Download Development of a single‐tube loop‐mediated isothermal

RESEARCH LETTER
Development of a single-tube loop-mediated isothermal
amplification assay for detection of four pathogens of bacterial
meningitis
Nguyen Tien Huy1, Le Thi Thuy Hang1, Daniel Boamah1, Nguyen Thi Phuong Lan2,
Phan Van Thanh2,3, Kiwao Watanabe4, Vu Thi Thu Huong4, Mihoko Kikuchi1,
Koya Ariyoshi4, Kouichi Morita5,6 & Kenji Hirayama1,6
1
Department of Immunogenetics, Institute of Tropical Medicine (NEKKEN), Nagasaki University, Sakamoto, Nagasaki, Japan; 2Laboratory of
Arbovirus, Pasteur Institute, Ho Chi Minh City, Vietnam; 3Faculty of Biology, Ho Chi Minh City University of Science, Ho Chi Minh City, Vietnam;
4
Department of Clinical Medicine, Institute of Tropical Medicine, Nagasaki University, Sakamoto, Nagasaki, Japan; 5Department of Virology,
Institute of Tropical Medicine, Nagasaki University, Nagasaki, Japan; and 6Global COE program, Nagasaki University, Nagasaki, Japan
Correspondence: Kenji Hirayama,
Department of Immunogenetics, Institute
of Tropical Medicine (NEKKEN), Nagasaki
University, 1-12-4 Sakamoto, Nagasaki
852-8523, Japan. Tel.: +81 95 819 7805;
fax: +81 95 819 7821; e-mail:
[email protected]
Received 18 July 2012; revised 29 August
2012; accepted 30 August 2012. Final
version published online 5 October 2012.
MICROBIOLOGY LETTERS
DOI: 10.1111/1574-6968.12002
Editor: Andre Klier
Keywords
assay; bacteria; diagnosis; LAMP; meningitis;
simultaneous.
Abstract
Several loop-mediated isothermal amplification (LAMP) assays have been
developed to detect common causative pathogens of bacterial meningitis (BM).
However, no LAMP assay is reported to detect Streptococcus agalactiae and
Streptococcus suis, which are also among common pathogens of BM. Moreover,
it is laborious and expensive by performing multiple reactions for each sample
to detect bacterial pathogen. Thus, we aimed to design and develop a singletube LAMP assay capable of detecting multiple bacterial species, based on the
nucleotide sequences of the 16S rRNA genes of the bacteria. The nucleotide
sequences of the 16S rRNA genes of main pathogens involved in BM were
aligned to identify conserved regions, which were further used to design broad
range specific LAMP assay primers. We successfully designed a set of broad
range specific LAMP assay primers for simultaneous detection of four species
including Staphylococcus aureus, Streptococcus pneumoniae, S. suis and S. agalactiae. The broad range LAMP assay was highly specific without cross-reactivity
with other bacteria including Haemophilus influenzae, Neisseria meningitidis
and Escherichia coli. The sensitivity of our LAMP assay was 100–1000 times
higher compared with the conventional PCR assay. The bacterial species could
be identified after digestion of the LAMP products with restriction endonuclease DdeI and HaeIII.
Introduction
Rapid diagnosis of bacterial meningitis (BM) is essential
as successful disease outcome is dependent on immediate
antibiotic therapy (Saez-Llorens & McCracken, 2003;
Zimmerli, 2005). However, accurate and rapid identification of BM is challenging for clinicians as its symptom
and laboratory test are often similar and overlapping with
those of aseptic meningitis. Conventional diagnosis of
BM relies on the detection of bacteria in cerebrospinal
fluid and/or blood by Gram staining, latex agglutination
and culturing. However, Gram staining and latex agglutination tests are low in sensitivity (Kennedy et al., 2007),
FEMS Microbiol Lett 337 (2012) 25–30
while culturing takes few days. Furthermore, antimicrobial therapy prior to lumbar puncture often reduces the
frequency of positive cultures from the CSF and blood
(Pandit et al., 2005).
PCR assays have recently been developed to detect several bacterial pathogens of BM. These assays have been
widely used in clinical practice and proved to have both
high sensitivity and specificity. However, the PCR method
requires expensive instrument, experienced technician and
few-hour performance. To overcome the limitations of
current PCR, the loop-mediated isothermal amplification
(LAMP) assay has been invented as an accurate, rapid
and cost-effective method, which amplifies the target
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
26
nucleic acid under isothermal conditions, usually
between 56 and 65 °C (Notomi et al., 2000). The
amplified product of LAMP assay can be detected in
< 1 h and identified by agarose gel electrophoresis, simple visual inspection, real-time monitoring of turbidity
or visual colour change using fluorescent dye. Importantly, the assay can be performed at bedside and in
rural areas using only a water bath (Tomita et al.,
2008). Several LAMP assays have been developed to
detect common causative pathogens of BM such as
Streptococcus pneumoniae, Haemophilus influenzae, Neisseria meningitidis, Escherichia coli and Staphylococcus
aureus (Seki et al., 2005; Yamazaki et al., 2008; Hanaki
et al., 2011; Kim et al. 2011; McKenna et al. 2011).
However, no LAMP assay has been reported to detect
Streptococcus agalactiae and Streptococcus suis, which
are two of the most common pathogens of BM in some
countries (Mai et al., 2008; Chiba et al., 2009). Moreover, it is laborious and expensive by performing multiple reactions for each sample to detect bacterial
pathogen. Thus, we aimed to design and develop a
LAMP assay capable of detecting multiple bacterial species based on the nucleotide sequences of the 16S rRNA
genes of the bacteria.
Materials and methods
Design of LAMP assay primers for seven
common bacteria in BM
The broad range LAMP primers were designed to be specific for eubacterial 16S rRNA-specific gene. This gene
was chosen because of its highly conserved regions among
species and has been widely used as a target for broad
range PCR method (Gray et al., 1984; Lane et al., 1985).
The partial nucleotide sequences of the 16S rRNA genes
of S. aureus (GenBank FJ907240.1), S. pneumoniae
(Z22807), S. suis (Z22776.1), S. agalactiae (Z22808),
N. meningitidis (Z22806), H. influenzae (Z22809.1) and
E. coli (AY513502.1) were retrieved from the GenBank
database and were aligned to identify potential target
regions using MULTIALIN software (Corpet, 1988). Several
conserved regions were chosen for designing of LAMP
primer set using the LAMP primer design software Primer Explorer version 4 (Eiken Chemical Co., Ltd, Tokyo,
Japan). A set of four primers including two outer primers
(forward primer F3 and backward primer B3) and two
inner primers [forward inner primer (FIP) and backward
inner primer (BIP)] that identified six distinct regions on
the potential target sequence was designed. This study
was approved by the institutional ethical review committees of the Institute of Tropical Medicine, Nagasaki
University.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
N. T. Huy et al.
Bacterial strains and samples preparation
Serotypes 3 and 10 of S. pneumoniae were isolated from
upper respiratory tract in Vietnamese patients. Two
strains (8-01 and 8-02) of S. suis serotype 2, E. coli,
S. aureus and S. agalactiae were also isolated from Vietnamese patients. In addition, H. influenzae and N. meningitidis were isolated from Japanese patients. The
S. pneumoniae was cultured on rabbit blood Muller
Hinton agar, while other bacteria were grown on rabbit
blood brain heart infusion agar. Grown bacteria were
harvested and suspended in normal saline. The cells were
pelleted, suspended in TE buffer (10 mM Tris-HCl,
1 mM EDTA, pH 8.0) and serially diluted with TE
buffer ranging from 108 down to 100 colonies of
bacteria mL 1 (CFU mL 1). DNA was released from the
bacteria by boiling for 20 min followed by centrifugation
at 10 000 g for 10 min. The supernatant was used as
the DNA template.
Optimization of LAMP reaction
The LAMP reaction was carried out in a 25-lL reaction
mixture with a Loopamp DNA amplification kit (Eiken
Chemical Co., Ltd) as described in our previous work
(Kubo et al., 2010). The reaction mixture contained
40 pmol (1 lL) each of FIP and BIP, 5 pmol (1 lL) each
of F3 and B3 and 20 pmol (1 lL) each of Loop F and
Loop B. LAMP reaction was performed at several different temperatures ranging from 55 to 68 °C in 90 min
using LA-320C Loopamp real-time turbidimeter (Teramecs, Japan). The best condition for LAMP procedure
was at 63 °C and in 60 min. Therefore, all of mixtures
were incubated at 63 °C for 90 min, followed by heating
at 80 °C for 5 min to inactivate the reaction. Two microlitre of the extracted DNA was used as the template in
each reaction mixture. A negative control (a reaction
mixture with distilled water instead of DNA template)
and a positive control (a confirmed positive sample) were
included in each run. Precautions were taken to prevent
cross-contaminations.
Analysis of LAMP product
The LAMP product was analysed by three methods
including a real-time turbidimeter, agarose gel analysis
and naked eye visualization. The LA-320C Loopamp realtime turbidimeter (Teramecs) was used to monitor the
LAMP reaction based on the turbidity of magnesium
pyrophosphate at 405 nm, a byproduct of the reaction.
The turbidity threshold value for a positive sample was
fixed at 0.1, and samples above this threshold value were
considered as positive. After amplification, 2 lL of the
FEMS Microbiol Lett 337 (2012) 25–30
27
Single-tube LAMP assay of bacterial meningitis
LAMP product was further separated by 2% agarose gel
electrophoresis, which was stained with ethidium bromide
and visualized under UV light. In addition, 1 lL of SYBR
Green I (Invitrogen) was added to the remained LAMP
product, a change from orange to fluorescent green colour was considered as positive. To further distinguish
bacterial species, 2 lL of the LAMP product was digested
with 10 U of DdeI or HaeIII at 37 °C for 90 min. The
digested LAMP product was analysed by 2% agarose gel
electrophoresis as described above.
Conventional PCR assay
A conventional PCR was also carried out with the universal primer set targeting 16S rRNA genes to compare the
sensitivity of the LAMP assay. The paired primers were
5′-CCAGCAGCCGCGGTAATACG-3′ and 5′-ATCGG(C/
T)TACCTTGTTACGACTTC-3′ (Lu et al., 2000). Twentyfive microlitre of PCR assay contained 2 lL of DNA template, 1 lL of each primer, 2 mM MgCl2, 0.2 mM
dNTPs, 2.5 lL of 10 9 buffer and 1.25 U Taq HS DNA
polymerase (Takara Bio, Shiga, Japan). The reactions were
amplified as follows: initial activation of one cycle at temperature 94 °C for 10 min and then followed by 35 cycles
at 94 °C for 30 s, 55 °C for 50 s and 72 °C for 2 min.
The final extension step was carried out at 72 °C for
10 min. Amplified products were then detected by ethidium bromide staining after 2% agarose gel electrophoresis.
Results and discussion
Design of broad range LAMP assay primers
We aimed to develop a LAMP assay capable of detecting
many bacterial species (multispecies LAMP assay) for
diagnosis of BM. The bacterial species used in this study
were S. aureus, S. pneumoniae, S. suis, S. agalactiae,
N. meningitidis, H. influenzae and E. coli. The nucleotide
sequences of the 16S rRNA genes of these bacteria were
retrieved and aligned to design broad range specific
LAMP assay primers using EXPLORER VERSION 4 (Eiken
Chemical Co., Ltd). We could not design any broad range
specific LAMP assay primers for all the seven bacteria due
to high level of variation in the target 16S rRNA gene
among species (Fig. 1a). Next, we repeatedly aligned the
target gene and designed broad range specific LAMP assay
primers each time removing each species. However, no
broad range specific LAMP assay primers were found for
the detection of any set of more than four bacterial species. Finally, we successfully designed a set of broad range
specific LAMP assay primers for the detection of four
species including S. aureus, S. pneumoniae, S. suis and
(a)
N.meningitidis
H.influenzae
S. pneumoniae
S. agalactiae
E. coli
S. aureus
S. suis
Consensus
N.meningitidis
H.influenzae
S. pneumoniae
S. agalactiae
E. coli
S. aureus
S. suis
Consensus
(b)
S. pneumoniae
S. agalactiae
S. aureus
S. suis
Consensus
S. pneumoniae
S. agalactiae
S. aureus
S. suis
Consensus
Fig. 1. Alignment of nucleotide sequences of the 16S rRNA genes of bacteria. The target gene of seven common bacteria of BM including
Neisseria meningitidis, Haemophilus influenzae, Streptococcus pneumoniae, Streptococcus agalactiae, Escherichia coli, Staphylococcus aureus and
Streptococcus suis (a) and four bacteria including S. pneumoniae, S. agalactiae, S. aureus and S. suis (b) were aligned to identify the highly
conserved regions, which were used for LAMP primers design. Consensus shown similar nucleotides in red colour was used to design a universal
set of LAMP primers for simultaneous detection of multiple bacteria.
FEMS Microbiol Lett 337 (2012) 25–30
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
28
N. T. Huy et al.
Table 1. LAMP primer sequences for simultaneous detection of
Streptococcus pneumoniae, Streptococcus agalactiae, Staphylococcus
aureus and Streptococcus suis
Primers
CGCTTTCG(C/A)(A/G)C(A/C)TCAGCGTCATGGAGGAA
CACC(A/G)GTGGC
CACGC(C/T)GTAAACGATGAGTGCTAGGC
GGAGTGCTTAATGC
CATGTGTAGCGGTGAAATGC
TCAACCTTGCGGTCGTACT
BIP
F3
B3
The limit of detection (CFU mL 1)
Bacteria
Sequence 5′–3′
FIP
Table 2. Sensitivities of LAMP and conventional PCR assays
S.
S.
S.
S.
LAMP assay
pneumoniae
suis
agalactiae
aureus
M
1
2
PCR assay
2
104
104
105
104
10
102
102
102
3
4
5
6
7
8
9
P
N
S. agalactiae (Fig. 1b). The name, positions and nucleotide sequences of all four primers are shown in Fig. 1b
and Table 1. The DNA sequence alignment of 16S rRNA
gene of these four species indicated a low variation
among these species.
Sensitivity and specificity of LAMP assay
The sensitivities of the broad range LAMP assay were performed by running 10-fold serial dilutions of target bacteria (from 107 to 100 CFU mL 1). The detection limit was
100 CFU mL 1 of S. pneumoniae by both real-time turbidimeter and electrophoresis of LAMP products, and
10 000 CFU mL 1 by conventional PCR method (Fig. 2).
Similarly, the broad range LAMP assay detected S. suis,
106 CFU mL–1
105 CFU mL–1
104 CFU mL–1
(a) 0.6
0.5
10 CFU mL
107 CFU mL–1
0.4
Turbidity
3
0.3
–1
102 CFU mL–1
0.2
0.1
0
–0.1
15
20
25
30
35
40
45
50
55
60
Time (min)
(b)
Fig. 3. Specificity of broad range LAMP assay. Two microlitre of
the DNA template (105 CFU mL 1) extracted from Staphylococcus
aureus (lane 1), Streptococcus pneumoniae serotype 3 (lane 2),
S. pneumoniae serotype 10 (lane 3), Streptococcus suis serotype 2-801 (lane 4), S. suis serotype 2-8-02 (lane 5), Streptococcus agalactiae
(lane 6), Haemophilus influenzae (lane 7), Escherichia coli (lane 8) and
Neisseria meningitidis (lane 9). Lane P, Positive control; lane N,
Negative control; and lane M, DNA size markers.
S. agalactiae and S. aureus at 100 CFU mL 1, while conventional PCR assay only detected these bacteria with
more than 104 CFU mL 1 (Table 2). The results of all
the positive samples detected by the LAMP assay were
achieved within 60 min.
The specificity of the LAMP assay was evaluated by
cross-reactivity test using DNA extracted from N. meningitidis, H. influenzae and E. coli. There were ladder-like
products amplified from S. pneumoniae, S. suis, S. agalactiae and S. aureus but not from N. meningitidis, H. influenzae and E. coli cultures (Fig. 3), suggesting that the
broad LAMP assay was specific for S. pneumoniae, S. suis,
S. agalactiae and S. aureus.
Visual detection of the LAMP products
Fig. 2. Sensitivity of broad range LAMP assay for the detection of
Streptococcus pneumoniae. LAMP reactions detected by real-time
turbidity (a) and electrophoresis of LAMP products and conventional
PCR products (b). The assay was performed in 10-fold serial dilutions
(from 107 to 100 CFU mL 1). Streptococcus pneumoniae with more
than 100 CFU mL 1 was detected by both real-time turbidimeter and
electrophoresis. The conventional PCR only detected S. pneumoniae
with more than 104 CFU mL 1.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
LAMP products were further explored by visual inspection based on the intercalation of fluorescent dye SYBR
Green I into amplified DNA. As shown in Fig. 4, the
product of positive reaction became visible under ultraviolet lamp and was green colour under naked eye, while
the negative product was not seen under ultraviolet lamp
and remained orange colour under day light.
FEMS Microbiol Lett 337 (2012) 25–30
29
Single-tube LAMP assay of bacterial meningitis
N
P
N
P
Fig. 4. Visual detection of LAMP products. Representative visual
inspection of Streptococcus pneumoniae by fluorescence under
ultraviolet lamp (left Streptococcus) and day light (right). (N), negative
control without DNA template; (P), positive reaction in the presence
of S. pneumoniae DNA template.
(a)
1
M
2
(b)
3
4
M
M
5
6
To our knowledge, this is the first study that developed
a broad range LAMP assay for simultaneous detection of
more than four different bacterial species. The sensitivity
of our LAMP assay was 100–1000 times higher compared
with the conventional PCR assay. The bacterial species
could be distinguished among S. pneumoniae, S. suis,
S. agalactiae and S. aureus based on the digested pattern
of the LAMP products with restriction enzymes of DdeI
and HaeIII. In addition, our method has several advantages over the current diagnostic methods. Firstly, the
method is rapid (c. 1 h) as compared with the real-time
PCR method which requires 6 h to run (Nadkarni et al.,
2002). Secondly, the LAMP method does not require
expensive fluorimeter and fluorogenic primers and
probes. Thirdly, the assay is simple and does not require
highly experienced technician. More importantly, the
assay can be performed in a water bath at bedside or in
rural areas. These advantages suggested that our broad
range LAMP assay would improve the early diagnosis and
treatment of BM, helping to reduce morbidity and mortality. Furthermore, the assay could detect bacterial species, helping to select an appropriate antibiotic therapy.
One limitation of our LAMP assay was that only four
species could be detected. A single-tube LAMP assay for
the detection of more than four species is under development using a mixture current broad range LAMP primers
and specific LAMP primers of other bacteria species.
Additional clinical studies are also required to validate
this new assay.
Conclusions
Fig. 5. The digested pattern of the LAMP products with restriction
enzymes using 2% agarose electrophoresis. (a) DdeI digestion
patterns of the LAMP products from Staphylococcus aureus (lane 1),
Streptococcus agalactiae (lane 2), Streptococcus pneumoniae (lane 3)
and Streptococcus suis (lane 4). (b) HaeIII digestion patterns of the of
the LAMP products from S. suis (lane 5) and S. agalactiae (lane 6).
Lane M is 100-bp ladder size markers.
Four common pathogen of BM including S. pneumoniae,
S. suis, S. agalactiae and S. aureus could be simultaneously detected using a broad range LAMP assay in single tube in < 1 h. The assay is highly sensitive, rapid and
simple and can be performed at bedside in healthcare
facilities.
Identification of bacterial species
To identify bacterial species, the LAMP product was
digested with specific restriction enzyme and analysed by
gel electrophoresis. After digested with DdeI, all LAMP
products were digested into several fragments. Staphylococcus aureus gave five bands at 55, 150, 197, 230 and
263 bp (Fig. 5a, lane 1). Streptococcus pneumoniae produced three bands at 55, 150 and 200 bp (Fig. 5a, lane
3). Streptococcus agalactiae (lane 2) and S. suis (lane 4)
gave similar pattern. Thus, the LAMP products of S. agalactiae and S. suis were further digested with HaeIII. The
result showed that S. agalactiae was digested into four
bands at 70, 216, 254 và 292 bp (Fig. 5b, lane 6), while
S. suis was not digested by HaeIII (Fig. 5b, lane 5).
FEMS Microbiol Lett 337 (2012) 25–30
Acknowledgements
We thank Dr Toru Kubo, from Department of Virology,
Institute of Tropical Medicine, Nagasaki University,
Nagasaki, Japan, for his technical advice. The authors
declare no competing interests of the manuscript due to
commercial or other affiliations. This study was supported in part by Japan Initiative for Global Research
Network on Infectious Diseases (J-GRID) for K.H.
Authors’ contributions
N.T.H and L.T.T.H. contributed equally to this work.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
30
References
Chiba N, Murayama SY, Morozumi M, Nakayama E, Okada T,
Iwata S, Sunakawa K & Ubukata K (2009) Rapid detection
of eight causative pathogens for the diagnosis of bacterial
meningitis by real-time PCR. J Infect Chemother 15: 92–98.
Corpet F (1988) Multiple sequence alignment with hierarchical
clustering. Nucleic Acids Res 16: 10881–10890.
Gray MW, Sankoff D & Cedergren RJ (1984) On the
evolutionary descent of organisms and organelles: a global
phylogeny based on a highly conserved structural core in
small subunit ribosomal RNA. Nucleic Acids Res 12:
5837–5852.
Hanaki K, Sekiguchi J, Shimada K, Sato A, Watari H, Kojima
T, Miyoshi-Akiyama T & Kirikae T (2011) Loop-mediated
isothermal amplification assays for identification of
antiseptic- and methicillin-resistant Staphylococcus aureus. J
Microbiol Methods 84: 251–254.
Kennedy WA, Chang SJ, Purdy K et al. (2007) Incidence of
bacterial meningitis in Asia using enhanced CSF testing:
polymerase chain reaction, latex agglutination and culture.
Epidemiol Infect 135: 1217–1226.
Kim DW, Kilgore PE, Kim EJ, Kim SA, Anh DD & Seki M
(2011) Loop-mediated isothermal amplification assay for
detection of Haemophilus influenzae type b in cerebrospinal
fluid. J Clin Microbiol 49: 3621–3626.
Kubo T, Agoh M, Mai le Q et al. (2010) Development of a
reverse transcription-loop-mediated isothermal amplification
assay for detection of pandemic (H1N1) 2009 virus as a
novel molecular method for diagnosis of pandemic
influenza in resource-limited settings. J Clin Microbiol 48:
728–735.
Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML & Pace NR
(1985) Rapid determination of 16S ribosomal RNA
sequences for phylogenetic analyses. P Natl Acad Sci USA
82: 6955–6959.
Lu JJ, Perng CL, Lee SY & Wan CC (2000) Use of PCR with
universal primers and restriction endonuclease digestions for
detection and identification of common bacterial pathogens
in cerebrospinal fluid. J Clin Microbiol 38: 2076–2080.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
N. T. Huy et al.
Mai NT, Hoa NT, Nga TV et al. (2008) Streptococcus suis
meningitis in adults in Vietnam. Clin Infect Dis 46:
659–667.
McKenna JP, Fairley DJ, Shields MD, Cosby SL, Wyatt DE,
McCaughey C & Coyle PV (2011) Development and clinical
validation of a loop-mediated isothermal amplification
method for the rapid detection of Neisseria meningitidis.
Diagn Microbiol Infect Dis 69: 137–144.
Nadkarni MA, Martin FE, Jacques NA & Hunter N (2002)
Determination of bacterial load by real-time PCR using a
broad-range (universal) probe and primers set. Microbiology
148: 257–266.
Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe
K, Amino N & Hase T (2000) Loop-mediated isothermal
amplification of DNA. Nucleic Acids Res 28: E63.
Pandit L, Kumar S, Karunasagar I & Karunasagar I (2005)
Diagnosis of partially treated culture-negative bacterial
meningitis using 16S rRNA universal primers and
restriction endonuclease digestion. J Med Microbiol 54:
539–542.
Saez-Llorens X & McCracken GH Jr (2003) Bacterial
meningitis in children. Lancet 361: 2139–2148.
Seki M, Yamashita Y, Torigoe H, Tsuda H, Sato S & Maeno
M (2005) Loop-mediated isothermal amplification method
targeting the lytA gene for detection of Streptococcus
pneumoniae. J Clin Microbiol 43: 1581–1586.
Tomita N, Mori Y, Kanda H & Notomi T (2008) Loopmediated isothermal amplification (LAMP) of gene
sequences and simple visual detection of products. Nat
Protoc 3: 877–882.
Yamazaki W, Taguchi M, Ishibashi M, Kitazato M, Nukina M,
Misawa N & Inoue K (2008) Development and evaluation
of a loop-mediated isothermal amplification assay for rapid
and simple detection of Campylobacter jejuni and
Campylobacter coli. J Med Microbiol 57: 444–451.
Zimmerli W (2005) How to differentiate bacterial from viral
meningitis. Intensive Care Med 31: 1608–1610.
FEMS Microbiol Lett 337 (2012) 25–30