Download Mechanism of action and morphologic changes in the alveolar bone

ORIGINAL ARTICLE
Mechanism of action and morphologic changes in
the alveolar bone in response to selective alveolar
decortication–facilitated tooth movement
S. Susan Baloul,a Louis C. Gerstenfeld,b Elise F. Morgan,c Roberto S. Carvalho,d Thomas E. Van Dyke,e
and Alpdogan Kantarcif
Boston, Mass
Background and Purpose: The aim of this study was to test if corticotomy-induced osteoclastogenesis and
bone remodeling underlie orthodontic tooth movement and how selective alveolar decortication enhances the
rate of tooth movement. Materials and Methods: A total of 114 Sprague-Dawley rats were included in 3
treatment groups: selective alveolar decortication alone (SADc); tooth movement alone (TM); and “combined”
therapy (SADc 1 TM). Surgery was performed around the buccal and palatal aspects of the left maxillary first
molar tooth and included 5 decortication dots on each side. Tooth movement was performed on the first
molar using a 25-g Sentalloy spring. Measurements were done at baseline (day 0: no treatment rendered)
and on days 3, 7, 14, 21, 28 and 42. Microcomputed tomography, Faxitron analyses, and quantitative realtime polymerase chain reaction (q-PCR) of expressed mRNAs were used to assess changes. Results: The
combined group showed increased tooth movement (P 5 0.04) at 7 days compared with the tooth movement
group with significantly decreased bone volume (62%; P 5 0.016) and bone mineral content (63%; P 5
0.015). RNA markers of osteoclastic cells and key osteoclastic regulators (M-CSF [macrophage colonystimulating factor], RANKL [receptor activator of nuclear factor kappa-B ligand], OPG [osteoprotegerin],
calcitonin receptor [CTR], TRACP-5b [tartrate-resistant acid phosphatase 5b], cathepsin K [Ctsk]) all showed
expression indicating increased osteoclastogenesis in the combined group. RNA markers of osteoblastic
cells (OPN [osteopontin], BSP [bone sialoprotein], OCN [osteocalcin]) also showed increased anabolic
activity in response to the combination of alveolar decortication and tooth movement. Conclusions: The data
suggest that the alveolar decortication enhances the rate of tooth movement during the initial tooth displacement
phase; this results in a coupled mechanism of bone resorption and bone formation during the earlier stages of
treatment, and this mechanism underlies the rapid orthodontic tooth movement. (Am J Orthod Dentofacial
Orthop 2011;139:S83-101)
a
Resident, Department of Orthodontics and Dentofacial Orthopedics, Boston
University Goldman School of Dental Medicine, Boston, Mass.
b
Professor of Orthopedic Surgery, Boston University School of Medicine, Boston,
Mass.
c
Associate professor of Mechanical Engineering, Boston University, Boston,
Mass.
d
Assistant professor, Department of Orthodontics and Dentofacial Orthopedics,
Boston University Goldman School of Dental Medicine, Boston, Mass.
e
Professor, Department of Periodontology and Oral Biology, Boston University
Goldman School of Dental Medicine, Boston, Mass.
f
Alpdogan Kantarci, Associate Professor, Department of Periodontology and Oral
Biology, Boston University Goldman School of Dental Medicine, Boston, Mass.
Dr. S. Susan Baloul is the recipient of the 2010 Milo Hellman Research Award.
The authors report no commercial, proprietary, or financial interest in the
products or companies described in this article.
Reprint requests to: Alpdogan Kantarci, Department of Periodontology, Forsyth
Institute, 245 First Street, Cambridge, MA 02142; e-mail, [email protected].
Submitted, March 2010; revised and accepted, September 2010.
0889-5406/$36.00
Copyright Ó 2011 by the American Association of Orthodontists.
doi:10.1016/j.ajodo.2010.09.026
H
istorically, orthodontic tooth movement was described as a site-specific bone remodeling and
consists of coupled bone resorption and bone
formation.1 The mechanical basis of orthodontic
treatment is the application of force (stimuli) to the teeth
using an appliance. This, in turn, leads to biologic reactions, including remodeling changes in the dental and
periodontal tissues.2
Biologically, tooth movement has 2 fundamental
requirements: (1) periodontal ligament (PDL) between
the tooth and alveolar bone and (2) bone turnover. In
response to orthodontic force, the PDL mediates the mobility of the tooth in the alveolus.3 The bone is temporarily and spatially regulated, facilitating the movement of
teeth.4 Application of force during orthodontic tooth
movement leads to osteoclastogenesis characterized
by tissue damage with production of inflammatory
S83
Baloul et al
S84
mediators in the PDL and alveolar process deformation.
A few days after force application, the first osteoclast
progenitor cells appear at the compression sites in the alveolar crest vasculature and marrow spaces, and the PDL
space widens. Osteoclasts appear in higher quantity at
the compression sites compared with tension sites.5
While the pathologic aspect of inflammation certainly does not represent the physiologic response to
the mechanical forces by the alveolar bone during the
orthodontic therapy, pathways inherent to inflammatory
processes regulate the bone turnover, soft and hard tissue reactions, and the healing process. Proinflammatory
cytokines such as interleukin-6, interleukin-8, and
tumor necrosis factor-a are produced at this stage,
which supports the notion that the pathways of inflammation initiate the osteoclastogenesis during tooth
movement.6,7 Osteoclastic activity is characterized by
changes in tooth-supporting tissue biomarkers of receptor activator of nuclear factor (RANK), RANKL, and OPG
during tooth movement. RANKL expression is increased
in response to compressive forces and mediated by prostaglandin E2.8 RANKL mediates osteoclastogenesis and
tooth movement, and its actions are antagonized by
OPG. Osteoclastic activity is coupled with osteogenesis,
where the type of orthodontic force determines the
osteoblast recruitment and tensile strains determine
the osteogenic activity. Tensile strains stimulate the
proliferation of the osteoblast progenitor cells in the
PDL, leading to bone formation and inhibition of bone
resorption.
Various methods have been tested to enhance the
rate, magnitude, and stability of the tooth movement.
While the history of intentional wounding of the alveolar
bone to enhance the speed of the tooth movement dates
back to the late 19th century, K€
ole9 reintroduced the
corticotomy procedure to orthodontic therapy. He proposed that by disturbing the continuity of the cortical
layer, tooth movement would increase dramatically as
a “bony block” with several teeth embedded. This technique was not widely accepted because of its invasive
nature, but it was tested in various experimental models
with some modifications.10-12 More recently, accelerated
osteogenic orthodontics has been introduced as
a combination of ideas from previous corticotomyfacilitated tooth movement, along with periodontal
therapy including alveolar bone augmentation, allowing
the selective alveolar decortication in areas of desired
tooth movement.13,14
It was proposed that the coupling between demineralization and remineralization during corticotomyfacilitated tooth movement therapy was due to a regional
acceleratory phenomenon and not as a net result of bony
“block” movement.13 Following the observation that
April 2011 Vol 139 Issue 4 Supplement 1
bone resorption occurs following the periosteal flap surgery15; rapid mineral release was hypothesized to occur
during the earlier weeks after the surgery followed by resorption of the bone organic matrix, release of calcium,
and occurrence of localized osteoporosis. However,
while the clinical protocols have been well defined and
successful outcomes have been reported, the biologic
mechanism underlying the corticotomy-assisted tooth
movement is not understood.
A recent rat model studying the biologic mechanisms
underlying the corticotomy process in vivo demonstrated that bone turnover followed the alveolar decortication, suggesting that a periodontium-mediated
Regional Acceleratory Phenomenon (RAP) accompanies
the decortication. Enhancement of the PDL activity
and a dominant role by the spongiosa suggested that
tooth movement could be the result of increased turnover rate in alveolar bone.16
We have hypothesized that SADc-induced osteoclastogenesis and bone remodeling underlie the orthodontic
tooth movement, where alveolar decortication enhances
the rate of tooth movement by increasing bone remodeling compared with conventional tooth movement.
Thus, the aims are (1) to study the rate of tooth movement after orthodontic treatment with or without
SADc, (2) to examine the alveolar bone structure after
orthodontic tooth movement with or without SADc
using MicroCT, (3) to analyze the osteoclastic and
osteoblastic activities in selective alveolar decorticationfacilitated tooth movement at the molecular level, and
(4) to assess the temporal relationships in the expression
of regulatory genes that control bone formation and
remodeling.
MATERIAL AND METHODS
Study design
The study included a total of 114 Sprague-Dawley
(Crl:CD) rats obtained from Charles River Laboratories,
Mass. The study protocol was approved by the Institutional Animal Use and Care Committee. All animals
were housed at the Laboratory Animal Science Center
where all procedures, including surgery, orthodontic appliance application, orthodontic appliance removal, and
euthanasia were performed. A 12-hour light cycle was
maintained during the period of observation, and a regular hard diet was supplied. The animals were anesthetized intraperitoneally with a mixture of anesthetic
solution (100 mg/kg of ketamine hydrochloride [Ketaset
III; Injectable, 100 mg/mL, Fort Dodge Animal Health,
Fort Dodge, Iowa], 4 mg/kg of xylazine hydrochloride
[AnaSed; Injectable, 20 mg/mL, Lloyd Inc., Shenandoah,
Iowa], and 0.9% sodium chloride solution [Hospira Inc.,
American Journal of Orthodontics and Dentofacial Orthopedics
Baloul et al
Lake Forest, Ill]). During the surgery, animals were
closely monitored and a heating pad was placed under
the operation field to avoid body temperature loss. Observations were made at baseline (day 0: no treatment
rendered) and days 3, 7, 14, 21, 28, and 42. Table I summarizes the distribution of the animals among different
groups and subgroups with the corresponding observation periods; Figure 1 represents the study design and
timeline.
S85
Table I. Study design*
Time
(Days)
0
3
7
14
Clinical procedures
Selective alveolar decortication was performed first
by making a sulcular incision from the mesial aspect of
the maxillary left first molar, which extended 5 mm
(measured by a periodontal probe) in a mesial direction
from the tooth line-angle extending to the edentulous
soft tissue space adjacent to the molar. Full-thickness
flaps were then elevated on the buccal and palatal
aspects. Using a slow-speed hand piece and a small
No. 1/4 round bur (Buffalo Dental Manufacturing, Syosset, NY), 5 intramedullary decortication marks—each
0.25-mm wide and 0.25-mm deep corresponding to
the size of the bur—were made on both the buccal and
palatal sides under water irrigation. Drilling was done
where the 0.25-mm bur was fully immersed into bone
(for every decortication mark). Flaps were sutured with
simple interrupted bioresorbable 6–0 chromic gut
sutures (ACE Surgical Supply Inc., Brockton, Mass).
Primary closure was achieved for primary tissue healing.
Orthodontic tooth movement was performed on the
left side of the maxilla. The original technique was first
described by Verna.17 We modified the model to achieve
stability over the course of the study period. Force was
applied to the maxillary left first molar using an ultralight (25 g) superelastic NiTi (Sentalloy) closed coil
spring with eyelets (GAC International, Bohemia, NY) between the left maxillary first molar and the maxillary incisors. A retentive groove was made using a 1/4 round
bur in a slow-speed hand piece. The groove connected
the linear mesial angles of the first molar. Another retentive groove was made on the central incisors placed as
close to the gingiva as possible on the lateral surface
of the central incisor continuing to the buccal surface
of the incisors and ending on the lateral surface of the
contralateral incisor. A 0.010-in stainless steel ligature
wire (GAC international, Bohemia, NY) was inserted under the contact point of the first and second maxillary
left molars palatal and pulled from the buccal using
a Mathieu forceps. The ligature wire was then wrapped
around the first molar under the retentive groove, and
the distal eyelet of the coil spring was engaged into
the palatal end of the ligature wire. The ligature wire
21
28
42
Total
Subgroup
Baseline controls
SADc
TM
SADc 1 TM
SADc
TM
SADc 1 TM
SADc
TM
SADc 1 TM
SADc
TM
SADc 1 TM
SADc
TM
SADc 1 TM
SADc
TM
SADc 1 TM
Faxitron,
Micro-CT
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
57
Molecular
markers (RNA)
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
57
114
*Table summarizes the study design and animal numbers in each
group. Half of the animals were used in microcomputed tomography
(MicroCT), and Faxitron analyses and the rest were used for molecular biology studies (RNA isolation and real-time PCR). Timeline included baseline observation, where no procedures were performed,
and 3, 7, 14, 21, 28 and 42 days of active tooth movement. Nine
animals were used at each time point and 3 treatment groups
were defined: selective alveolar bone decortication only (SADc),
tooth movement only (TM), and combination of selective alveolar
bone decortication with tooth movement (SADc 1 TM).
was then tied against the mesial site of the first molar securing the distal end of the coil spring to the mesiopalatal angle of the first molar. Another stainless steel
ligature wire was inserted into the mesial eyelet of
the coil spring, snapped between the 2 incisors, wrapped around the incisors in a double figure-8 tie running under the retentive groove, and then tied
against the buccal surface of the incisors. This was
used to secure the closed coil spring against the palatal
surface of the incisors.
To ensure the stability of the ligature wire in the anterior area, a 1.5-mm-diameter 4-mm-long titanium
miniscrew (Neuro MD screw, KLS Martin LP, Jacksonville, Fla) was inserted through the mesial eyelet of the
coil spring palatal to the incisors into the maxillary
bone, avoiding the palatal bony suture. Flowable composite bonding material (Henry Schein Inc., Melville,
NY) was placed over the ligature wire on the mesialbuccal-distal aspects of the incisor teeth. This was
done to prevent appliance loss and protect the animal’s
lips from damage by the ligature.
American Journal of Orthodontics and Dentofacial Orthopedics
April 2011 Vol 139 Issue 4 Supplement 1
Baloul et al
S86
Fig 1. Study design and timeline. This figure represents the total number of animals used in the study:
equally divided into Group A (descriptive studies: Faxitron and MicroCT analyses) and Group B (molecular biology real-time PCR studies). Furthermore, each group (A and B) was subdivided into 3 experimental treatment groups: selective alveolar decortication alone (SADc), tooth movement alone
(TM), and combination of selective alveolar decortication and tooth movement (SADc 1 TM). Time
line included baseline observation, where no procedures were performed, and 3, 7, 14, 21, 28 and
42 days of active tooth movement. Nine animals were used at each time point (n 5 3 for each treatment
group).
Prior to placement of the bonding material, the incisors were etched using a self-etching primer (Transbond
plus, 3M Unitek, Monrovia, Calif). The bonding material
was then light cured. This model resulted in delivering
a continuous 25-g mesial force to the left maxillary first
molar, with an absolute anchorage resulting from the
use of the miniscrews. The 25-g continued force was measured by an internal dial caliper gauge at the initial day of
the procedure and the force was remeasured using the caliper gauge prior to complete removal of the appliance on
the day of sacrifice. Our measurements showed consistent
force delivery of 25 g throughout the treatment period.
(Olympus, Center Valley, Pa). It consisted of the following linear variables measured from the posterior nasal
spine and palatal midline (Fig 2):
1.
2.
3.
4.
Anterior-posterior (mesial-distal) length measurements
Transverse tooth-width measurements
Space created by mesial movement of right first
molar (distance)
Rate of tooth movement (distance/time, calculated
from measurements).
Microcomputed tomography
Faxitron-assisted assessment of tooth movement
Two-dimensional radiographic Faxitron imaging has
been widely used in animal research for studying the
specimen without distortion. In this study, terminal
Faxitron x-ray images (Faxitron X-Ray Corp. Wheeling,
Ill) were taken after the harvest of the maxillae. The
images were taken at 3x magnification with 35 kV for
45 seconds’ exposure on XAR-5 Kodak film (Kodak,
Rochester, NY). Data obtained from Faxitron images
was analyzed using Olympus MicroSuite five software
April 2011 Vol 139 Issue 4 Supplement 1
Microcomputed tomography (MicroCT) was used as
a tool to study the structural changes, which occurred
in bone in 3 dimensions. Samples were immersed in
Accustain formalin solution 10% neutral buffered
(Sigma-Aldrich Inc., St. Louis, Mo, USA) during scanning
in order to minimize decomposition of the tissue
throughout the duration of the scan. Scans were performed using a Scanco mCT 40 system (Scanco Medical,
Bassersdorf, Switzerland). Total mineral density was calculated by converting the grayscale output of bone
American Journal of Orthodontics and Dentofacial Orthopedics
Baloul et al
S87
Fig 2. Faxitron analysis: A, Graphic presentation of Faxitron analysis of amount of tooth movement
distance in response to TM and SADc 1 TM during tooth movement. B, Graphic presentation of
Faxitron analysis of tooth movement rate in response to TM and SADc 1 TM during tooth movement.
C, Illustration of Faxitron analysis linear lines made for measurement of tooth movement distance.
D, Table showing P values.
voxels in Hounsfield units (HU) to mineral values (mg/
mL of hydroxyapatite) through the use of a calibration
phantom containing air, water, and hydroxyapatite
(SB3; Gammex RMI, Middleton, Wis, USA). Total mineral
density was defined as the average bone voxel HU value
divided by the average HA phantom HU value multiplied
by 1130 mg/mL (hydroxyapatite physical density). The
same calibration phantom was used in each scan to
normalize mineral density measurements and to account
for possible variability among scan sessions.
Scans were performed at a resolution of 36 mm/voxel.
Samples were filtered to remove extraneous voxels using
a gaussian smoothing algorithm and individually adjusted using a standard threshold algorithm to segment
bone and nonbone voxels.18 Adjusted MicroCT images
were used to measure mineralized tissue surrounding
the maxillary first molar. In order to measure the mineral
bone only, with exclusion of tooth-mineral structure, a region of interest was isolated using the contouring option.
The bone area found in between the 5 roots of the maxillary first molar was defined as region of interest (ROI).
Measurements of the bone (total volume) and density (volume fraction and mineral density) were made directly from
the MicroCT image data of each specimen. The following
measurements were obtained from the MicroCT scanning:
TV: The total volume of tissue enclosed by the contours that were measured
BV: The volume of the voxels that were above the
threshold (8192), that is, the volume of mineralized
tissue and therefore considered to be bone.
BV/TV: Bone volume fraction: the ratio of bone volume to total volume; this parameter is described as
a percentage of the total volume that is bone
American Journal of Orthodontics and Dentofacial Orthopedics
April 2011 Vol 139 Issue 4 Supplement 1
Baloul et al
S88
Table II. Probes used in this study from Applied Biosystems*
Gene
b-Actin
Calcitonin R
Cathepsin K
Osteocalcin
Osteoprotegrin
RANKL
Gene Symbol
Actb
Calcr
Ctsk
Bglap
Tnfrsf11b
Tnfsf11
UniGene ID
Rn.94978
Rn.10062
Rn.5598
Rn.9722
Rn.202973
Rn.217570
Reference Number
NM_031144.2
NM_053816.2
NM_031560.2
NM_013414.1
NM_012870.2
NM_057149.1
Primer Sequence
CCTTCCTTCCTGGGTATGGAATCCT
CCGGACTTTGACCCAACAGAAAAGG
ATAATTAAAAACAGCTGGGGAGAAA
CTGACAAAGCCTTCATGTCCAAGCA
CTGTGCACTCCTGGTGTTCTTGGAC
GCCGACATCCCATCGGGTTCCCATA
*Table represents gene probes purchased from Applied Biosystems and their pertinent information, including primer sequences.
BMD: The average mineral density of only those voxels above the threshold (ie, voxels that are considered
to be bone tissue)
BMC: The average mass of bone mineral over those
voxels above the threshold and therefore considered
to be bone.
RNA isolation from the alveolar bone
mRNA isolation was prepared from each animal
around the maxillary molar area harvested. The boundaries of the collected bone area was a box-like configuration that measured 5 mm mesial to the maxillary
molar, the exact distal area of the molar, 5 mm palatal
bone, and 5 mm buccal bone. In addition, the box
enclosed the root apex. The specimens were powdered
in liquid nitrogen using a mortar and pestle. mRNA
was extracted using QIAzol Lysis Reagent (QIAGEN
Inc., Valencia, Calif). RNeasy Lipid Tissue Mini Kit
(QIAGEN Inc., Valencia, Calif) was used to purify the
RNA as described by the manufacturer. Quantification
of mRNA was determined using NanoDrop 1000 (Thermo
Fisher Scientific, Wilmington, Del). mRNA sample integrity was verified by visualization of ribosomal RNA with
Gelstar Nucleic Acid Stain (Cambrex Bioscience Rockland
Inc., Rockland, Me) after denaturing RNA gel electrophoresis. mRNA samples were stored at 80 C until use.
RNAse-free water (American Bioanalytical, Natick, Mass)
was used for all dilutions during procedures.
Quantitative mRNA expression by q-PCR for
detection of osteoclastic and osteoblastic activity in
alveolar bone
To study osteoclastic and osteoblastic activities, we
analyzed 9 markers at mRNA level by q-PCR. The
markers were grouped by function into 3 categories:
1.
Osteoclast regulation markers
M-CSF
OPG
RANKL
April 2011 Vol 139 Issue 4 Supplement 1
2.
Osteoclast activity markers
TRACP 5b
Cathepsin K (Ctsk)
Calcitonin receptor (CTR)
3.
Osteoblast markers
Osteopontin (OPN)
Bone sialoprotein (BSP)
Osteocalcin (OCN)
All reagents for the q-PCR analysis were from
Applied Biosystems, and plate assays were read on an
ABI 7700 Sequence Detector (Applied Biosystems,
Foster City, Calif). One microgram of total RNA was
used for each preparation of cDNA. All cDNA preparations were generated by random hexamer priming.
External and internal primers for ß-actin, CTR, Ctsk,
OCN, OPG, and RANKL were purchased from commercial sets available from Applied Biosystems Inc. Pertinent sequence information and amplicon sizes for
each target gene are presented in Table II. In addition,
we designed our own primers and probes for the
markers, which were not available at Applied Biosystems. These (BSP, M-CSF, OPN, and TRACP 5b) were
purchased from either Sigma-Aldrich or Invitrogen
(Table III). Each plate contained 2 negative controls
and a positive control probe. The endogenous control
b-actin was used in all experimental samples for normalization and quantification of each target sequence.
All samples were run in triplicate. The fractional cycle
number at which the fluorescence passed the fixed
threshold (CT values) was used for quantification by
using a comparative CT method. Sample values were
normalized to the threshold value for b-actin (Actb)
for each time point: DCT 5 X CT (exp) – X CT (Actb).
The CT value for baseline (day 0) was used as a reference
in the following formula: DDCT 5 X CT (exp) X CT
(control day 0). The fold change in mRNA expression
for each time point was plotted in a graph using day
0 as a reference: 2 DDCT (baseline at day 0) 5 1.
American Journal of Orthodontics and Dentofacial Orthopedics
Baloul et al
S89
Table III. Primers custom-designed and used in this study
Gene
BSP
M-CSF
OPN
TRACP 5b
Forward Sequence
TGACGCTGGAAAGTTGGAGTTAG
CCGACACAGGCTCTTCTATTCAG
GGAGCGGTCGGATGCTATC
TGCATGACGCCAATGACAA
Statistical analysis
The data for both the control and experimental
groups were presented as means. Two independent and
blinded investigators at different time points evaluated
the Faxitron data. MicroCT measurements were repeated
3 times by the same investigator at different time points.
The average of the 3 measurements was reported in the
final results. q-PCR measurements were all done in
triplicate, and all assays were repeated twice. The level
of significance was P \0.05 for all data analyzed.
One-way analysis of variance (ANOVA) using the effect
of time, treatment, and the interaction between time
and treatment was used. When applicable, a post hoc
least significant difference (LSD) test was used to identify
significant differences between the means. As a nonparametric alternative to the 1-way independent samples
ANOVA, a Kruskal-Wallis test was performed. We observed no differences between the 2 tests. Therefore,
we elected, with a consultation with statisticians, to use
1-way ANOVA for our study. SPSS 16.0.1 (SPSS Inc.,
Chicago, Ill) software was used for all statistical analysis.
RESULTS
Magnitude and rate of tooth movement
The impact of alveolar decortication on tooth movement was initially assessed via Faxitron analysis. Two
variables were measured. First, we examined the amount
of tooth movement that occurred in both the tooth
movement (TM) and combined (SADc 1 TM) groups.
Second, we calculated the rate of tooth movement in
TM and SADc 1 TM. In terms of the amount of tooth
movement, our results illustrated that the SADc 1 TM
group showed a steady increase beginning from baseline
up to 21 days. The amount of tooth movement was
higher at 7 days in the SADc 1 TM group compared
with the TM group (Fig 2, A; P 5 0.04). In contrast,
the TM group demonstrated a fluctuation reflecting
the typical characteristics of tooth movement phases beginning with an initial displacement (seen as an increase
between 7 and 14 days), followed by a lag phase (decrease between 14 days to 28 days), and then a continuous tooth movement (increase between 28 days and 48
days). TM and SADc 1 TM demonstrated similar tooth
Reverse Sequence
GCCTTGCCCTCTGCATCTC
CAGCCAGCAAGACTAGGATGA
TCGTGGCTCTGATGTTCCA
GAGGGCACGGTCAGAGAAC
movement displacement (amount of movement and
rate) between 28 and 42 days. Rate of tooth movement
illustrated an early, sharp increase in the SADc 1 TM
group compared with the TM group for the first 7
days. This was significantly higher compared with the
TM group (Fig 2, B; P 5 0.04). The TM group showed
a similar sharp increase 7 days later (at 14 days) compared with the SADc 1 TM group. Alveolar decortication
appears to keep the rate of tooth movement at a high
steady level during the initial force application for part
of tooth movement. The TM group showed a dramatic
decrease in tooth movement rate by 21 days. The effect
of alveolar decortication on tooth movement seems to
diminish by 28 days; SADc 1 TM and TM groups had
a similar tooth movement rate between day 28 and
end of therapy at 42 days (Fig 2, D).
Structural changes in alveolar bone
In order to determine how alveolar decortication affects the bone during tooth movement, we next examined the overall bone structure and mineral content by
MicroCT. Representative MicroCT images of the first molar and surrounding area are shown in Figure 3. The bone
volume, which is defined as total volume of voxels above
a density threshold, was found to be significantly decreased ( 62%) in the combined group by 14 days compared with the baseline, (P 5 0.016), but BV was
increased to higher levels than baseline by 42 days
(130%). In comparison, the TM group demonstrated
a significant decrease ( 65 %) by 21 days, 1 week after
the SADc 1 TM group (P 5 0.013), and restored to levels
close to baseline (16%) by 42 days. Selective alveolar decortication by itself resulted in no effect on BV until 21
days (133% bone formation). Overall, there were no
significant differences between the TM and SADc 1
TM groups at any given time point regarding the BV
(Fig 4, A). The SADc group showed no significant
changes in BV. In addition, MicroCT analysis showed
that SADc 1 TM resulted in a proportional and significant reduction in the overall ratio of bone volume–to–
total volume (BV/TV) 7 days after treatment ( 55%;
P 5 0.010 vs baseline) and at 14 days ( 44%; P 5
0.039). BV/TV was restored to baseline levels by 28
days in the SADc 1 TM group (18%). Tooth movement
American Journal of Orthodontics and Dentofacial Orthopedics
April 2011 Vol 139 Issue 4 Supplement 1
Baloul et al
S90
Fig 3. Representative MicroCT images of first molar and surrounding area in ROI. Images were obtained from baseline, SADc, TM, and SADc 1 TM groups during 14 days and at end of active tooth
movement phase at 42 days. Top row images represent teeth from buccal side. Middle row images
represent teeth from occlusal surface. Reconstructed images (bottom row) were cut at CEJ level to
show bone between 5 roots of maxillary first molar. Yellow arrows indicate space created between first
and second molars as seen in buccal and occlusal views. Yellow arrows in CEJ view depict bone
changes around roots of first molar.
alone demonstrated a decrease in BV/TV as well, but the
change was not statistically significant compared with
the baseline. The difference between the SADc 1 TM
( 55%) and TM ( 18%) groups showed a strong trend
toward statistical significance at 7 days (P 5 0.075).
While there was a decrease in the BV/TV in the SADc
group, the difference was not statistically significant
compared with the baseline. Interestingly, the SADc
group showed a significant increase in BV/TV between
day 28 (119%) and day 42 (122%; P 5 0.045) (Fig 4, B).
To examine the mineralization associated with alveolar decortication combined with tooth movement, we
analyzed bone mineral content (BMC) and bone mineral
density (BMD). In terms of bone mass (BMC), the
April 2011 Vol 139 Issue 4 Supplement 1
combined group demonstrated a decrease starting at 7
days ( 49%; P 5 0.056). This decrease was statistically
significant by 14 days ( 63%; P 5 0.015) and restored
to levels greater than baseline (day 0) at 42 days (122%).
Tooth movement alone exhibited a significant decrease
compared with baseline in BMC at a later stage, 21
days, ( 64%; P 5 0.015). The BMC was restored to
levels close to baseline by the end of the study at 42
days (19%). SADc by itself did not affect the BMC while
an increase was observed at 42 days (145%) compared
with SADc at 7 days ( 6%; P 5 0.049) (Fig 4, C).
In terms of BMD, there were no statistical significant
changes among the 3 procedures at any time point. The
BMD fluctuated in response to TM and SADc 1 TM, but
American Journal of Orthodontics and Dentofacial Orthopedics
Baloul et al
S91
Fig 4. Graphic presentation of bone volume, bone volume fraction, bone mineral content and bone mineral
density as measured by MicroCT for SADc, TM, and SADc 1 TM during active tooth movement phase.
no statistically significant changes were observed. In response to SADc alone, BMD showed a gradual increase,
which reached its maximum level at 28 days (19.1%).
This increase was significant when compared with 7
days ( 0.96%, P 5 0.012), 14 days (11.45%, P 5
0.008), and 21 days (13.61%, P 5 0.005) (Fig 4, D).
Molecular mechanism of osteoclastogenesis
Since selective alveolar decortication results in significant therapeutically induced osteopenia16 and our
MicroCT results further confirmed that this may be the
mechanism in rapid tooth movement, we examined the
mRNA expression of the major molecules that regulated
osteoclastogenesis. M-CSF is essential for osteoclast
development and regulation. Its expression increased
at 3 days in the SADc 1 TM group, suggesting the presence of mature osteoclasts at an early stage of SADc 1
TM compared with TM alone (P 5 0.005 vs baseline).
At 14 days, the SADc 1 TM group showed a further increase in M-CSF expression compared with the baseline
(P 5 0.001) (Fig 5, A).
RANKL is important for osteoclastogenesis; it is present during osteoclast differentiation and activity in resorbing bone. The SADc 1 TM group demonstrated an
increased expression of RANKL at 7 days (P 5 0.000),
14 days (P 5 0.000), 21 days (P 5 0.000), and 28 days
(P 5 0.00) compared with the baseline. At 28 days, the
SADc 1 TM group showed significant increased levels of
RANKL when compared with the TM (P 5 0.006) and
SADc (P 5 0.030) groups. Similarly, the TM group showed
an increased expression of RANKL at 7 days (P 5 0.000),
14 days (P 5 0.000), 21 days (P 5 0.000), and 28 days
(P 5 0.010) compared with baseline (Fig 5, B).
The temporal expression of OPG, a molecule that inhibits osteoclast differentiation, was increased in the
SADc 1 TM group during the initial 3 days (P 5 0.000).
Increased expression of OPG in the SADc 1 TM group
American Journal of Orthodontics and Dentofacial Orthopedics
April 2011 Vol 139 Issue 4 Supplement 1
Baloul et al
S92
Fig 5. Graphic presentation of amount of relative mRNA expression levels during osteoclast regulation; markers studied: M-CSF, OPG, and RANKL. Levels obtained from q-PCR analysis over time
course of active tooth movement phase for SADc, TM, and SADc 1 TM. Fold change is presented relative to control bone (day 0). Data presented as mean values.
continued to 14 days (P 5 0.000 vs baseline: day 0). A
decrease in OPG expression in the SADc 1 TM group
was observed thereafter until the end of treatment at 42
days (P 5 0.001). In contrast, TM showed a decrease in
OPG expression at 3 days (P 5 0.005 vs baseline: day 0).
This decrease was significant in comparison with the
SADc 1 TM group (P 5 0.000). In addition, the TM group
showed an increase in OPG expression between 3 and 14
days, but this was not statistically significant. However,
at 21 days, the TM group demonstrated a decrease in OPG
expression (P 5 0.001 compared with the SADc 1 TM).
SADc alone did not exhibit a change until 21
(P 5 0.016) and 28 (P 5 0.044) days when a decrease
in OPG expression was observed. OPG expression in response to SADc returned to baseline (day 0) levels by
April 2011 Vol 139 Issue 4 Supplement 1
42 days when SADc showed statistically significant
higher levels of OPG expression compared with both TM
(P 5 0.006) and SADc 1 TM (P 5 0.001) (Fig 5, C).
To further study osteoclast differentiation in response to selective alveolar decortication-facilitated
tooth movement, we analyzed CTR expression. The combined group exhibited the highest expression at 3 days
(P 5 0.000). This was significantly higher than SADc
at 3 days (P 5 0.012). In the combined group, CTR expression decreased at 7 days (P 5 0.001 vs 3 days) and
increased at 14 days (P 5 0.000 vs baseline: day 0). At
14 days, SADc 1 TM was the highest compared with
TM (P 5 0.027) and SADc (P 5 0.000). The SADc 1
TM group showed a decrease at 21 days (P 5 0.021 vs
14 days), an increase at 28 days (P 5 0.000 vs baseline
American Journal of Orthodontics and Dentofacial Orthopedics
Baloul et al
S93
Fig 6. Graphic presentation of amount of relative mRNA expression levels for osteoclastic activity;
markers studied 5 TRACP-5b, Ctsk, and CTR. Levels obtained from q-PCR analysis over time course
of active tooth movement phase for SADc, TM and SADc 1 TM. Fold change is presented relative to
control bone (day 0). Data presented as mean values.
at day 0), and remained at a higher level compared with
baseline (day 0) at 42 days (P 5 0.042). The TM group
demonstrated an increase in CTR expression at 3 days
(P 5 0.000), decreased to levels still higher than baseline
(day 0) at 14 days (P 5 0.002), increased at 21 days (P 5
0.000) and 28 days (P 5 0.000) vs baseline (day 0). Furthermore, the SADc group showed an increased expression of CTR at 3 days (P 5 0.006) and a decrease at 7
days (P 5 0.041 vs 3 days) and 14 days (P 5 0.016 vs
3 days). CTR expression was increased by 28 days in
SADc group (P 5 0.042) (Fig 6, A).
To study the bone resorption activity, we analyzed
TRACP 5b. TRACP is an enzyme that is expressed in
high amounts by bone-resorbing osteoclasts, inflammatory macrophages, and dendritic cells. Two forms of
TRACP circulate in serum. We specifically chose the
TRACP 5b isoform, since studies have shown that it is secreted by osteoclasts and is a marker of osteoclast number
and bone resorption. The combined group exhibited an
increase in TRACP 5b expression at 7 days (P 5 0.013).
This expression declined by the end of the study at 42
days. In contrast, the TM group exhibited an increase in
TRACP 5b expression at multiple time points: 7 days
(P 5 0.000), 14 days (P 5 0.002), and 21 days (P 5
0.020). The TRACP 5b increased expression at 7 days
and 14 days in the TM group was significantly higher
than TM response at 3, 28, and 42 days. The SADc group
did not exhibit significant changes (Fig 6, B).
We then studied the Ctsk, which is an enzyme expressed during bone resorption. The SADc 1 TM group
American Journal of Orthodontics and Dentofacial Orthopedics
April 2011 Vol 139 Issue 4 Supplement 1
Baloul et al
S94
showed a higher and early upregulation of Ctsk starting
at 7 days (P 5 0.010 vs baseline). A decrease was then
observed at 14 days (P 5 0.010). This was followed by
an increase in expression at 28 days (P 5 0.002). The
SADc 1 TM group demonstrated a higher Ctsk expression at 28 days (P 5 0.011 vs TM group) and the expression went back to baseline by 42 days. In contrast, the
TM group showed an upregulation in Ctsk expression
starting at 7 days (P 5 0.017), reached its highest at
21 days (P 5 0.000), and returned to baseline at 42
days. The SADc group did not exhibit significant changes
(Fig 6, C).
Molecular mechanisms of osteogenesis
Since previous work16 has suggested that the corticotomy results in an expedited coupling and remodeling of
the bone, and limited clinical evidence has implied that
the resorptive changes in alveolar bone have been rapidly
reversed by bone apposition.13 we wanted to study the
osteoblastic activity in parallel to the osteoclastic activity. MicroCT assessment supported the notion that this
could be the case in SADc 1 TM. Therefore, to better
understand how the osteoblastic activity is affected in
response to alveolar decortication with or without tooth
movement, we analyzed 3 osteoblastic markers: OPN,
BSP, and OCN
To study the early osteoblastic activity, we analyzed
OPN. The combined group demonstrated the highest
OPN expression at both 7 days (P 5 0.000) and 14
days (P 5 0.000) vs baseline. At 21 days, OPN expression
in the SADc 1 TM group decreased to close to baseline
levels (P 5 0.001 vs 14 days). In contrast, the TM group
demonstrated an increase in OPN at 7 days (P 5 0.007).
The TM group exhibited a decrease by 14 days and
stayed at levels close to baseline until the end of the
study at 42 days. Similar to the SADc 1 TM group, the
SADc group showed an increased OPN at 7 days (P 5
0.010 vs baseline at day 0). This expression decreased
at 14 days (P 5 0.046 vs 7 days) with no further change
observed in the SADc group (Fig 7, A).
To study the intermediate osteoblastic activity associated with alveolar decortication in relation to orthodontic movement, we analyzed BSP expression. The
SADc 1 TM group demonstrated the highest increase
in BSP expression at 14 days (P 5 0.000 vs baseline at
day 0). This increase was statistically significant when
compared with TM group at 14 days (P 5 0.000). However, the TM group showed an increase in BSP expression at 21 days (P 5 0.000). That was statistically
significant compared with both SADc (P 5 0.022) and
CTM (P 5 0.023) groups. The BSP expression in the
TM group then decreased at 28 days (P 5 0.019 vs 21
April 2011 Vol 139 Issue 4 Supplement 1
days). At 42 days, BSP expression was increased in the
TM group (P 5 0.000 vs baseline at day 0). The SADc
group did not show any significant changes in BSP
expression (Fig 7, B).
Finally, to study the late osteoblastic activity in response to alveolar decortication combined with orthodontic tooth movement, we analyzed OCN expression.
At 14 days, both the TM (P 5 0.033) and SADc 1 TM
(P 5 0.009) groups exhibited the highest expression
compared with the baseline and decreased to the baseline levels for the rest of the study. Additionally, the
SADc group demonstrated an increase in OCN at 21
days (P 5 0.001 vs baseline at day 0); this was statistically significant compared with both TM (P 5 0.029)
and CTM (P 5 0.006). The SADc group then showed
a decline in OCN expression at 28 days (P 5 0.014 vs
21 days) and throughout the rest of the study (Fig 7, C).
DISCUSSION
Selective alveolar decortication induces a localized
increase in turnover of alveolar spongiosa,16 suggesting
that the dramatic acceleration of demineralization and
remineralization dynamics could be the mechanism underlying the rapid tooth movement after selective alveolar decortication observed in clinical reports.13 Based on
this evidence,therefore, we hypothesized that the selective alveolar decortication–induced osteoclastogenesis
and bone remodeling underlie the orthodontic tooth
movement, and selective alveolar decortication enhances the rate of tooth movement by increasing the
bone turnover compared with the conventional tooth
movement. In order to test this hypothesis, we used morphologic analysis, quantitative MicroCT for the structural analysis, and q-PCR to analyze mRNA expression
of genes associated with both osteoclasts and osteoblasts. Three groups were formed to investigate the
response of alveolar bone in an experimental animal
model: SADc alone, TM, and the combination of SADc
and tooth movement (SADc 1 TM). The results suggested that the combined treatment group had an increased amount and rate of tooth movement and there
was significant reduction in bone volume and increased
osteoclastic and osteoblastic activity during the early
healing process, denoting a coupled bone remodeling
response after alveolar decortication. These data further
suggest that the coupling mechanism at an earlier time
point can be induced by alveolar decortication without
any pathologic consequences in alveolar bone and that
this mechanism underlies the rapid orthodontic tooth
movement phenomenon.
The migration of the teeth via orthodontic appliances
has been traditionally described as “a process in which
American Journal of Orthodontics and Dentofacial Orthopedics
Baloul et al
S95
Fig 7. Graphic presentation of amount of relative mRNA expression levels for osteoblastic markers:
OPG, BSP, and OCN. Levels obtained from q-PCR analysis over time course of active tooth movement
phase for SADc, TM, and SADc 1 TM. Fold change is presented relative to control bone (day 0). Data
presented as mean values.
the application of a mechanical force induces alveolar
bone resorption on the pressure side and alveolar bone
deposition on the tension side.”19 This description
suggests that the mechanical force results in several different events around the tooth that is being moved. The
resorption of the bone is accompanied by the apposition
of the bone under controlled mechanical forces, where
the tooth movement does not exceed the physiologic
threshold that the PDL fibers could withstand. This
paradigm has dominated the understanding of the
mechanism of orthodontic tooth movement. More recent
studies suggest that the resorption and apposition are
not strictly sequential or independent events; they are
rather connected with each other and overlap in their action.20 This phenomenon is referred to as “coupling” and
suggests that the resorptive changes in the bone are accompanied by the formation process in healthy tissues.21
Osteoclasts are actively involved in the osteoblastic function, and the bone represents a dynamic environment.22
Since the clinical orthodontic treatment can take considerable time, numerous efforts have been made to
enhance the rate of therapy. Increasing the magnitude
of mechanical forces and exceeding the biologic threshold of the tissue capacity to physiologically respond to
increased forces leads to pathologic responses such as
ankylosis, root resorption and hyalinization.23,24 and
American Journal of Orthodontics and Dentofacial Orthopedics
April 2011 Vol 139 Issue 4 Supplement 1
Baloul et al
S96
cessation of the tooth movement.25 Therefore, the rationale for “speeding” the orthodontic tooth movement
without increasing the force application should be based
on accelerating the turnover rate of the alveolar bone.26
A recent study has confirmed that the basic mechanism
underlying the selective alveolar decortication was the
coupling between osteoblasts and osteoclasts initiated
at the same time window after the mechanical injury.16
This work further suggested that the orthodontic tooth
movement enhancement could be due to rapid turnover
of the alveolar bone when osteoclastic activity can be initiated earlier. It was not clear however, if the tooth movement in response to surgical decortication followed the
same pattern as the conventional tooth movement in
a similar sequence of phases or if different biologic pathways were followed. The findings from the current work
demonstrate that the tooth displacement curve of the
maxillary left first molar was similar to the classic tooth
displacement curve first described in response to conventional tooth movement.27 There was a decrease in BV
during the initial 7 days. This decrease, however, was
not sufficient to cause any initial displacement but
should be referred as the “initial phase.” During this period, the combined group demonstrated an early “initial
movement.” MicroCT analysis of the bone volume suggested that the combined group, in contrast to TM,
showed the most significant decrease in 7 days, corresponding to the initial movement observed. Thus, the
comparison of the combined group to the TM group suggested that the remodeling phase was earlier; a primary
catabolic phase in bone healing was observed at
a much higher level and RAP28 occurred during the
bone remodeling in association with alveolar bone
decortication. After the first week, the initial tooth movement occurred by 14 days in the TM group, with a decreased activity over the next 7 days. On the other
hand, alveolar decortication results in continuity of the
tooth movement that had been initiated earlier over 14
days. This observation was supported by further reduction in bone volume, suggesting that the bone resorption
continued. The lag phase in traditional tooth movement
has been associated with hyalinization in the PDL.
Pressure associated with orthodontic forces on the PDL
results in permanent damage and plays a major role as
a rate-limiting factor in orthodontic tooth movement.25
In our study, a lag phase after the initial displacement
phase was found in conventional tooth movement
group, which occurred between 14 and 21 days. On the
other hand, the SADc 1 TM group showed a continuous
and steady movement without any evidence of a lag
phase. The increase in tooth movement is possibly a result
of the alveolar decortication effect on tooth movement,
as it was suggested that selective alveolar decortication
April 2011 Vol 139 Issue 4 Supplement 1
led to rapid alveolar bone reaction and it might have
been due to less hyalinization of the PDL on the alveolar
wall.29 Thus, the mechanism of this technique was to
“bypass” the lag phase and initiate the tooth movement
earlier in comparison with the traditional tooth movement group and, therefore, eliminate the hyalinization
associated with the lag phase early on.
In order to characterize the kinetics of tooth movement and bone response, we used several methods: Faxitron analysis as detailed above provided information on
2D changes in spatial displacement of the teeth using radiographic techniques.30 Further morphologic evidence
regarding the density, mass, and bone in 3D was
obtained by MicroCT analysis.31 Indeed, this is the first
study where these 2 techniques have been used in combination with other methods to assess bone structure
and its mineralization during alveolar bone healing
associated with orthodontic treatment with or without
SADc. Thus, we were able to characterize the changes
in bone over time. The results suggested a significant reduction in bone volume in response to the combination
of tooth movement, and selective alveolar decortication
supports the notion that such an impact would result in
a rapid loss of bone volume. Another important finding
using the MicroCT analysis was the observation that the
bone homeostasis was restored to baseline levels with no
pathologic loss of bone density, mass, and volume. The
tooth movement phase can be interpreted as a period in
which the biologic processes involving remodeling of the
PDL and alveolar bone reach their maximum.32 At this
stage, hyalinization has been eliminated and bone
remodeling occurs by direct and undermining bone
resorption. The total tooth displacement during our
study was 6.94 mm in the combined group compared
with 5.30 mm in the traditional tooth movement group.
This greater orthodontic tooth movement has been reported to occur in alveolar bone with loose trabeculae
and less bone resistance.33 During the tooth displacement phase (28 to 42 days), the combined treatment
group showed an increase in the mineralized bone
volume and increased bone mass, with simultaneous
loss in BV and BMD. This denotes that the surgical intervention led to an increase in bone mineral volume and
bone mineral mass. Using these qualitative assessments
of change in alveolar bone and based on a previous report.6 We suggest that the coupling initiated by osteoclastic bone resorption and accompanied by
osteoblastic bone deposition is the underlying mechanism for rapid orthodontic tooth movement.
Characteristic changes of reversible osteopenia were
associated with alveolar decortication in previous studies.34,35 Therefore, to further elucidate the mechanism
by which the alveolar decortication affects the bone
American Journal of Orthodontics and Dentofacial Orthopedics
Baloul et al
healing during orthodontic tooth movement, molecular
analyses of osteoclastic and osteoblastic markers were
carried out. To this end, we first studied the expression
of macrophage-colony stimulating factor (M-CSF),
which stimulates osteoclastic proliferation and differentiation and decreases osteoclast apoptosis.36 The
SADc 1 TM group displayed an initial increase in MCSF expression at 3 days and another peak at 14 days.
These levels were significantly different from the TM
group, suggesting that the combination of surgical injury to the bone and mechanistic forces can lead to increased osteoclast proliferation and differentiation.
In order to elucidate if the alveolar decorticationmediated increase in the expression of cytokines was associated with osteoclast differentiation and regulation,
we then studied RANKL and OPG , which are known to
regulate osteoclast differentiation and survival. RANKL
is a member of the tumor necrosis factor (TNF) superfamily and a membrane-residing protein on osteoblasts
and their precursors, which recognize its receptor RANK
on marrow macrophages, promoting them to assume the
osteoclast phenotype.37 In addition to increasing osteoclastogenesis by inducing osteoclast differentiation,
RANKL activates osteoclasts.38 Data from our study
showed that RANKL expression was elevated in response
to both the combined and traditional tooth movement
modalities beginning at 7 days. The combined group exhibited a steady increase in RANKL expression during the
14 and 21 days compared with baseline (day 0), while the
TM group demonstrated a peak at 14 days and a decline
thereafter. This data further suggested that the increased
osteoclastic proliferation and differentiation were translated into prolonged osteoclastic activity in the SADc 1
TM group.
Next, we evaluated the expression for OPG, which is
a soluble decoy receptor antagonist to RANK.39 By
binding to RANKL, OPG inhibits osteoclast differentiation.40 OPG expression in the combined group peaked
at 3 days and 14 days, suggesting a bimodal response.
On the other hand, the TM group showed a decrease of
OPG expression at 3 days. These findings suggested
that selective alveolar decortication diverts the biologic
response to conventional tooth movement, and the
combination approach represents a unique pattern of
challenge to the alveolar bone in which the coupling
of RANKL and OPG is more rapid and simultaneous
compared with conventional tooth movement, where
an increase in RANKL was associated with decreased
OPG.
Calcitonin has an inhibitory effect on the osteoclast
activity and decreases bone resorption via the
CTR.41 Several studies have recognized calcitonin as
a therapeutic agent for the treatment of osteoporosis,
S97
Paget’s disease and late-stage malignancies.36 Calcitonin receptor is a G-protein coupled receptor present on
the osteoclasts and is a specific marker of osteoclast
differentiation. While all treatment groups showed
a significant increase in CTR compared with baseline,
the SADc 1 TM group exhibited the highest expression.
At 7 days, all 3 groups showed a decrease reflecting
increased osteoclastogenesis and bone resorption. The
SADc 1 TM group returned to higher levels by 14
days, whereas the TM group levels decreased and the
SADc group stayed at low levels. This observation was
in parallel with the fluctuating pattern observed in the
MicroCT analysis and illustrates that the bone healing
in the combined therapy is following a unique pattern
independent of TM.
TRACP-5b has been used as a potential marker to
evaluate osteoclastic activity and bone resorption
rate.42 It is secreted by osteoclasts during bone
resorption.43 Studies showed that TRACP-5b was significantly elevated in osteoporotic patients.44 In addition,
TRACP-5b has been shown to have a significant negative
correlation with BMD. TRACP-5b demonstrated activity
throughout our study. The combined group exhibited an
osteoclastic activity at 3 days, 7 days, and 14 days, which
was in parallel with the bone changes seen in MicroCT
analyses. Conventional tooth movement displayed a similar pattern. However, active osteoclastic activity in TM
was seen later than the SADc 1 TM group at 7 days
and 14 days, suggesting that the active bone resorption
facilitated the earlier tooth movement in the SADc 1 TM
group.
The final marker of osteoclastic activity tested in this
study was Ctsk, which is predominantly expressed in
osteoclasts and is a major bone extracellular bonedegrading enzyme. Ctsk represents 98% of the total
cysteine protease activity and of the collagenases of
the matrix metalloproteinase (MMP) family.45,46 The
combined group demonstrated high mRNA expression of
Ctsk at 3 days and 7 days, indicating a high osteoclastic
activity allowing the tooth to move more rapidly. Ctsk
activity decreased in the SADc 1 TM group by 14 days.
The conventional tooth movement group followed
a similar pattern at 3 and 7 days, while the expression at
3 days was not as high as seen in the SADc 1 TM group,
which may explain the delay in initial tooth
displacement. Overall, the analyses of different markers
of osteoclastic activity, proliferation, and differentiation
demonstrated that the osteopenic changes were induced
by selective alveolar decortication and that this impact
accounted for the rapid tooth movement. Another
important finding was that the combination of surgical
decortication injury to the alveolar bone and orthodontic
forces represents a unique healing model, compared
American Journal of Orthodontics and Dentofacial Orthopedics
April 2011 Vol 139 Issue 4 Supplement 1
Baloul et al
S98
with the individual responses to these stimuli, rather than
an additive effect.
RANKL expression was decreased in both the SADc 1
TM and TM groups, denoting a decrease in osteoclastic
activity during the linear tooth displacement period. In
the combined group, RANKL expression showed a decrease during the period of 28 to 42 days. The TM group
demonstrated a similar pattern in its lag phase between
21 and 42 days. Both groups, therefore, exhibited a decrease in osteoclast differentiation and activation during
the tooth movement phase. The combined group returned to levels close to baseline, while the TM group
had a higher expression than baseline by the end of
the study at 42 days. Both SADc 1 TM and TM exhibited
a similar pattern in OPG expression, with SADc 1 TM
showing a decreased expression at 42 days. Calcitonin
receptor data demonstrated that during the linear tooth
movement, all treatment modalities led to a decrease
between 28 and 42 days. Interestingly, the peak in
CTR expression at 28 days in the SADc group paralleled
the increase seen in MicroCT parameters (BV, BV/TV,
BMC, and BMD). Since CTR expression is associated
with osteoclast formation.47 The peak activity between
28 and 42 days may suggest apoptotic changes in
osteoclasts and inhibition of further bone resorption.
Furthermore, this signifies that alveolar decortication
alone leads to increased bone formation in the later
stages of alveolar bone healing.
Since orthodontic tooth movement is the result of an
extrinsic mechanical stimulus, which aims to restore the
balance by remodeling the PDL, it is of interest to assess
the timing of the bone apposition in conjunction with
the resorption of the alveolar bone around the tooth.
An increase in both catabolic and anabolic activities
has been reported, suggesting coupled alveolar turnover
in response to selective alveolar decortication.16 Therefore, in order to explore the anabolic mechanism in
response to tooth movement with or without alveolar
decortication, it was prudent to assay osteoblastic
markers. We began our investigation with OPN as an
early osteoblastic activity marker. OPN is a secreted
phosphoprotein rich in sialic acid. It is a prominent
constituent of the extracellular matrices of mineralized
tissues such as bone and cementum.48 OPN has multiple
roles in various tissues such as bone, kidney, heart,
and immune tissue49,50; it is produced by oncogenic
cells regardless of their origin in substantial amounts in
comparison with their nontransformed cell counterparts.51
Sodek et al52 reported high levels of OPN mRNA expression
found in mature osteoblasts at sites of bone remodeling.
Our results demonstrated that the SADc 1 TM resulted
in a robust increase in OPN expression at 3, 7, and 14
days, while the TM group displayed an increase in OPN
April 2011 Vol 139 Issue 4 Supplement 1
expression at significantly lower levels. The SADc group
showed a peak in OPN expression at 3 and 7 days, and
the osteoblastic activity soon returned to baseline levels
by 14 days. The data suggested that osteoblast maturation was complete in response to alveolar decortications,
while the increased osteoclastic activity was coupled with
higher osteoblastic activity in the SADc 1 TM group.
In order to assess the changes in an intermediate osteoblastic marker, we then studied BSP, another noncollagenous matrix protein. Similar to OPN, BSP contains
a classic integrin-binding motif (RGD) for cell attachment.53 Its expression is restricted to mineralized connective tissues, and it is first expressed at the onset of
bone, cementum, and dentin formation.54 BSP has an
important role in nucleation of hydroxyapatite at the
mineralization front of bone.55 In addition, the expression of BSP has been reported in breast, thyroid, and
prostate cancers that metastasize to bone.56 Similar to
OPN, we found a significant increase in BSP expression
in the SADc 1 TM group at 14 days. This was significantly different in comparison with both the traditional
TM group and the SADc group. A later peak was
observed in the TM group at 21 days, suggesting that
the early increase in BSP in the SADc 1 TM group led
to earlier osteoblastic activity. These data, combined
with an earlier OPN expression increase suggests that
the bone turnover was steady in SADc 1 TM.
To study late osteoblastic activity, we analyzed OCN,
another noncollagenous protein secreted by osteoblasts,
which plays an important role during the mineralization
stage and is known as a marker for mature osteoblasts.57
Our data showed an increased peak in OCN at 14 days in
both the combined and the TM groups. Therefore, both
treatment modalities exhibited a simultaneous high rate
of turnover along with initial tooth movement. Overall,
these observations suggested that the selective alveolar
decortication–induced osteoclastic activity is a continuous stimulation of osteoblast proliferation and maturation, and anabolic activity is directed by the catabolic
resorption of the alveolar bone during orthodontic tooth
movement.
The rat is considered suitable for an animal model of
orthodontic tooth movement because the rat mouth is
large enough to perform surgery and place orthodontic
wires.58,59 However, there are morphologic and
physiologic differences between rat and human
alveolar bone. The alveolar bone in rats is denser and
exhibits no osteons. Its bone plates are void of marrow
spaces. Humans have more osteoid tissue along the
alveolar bone surfaces.60 Some reports showed that rat
extracellular matrix has less acid mucopolysaccharides,
and calcium homeostasis is controlled by the kidneys
rather than in the bone. In addition, tissue development
American Journal of Orthodontics and Dentofacial Orthopedics
Baloul et al
during tooth formation, as related to orthodontic treatment, appears to be faster in rats compared with humans. Another limitation is the natural distal drift of
rat teeth.58 This may have led to an underestimation
of the mesial molar displacement. A limitation in our
study design using the rat as a model was the tipping
tooth movement. Tipping takes place by means of uneven distribution of stresses and strains occurring within
the PDL. This results clinically in different rates of movement in both the crown and root of the tooth, leading to
movement in different directions. According to Fortin,61
the rate of crown and root movement is determined by
the center of rotation, and this is difficult to change during the tipping movement. Consequently, tipping movement is not a well-defined reproducible action.
Measurements of the mesial molar displacement using
the Faxitron x-ray system were performed at the crown
level rather than the center of rotation. Therefore, this
may have caused an overestimation of our tooth displacement measurements. However, we performed the
same type of measurements with all samples and groups
so that the relative movements are comparable. Meanwhile, in order to eliminate the shortcoming of the
lack of tooth movement reactivation throughout the
study period in our study design, we used ultralight
superelastic NiTi closed coil spring with eyelets producing a force of 25 g, which was attached to a ligature wire
on the maxillary left first molar and the anterior teeth.
These springs produced a constant, continuous, reciprocal force on the anchorage teeth over a wider range of
activation.23 Therefore, reactivation was not required.
However, we still made sure that the force was constant
during the activation period by measuring with a gauge.
The key point in this technique was not to violate the active range of action, which was 1 cm. This distance was
severalfold larger than the distance between the molar
and the incisor.
CONCLUSIONS
Collectively, the results demonstrate that tooth movement with or without alveolar decortication is a coupled
process in which there is bone resorption followed by formation during bone turnover. This was demonstrated by
means of radiographic, tomographic, and molecular
methods. The early rapid tooth movement observed in
the combined group during the initial phase of tooth displacement is due to the increased bone remodeling as
a result of the surgical intervention. The results support
the notion that surgically facilitated tooth movement is
a process of demineralization-remineralization and
suggest that selective alveolar decortication induces a localized increased turnover of alveolar spongiosa and that
S99
demineralization-remineralization is the likely biologic
mechanism underlying rapid tooth movement associated
with selective alveolar decortication.
This study provides the first scientific evidence for the
role of coupled osteoclastic and osteoblastic activity in
response to alveolar decortication through which the orthodontic tooth movement is enhanced. While the surgical intervention during the orthodontic treatment may
not always be desired, understanding the biologic mechanism underlying the bone turnover and the change in
dynamics of tooth movement as a result of the increased
bone activity are critical for designing novel treatment
methods in the future. Therefore, the knowledge gained
from the current study would be useful when mechanics
are combined with biologic processes during orthodontic treatment.
The authors would like to acknowledge the following
members for their contribution to the study: Dr. Tareq
Al-Zeitani, Dr. Chie Hayashi, Dr. Donald Ferguson,
Dr. Manish Bais, Dr. Leslie Will, and Mr. Zack Mason.
REFERENCES
1. Parfitt AM. The cellular basis of bone remodeling: the quantum
concept reexamined in light of recent advances in the cell biology
of bone. Calcified Tissue Int 1984;36:S37-45.
2. Krishnan V, Davidovitch Z. Cellular, molecular, and tissue-level reactions to orthodontic force. Am J Orthod Dentofacial Orthop
2006;129:469.e1-32.
3. de Carlos F, Cobo J, Perillan C, Garcia MA, et al. Orthodontic tooth
movement after different coxib therapies. Eur J Orthod 2007;29:596-9.
4. Wise GE, King GJ. Mechanisms of tooth eruption and orthodontic
tooth movement. J Dent Res 2008;87:414-34.
5. Kawarizadeh A, Bourauel C, Zhang D, Gotz W, Jager A. Correlation
of stress and strain profiles and the distribution of osteoclastic cells
induced by orthodontic loading in rat. Eur J Oral Sci 2004;112:
140-7.
6. Alhashimi N, Frithiof L, Brudvik P, Bakhiet M. Orthodontic tooth
movement and de novo synthesis of proinflammatory cytokines.
Am J Orthod Dentofac Orthoped 2001;119:307-12.
7. Lee YH, Nahm DS, Jung YK, et al. Differential gene expression of
periodontal ligament cells after loading of static compressive force.
J Periodontol 2007;78:446-52.
8. Kanzaki H, Chiba M, Shimizu Y, Mitani H. Periodontal ligament
cells under mechanical stress induce osteoclastogenesis by receptor activator of nuclear factor kappaB ligand up-regulation
via prostaglandin E2 synthesis. J Bone Miner Res 2002;17:
210-20.
9. K€ole H. Surgical operations on the alveolar ridge to correct occlusal
abnormalities. Oral Surg Med Pathol 1959;12:515-29.
10. Duker J. Experimental animal research into segmental alveolar
movement after corticotomy. J Maxillofac Surg 1975;3:81-4.
11. Anholm JM, Crites DA, Hoff R, Rathbun WE. Corticotomy-facilitated orthodontics. CDA J 1986;14:7-11.
12. Amimoto A, Iwamoto S, Taura Y, Nakama S, Yamanouchi T. Effects
of surgical orthodontic treatment for malalignment due to the
prolonged retention of deciduous canines in young dogs. J Vet
Med Sci 1993;55:73-9.
American Journal of Orthodontics and Dentofacial Orthopedics
April 2011 Vol 139 Issue 4 Supplement 1
Baloul et al
S100
13. Wilcko WM, Wilcko T, Bouquot JE, Ferguson DJ. Rapid orthodontics with alveolar reshaping: two case reports of decrowding. Int J
Periodontics Restorative Dent 2001;21:9-19.
14. Murphy KG, Wilcko MT, Wilcko WM, Ferguson DJ. Periodontal accelerated osteogenic orthodontics: a description of the surgical
technique. J Oral Maxillofac Surg 2009;67:2160-6.
15. Yaffe A, Fine N, Binderman I. Regional accelerated phenomenon in
the mandible following mucoperiosteal flap surgery. J Periodontol
1994;65:79-83.
16. Sebaoun JD, Kantarci A, Turner JW, Carvalho RS, Van Dyke TE,
Ferguson DJ. Modeling of trabecular bone and lamina dura following selective alveolar decortication in rats. J Periodontol
2008;79:1679-88.
17. Verna C, Zaffe D, Siciliani G. Histomorphometric study of bone reactions during orthodontic tooth movement in rats. Bone 1999;
24:371-9.
18. Otsu N. A threshold selection method from gray-scale histogram.
IEEE Trans Syst Man Cybernet 1978;8:62-6.
19. Graber T, Vanarsdall RL. Orthodontics: Current principles and
techniques. St. Louis: Mosby; 2000.
20. King GJ, Keeling SD. Orthodontic bone remodeling in relation to
appliance decay. Angle Orthodont 1995;65:129-40.
21. Proff P, Romer P. The molecular mechanism behind bone remodelling: a review. Clin Oral Invest 2009;13:355-62:Epub 2009 Mar
25. Review.
22. Vargervik K. Some aspects of bone formation and remodeling pertinent to craniofacial development and reconstructive treatment.
Acta Odontol Scand 1995;53:167-73.
23. van Leeuwen EJ, Maltha JC, Kuijpers-Jagtman AM. Tooth movement with light continuous and discontinuous forces in beagle
dogs. Eur J Oral Sci 1999;107:468-74.
24. van Driel WD, van Leeuwen EJ, Von den Hoff JW, Maltha JC,
Kuijpers-Jagtman AM. Time-dependent mechanical behaviour of
the periodontal ligament. Proc Inst Mech Eng H 2000;214:497-504.
25. Rygh P, Norton LA, Burstone CJ. The periodontal ligament under
stress: the biology of tooth movement. Boca Raton: CRC Press;
1989. p. 9-12.
26. Verna C, Dalstra M, Melsen B. The rate and the type of orthodontic
tooth movement is influenced by bone turnover in a rat model. Eur
J Orthod 2000;22:343-52.
27. Reitan K. Clinical and histologic observations on tooth movement
during and after orthodontic treatment. Am J Orthodont 1967;53:
721-45.
28. Frost HM. The biology of fracture healing: an overview for clinicians. Part I. Clin Orthop Relat Res 1989;248:283.
29. Iino S, Sakoda S, Ito G, Nishimori T, Ikeda T, Miyawaki S. Acceleration of orthodontic tooth movement by alveolar corticotomy in
the dog. Am J Orthodont Dentofacial Orthoped 2007;31:448.e1-8.
30. Aitchison GU. Use of a Faxitron x-ray cabinet for the rapid detection
of the end-point of decalcification. Med Lab Sci 1979;36:195-6.
31. Muller R, Ruegsegger P. Micro-tomographic imaging for the nondestructive evaluation of trabecular bone architecture. Stud Health
Tech Informat 1997;40:61-79.
32. Pilon JJ, Kuijpers-Jagtman AM, Maltha JC. Magnitude of orthodontic forces and rate of bodily tooth movement. An experimental
study. Am J Orthodont Dentofacial Orthoped 1996;110:16-23.
33. Midgett RJ, Shaye R, Fruge JF Jr. The effect of altered bone metabolism on orthodontic tooth movement. Am J Orthod 1981;80:
256-62.
34. Ashcraft MB, Southard KA, Tolley EA. The effect of
corticosteroid-induced osteoporosis on orthodontic tooth
movement. Am J Orthodont Dentofacial Orthoped 1992;102:
310-9.
April 2011 Vol 139 Issue 4 Supplement 1
35. Sidiropoulou-Chatzigiannis S, Kourtidou M, Tsalikis L. The effect
of osteoporosis on periodontal status, alveolar bone and orthodontic tooth movement. A literature review. J Int Acad Periodont
2007;9:77-84.
36. Bruzzaniti A, Baron R. Molecular regulation of osteoclast activity.
Rev Endocr Metab Dis 2006;7:123-39.
37. Teitelbaum SL. Osteoclasts: what do they do and how do they do
it? Am J Pathol 2007;170:427-35.
38. Lam J, Nelson CA, Ross FP, Teitelbaum SL, Fremont DH. Crystal structure of the TRANCE/RANKL cytokine reveals determinants of receptor-ligand specificity. J Clin Invest 2001;108:
971-9.
39. Kostenuik PJ, Shalhoub V. Osteoprotegerin: a physiological and
pharmacological inhibitor of bone resorption. Curr Pharm Des
2001;7:613-35.
40. Aubin JE, Bonnelye E. Osteoprotegrin and its ligand: a new
paradigm for regulation of osteoclastogenesis and bone resorption. Osteoporosis Int 2000;11:905-13.
41. Becker KL, Nylen ES, White JC, Muller B, Snider RH Jr. Clinical review 167: Procalcitonin and the calcitonin gene family of peptides
in inflammation, infection, and sepsis: a journey from calcitonin
back to its precursors. J Clin Endocrinol Metabol 2004;89:
1512-25.
42. Pagani F, Francucci CM, Moro L. Markers of bone turnover: biochemical and clinical perspectives. J Endocrinol Invest 2005;28:
8-13.
43. Halleen JM, Tiitinen SL, Ylipahkala H, Fagerlund KM, Vaananen HK.
Tartrate-resistant acid phosphatase 5b (TRACP 5b) as a marker of
bone resorption. Clin Lab 2006;52:499-509.
44. Rosenbrock H, Seifert-Klauss V, Kaspar S, Busch R, Luppa PB.
Changes of biochemical bone markers during the menopausal
transition. Clin Chem Lab Med 2002;40:143-51.
45. Shingleton WD, Hodges DJ, Brick P, Cawston TE. Collagenase:
a key enzyme in collagen turnover. Biochem Cell Biol 1996;74:
759-75.
46. Kafienah W, Bromme D, Buttle DJ, Croucher LJ, Hollander AP.
Human cathepsin K cleaves native type I and II collagens at the
N-terminal end of the triple helix. Biochem J 1998;331(Pt 3):
727-32.
47. Granholm S, Lundberg P, Lerner UH. Calcitonin inhibits osteoclast
formation in mouse haematopoetic cells independently of transcriptional regulation by receptor activator of NF-{kappa}B and
c-Fms. J Endocrinol 2007;195:415-27.
48. McKee MD, Nanci A. Osteopontin at mineralized tissue interfaces
in bone, teeth, and osseointegrated implants: ultrastructural
distribution and implications for mineralized tissue formation,
turnover, and repair. Micros Res Tech 1996;33:141-64.
49. Brown LF, Berse B, Van de Water L, et al. Expression and distribution of osteopontin in human tissues: widespread association with luminal epithelial surfaces. Mol Biol Cell 1992;3:
1169-80.
50. Giachelli CM, Bae N, Almeida M, Denhardt DT, Alpers CE,
Schwartz SM. Osteopontin is elevated during neointima formation
in rat arteries and is a novel component of human atherosclerotic
plaques. J Clin Invest 1993;92:1686-96.
51. Denhardt DT, Guo X. Osteopontin: a protein with diverse functions. FASEB J 1993;7:1475-82.
52. Sodek J, Chen J, Nagata T, et al. Regulation of osteopontin expression in osteoblasts. Ann NY Acad Sci 1995;760:223-41.
53. Oldberg A, Franzen A, Heinegard D. Cloning and sequence analysis
of rat bone sialoprotein (osteopontin) cDNA reveals an
Arg-Gly-Asp cell-binding sequence. Proc Nat Acad Sci 1986;83:
8819-23.
American Journal of Orthodontics and Dentofacial Orthopedics
Baloul et al
54. Chen J, Shapiro HS, Sodek J. Development expression of bone
sialoprotein mRNA in rat mineralized connective tissues. J Bone
Miner Res 1992;7:987-97.
55. Ogata Y. Bone sialoprotein and its transcriptional regulatory
mechanism. J Periodont Res 2008;43:127-35.
56. Waltregny D, Bellahcene A, de Leval X, Florkin B, Weidle U,
Castronovo V. Increased expression of bone sialoprotein in bone
metastases compared with visceral metastases in human breast
and prostate cancers. J Bone Miner Res 2000;15:834-43.
57. Liu Z, Luyten FP, Lammens J, Dequeker J. Molecular signaling in
bone fracture healing and distraction osteogenesis. Histol Histopathol 1999;14:587-95.
S101
58. Ren Y, Maltha JC, Kuijpers-Jagtman AM. The rat as a model for
orthodontic tooth movement—a critical review and a proposed
solution. Eur J Orthod 2004;26:483-90.
59. Verna C, Dalstra M, Melsen B. Bone turnover rate in rats does not
influence root resorption induced by orthodontic treatment. Eur J
Orthod 2003;25:359-63.
60. Reitan K, Kvam E. Comparative behavior of human and animal tissue during experimental tooth movement. Angle Orthod 1971;41:
1-14.
61. Fortin JM. Translation of premolars in the dog by controlling the
moment-to-force ratio on the crown. Am J Orthodont 1971;59:
541-51.
American Journal of Orthodontics and Dentofacial Orthopedics
April 2011 Vol 139 Issue 4 Supplement 1