2.1 is the predominant Kir2.x
isoform in the sheep atria. B. Sheep Kir2.1 and 2.3 RPA gels using atrial and ventricular
tissue. Note that Kir2.3 is the predominant Kir2.x isoform in the sheep atria.
Figure 5
Representative western blots of guinea pig and sheep atria and ventricles.
Figure 6
Current-voltage relations of Kir2.1 and Kir2.3 channels expressed in HEK293 cells
recorded at 37o C. Average data of ramp (-100 mV to 0 mV)-generated, barium-sensitive
currents for cells expressing Kir2.1 (n = 3) and Kir2.3 (n = 3) channels. Data were
normalized to current at –100 mV.
Figure 7
Representative current-voltage relations of the background current recorded from guinea
pig and sheep atrial and ventricular myocytes. A. Ramp (-100 mV to 0 mV)-generated
guinea pig atrial and ventricular background current. B. Ramp (-100 mV to 0 mV)generated sheep atrial and ventricular background current.
Table 1
Properties of freshly isolated sheep atrial and ventricular cells.
Reference List
1. Fabiato A, Fabiato F. Calculator programs for computing the composition of the
solutions containing multiple metals and ligands used for experiments in skinned
muscle cells. J Physiol (Paris). 1979;75:463-505.
2. Kubo Y, Baldwin TJ, Jan YN, Jan LY. Primary structure and functional expression
of a mouse inward rectifier potassium channel. Nature. 1993;362:127-133.
3. Makhina EN, Kelly AJ, Lopatin AN, Mercer RW, Nichols CG. Cloning and
expression of a novel human brain inward rectifier potassium channel. J Biol Chem.
1994;269:20468-20474.
4. Liu GX, Derst C, Schlichthorl G, Heinen S, Seebohm G, Bruggemann A, Kummer
W, Veh RW, Daut J, Preisig-Muller R. Comparison of cloned Kir2 channels with
native inward rectifier K+ channels from guinea-pig cardiomyocytes. J Physiol.
2001;532:115-126.
5. Morley GE, Anumonwo JM, Delmar M. Effects of 2,4-dinitrophenol or low [ATP]i
on cell excitability and action potential propagation in guinea pig ventricular
myocytes. Circ Res. 1992;71:821-830.
6. Anumonwo JM, Freeman LC, Kwok WM, Kass RS. Delayed rectification in single
cells isolated from guinea pig sinoatrial node. Am J Physiol. 1992;262:H921-H925.
7. Preisig-Muller R, Schlichthorl G, Goerge T, Heinen S, Bruggemann A, Rajan S,
Derst C, Veh RW, Daut J. Heteromerization of Kir2.x potassium channels
contributes to the phenotype of Andersen's syndrome. Proc Natl Acad Sci U S A.
2002;99:7774-7779.
8. Vaidya D, Tamaddon HS, Lo CW, Taffet SM, Delmar M, Morley GE, Jalife J. Null
mutation of connexin43 causes slow propagation of ventricular activation in the late
stages of mouse embryonic development. Circ Res. 2001;88:1196-1202.
9. Pond AL, Scheve BK, Benedict AT, Petrecca K, Van Wagoner DR, Shrier A,
Nerbonne JM. Expression of distinct ERG proteins in rat, mouse, and human heart.
Relation to functional I(Kr) channels. J Biol Chem. 2000;275:5997-6006.
10. Anumonwo JM, Horta J, Delmar M, Taffet SM, Jalife J. Proton and zinc effects on
HERG currents. Biophys J. 1999;77:282-298.
11. Samie FH, Berenfeld O, Anumonwo J, Mironov SF, Udassi S, Beaumont J, Taffet
S, Pertsov AM, Jalife J. Rectification of the background potassium current: a
determinant of rotor dynamics in ventricular fibrillation. Circ Res. 2001;89:12161223.
12. Shyng SL, Sha Q, Ferrigni T, Lopatin AN, Nichols CG. Depletion of intracellular
polyamines relieves inward rectification of potassium channels. Proc Natl Acad Sci
U S A. 1996;93:12014-12019.
13. Courtemanche M, Ramirez RJ, Nattel S. Ionic mechanisms underlying human atrial
action potential properties: insights from a mathematical model. Am J Physiol.
1998;275:H301-H321.
Figure 1
ATGCACGGACACAGCCGCAACGGGCAGGCCCACGTGCCCCGGCGGAAGCGCCGCAACCGC
TTCGTGAAAAAGAACGGCCAATGCAACGTCTACTTCGCCAACCTGAGCAACAAGTCGCAG
CGCTACATGGCGGACATCCTCACCACCTGCGTGGACACGCGCTGGCGCTACATGCTCATG
ATCTTCTCCGCGGCCTTCCTCGTCTCCTGGCTCTTTTTCGGCCTCCTCTTCTGGTGCATC
GCCTTCTTCCACGGTGACCTGGAGGCCGGCCCGGCGGGGACCGCGGCAGGGACCGCGGCG
GGAGGCGGCGGGGCGGCACCGGTGGCTCCCAAGCCCTGCATTATGCACGTGAATGGCTTC
CCGGGCGCCTTCCTCTTCTCGGTGGAGACGCAGACGACCATCGGCTACGGGTTCCGGTGC
GTGACGGAGGAGTGCCCGCTGGCGGTCATCGCCGTGGTGGTCCAGTCTATCGTGGGCTGT
GTCATCGACTCCTTCATGATTGGCACCATCATGGCCAAGATGGCCCGGCCCAAGAAGCGG
GCGCAGACGTTGCTGTTCAGCCACCACGCCGTCATCTCGGTGCGCGACGGCAAGCTCTGC
CTCATGTGGCGCGTGGGCAACCTACGCAAGAGCCACATTGTGGAGGCCCATGTGCGGGCC
CAGCTCATCAAGCCCTACATGACCCAGGAGGGCGAGTACCTGCCGCTGGATCAGCGGGAC
CTCAACGTGGGCTCTGACATCGGCCTGGACCGCATCTTCCTGGTCTCGCCCATCATCATT
GTCCACGAGATCGATGAGGACAGCCCGCTCTACGGCATGGGCAAGGAGGAGCTGGAGTCG
GAGGACTTCGAGGTCGTGGTCATCCTGGAGGGTATGGTGGAGGCCACGGCCATGACCACC
CAGGCCCGCAGCTCCTACCTGGCCAGCGAGATCCTGTGGGGCCACCGCTTCGAGCCTGTG
GTCTTCGAGGAGGAGAGCCACTACAAGGTGGACTACTCGCGCTTCCACAAGACCTACGAG
GTGGCCGGCACGCCCTGCTGCTCTGCCCGGGAGCTGCAGGAGAGCAAGATCACCGTGCTG
CCCGCCCCGCCGCCCCCGCCCAGTGCCTTCTGCTACGAGAACGAGCTGGCCCTCATGAGC
CAGGAGGAAGAGGAGATGGAGGAGGAGGCTGCGGCCGCTGCCGCTGTGGCTGCGGGCCTG
GGCCTGGAGGCGGGCTCCAAGGAGGAGGCGGGCATCATCCGGATGCTGGAGTTTGGCAGC
CACCTGGATCTGGAGCGCATGCAAGCCACCCTCCCGCTGGACAACATCTCCTACCGCAGG
GAGTCTGCCATCT
1
51
101
151
201
251
301
351
401
MHGHSRNGQA
VDTRWRYMLM
GGGGAAPVAP
AVVVQSIVGC
LMWRVGNLRK
RIFLVSPIII
QARSSYLASE
ELQESKITVL
GLEAGSKEEA
HVPRRKRRNR
IFSAAFLVSW
KPCIMHVNGF
VIDSFMIGTI
SHIVEAHVRA
VHEIDEDSPL
ILWGHRFEPV
PAPPPPPSAF
GIIRMLEFGS
FVKKNGQCNV
LFFGLLFWCI
PGAFLFSVET
MAKMARPKKR
QLIKPYMTQE
YGMGKEELES
VFEEESHYKV
CYENELALMS
HLDLERMQAT
YFANLSNKSQ
AFFHGDLEAG
QTTIGYGFRC
AQTLLFSHHA
GEYLPLDQRD
EDFEVVVILE
DYSRFHKTYE
QEEEEMEEEA
LPLDNISYRR
RYMADILTTC
PAGTAAGTAA
VTEECPLAVI
VISVRDGKLC
LNVGSDIGLD
GMVEATAMTT
VAGTPCCSAR
AAAAAVAAGL
ESAI
Figure 5
210 kDa
125 kDa
125 kDa
101 kDa
101 kDa
Kir2.1
Kir2.3
56 kDa
Abbreviations:
GP = guinea pig
LV = left ventricle
RV = right ventricle
LA = left atrium
RA = right atrium
56 kDa
Sheep LV
Sheep LA
Sheep RA
GP LV
GP RV
Kir2.1
Kir2.3
210 kDa
GP atria
Kir2.3
GP atria
Sheep RA
GP LV
GP RV
Sheep LV
Sheep RV
Sheep LA
Kir2.1
Kir2.3
Kir2.1
0.5
-120
-100
-80
-60
-40
-20
20
-0.5
-1.0
-1.5
-120 -100
-80
-60
-40
8
8
4
4
-20
20
-120 -100
-80
-60
-40
-20
20
-4
-4
-8
-8
-12
-12
-16
-16
Table 1.
Atrial Cells
Length (mM)
Width (mM)
Surface area (mM2)
Ventricular Cells
122.2 ± 2.0 (n = 150)
155.8 ± 2.9 (n = 58)
11.1 ± 0.2 (n = 150)
14.4 ± 0.3 (n = 58)
4499.9 ± 116.7 (n = 150)
7361.4 ± 195.3 (n = 58)
Input Resistance (GW)
0.20 ± 0.01 (n = 20)
0.04 ± 0.003 (n = 12)
Cell Capacitance (pF)
78.7 ± 3.9 (n = 20)
90.0 ± 5.9 (n = 10)
-73.4 ± 1.0 (n = 32)
-81.3 ± 1.3 (n = 10)
RMP (mV)
Properties of freshly isolated sheep atrial and ventricular cells. Myocytes were isolated from the
free walls of the atria and from the left ventricle. Surface area was calculated by assuming the shape of
a right cylinder for the isolated myocytes. Surface area was calculated from 2πr(L+r). L; length, r; cell
radius (half of cell width). Data are Mean and ± SEM.