Download Animal procedures and experimental protocol

Supplemental Data
Animal procedures and experimental protocol
A thoracotomy performed at the fourth left intercostal space under anaesthesia (Zoletil 100,
50mg/kg im), the heart was rapidly exposed and the left anterior descending coronary artery was
ligated with 6-0 mononylon thread while the EKG was continuously recorded to monitor ST
changes and arrhythmias. Standard post-MI care, including analgesics and antibiotics, were
provided and the rats were housed in single cage to allow fully recovery.
Global and Regional LV function
Short and long axis two-dimensional views and M-mode at the level of the infarcted area were
analyzed in real-time and recorded for off-line analysis. Anterior and posterior end-diastolic and
end-systolic wall thicknesses and left ventricular (LV) internal dimensions were measured, as
recommended by the American Society of Echocardiography (1). Ejection fraction (EF, %) and
fractional shortening (FS, %) of the LV internal diameter were used to quantify LV systolic
function. Regional contractile function was assessed by measuring the LV end-systolic wall
thickening (ESTHK, %) in the infarct border (BZ) and remote zone (RZ) in short and long axis
view.
Histological and immunohistochemical analysis
Myocardial wall thickness was measured in hematoxylin and eosin slices, while Masson’s
trichrome stained sections were used to quantify the percentage of fibrosis by computer based
morphometry analysis (IMT 50, Leica Microsystems). For quantitative immunohistochemical
analysis, images were digitalized through a video camera (JVC 3CCD video camera, KY-F55B)
connected with a Leitz Diaplan light microscope; original images of the region of interest were
taken at 100 of magnification and analyzed using the Image-Pro Plus® 4.5 software (Media
Cybernetics, Inc.). The density of capillaries per ring was determined randomly by enumerating
six square fields of 1mm2. Six randomly chosen microscopic fields for each LV ring were
captured and the number of TUNEL-positive cardiomyocyte nuclei was calculated as a fraction
of total cardiomyocyte nuclei in each microscopic field. The fractions of TUNEL-positive nuclei
determined for each microscopic field were averaged and results are presented as means plus
minus SEM (n=number of fiels counted).
Mitochondria isolation
Cardiac tissue was homogenized in buffer containing 10mM Hepes, 200mM mannitol, 70mM
sucrose and 1mM EGTA (PH 7.5) and centrifuged at 1000g at 4°C for 5 min. The supernatant
was collected and centrifuged at 11000g at 4°C for 10 min. The pellet was suspended in storage
buffer at pH 7.5 containing 10mM HEPES, 250mM sucrose, 1mMATP, 0.08mM ADP, 5mM
sodium succinate, 2mM K2HPO4 and 1mM DTT and stored at -80°C until use. An aliquot of the
suspended pellet was assayed for protein content with the BioRad protein assay kit.
Mitochondrial enzyme activity assays
To measure COX-1 activity, isolated mitochondria were preincubated for 10 min on ice in
enzyme dilution buffer (10mM Tris-HCl, pH 7.0 containing 250 mM sucrose and 1 mM ndodecyl-b-D-maltoside). Thereafter, 1-2 g of mitochondria, diluted to 100 l with enzyme
dilution buffer without n-dodecyl-b-D-maltoside, were mixed with 950 ml of assay buffer (10
mM Tris-HCl, pH 7.0 containing 120 mM KCl) and 50 l of ferrocytochrome c substrate
solution (0.22 mM); decrease in 550 nm absorbance was followed, the difference in extinction
coefficients (DemM) between reduced and oxidized cytochrome c being 21.84. To measure CS
activity, isolated mitochondria were diluted in celLytic MT Cell Lysis reagent (SIGMA).
Thereafter, in 1 ml cuvette, 2 g of mitochondria (4 l) were mixed with 926 l assay buffer, 10
l of 30mM acetyl CoA solution and 10 l of 10 mM 5,5’-dithiobis-(2-nitrobenzoic acid)
(DTNB); the increase of absorbance at 412nm was followed for 1.5 min. to measure baseline
reaction, endogenous levels of thiol or deacetylase activity. Thereafter 10 l of 10mM
oxaloacetic acid solution was added to the well to initiate the reaction; the increase of
absorbance at 412 nm was followed for 1.5 min. to measure total activity.
mtDNA quantification
Mitochondrial DNA (mtDNA) was co-purified with genomic DNA from neonatal rat
cardiomyocytes using the DNeasy kit (QIAGEN), Ct values determined for mitochondrial
cytochrome c oxidase subunit II (MTCO2) gene encoded by mtDNA and 18S rRNA gene
encoded by the nuclear DNA, and the relative mtDNA copy number calculated by normalizing
to 18S rRNA gene copy number.13 Primer sequences for MTCO2 and 18S rRNA are provided
below:
MTCO2,
F 5’-CCATAGGGCACCAATGATACTG -3’,
R 5’-AGTCGGCCTGGGATGGCATC-3’;
18S rRNA,
F 5’-CTTAGAGGGACAAGTGGCGTTC-3’;
R 5’-CGCTGAGCCAGTCAGTGTAG-3’.
Quantitative Real time RT PCR
For first-strand cDNA synthesis, 1 μg total RNA was reverse-transcribed in a 20-μl volume
using the iScript cDNA Synthesis kit according to the manufacturer’s instructions (BioRad,
Milan, Italy). Primers for target genes were designed by Primer 3 Input (v.0.4.0) software. PCR
amplification was performed in triplicate in a total reaction volume of 20 μl. The reaction
mixture consisted of 1 μl cDNA, 2 μl of 1X Light-Cycler-FastStar DNA Master SYBR Green I
mix (Roche Diagnostics), 3 mM MgCl2, and 0.5 μM of primers (Roche Diagnostics). PCR was
performed with 10 min of initial denaturation and then 40 cycles with 10 s at 95°C
(denaturation), 7 s at 58°C (annealing), and 13 s at 72°C (extension). After amplification, a
melting curve analysis from 65°C to 95°C with heating rate of 0.1°C/s with a continuous
fluorescence acquisition was constructed. Threefold dilutions (1:3 to 1:27) were analysed for
each target gene and reference gene and allowed us to generate standard curves for each gene.
For the relative quantification of samples, the Light-Cycler Relative Quantification Software was
utilized. Results were expressed as the target-to-reference ratio of each sample, normalized by
the target-to-reference ratio of the calibrator. In the present data, the coefficient of variation in
measurements for the target gene in each sample ranged 0–10%.
References
1. Sahn DJ, De Maria A, Kisslo J, Weyman A. Recommendations regarding quantitation in
M-mode echocardiography: results of a survey of echocardiographic measurements.
Circulation 1978; 58:1072-1083.
Figure Legends
Figure 1. Measures of circulating FT3 (A) and TT3 (B) levels before (Normal), 72hours postcoronary ligation (72h MI) and after 1, 2, 3, 4 weeks of experimental T3 treatment. T3
supplementation at 0.5 or 1.2 g/kg/day in rodents with myocardial infarction began 72 hours
after coronary ligation by osmotic pump. Values are means ± SEM; n=4 animals per group.
*P<0.05 vs Normal; #P<0.05 vs 0.5g/kg/day at the same experimental condition; †P<0.05 vs
72h MI.
Figure 1
Table 1. Oligonucleotides sequences
mRNA
PGC-1
Forward (682-701)
Reverse (792-774)
Oligonucleotide sequence
GeneBanK Locus
5’cgatgaccctcctcacacca 3’
5’ ttggcttgagcatgttgcg 3’
BC066868.1
HIF-1
Forward (1968-1990)
Reverse (2086-2064)
5’atgaccactgctaaggcatcagc 3’
5’ aggttaaggctccttggatgagc 3’
NM024359.1
Mt-TFA
Forward (522-542)
Reverse (696-676)
5’ gaaagcacaaatcaagaggag 3’
5’ ctgcttttcatcatgagacag 3’
AB014089.1
-Actin
Forward (471-491)
Reverse (551-531)
5’ agccatgtacgtagccatcca 3’
5’ tctccggagtccatcacaatg 3’
NM031144.2
PGC-1 peroxisome proliferator activated receptor gamma coactivator–1alpha; HIF-1
hypoxic inducible factor-1alpha; Mt-TFA, mitochondrial transcription factor A. The numbers in
parentheses indicate the position in the reported sequences.