Download Tyrode`s solution: (mmol/L)

Solutions
Whole Cell Recordings
HEK293 cells:
Tyrode’s solution: (mmol/L) NaCl 140, KCl 5.4, CaCl2 1.8, NaH2PO4 0.33, HEPES 5.0;
pH 7.4 (NaOH).
When [K+]o was increased to 10 mmol/L [K+]o, we carried out
equimolar substitution by decreasing extracellular NaCl by 4.6 mmol/L.
The
concentrations of other ions were not changed. For experiments in which BaCl2 was used
to block inwardly rectifying channels, 0.25-1 mmol/L BaCl2 was added to the Tyrode’s
solution. The cells were superfused with this solution until IK1 channels were completely
blocked.
Pipette filling solution: (mmol/L) KCl 20, K-aspartate 90, KH2PO4 10, EDTA 5.0,
K2ATP 1.9, HEPES 5.0 and Mg2+ 7.9; pH 7.2 (KOH). With the above concentration of
EDTA, Mg2+ concentration is expected to be 1.1 mmol/L.1
Guinea pig and sheep myocytes:
Ca2+-free cardioplegic: (mmol/L) Glucose 280, KCl 13.44, NaHCO3 12.6, Mannitol 34.
Tyrode’s solution: (mmol/L) NaCl 148, KCl 5.4, MgCl2 1.0, CaCl2 1.8, NaH2PO4 0.4,
Glucose 5.5, HEPES 15; pH 7.4 (NaOH). When [K+]o was increased to 10 mmol/L
[K+]o, we carried out equimolar substitution by decreasing extracellular NaCl by 4.6
mmol/L. The concentrations of other ions were not changed.
Low Ca2+ solution: (mmol/L) NaCl 148, KCl 5.4, MgCl2 1.0, NaH2PO4 0.4, Glucose 5.5,
HEPES 15, Albumin 1 mg/mL; pH 7.2 (NaOH).
Enzyme solution: Same as the Low Ca2+ solution, but in addition, contains collagenase
(100 units/mL, Worthington, type II (Lakewood, NJ) for guinea pig and 200 units/mL,
Worthington, type II (Lakewood, NJ) for sheep hearts).
KB Solution: (mmol/L) KCl 80, MgSO4 5, KH2PO4 30, Glucose 20, EGTA 0.25, Creatine
5, β-Hydroxybutyric acid 5, Taurine 20, Pyruvic acid 5, ATP 5; pH 7.4 (KOH).
Pipette filling solution: (mmol/L) KCl 148, MgCl2 1, EGTA 5, HEPES 5, Creatine 2,
ATP 5, Phosphocreatine 5; pH 7.2 (KOH).
For IK1 measurement, 5 µmol/L nifedipine was added to block ICaL channels and the Ca2+sensitive ICl. BaCl2 (0.4-1 mmol/L) was used to isolate IK1 from other background
currents.
Single Channel Recordings
Bath solution for cell-attached recordings: (mmol/L) KCl 140, CaCl2 1.8, HEPES 5,
NaH2PO4 0.33; pH 7.4 (KOH).
Pipette solution for cell-attached recordings: (mmol/L) KCl 140, CaCl2 1, HEPES 5; pH
7.4 (KOH).
Single-channel events were recorded from and to baseline. For cell-attached recordings,
1-5 µmol/L BaCl2 was added to the pipette solution to reduce open probability (Po) and
increase the number of transitions. It has been previously demonstrated that 1 µM BaCl2
does not change the unitary conductance of IK1 channels compared to control.2-4 Also, the
single channel conductance for Kir2.3 channels was not statistically different with 1
µmol/L BaCl2 (13.4 pS; n = 24) or 5 µmol/L BaCl2 (13.1 pS; n = 208) in the pipette
filling solution and therefore, these data were combined. Similarly, recordings in 1 and 5
µmol/L BaCl2 were combined for sheep atrial cell recordings as well as for ventricular
cell single-channel recordings.
Enzymatic dissociation of cardiac myocytes
Guinea pig myocytes were isolated using the Langendorff retrograde perfusion method,
the details of which have been previously described.5,6 Isolated atrial and ventricular cells
were separately kept at 37°C in KB solution for 30 minutes for recovery. In this study,
ventricular cells were only taken from the left ventricle. The KB solution (including the
cells) was gradually brought up to 10 mL using normal Tyrode’s solution. This process
was carried out in 5-minute steps, with an increasing volume of the Tyrode’s solution.
Cells were kept at room temperature until use.
Sheep atrial and ventricular myocytes were similarly isolated using the Langendorff
method. Sheep (15-17 kg) were anesthetized with sodium pentobarbital (30 mg/kg I.V.).
Following thoracotomy, hearts were retrogradely perfused (160 mL/min) with Tyrode’s
solution at 37°C until the effluent was clear of blood and then with the Ca2+-free solution
for 10 minutes. The enzyme solution was perfused for 40 minutes. This was followed
with the perfusion of the KB storage solution for 10 minutes. Sections of the heart were
removed from both the atria and the left ventricle and transferred into separate 100 mL
flasks containing 20 mL of KB solution. The isolated cells were kept at 37°C in KB
solution for another 30 minutes for recovery. The 20 mL KB solution (including the
cells) was gradually brought up to 100 mL with an increasing volume of Tyrode’s
solution. Cells were kept at room temperature until use.
Cloning of Kir2.x channels
We cloned the cDNA for Kir2.1, 2.2, and 2.3 channels from guinea pig DNA using the
polymerase chain reaction (PCR). Primer pairs for PCR were designed based on the
guinea pig Kir2.x sequences in the Genbank database (AF187872, AF187873,
AF187874, AF187875). We obtained PCR products for Kir2.1, 2.2 and 2.3 and their
DNA sequences were confirmed. The sequences of our guinea pig Kir2.2 and 2.3 clones
were not identical to the published sequences.4 All of our Kir2.2 clones had a serine at
amino acid position 196 while the published sequence had an aspartate. We believe that
our sequence is correct and the submitted sequence is in error. This conclusion was
reached upon comparing our sequence with the human, rat and mouse Kir2.2 sequences
which all had a serine at this site. Likewise, all of our Kir2.3 sequences had two amino
acid differences with the published sequence. Our sequencing results showed an
asparagine and a valine at amino acid positions 243 and 244, respectively, that were
consistent with the human, rat, and mouse sequences. Once again we believe that our
clones are the correct sequence. Kir2.1, 2.2 and 2.3 cDNA have each been subcloned
into the bicistrionic mammalian expression vector, pIRES-hrGFP (Stratagene, La Jolla,
CA), which allowed for the simultaneous expression of the Kir2.x protein and the green
fluorescent protein marker.
We cloned the cDNA for sheep Kir2.3 channels from sheep genomic DNA using PCR.
The forward (5’-ATGCACGGACACAGCCGCAAC GGGCAG-3’) and reverse (5’TCAGATGGCAGACTCCCTGCG-3’) primers are based on the consensus sequence of
the first and last twenty nucleotides from the Kir2.3 sequence from several different
species. We obtained PCR product and its DNA sequence was confirmed. Figure 1 shows
the nucleotide sequence and the expected protein sequence of sheep Kir2.3. The first and
last six amino acids are based upon the consensus sequence of the forward and reverse
primers from other species. Sheep Kir2.3 cDNA was subcloned into the pIRES-hrGFP
(Stratagene, La Jolla, CA), similar to the guinea pig Kir2.x experiments.
We subcloned the guinea pig Kir2.1 and 2.3 cDNA into the bicistrionic pIRES vector
(Clontech, Palo Alto, CA). Co-expression of Kir2.1 and 2.3 protein was confirmed by
western blot. Concatemers of Kir2.1 and 2.3 in pCDNA3 were a generous gift from C.
Derst.7
The
electrophysiological
properties
of
Kir2.1-2.3
concatemers
were
indistinguishable from the properties of Kir2.3-2.1 concatemers7 and data from the two
constructs were pooled.
Cell culture and transfection procedures
HEK293 cells were grown in Dulbecco’s modified Eagle’s medium supplemented with
10% fetal bovine serum. We used the Effectene (Qiagen, Valencia, CA) protocol to
transiently transfect HEK293 cells following manufacturer’s instructions. In order to
visualize transfected cells for patch-clamping, the pIRES and pCDNA3 vectors were cotransfected with pEGFP-N1 (Clontech, Palo Alto, CA).
RNase Protection Assay
RNase protection assay was carried out as described previously.8 Briefly, total RNA was
extracted from the atria and ventricles of six guinea pigs (300g) and three sheep (15-17
kg) hearts using Tri Reagent (MRC Inc., Cincinnati, OH) following manufacturer’s
instructions. Antisense probes were designed to recognize coding regions of guinea pig
Kir2.x channels. Separate antisense probes were designed for the sheep Kir2.x clones. A
probe for the housekeeping gene, cyclophilin, was used as a control. In vitro transcribed
full-length Kir2.x mRNA and guinea pig brain RNA extracts were used as positive
controls for the guinea pig experiments. In vitro transcribed portions of sheep Kir2.x
coding regions as well as sheep brain RNA extracts were used as positive controls for
sheep RPA experiments. The RPA was performed using the Riboquant RPA kit
(Pharmingen, San Diego, CA). Total mRNA from the atria and ventricle was hybridized
to antisense radioactive probes against various Kir2.x isoforms and cyclophilin.
Hybridized RNA was digested with ribonuclease and the protected, labeled RNA was
resolved on an acrylamide gel and visualized by phosphorimager, which allows for
quantification of the radioactive signal. The band density in each lane was normalized to
the
cyclophilin
band
intensity
and
averaged.
Phosphorimager
(Molecular
Dynamics/Amersham, Piscataway, NJ) Kir2.x RPA signals were quantified as a
percentage of the cyclophilin signal using Imagequant (Molecular Dynamics/Amersham,
Piscataway, NJ) software. Figure 2 shows that antisense guinea pig Kir2.x probes were
able to detect their respective RNA species in the brain of the guinea pig. We were not
able to detect Kir2.2 in the heart, but we were able to detect Kir2.2 RNA in the brain.
Figure 3 shows that antisense sheep Kir2.x probes were able to detect their respective
RNA species in the brain. Like the guinea pig, Kir2.2 was detected in the brain of the
sheep, but was not found to be expressed in the heart.
Western blots
Guinea pig and sheep membrane proteins were isolated as described previously.9 Three
separate guinea pig and sheep membrane preparations were analyzed. Each guinea pig
membrane preparation consisted of atrial and ventricular tissues combined from two
animals. Guinea pig and sheep atrial and ventricular membrane proteins (~20 µg) were
resolved by 10% SDS-PAGE and then probed by Western blot analysis with anti-Kir2.1
(Alomone labs, Jerusalem, Israel) and anti-Kir2.3 (Chemicon International, Tenecula,
CA) antibodies. Immunoreactivity was visualized by ECL reagent (Amersham Pharmacia
Biotech, Piscataway, NJ).
Electrophysiology
Whole-cell patch-clamp recordings were carried out as previously described.10,11 Wholecell and cell-attached recordings were obtained using Axopatch 1D and 200B amplifiers
(Axon Instruments, Union City, CA). The data were acquired and analyzed using the
pCLAMP 8 suite of programs (Axon Instruments, Union City, CA). Recordings in
cardiac myocytes were performed at 37 ± 0.5 °C. Recordings from HEK293 cells were
done at room temperature (21-22 °C). Electrophysiology on HEK293 cells was
commenced 24-48 h after transfection by Kir2.x cDNA. Pipette resistance was 2-3 MΩ
for whole-cell IK1 recordings in normal [K+]o. For recordings in 10 mmol/L [K+]o in
which currents were significantly larger, pipette resistance was reduced to 1-2 MΩ in
order to minimize voltage clamp error. For cell-attached single-channel recordings
pipette resistance was 8-12 MΩ. For recording whole-cell IK1 currents, voltage-clamp
ramps were applied from –100 to 0 mV. For native cardiac myocytes, a slow ramp
protocol (1.6 mV/sec) was utilized in order to minimize possible activation of other
currents. For recording Kir2.x currents in HEK293 cells, the ramp rate was 30 mV/sec.
Data Analysis for Kir2.x isoforms
The degree of rectification for the Kir2.x isoforms was estimated as the relative chord
conductance (Gc) in accordance with an earlier study.12 Gc was calculated as the ratio of
the actual current and current predicted by assuming a linear unblocked current (Data for
Gc near the reversal potential were discarded from analysis since the ratio of current to
voltage approaches “0/0” near this potential). Gc relationships obtained for Kir2.1 and 2.2
were fitted by a single Boltzmann equation:
Vm = [1.0/ {1.0 + exp(-λ1(V – V1))}]
Equation 1.
The Gc relationship for Kir2.3 was fitted by a sum of two Boltzmann equations described
by:
Vm = [A1/ {1.0 + exp(-λ1(V – V1))} + A2/ {1.0 + exp(-λ2(V – V2))}]
Equation 2.
The sum of their respective amplitudes A1 and A2 were normalized to 1.0 (A1 + A2 = 1.0).
V is the membrane potential, V1,2 represent parameters, and λ1,2 = zF/RT, where z stands
for the effective valency or steepness of rectification, F is Faraday’s constant, R is the gas
constant, and T is the absolute temperature.
Computer Simulations
A mathematical model of the human atrial myocyte13 was implemented in C, on a SUN
Ultra-10 workstation platform. The diferential equations in this model were integrated
using a fixed time step (∆t = 0.005 msec) Euler method, to simulate the atrial action
potential. This model was then used to assess the functional significance of the
differential rectification profiles of Kir2.1 and Kir2.3 in modulating the action potential
waveform. The parameters in the equation for IK1 in the atrial model were modified to
obtain fits to the normalized I-V plots for Kir2.1 and Kir2.3. These fits were then scaled
so that the absolute current magnitude of the equations used to fit the Kir2.1 and Kir2.3
data at –100 mV was identical to that of the original value of IK1 in the human atrial
model (~-80 pA). These new equations for IK1 were then incorporated into the whole-cell
human atrial model, and then steady-state action potentials were obtained by running the
model for 13 seconds at 1.0 Hz.
Statistical Analysis
All experimental results were presented as mean ± SEM. The significance of differences
between the means was evaluated by one-way ANOVA or student’s t-test as appropriate.
A value of P ≤ 0.05 was used as the criterion for significance.
FIGURE LEGENDS
Figure 1
Sheep Kir2.3 sequence. A. cDNA sequence of sheep Kir2.3. The first and last 29 bases
(six amino acids) are defined from the polymerase chain reaction primers, which are
based on the consensus sequence of cloned Kir2.3 sequences. B. Predicted amino acid
sequence based on the above cDNA.
Figure 2
Guinea pig RNase protection assay positive controls.
Examples of Kir2.x mRNA
protection signals obtained from representative heart and brain samples. For Kir2.1, 2.2,
and 2.3, lanes with the undigested probe show the location of the unprotected length of
the probe. The location of the size of the protected probe (designated by arrows) was
determined by using in vitro transcribed positive control mRNA (data not shown). Kir2.x
signals were normalized with cyclophilin mRNA as internal control. Note the absent
Kir2.2 signal in the heart, but a clear signal in the brain.
Figure 3
Sheep RNase protection assay positive controls. Examples of Kir2.x mRNA protection
signals obtained from representative heart and brain samples. For Kir2.1, 2.2, and 2.3,
lanes with the undigested probe show the location of the unprotected length of the probe.
The location of the size of the protected probe (designated by arrows) was determined by
using in vitro transcribed positive control mRNA (data not shown). Kir2.x signals were
normalized with cyclophilin mRNA as internal control. Note the absent Kir2.2 signal in
the heart, but a clear signal in the brain.
Figure 4
Representative RPAs of guinea pig and sheep mRNA. A. Guinea pig Kir2.1 and 2.3
RPA gels using atrial and ventricular tissue. Note that Kir2.1 is the predominant Kir2.x
isoform in the sheep atria. B. Sheep Kir2.1 and 2.3 RPA gels using atrial and ventricular
tissue. Note that Kir2.3 is the predominant Kir2.x isoform in the sheep atria.
Figure 5
Representative western blots of guinea pig and sheep atria and ventricles.
Figure 6
Current-voltage relations of Kir2.1 and Kir2.3 channels expressed in HEK293 cells
recorded at 37o C. Average data of ramp (-100 mV to 0 mV)-generated, barium-sensitive
currents for cells expressing Kir2.1 (n = 3) and Kir2.3 (n = 3) channels. Data were
normalized to current at –100 mV.
Figure 7
Representative current-voltage relations of the background current recorded from guinea
pig and sheep atrial and ventricular myocytes. A. Ramp (-100 mV to 0 mV)-generated
guinea pig atrial and ventricular background current. B. Ramp (-100 mV to 0 mV)generated sheep atrial and ventricular background current.
Table 1
Properties of freshly isolated sheep atrial and ventricular cells.
Reference List
1. Fabiato A, Fabiato F. Calculator programs for computing the composition of the
solutions containing multiple metals and ligands used for experiments in skinned
muscle cells. J Physiol (Paris). 1979;75:463-505.
2. Kubo Y, Baldwin TJ, Jan YN, Jan LY. Primary structure and functional expression
of a mouse inward rectifier potassium channel. Nature. 1993;362:127-133.
3. Makhina EN, Kelly AJ, Lopatin AN, Mercer RW, Nichols CG. Cloning and
expression of a novel human brain inward rectifier potassium channel. J Biol Chem.
1994;269:20468-20474.
4. Liu GX, Derst C, Schlichthorl G, Heinen S, Seebohm G, Bruggemann A, Kummer
W, Veh RW, Daut J, Preisig-Muller R. Comparison of cloned Kir2 channels with
native inward rectifier K+ channels from guinea-pig cardiomyocytes. J Physiol.
2001;532:115-126.
5. Morley GE, Anumonwo JM, Delmar M. Effects of 2,4-dinitrophenol or low [ATP]i
on cell excitability and action potential propagation in guinea pig ventricular
myocytes. Circ Res. 1992;71:821-830.
6. Anumonwo JM, Freeman LC, Kwok WM, Kass RS. Delayed rectification in single
cells isolated from guinea pig sinoatrial node. Am J Physiol. 1992;262:H921-H925.
7. Preisig-Muller R, Schlichthorl G, Goerge T, Heinen S, Bruggemann A, Rajan S,
Derst C, Veh RW, Daut J. Heteromerization of Kir2.x potassium channels
contributes to the phenotype of Andersen's syndrome. Proc Natl Acad Sci U S A.
2002;99:7774-7779.
8. Vaidya D, Tamaddon HS, Lo CW, Taffet SM, Delmar M, Morley GE, Jalife J. Null
mutation of connexin43 causes slow propagation of ventricular activation in the late
stages of mouse embryonic development. Circ Res. 2001;88:1196-1202.
9. Pond AL, Scheve BK, Benedict AT, Petrecca K, Van Wagoner DR, Shrier A,
Nerbonne JM. Expression of distinct ERG proteins in rat, mouse, and human heart.
Relation to functional I(Kr) channels. J Biol Chem. 2000;275:5997-6006.
10. Anumonwo JM, Horta J, Delmar M, Taffet SM, Jalife J. Proton and zinc effects on
HERG currents. Biophys J. 1999;77:282-298.
11. Samie FH, Berenfeld O, Anumonwo J, Mironov SF, Udassi S, Beaumont J, Taffet
S, Pertsov AM, Jalife J. Rectification of the background potassium current: a
determinant of rotor dynamics in ventricular fibrillation. Circ Res. 2001;89:12161223.
12. Shyng SL, Sha Q, Ferrigni T, Lopatin AN, Nichols CG. Depletion of intracellular
polyamines relieves inward rectification of potassium channels. Proc Natl Acad Sci
U S A. 1996;93:12014-12019.
13. Courtemanche M, Ramirez RJ, Nattel S. Ionic mechanisms underlying human atrial
action potential properties: insights from a mathematical model. Am J Physiol.
1998;275:H301-H321.
Figure 1
ATGCACGGACACAGCCGCAACGGGCAGGCCCACGTGCCCCGGCGGAAGCGCCGCAACCGC
TTCGTGAAAAAGAACGGCCAATGCAACGTCTACTTCGCCAACCTGAGCAACAAGTCGCAG
CGCTACATGGCGGACATCCTCACCACCTGCGTGGACACGCGCTGGCGCTACATGCTCATG
ATCTTCTCCGCGGCCTTCCTCGTCTCCTGGCTCTTTTTCGGCCTCCTCTTCTGGTGCATC
GCCTTCTTCCACGGTGACCTGGAGGCCGGCCCGGCGGGGACCGCGGCAGGGACCGCGGCG
GGAGGCGGCGGGGCGGCACCGGTGGCTCCCAAGCCCTGCATTATGCACGTGAATGGCTTC
CCGGGCGCCTTCCTCTTCTCGGTGGAGACGCAGACGACCATCGGCTACGGGTTCCGGTGC
GTGACGGAGGAGTGCCCGCTGGCGGTCATCGCCGTGGTGGTCCAGTCTATCGTGGGCTGT
GTCATCGACTCCTTCATGATTGGCACCATCATGGCCAAGATGGCCCGGCCCAAGAAGCGG
GCGCAGACGTTGCTGTTCAGCCACCACGCCGTCATCTCGGTGCGCGACGGCAAGCTCTGC
CTCATGTGGCGCGTGGGCAACCTACGCAAGAGCCACATTGTGGAGGCCCATGTGCGGGCC
CAGCTCATCAAGCCCTACATGACCCAGGAGGGCGAGTACCTGCCGCTGGATCAGCGGGAC
CTCAACGTGGGCTCTGACATCGGCCTGGACCGCATCTTCCTGGTCTCGCCCATCATCATT
GTCCACGAGATCGATGAGGACAGCCCGCTCTACGGCATGGGCAAGGAGGAGCTGGAGTCG
GAGGACTTCGAGGTCGTGGTCATCCTGGAGGGTATGGTGGAGGCCACGGCCATGACCACC
CAGGCCCGCAGCTCCTACCTGGCCAGCGAGATCCTGTGGGGCCACCGCTTCGAGCCTGTG
GTCTTCGAGGAGGAGAGCCACTACAAGGTGGACTACTCGCGCTTCCACAAGACCTACGAG
GTGGCCGGCACGCCCTGCTGCTCTGCCCGGGAGCTGCAGGAGAGCAAGATCACCGTGCTG
CCCGCCCCGCCGCCCCCGCCCAGTGCCTTCTGCTACGAGAACGAGCTGGCCCTCATGAGC
CAGGAGGAAGAGGAGATGGAGGAGGAGGCTGCGGCCGCTGCCGCTGTGGCTGCGGGCCTG
GGCCTGGAGGCGGGCTCCAAGGAGGAGGCGGGCATCATCCGGATGCTGGAGTTTGGCAGC
CACCTGGATCTGGAGCGCATGCAAGCCACCCTCCCGCTGGACAACATCTCCTACCGCAGG
GAGTCTGCCATCT
1
51
101
151
201
251
301
351
401
MHGHSRNGQA
VDTRWRYMLM
GGGGAAPVAP
AVVVQSIVGC
LMWRVGNLRK
RIFLVSPIII
QARSSYLASE
ELQESKITVL
GLEAGSKEEA
HVPRRKRRNR
IFSAAFLVSW
KPCIMHVNGF
VIDSFMIGTI
SHIVEAHVRA
VHEIDEDSPL
ILWGHRFEPV
PAPPPPPSAF
GIIRMLEFGS
FVKKNGQCNV
LFFGLLFWCI
PGAFLFSVET
MAKMARPKKR
QLIKPYMTQE
YGMGKEELES
VFEEESHYKV
CYENELALMS
HLDLERMQAT
YFANLSNKSQ
AFFHGDLEAG
QTTIGYGFRC
AQTLLFSHHA
GEYLPLDQRD
EDFEVVVILE
DYSRFHKTYE
QEEEEMEEEA
LPLDNISYRR
RYMADILTTC
PAGTAAGTAA
VTEECPLAVI
VISVRDGKLC
LNVGSDIGLD
GMVEATAMTT
VAGTPCCSAR
AAAAAVAAGL
ESAI
Figure 5
210 kDa
125 kDa
125 kDa
101 kDa
101 kDa
Kir2.1
Kir2.3
56 kDa
Abbreviations:
GP = guinea pig
LV = left ventricle
RV = right ventricle
LA = left atrium
RA = right atrium
56 kDa
Sheep LV
Sheep LA
Sheep RA
GP LV
GP RV
Kir2.1
Kir2.3
210 kDa
GP atria
Kir2.3
GP atria
Sheep RA
GP LV
GP RV
Sheep LV
Sheep RV
Sheep LA
Kir2.1
Kir2.3
Kir2.1
0.5
-120
-100
-80
-60
-40
-20
20
-0.5
-1.0
-1.5
-120 -100
-80
-60
-40
8
8
4
4
-20
20
-120 -100
-80
-60
-40
-20
20
-4
-4
-8
-8
-12
-12
-16
-16
Table 1.
Atrial Cells
Length (mM)
Width (mM)
Surface area (mM2)
Ventricular Cells
122.2 ± 2.0 (n = 150)
155.8 ± 2.9 (n = 58)
11.1 ± 0.2 (n = 150)
14.4 ± 0.3 (n = 58)
4499.9 ± 116.7 (n = 150)
7361.4 ± 195.3 (n = 58)
Input Resistance (GW)
0.20 ± 0.01 (n = 20)
0.04 ± 0.003 (n = 12)
Cell Capacitance (pF)
78.7 ± 3.9 (n = 20)
90.0 ± 5.9 (n = 10)
-73.4 ± 1.0 (n = 32)
-81.3 ± 1.3 (n = 10)
RMP (mV)
Properties of freshly isolated sheep atrial and ventricular cells. Myocytes were isolated from the
free walls of the atria and from the left ventricle. Surface area was calculated by assuming the shape of
a right cylinder for the isolated myocytes. Surface area was calculated from 2πr(L+r). L; length, r; cell
radius (half of cell width). Data are Mean and ± SEM.