Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of Pediatrics Allergy-Immunology Division Childrens Mercy Hospital Kansas City, Missouri Professor of Pediatrics, Medicine and Basic Science University of Missouri Kansas City School of Medicine Disclosure Statement Lanny J. Rosenwasser, MD • RESEARCH STUDIES Alcon, A-Z, GlaxoSmithKline, Genentech, Novartis MBBH/MacArthur Foundation, National Institutes of Health • CONSULTANT Alcon, , A-Z, Genentech, GlaxoSmithKline, Novartis, Regeneron, Sanofi-Aventis • SPEAKERS’ BUREAU Alcon, A-Z, Genentech, Novartis Learning Objectives •Understand the nature of Systems Biology •Examine the complex nature of Immune Response in Allergy and Asthma •Understand the applications of Systems Biology to Allergic Responses Definitions Systems Biology – Integrated basis for functionality of an Organism Immune Responses – Symphonies of Molecular and Cellular Mechanisms with each component generating a coordinated effective response Analogies - Multiple Analogies of Complex Disease Process •Symphony •Airplane •Junkyard •Radio Modeling and Simulation at Molecular Scale • Informatics – Software driven • Modeling of Signaling and Receptor Activity • Modeling of Cellular Behavior and Interactions Large Scale Data Acquisition Technologies • Cell and Molecular Biology • Proteomics, Genomics • Immunology Wet Lab Molecular Biological Tools • Gene and MiRNA Expression • Transcript Profiling • Next Generation Sequencing • RNA; Screening • Assay Design • Applications Interactional Measures • • • • • • Network Models 2 Hybrid Screens Mass Spec Proteomics Array Protein Assays Flow Cytometry Characteristics of Asthma • • • • Narrowing of the airways Airway obstruction Airway inflammation Increased airway responsiveness NHLBI, NAEPP, 1997. Environmental factors Th-2/Th-1 cytokines – eg IL-13, TNF Environmental factors and Inflammatory products Dendritic cell B lymphocyte T lymphocyte IgE IL-3, IL-5 GM-CSF IL-3, IL-4, IL-13, IL-9 TNF Mast cell Airway Effects Bronchospam Acute Inflammation Persistent Inflammation Remodeling Initiation (myo) fibroblasts Eosinophil Amplification Airway microenvironment mucus Propagation Smooth muscle Blood vessels Neutrophil Acute Inflammation Proinflammatory mediators DRAFT Persistent inflammation and development of remodeling www.nhlbi.nih.gov/guidelines/asthma/epr3/ Complexity of Asthma • Several orders of magnitude more complex • Microbiome, Proteome, Transcriptome, Genome • Tissues, Organs, Whole Body, Brain • Third and Fourth Dimensions Stepwise Approach for Managing Asthma in Patients Aged ≥12 Years Persistent Asthma: Daily Medication Intermittent Asthma Consult with asthma specialist if Step 4 care or higher is required. Consider consultation at Step 3. Step 6 Step 5 Step 4 Step 3 Step 2 Step 1 Preferred: SABA PRN Preferred: Low-dose ICS (A) Alternative: Cromolyn (A), LTRA (A), Nedocromil (A), or Theophylline (B) Preferred: Low-dose ICS + LABA (A) OR Medium-dose ICS (A) Alternative: Low-dose ICS + either LTRA (A), Theophylline (B), or Zileuton (D) Preferred: Medium-dose ICS + LABA (B) Alternative: Medium-dose ICS + either LTRA (B), Theophylline (B), or Zileuton (D) Preferred: High-dose ICS + LABA (B) AND Consider Omalizumab for Patients Who Have Allergies (B) Preferred: High-dose ICS + LABA + Oral Corticosteroid AND Consider Omalizumab for Patients Who Have Allergies Each Step: Patient education, environmental control, and management of comorbidities Steps 2-4: Consider subcutaneous allergen immunotherapy for patients who have allergic asthma Quick-Relief Medication for All Patients • SABA as needed for symptoms. Intensity of treatment depends on severity of symptoms: up to 3 treatments at 20-minute intervals as needed. Short course of systemic oral corticosteroids may be needed • Use of SABA >2 days a week for symptom relief (not prevention of EIB) generally indicates inadequate control and the need to step up treatment ICS = inhaled corticosteroids; LABA = long-acting β2-agonist; LTRA = leukotriene receptor antagonist. Adapted from National Asthma Education and Prevention Program. Expert Panel Report 3: Guidelines for the Diagnosis and Management of Asthma (EPR-3 2007). U.S. Department of Health and Human Services. Available at: http://www.nhlbi.nih.gov/guidelines/asthma/asthgdln.pdf. Accessed August 29, 2007. Step Up If Needed (first, check adherence, environmental control, and comorbid conditions) Assess Control Step Down If Possible (and asthma is well controlled at least 3 months) Anti IgE • Targets IgE, FCeRI • Rhu Mab - E25 - Omalizumab, Xolair • Reduces Free IgE (allergen specific) • Reduces Eos (sputum, BAL, blood) • Reduces FCeRI and FCeRII expression • Efficacy - Asthma, AR Biotherapeutic Targets in Immune Allergic Disorders, Anti-IgE Innate Immunity Targets IL-1, TNF, IL-6 TLR, Adhesion Molecules IFN Modulation Chemokines Acquired ImmunityTargets Th2, Th17 Cytokines IL-2, 4,5,9,13,17,25,33 Cellular DC, T, B Other Targets TSLP Adipokines Growth and Differentiation Factors IL-1 family members – Chr. 2q13 New Name Other Name IL-1F1 IL-1F2 IL-1F3 IL-1F4 IL-1F5 IL-1F6 IL-1F7 IL-1F8 IL-1F9 IL-1F10 IL-1F11 IL-1α IL-1β IL-1Ra IL-18 FIL1δ FIL-1ε IL-37 IL-1H2 IL-1ε IL1HУ2 IL-33 Property Agonist Agonist Receptor antagonist Agonist Anti-inflammatory Agonist Anti-inflammatory Agonist Agonist Receptor antagonist Agonist Extended IL-1 Family • • • • (Caspase 1 Dependent) IL-18 – shared receptor and genetics (IL-18bp) IL-32 – TNF inducer IL-33 – Ligand for ST2 Induces TH2 Cytokines IL-37 – Downregulation of IL-1 family activities IL-17 Family • 20-30 кd • IL-17A, IL-17F – profibrotic activate chemokines (IL-8) and IL-6 • IL-17E – IL-25 • IL-25 associated with eosinophilia, airways hyperresponsiveness • Genetics of IL-17 family linked to asthma Key Central Role of IL-5 in Asthma J ALLERGY IMMUNOL 2010 APR Anti-IL-5 in Human Asthma: Reduction in Exacerbations Haldar P et al. New Engl J Med 2009;360:973 Nair P et al. New Engl J Med 2009;360:985 • Severe (CCS-dependent) asthma • Sputum eosinophilia required for enrollment • No improvement in FEV1, control, symptoms Anti-IL-5 in Human Asthma: Haldar P et al. New Engl J Med 2009;360:973 Nair P et al. New Engl J Med 2009;360:985 Comparison of High Affinity vs. Low Affinity IgE Receptor (One log difference in binding) Effector Cells of Allergy/Asthma -Mast Cells -Basophils Antigen Presenting Cells (Modified from Novak, et at. JACI 2003) CD23a -B cells CD23b -Antigen Presenting Cells CD 23 as a Target for Therapy • FCe RII • 45 KD C-type Lectin • Type 2 Protein • Expressed - B-cells, APC, DC Airway Smooth Muscle FCER2 – Pleiotropic Effects FCER2 SNP G9782a12 G9782a19 G9782a26 G9782a5 G9782a8 Allele [T/G] [T/C] [C/T] [C/T] [C/A] Forest Haplotype TTCCC TCTCA GTCTA Phenotype BD % Change BD Extremes Steroid Extremes Frequency P-Value 0.06 0.03 0.05 0.05 0.13 0.02 CAMP Haplotype GTCTA GTCTA GTCTA TCTTA TTCCC Phenotype BD % Change BD % Change 1 yr BD % Change 4 yr Steroid % Ch. 1 yr Steroid % Ch. 4 yr Frequency P-Value 0.03 0.01 0.02 0.04 0.03 0.15 0.08 0.08 0.04 0.07 Global P value for Steroid % Change 1 yr = 0.001 % with Haplotype FCER2 – GCTTA Haplotype 50 45 40 35 30 25 20 15 10 5 0 Yes No Hospitalizations ER Visits p = 0.0001 (Hosp) and 0.01 (ER) CD23 GENETIC POLYMORPHISM AA seq position 62 Nucleotide Variant C to T Allele Frequency AA Change C 0.75 Arginine to T 0.25 Tryptophan Genotype of CD23 R62W in Genomic DNA (NT_011145) 3771 Nci I | 3785 3800 aagagagggctgcccggaacggtatgaagg 3771 |3785 3800 aagagagggctgcctggaacggtatgaagg ttctctcccgacgggccttgccatacttcc Agr Ttctctcccgacggaccttgccatacttcc trp 393bp 210bp 183bp R W Homo Wild type Hetero Kijimoto-Ochiai S., 2002 Tantisera et al JACI,120,1285,2007 Allergy - 2030 • Systems Biology Approach to Allergic Cascades • Biotherapeutics • Pharmacogenetic Profiling • Early Intervention Systems Medicine • • • • Predictive Preventive Pharmacologically Effective Personalized Challenges for the Future in Complex Genetic Disease Translational Research • Robust Biomarkers • Phenotype Analysis Phenotype/Genotype Association • Diagnostic/Pathologic Visualization (Nanomedicine) • Informatics Modeling References Ronald N. Germain et al. Systems Biology in Immunology – A Computational Modeling Perspective. Annu Rev Immunol. 2011 29: 537-585 David J. Weatherall . Systems Biology and Red Cells, N ENGL J MED. 2011 364; 375-77. Sydney Brenner. Sequence and consequences. Phil. Trans. R. Soc. B 2010 365,207-212. Acknowledgments Children’s Mercy Hospital & Clinics Jianfeng Meng Marcia A. Chan Brianna May Nicole Gigliotti Sharrion Russell