Download HIV-1 incorporates ABO histo-blood group antigens

From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
IMMUNOBIOLOGY
HIV-1 incorporates ABO histo-blood group antigens that sensitize virions to
complement-mediated inactivation
Stuart J. D. Neil, Áine McKnight, Kenth Gustafsson, and Robin A. Weiss
ABO histo-blood group antigens have
been postulated to modify pathogen
spread through the action of natural antibodies and complement. The antigens
are generated by a polymorphic glycosyltransferase encoded by 2 dominant active and a recessive inactive allele. In this
study we investigated whether ABO sugars are incorporated into the envelope of
HIV-1 virions. HIV vectors derived from
cells expressing ABO antigens displayed
sensitivity to fresh human serum analogous to ABO incompatibility, and ABO
histo-blood group sugars were detected
on the viral envelope protein, glycoprotein 120 (gp120). Moreover, lymphocytederived virus also displayed serum sensitivity, reflecting the ABO phenotype of the
host when cultured in autologous serum
due to adsorption of antigens to cell
surfaces. Serum sensitivity required both
active complement and specific anti-ABO
antibodies. Thus, incorporation of ABO
antigens by HIV-1 may affect transmission of virus between individuals of discordant blood groups by interaction with
host natural antibody and complement.
(Blood. 2005;105:4693-4699)
© 2005 by The American Society of Hematology
Introduction
The ABO blood group system, discovered by Landsteiner1 more
than a century ago, is one of the best-studied polymorphic genetic
loci in the human genome.2 The blood group, a carbohydrate
antigen, is synthesized by allelic forms of a single glycosyltransferase that catalyses the addition of N-acetylgalactosamine (A) or
D-galactose (B) to a core fucosylated oligosaccharide generated by
the H transferase (fucosyltransferase 1; FUT1) product of the fut1
gene; the O group is found in individuals homozygous for a
prematurely truncated form of the ABO transferase and displays
the H phenotype without A or B. ABO antigens are incorporated
into the surface glycoproteins and glycolipids of red blood cells.
Also free glycolipids in the serum bearing ABO sugars can be
incorporated into membranes of other cells and tissues, including
lymphocytes that do not normally express the glycosyltransferases.3-5 In more than 80% of individuals in which the blood
group is present in secretions, ABO antigens are expressed on
epithelial mucosae, including those of the male and female genital
tract. The secretor phenotype is defined by the activity of a separate
H synthesizing enzyme, FUT2.2 Due to molecular mimicry by gut
flora, individuals acquire “natural” antibodies (mainly immunoglobulin M [IgM]) to the antigen structure that they do not
synthesize, which gives rise to transfusion incompatibility mediated by complement fixation by these antibodies. This process is
analogous to the hyperacute rejection of xenotransplants seen in
old world primates and humans due to their lack of a functional
␣(1-3)galactosyltransferase gene.6,7 Indeed ABO compatibility is
crucial for successful organ transplantation in humans; hence, ABO
antigens are now referred to as histo-blood group antigens.
The ABO transferase is evolutionarily old but acquired its
polymorphic nature during mammalian evolution.6 The selective
pressures that retain a balanced polymorphism are undefined, but
their role in modulating the spread and pathogenesis of infectious
disease has been postulated6,8 (and references therein). Bacteria and
viruses often coat themselves in carbohydrate structures to mask
their antigenic domains and ward off adaptive immune responses,
as well as using oligosaccharide moieties as attachment sites.
Notable examples are the enteric pathogens Norwalk-like caliciviruses and Helicobacter pylori that use carbohydrate blood group
antigens as cellular receptors on the gastric mucosa.9-12
In this study we address the question of whether ABO antigens
can be incorporated into the envelope of HIV-1. The surface
envelope protein of HIV-1, glycoprotein 120 (gp120), is highly
glycosylated, especially over the side of the molecule that faces
outward from the virion after trimerization during assembly,
protecting this area from neutralizing antibodies.13 Interestingly,
analyses of viruses that escape from neutralizing antibodies often
do so through repositioning of glycosylation sites in gp120.14
Although many of the N-linked carbohydrate groups of gp120 are
of the high mannose type, others have a mature structure,15,16 which
can act as substrates for ABO transferases. The presence of O-linked
sugars on gp120 has been suggested to be dependent on the host cell
(reviewed by Feizi17). The lipid envelope of HIV derived from the host
lymphocyte may also contain glycolipids as well as host cell glycoproteins such as major histocompatibility complex (MHC) class II and
complement regulatory proteins.18
Modification of viral glycosylation is known to render enveloped virions sensitive to natural antibody-mediated complement
lysis. Retroviruses, lentiviruses, and rhabdoviruses raised in nonprimate mammalian cells incorporate ␣(1-3)galactoside moieties that
sensitize them to human serum.7,19,20 Arendrup et al21 reported that
From the Wohl Virion Centre, Division of Infection and Immunity, University
College London, London, United Kingdom; and the Institute of Child Health,
University College London, London, United Kingdom.
The authors declare they have no competing financial interests.
Submitted November 12, 2004; accepted February 7, 2005. Prepublished
online as Blood First Edition Paper, February 22, 2005; DOI 10.1182/blood2004-11-4267.
Supported by the Medical Research Council, United Kingdom.
BLOOD, 15 JUNE 2005 䡠 VOLUME 105, NUMBER 12
Reprints: R. A. Weiss, Division of Infection and Immunity, University College
London, 46 Cleveland St, London W1T 6JH, United Kingdom; e-mail:
[email protected].
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
© 2005 by The American Society of Hematology
4693
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
4694
NEIL et al
HIV-1 IIIB derived from lymphocytes from an A donor could be
neutralized by mouse monoclonal antibodies to the A antigen.
Additionally, a recent study showed that measles virus grown in
cells overexpressing ABO transferases is sensitive to human sera in
an ABO-dependent manner.22 Incorporation of these antigens into
HIV-1 particles may determine the relative risk of transmission
between individuals of discordant blood groups. Recent studies
have shown that the presence of natural antibodies can have a
profound effect on the generation of cytotoxic T-cell responses
against pathogens.23 Such innate immune responses against sugar
structures on incoming viruses may also determine the speed at
which the adaptive immune response against HIV is generated and
thus help limit primary viral replication. We, therefore, sought to
analyze the incorporation of ABO antigens into HIV-1 virions and
their sensitivity to complement-mediated antibody-dependent
inactivation.
Materials and methods
Cell lines, lectins, and plasmids
293T cells were obtained from the American Tissue Culture Collection
(ATCC, Manassas, VA). The glioma cell line NP2 expressing CD4 and
CXC chemokine receptor 4 (CXCR4) or CC chemokine receptor 5 (CCR5)
have been described elsewhere24 and were kindly provided by H. Hoshino.
All cell lines were maintained in Dulbecco-modified Eagle Medium
(Invitrogen, Paisley, United Kingdom) supplemented with 10% fetal calf
serum (FCS) and 1000 U/mL penicillin and streptomycin. Fluorescein
isothiocyanate (FITC)–conjugated and biotinylated lectins selective for
blood group A (Bandeiraea simplicifolia BSI-A4, Helix pomatia), blood
group B (Bandeiraea simplicifolia BSI-B4), the H antigen (Ulex europeanus) and ␣(1-3)–linked galactoside (Bandeiraea simplicifolia BSI) were
obtained from Sigma, Poole, United Kingdom. Plasmid pSG encoding A
and B transferases25 were kindly provided by F. Yamamoto, La Jolla, CA,
and pcDNA encoding porcine ␣(1-3)␣galactosyltransferase26 was from C.
Porter (Institute of Cancer Research, London, United Kingdom). The H
transferase, FUT-1, was isolated from HeLa cells by reverse transcription–
polymerase chain reaction and cloned into pBabe-Puro as a BamH1-EcoR1
fragment using the primers GCGCGGATCCCGCCACCATGTGGCTCCGGAGCCAGTCG and GCGCGAATTCTCAAGGCTTAGCCAATGTCC.
Lentiviral vector plasmids pCSGW (vector genome expressing enhanced
green fluorescent protein [eGFP]) and p8.2 (HIV-1 packaging construct)
were kindly provided by M. Collins, United Kingdom, and the HXB2
gp160 envelope expression vector pSVIII-HXB2 was obtained from P.
Clapham, Worcester, MA.
Serum preparation
Fresh venous blood was drawn from healthy HIV-negative volunteers with
informed consent (in accordance with the Declaration of Helsinki) and
allowed to clot. We confirm that approval for the use of human serum from
healthy volunteers was granted to Professor R. Weiss by the University
College London Committee on Ethics (project ID 0335/001) in accordance
with the Helsinki Protocol. Sera from ABO-defined donors were pooled and
stored frozen until required. Total IgM was purified from serum using a
HiTrap IgM purification column (Nycomed Amersham, Buckinghamshire,
United Kingdom) as per the manufacturer’s instructions.
Virus propagation
HIV-1 IIIB and SF2 are T-cell line-adapted X4 strains, SF162 is an R5 using
primary isolate, 89.6 is a molecular clone derived from an R5 ⫻ 4 isolate,
and 2028 and 204427,28 are low-passage primary isolates that use R5 ⫻ 4
and X4, respectively. Peripheral blood mononuclear cells (PBMCs) were
prepared from ABO-defined donated buffy coats (National Blood Transfusion Service, Brentwood, United Kingdom) by Ficoll gradient centrifuga-
BLOOD, 15 JUNE 2005 䡠 VOLUME 105, NUMBER 12
tion. Purified PBMCs were stimulated with 50 ng/mL phytohemagglutinin
and cultured at 106 cells/mL in RPMI 1640/10% FCS or autologous human
serum for 2 days. The cells were then split and cultured for a further 3 days
in medium supplemented with 10 U/mL recombinant human interleukin 2
(Roche, Hertfordshire, United Kingdom). Cells (5 ⫻ 105) were then
exposed to 1 ⫻ 105 focus-forming units (FFU) of HIV-1 stocks for 2 hours
and cultured for 2 days. Infected cells were then cocultivated with fresh
PBMCs and grown for a further 3 to 5 days. For cells cultured in autologous
serum, fresh serum was added every 2 days. The cell supernatants were
cleared by centrifugation and snap-frozen in liquid nitrogen. Titers were
determined by serial dilution on NP2 cells expressing CD4 and the appropriate
coreceptor and processed as described under “Serum sensitivity assays.”
Production of HIV-1 vector pseudotypes
Subconfluent monolayers of 293T cells on 10-cm plates were transfected
with a total of 8 ␮g plasmid (pCSGW, p8.2, and pSVIII-HXB2 in weight
ratio of 3:2:1) using Fugene-6 (Roche). For blood group incorporation, the
cells were also cotransfected with pBabe-H, pSG-A, pSG-B, or pcDNA–␣(13)␣ galactosyltransferase (GT). Viral supernatants were harvested 48 hours
after transfection, filtered, and snap-frozen in liquid nitrogen. Viral titers
were determined on NP2/CD4/CXCR4 by fluorescence-activated cell
sorting (FACS) as described.29
Serum sensitivity assays
Dilutions of fresh human sera were mixed with 200 FFU of each virus, and
the serum concentration was adjusted to 10% with matched heat-inactivated
serum, in OptiMEM (Invitrogen). The virus was then incubated at 37°C for
1 hour and plated on NP2 cells expressing CD4 and the appropriate
coreceptor. After 2 hours of adsorption, the target cells were washed and
cultured for a further 72 hours in fresh medium. The monolayers were then
fixed in cold acetone/methanol (1:1 vol/vol) for 10 minutes and immunostained for in situ p24 expression as described previously.30 Titer was
determined by counting infected foci by microscopy. Assays using guinea
pig complement (Sigma) were performed by using reconstituted complement at 1:5. For assays using vectors, a multiplicity of infection (MOI) of
0.3 as determined on NP2 cells was used as input in the above assay. Virus
infection was determined by eGFP expression by FACS 72 hours later.
Envelope Western blot
293T-produced vectors (10 mL) were pelleted by ultracentrifugation at
25 000g for 1 hour and resuspended in phosphate-buffered saline. A volume
of 10 ␮L of each sample was separated on a 10% sodium dodecyl
sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gel, transferred to
an enhanced chemiluminescence (ECL) membrane (Amersham, Buckinghamshire, England), and blocked in tris-buffered saline (TBS) containing
5% bovine serum albumin (BSA) and 0.1% Tween-20. Glycosylated viral
proteins were detected using ABO selective biotinylated lectins (10 ␮g/mL)
and streptavidin-linked horseradish peroxidase (HRP). HIV-1 proteins were
detected using a 1:2000 dilution of 3 sera from HIV-1–positive individuals
and an HRP-linked rabbit anti–human polyclonal antibody. Visualization of
the blots was by ECL reagent (Nycomed-Amersham).
Capture assay for gp120
A modified version of a gp120 capture enzyme-linked immunosorbent
assay (ELISA) was used to detect ABO sugars on gp120.31 Virus was lysed
in 0.5% empigen, and dilutions incubated on Maxisorb plates coated with a
gp120 monoclonal antibody D7146 (National Institute for Biological
Standards and Control [NIBSC], Hertfordshire, United Kingdom). Immobilized gp120 was then detected with either biotinylated ABO selective
lectins or anti–HIV-1 human sera, followed by streptavidin-linked alkaline
phosphate (AP; Nycomed Amersham) or AP linked to a goat anti–human
polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA), and
developed using the LumiPhos reagent. The relative luminescence was the
read on a Lucy Luminometer (Rosys Anthos, Hombrechtikon, Austria).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 JUNE 2005 䡠 VOLUME 105, NUMBER 12
HIV INCORPORATES ABO BLOOD GROUPS
4695
Flow cytometry
ABO antigens were detected on cell surfaces using FITC-conjugated
BSI-B4 or U europeanus (Sigma) at 5 ␮g/mL in phosphate-buffered saline
(PBS) plus 5% BSA and 0.05% sodium azide. For blood group A, a mouse
anti-A monoclonal IgG (Dako, Glostrup, Denmark) was used followed by a
FITC-labeled goat anti–mouse polyclonal antibody. The cells were then
analyzed on a FACScan (Becton Dickinson, San Jose, CA) using the
Cellquest software.
Results
ABO transferase expression in HIV-producing cells leads to
histo-blood group antigens associated with gp120
The HIV-1 envelope proteins gp120 and gp41 are highly glycosylated during synthesis. Gp120 itself is both N- and O-glycosylated,
especially on its outer face, an area known to exploit glycosylation
for immune evasion.13,32 293T cells were transfected with expression vectors encoding either A or B transferases in combination
with the H transferase, or the mammalian ␣(1-3)galactosyltransferase, known to modify gp120 glycosylation,20 as a control.
HIV-based vectors pseudotyped with the CXCR4-using gp120
HXB2 and packaging an eGFP reporter genome were raised in
these cells in serum-free medium, and titers were established on the
indicator cells, NP2/CD4/CXCR4, by FACS detection of GFPpositive cells. Cotransfection of ABO and H transferases had no
effect on output viral infectivity with all titers between 4 and
5 ⫻ 105 IU/mL (not shown). A gp120 capture ELISA31 was
modified to detect ABO sugars using A- or B-selective lectins. The
HIV vector stocks were equalized by titer, detergent disrupted, and
soluble gp120 was captured by immobilized antibody. Pooled
human sera from HIV-1⫹ individuals was used to detect the capture
of gp120 and demonstrated that all stocks contained similar levels
of the envelope protein (Figure 1A). The biotinylated A-selective
lectin from Helix pomatia (H pom) was used to detect gp120associated A antigen, with binding only detectable on envelope
from A-transfected 293T cells. The B-selective lectin, BSI-B4,
reacted strongly with envelope from B transfectants but not with A
and O transfectants. The ␣(1-3)Gal (galactosyl) lectin BSI reacted
both against virus from ␣(1-3)␣GalT (galactosyltransferase) and
B-transfected cells. While these lectins can bind to other carbohydrate antigens (eg, the Ty antigen for H pom), the reactivity for a
particular lectin for gp120 was dependent on the transfection of the
specific ABO glycosyltransferase.
These results indicated that ABO transferases add blood group
antigens to gp120. Pelleted virions from transfected cells were
lysed, and viral proteins were separated by SDS-PAGE and
detected by Western blot with lectins or serum from an HIV-1–
infected individual. Virus produced from A-expressing cells yielded
a band of 120 kDa with the H pomatia, whereas BSI gave 120-kDa
bands in the B and ␣(1-3)␣GalT transfectants. The total gp120
loading was equal in all lanes, and the lectin bands were dependent
on specific transfection with viral components (Figure 1B). Thus,
in cells expressing ABO transferases, HIV-1 gp120 can be modified
to carry blood group moieties.
ABO-dependent serum sensitivity of HIV vectors
The mammalian ␣(1-3)␣GalT when expressed in human cells
modifies the glycosylation of lentiviral envelope proteins, and
virions become sensitive to complement fixation by natural antibodies in human serum.20 To see whether the same was true of human
Figure 1. Expression of ABO transferases in cells producing HIV-1 particles
leads to incorporation of ABO antigens into viral envelopes. (A) HIV-1–based
vectors pseudotyped with the HXB2 envelope were produced in 293T cells cotransfected with the H (giving the O blood group) and A or B transferases, or the porcine
␣(1-3)galactosyltransferase. The envelope protein, gp120, from vectors was captured by immobilized anti-gp120 antibody. Captured ABO sugar was then detected
with biotinylated ABO selective lectins H pomatia (A), BSI-B4 (B), or BSI (B and
␣(1-3)galactoside), or anti–HIV-1 human sera as a loading control. Background lectin
binding was controlled by capturing media from ABO-expressing virus-negative 293T
cells. Binding was detected by streptavidin-conjugated alkaline phosphates and
expressed as relative light units. (B) Viral lysate was separated on a 10% SDS-PAGE
gel and Western blotted using the same reagents as in panel A, this time detecting
antigen with streptavidin-linked horseradish peroxidase. ABO-expressing 293T cell
supernatant was used as a negative control. Arrows represent the 113-kDa molecular
weight marker.
ABO transferases, the HIV vector stocks were assessed for
sensitivity to human sera from ABO-defined donors. A volume of
2 ⫻ 104 IU of vector (MOI of 0.3) was incubated with 10% or 1%
active human serum diluted in matched heat-inactivated serum.
Serum sensitivity was expressed as the percentage of GFP-positive
NP2 cells compared with virus incubated in 10% heat-inactivated
serum (Figure 2). O vectors (those produced only in the presence of
the H transferase) were not sensitive to inactivation in any sera.
Vector raised in cells cotransfected with the A transferase was
partially sensitive to inactivation by sera from O and B donors but
not in A serum. Conversely, vector raised in B transfectants was
partially sensitive in O and A sera but not in B serum. To control for
variation in complement in donor sera, vector raised in ␣(13)␣GalT–transfected cells was tested for human serum sensitivity,
which, as expected, was equally sensitive in all sera. These results
indicate that expression of ABO transferases in HIV-1–producing
cells sensitizes virus to human complement-mediated inactivation
in a manner consistent with the incorporation of ABO antigens into
the virion.
HIV-1 isolates propagated in PBMCs from ABO-defined donors
are sensitive to anti-ABO sera
Lymphocytes do not normally express ABO and H transferases, but
ABO-glycosylated lipids in the serum can be incorporated into cell
membranes. Therefore, lymphocytes can passively acquire these
antigens from sera.2 We postulated that HIV-1 grown in PBMCs
cultured in autologous serum might acquire the blood group of that
individual. PBMCs were isolated from O, A, or B donors and
cultured in human serum from A or B donors. The presence of free
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
4696
BLOOD, 15 JUNE 2005 䡠 VOLUME 105, NUMBER 12
NEIL et al
complement. Total IgM was purified from donor serum and diluted
to 10 ␮g/mL, 5 ␮g/mL, 1 ␮g/mL, and 0.1 ␮g/mL and added to
SF2-A in the presence of active or inactive guinea pig complement
(Figure 5B). While none of the IgMs neutralized virus in the
presence of inactive complement (not shown), IgM from O and B
donors, but not A, inactivated up to 60% of SF2-A when mixed
with active complement, and this effect titrated out with IgM
concentration. By contrast, virus derived from ␣GalT-transfected
cells was sensitive to IgM from all sera when mixed with
complement, and this inactivation was stronger, a reflection of the
levels of anti-␣Gal IgM in human serum. These results showed that
both anti–carbohydrate antibody and complement were required
for the observed viral inactivation, and thus incorporation of ABO
antigens by viral particles sensitizes them to serum inactivation
analogous to transfusion incompatibility.
Figure 2. Serum sensitivity of HIV-1 vectors encoding eGFP and pseudotyped
with the HIV-1 envelope HXB2 produced from cells cotransfected with ABO
expression vectors. Vectors were harvested in serum-free medium and titer was
determined. An MOI of 0.3 was incubated with 10% or 1% active sera from
blood-typed donors for 1 hour at 37°C and plated onto NP2/CD4/X4 target cells. The
number of GFP-expressing cells was determined by FACS 48 hours later and is
shown as the percentage of infected cells compared with a matched heat-inactivated
control. f indicates type O serum; 䡺, type A serum, and u, type B serum. Error bars
indicate ⫾ SEM.
antigen in the sera was confirmed by their ability to block BSI-A4–
or BSI-B4–mediated agglutination of A⫹ or B⫹ red blood cells (not
shown). All PBMCs were positive for the H antigen as determined
by Ulex lectin staining (Figure 3). In addition, PBMCs cultured in
A serum, but not B serum, displayed immunoreactivity using a
monoclonal anti-A antibody. Conversely, culture in B serum, but
not A serum, conferred staining using the B-selective lectin BSI-B4
compared with the background on PBMCs cultured in O serum.
This confirmed that ABO antigens could be passively acquired by
PBMCs from serum3-5 and, thus, possibly by virions derived under
these culture conditions.
The R5-using isolate SF162, the dual-tropic R5 ⫻ 4 isolates
2028 and 89.6, and the X4-using laboratory strain SF-2 of HIV-1
were then propagated in PBMCs cultured in autologous serum, and
fresh serum was supplemented every 2 days. We assessed 200 FFU
of each virus for serum sensitivity in ABO sera as in Figure 2. A
similar pattern of serum sensitivity was observed for all the isolates
(Figure 4A-B). Viruses propagated in cells from an A donor were
sensitive in O and B sera, whereas virus from a B donor was
inactivated by O and A sera. As expected, virus from O donors was
insensitive to all sera, whereas virus from AB donors was sensitive
in all test sera. We saw no ABO-dependent virus inactivation by
heat-inactivated sera (not shown), implying that all the inactivation
was complement dependent. Therefore, HIV-1 derived from donor
PBMCs, a primary cell target of the virus, acquired the “blood
group” of the donor.
Discussion
In this report we demonstrate that HIV-1 virions can incorporate
ABO blood group antigens, both in an artificial transfection system
and, more importantly, when primary strains are propagated in
human PBMCs. In cells expressing the transferases that synthesize
the antigen, progeny virions incorporated the blood group associated in part with the envelope protein gp120. In PBMCs, which do
Anti-ABO antibodies are required for viral serum sensitivity
To demonstrate that the serum sensitivity observed was anti-ABO
antibody dependent, the assays were repeated with soluble
A-trisaccharide as a competitive inhibitor. HIV-1 SF-2 derived
from an A donor was sensitive in O serum but not in A, as expected.
However, addition of excess soluble A abrogated this serum
sensitivity in O serum without any effect in A serum (Figure 5A).
This finding demonstrated that an A binding factor in O serum was
responsible for the viral inactivation by complement.
Anti-ABO and anti-␣Gal antibodies found in sera are mainly
IgM and IgG, with IgM being the most efficient at fixing
Figure 3. Passive acquisition of ABO antigens from human serum by PBMCs.
PBMCs isolated from O, A, or B donors were cultured in 10% human serum from
individuals of blood group A or B. The cells were stained for blood group antigen
expression using the H-specific lectin (Ulex), a blood group A-specific monoclonal
antibody, or the B-selective lectin BSI-B4 (open curves) compared with negative
controls (shaded curves), no lectin (H antigen), isotype antibody (anti-A), or the same
cells cultured in O serum (B lectin). Both lectins were FITC-conjugated, and a
secondary anti-mouse FITC was used for the anti-A staining.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 JUNE 2005 䡠 VOLUME 105, NUMBER 12
Figure 4. Serum sensitivity of HIV-1 propagated in PBMCs from ABO-defined
donors. (A) Serum sensitivity of SF162 grown in PBMCs from ABO-secreting donors
in the presence of autologous serum. Virus (200 FFU) was incubated for 1 hour at
37°C with varying concentrations of donor serum diluted against a constant
background of matched heat-inactivated serum so that total serum concentration was
10%. The viruses were then plated onto target NP2CD4CCR5 cells, and virus
infection was scored by in situ p24 staining 72 hours later. The results are expressed
as the percentage of viral infection compared with the matched HI control. Diamonds
(䉬), squares (f), and triangles (Œ) represent viral infections in the presence of O, A,
or B sera, respectively. Error bars represent ⫾ SEM. (B) HIV-1 89.6, 2028, or SF-2
from ABO-defined PBMCs were treated as in panel A. Results represent the
percentage infection of these viruses in 10% O (f), A (䡺), and B (u) serum compared
with a matched HI control.
not usually express these enzymes, the antigens could be acquired
passively from the serum. The presence of these antigens sensitizes
the virus to the serum of ABO distinct individuals by the action of
heat labile complement in conjunction with anti-AB antibodies.
The sensitivity, while weak, resembles transfusion incompatibility
and may have implications for the relative risk of transmission
between individuals of different blood groups.
Arendrup et al21 demonstrated neutralization of HIV-1 from an
A donor with a mouse monoclonal anti-A. With the monoclonals
available to us, however, we failed to detect any neutralization in
our system (not shown), and, furthermore, heat-inactivated serum
failed to neutralize the viruses in our assays. Our data are consistent
with a recent report showing that measles virus raised in HeLa
cells, transfected with A or B transferases, was serum sensitive in
an ABO-dependent manner.22 The level of inactivation (around
40%-50%) was similar in this study.
Importantly, we have extended our studies to show that HIV-1
grown in primary lymphocytes supplemented with autologous
serum acquire ABO antigens. While lymphocytes do not normally
express ABO transferases, they can acquire the antigens passively
from serum.3-5 Consistent with this, viruses derived from PBMCs
grown in autologous sera displayed ABO sensitivity. Arendrup et
al21 have also speculated that blood group expression may be
HIV INCORPORATES ABO BLOOD GROUPS
4697
induced during viral replication in T cells. We are currently
investigating this possibility.
It is interesting to note that, while much research has been
devoted to searching for genetic factors that confer resistance to
HIV-1 transmission, the most notable being the MHC and CCR5
loci,33,34 little is known about the role that some of the most
well-studied blood group polymorphisms may play in viral transmission. The sensitivity of cells expressing ␣(1-3)␣-galactosyltransferase, and viruses derived from them, to human sera is a major
barrier to xenotransplantation and zoonosis because up to 5% of
total IgM reacts against this antigen.19 Similarly, anti-ABO responses are strong enough to lead to life-threatening hemolytic
shock and transplant rejection. ABO antigens can be added to both
N- and O-linked glycans. While many N-linked glycans of gp120
are highly mannosylated, the majority of the O-linked glycans have
mature structures.15-17 The HIV envelope is known to contain
cellular glycoproteins and glycolipids,18 which may also carry
sugar antigens. It should be borne in mind that the incorporation of
the complement regulatory proteins, CD55 and CD59, are known
to help protect virions from complement attack,35 and the relative
weakness of the serum sensitivity observed might reflect this.
The question these results raise is how relevant are “natural”
immune responses to the transmission of HIV-1 between individuals? The reason for the evolution of the ABO blood group system is
at present unknown. Higher primates and humans have acquired
polymorphisms in highly conserved enzymes that lead to transfusion incompatibility by antibodies generated in response to molecular mimicry of sugar antigens by gut flora.36 The maintenance of
these polymorphisms, and their variable frequencies in different
populations, implies that a variety of selective pressures act on
these genes. A current theory is that ABO polymorphisms are
maintained by the actions of infectious agents.6 Variation in ABO
transferases may be driven by parasites that use specific sugar
moieties, highlighted by the discovery that this family of sugar
Figure 5. Purified IgM confers ABO serum sensitivity to virions. (A) Inhibition of
serum inactivation by excess soluble blood group antigens. SF-2 virus grown in
PBMCs from an A donor was assayed for serum sensitivity in O and A sera as before,
in the presence or absence of 10 ␮g soluble A trisaccharide. (B) IgM from ABO sera
differentially sensitizes virus to guinea pig complement. SF-2 derived from an A donor
was incubated with varying concentrations of IgM purified from ABO-defined donor
sera in the presence of active guinea pig complement (C⬘) or a heat-inactivated
control. Diamonds (䉬), squares (f), and triangles (Œ) represent viral infections in the
presence of IgM from O, A, or B sera, respectively. HIV-1 NL4-3 raised in 293T cells
transfected with ␣Gal(1-3)galactosyltransferase was treated similarly as a control for
antibody-dependent serum sensitivity. Both viruses were plated on NP2CD4X4 cells
and processed as before.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
4698
BLOOD, 15 JUNE 2005 䡠 VOLUME 105, NUMBER 12
NEIL et al
antigens serve as attachment factors for Norwalk-like viruses9,10,37
and H pylori11,12 on the gastric mucosa.
We postulate an additional role for infectious agents to maintain
these polymorphisms. Selective transfer of pathogens between
individuals of different ABO blood groups may have to surmount a
natural immune barrier to transmission.38 Pathogens that have a
glycosylation pattern, or acquire one from their host, that resembles
that given by one ABO group, will be at an inherent disadvantage
when transmitted to individuals of a different blood group. This
may act at the level of restricting pathogen entry to the host by
direct neutralization/serum inactivation. In addition, opsonization
of pathogens by natural antibodies and complement may induce
more rapid phagocytosis by antigen-presenting cells and induction
of adaptive immunity.23,39 Interestingly, in some studies of respiratory pathogens, most notably influenza, transmission between
individuals varied with ABO blood group,40 as did mean antibody
titers and duration of symptoms.41
Blood group secretors express ABO antigens on mucosal
epithelia, including those of the male and female reproductive
tracts, and these antigens are released into fluid secretions.2 Our
results suggest that viral replication in these mucosal tissues could
lead to either direct envelope glycosylation from an antigenexpressing infected cell or the acquisition of these antigens from
the mucosal secretion by infected lymphocytes. Either way, this
blood group phenotype could be carried by these virions during
transfer to the next host. In this case the possession of a functional
fut2 (Secretor transferase) gene will govern the ABO incorporation.
Interestingly, secretor status has been shown to have an affect on
HIV-1 transmission risk in a cohort of Senegalese sex workers,42
although ABO was not tested in this study.
Opsonization by natural antibodies may also lead to antibodyand complement-mediated enhanced infection of phagocytes.43
Since phagocytic macrophages and dendritic cells are HIV-1
targets and express antibody and complement receptors, opsoniza-
tion of virions by anti-A or -B antibodies may enhance infection of
these cells. In this case, the potential effect of ABO incompatibility
would be detrimental to the host. This possibility requires in vitro
and epidemiologic investigations.
Should ABO polymorphisms play a protective role, one might
expect to see underrepresentation of a particular blood group
among infected patients. For example, individuals of blood group
O may be less likely to acquire HIV from an A partner due to
circulating anti-A. Thus, small effects, such as antibody/complement reactions against discordant ABO antigens on incoming
virions, may allow more efficient control of primary viral infections. This may also be apparent in parenteral infections, whereby
virus is injected directly into the blood stream. Protection from
infection solely by this route seems unlikely. Where ABO has been
speculated to influence viral infections, the difference in representations has been low, but the mean duration of symptoms has
differed. This raises another scenario. It is now well established that
effective control of primary HIV-1 replication in the host determines the viral load set point and the time to disease progression.44
That this is mainly due to the action of cytotoxic T cells may imply
that the faster the adaptive immune response recognizes the virus in
the context of inflammatory activators such as complement components, the more effective the control of primary replication. Innate
immune responses play a determining role in the efficient induction
of adaptive immunity.23,45 We are currently determining whether
any ABO group is overrepresented among long-term nonprogressors or multiply exposed seronegative individuals.
Acknowledgments
We thank Keith Aubin technical assistance and Elaine Thomas, Mary
Collins, and Colin Porter for helpful advice and gifts of reagents.
References
1. Landsteiner K. Ueber Agglutinationserscheinungen normalen menschlichen Blutes. Wiener Klinische Wochenschrift. 1901;46:1132-1134.
2. Daniels G. Human Blood Groups. 2nd ed. Malden, MA: Blackwell; 2002.
3. Mollicone R, Caillard T, Le Pendu J, et al. Expression of ABH and X (Lex) antigens on platelets and
lymphocytes. Blood. 1988;71:1113-1119.
4. Dunstan RA. Status of major red cell blood group
antigens on neutrophils, lymphocytes and monocytes. Br J Haematol. 1986;62:301-309.
5. Bernoco M, Danilovs J, Terasaki PI, et al. Detection of combined ABH and Lewis glycosphingolipids in sera of H-deficient donors. Vox Sang. 1985;
49:58-66.
6. Gagneux P, Varki A. Evolutionary considerations
in relating oligosaccharide diversity to biological
function. Glycobiology. 1999;9:747-755.
7. Takeuchi Y, Porter CD, Strahan KM, et al. Sensitization of cells and retroviruses to human serum
by (alpha 1-3) galactosyltransferase. Nature.
1996;379:85-88.
8. Haldane JBS. Disease and Evolution. Symposium sui fattori ecologia e genetici della specilazione negli animali, Supplemento a la Ricerca
Scientifica Anno 19th; 1949:66-75.
9. Harrington PR, Lindesmith L, Yount B, Moe CL,
Baric RS. Binding of Norwalk virus-like particles
to ABH histo-blood group antigens is blocked by
antisera from infected human volunteers or experimentally vaccinated mice. J Virol. 2002;76:
12335-12343.
10. Lindesmith L, Moe C, Marionneau S, et al. Hu-
man susceptibility and resistance to Norwalk virus infection. Nat Med. 2003;9:548-553.
11. Boren T, Falk P, Roth KA, Larson G, Normark S.
Attachment of Helicobacter pylori to human gastric epithelium mediated by blood group antigens.
Science. 1993;262:1892-1895.
12. Aspholm-Hurtig M, Dailide G, Lahmann M, et al.
Functional adaptation of BabA, the H. pylori ABO
blood group antigen binding adhesin. Science.
2004;305:519-522.
13. Wyatt R, Kwong PD, Desjardins E, et al. The antigenic structure of the HIV gp120 envelope glycoprotein. Nature. 1998;393:705-711.
14. Wei X, Decker JM, Wang S, et al. Antibody neutralization and escape by HIV-1. Nature. 2003;
422:307-312.
15. Mizuochi T, Matthews TJ, Kato M, et al. Diversity
of oligosaccharide structures on the envelope
glycoprotein gp 120 of human immunodeficiency
virus 1 from the lymphoblastoid cell line H9. Presence of complex-type oligosaccharides with bisecting N-acetylglucosamine residues. J Biol
Chem. 1990;265:8519-8524.
16. Mizuochi T, Spellman MW, Larkin M, Solomon J,
Basa LJ, Feizi T. Carbohydrate structures of the
human-immunodeficiency-virus (HIV) recombinant envelope glycoprotein gp120 produced in
Chinese-hamster ovary cells. Biochem J. 1988;
254:599-603.
17. Feizi T. Glycobiology of AIDS. In: Ernst B, Hart G,
Sinay P, eds. Carbohydrates in Chemistry and
Biology. Weinheim: Wiley-VCH; 2000:851-866.
18. Ott DE. Potential roles of cellular proteins in
HIV-1. Rev Med Virol. 2002;12:359-374.
19. Rother RP, Squinto SP. The alpha-galactosyl
epitope: a sugar coating that makes viruses and
cells unpalatable. Cell. 1996;86:185-188.
20. Takeuchi Y, Liong SH, Bieniasz PD, et al. Sensitization of rhabdo-, lenti-, and spumaviruses to human serum by galactosyl(alpha1–3)galactosylation. J Virol. 1997;71:6174-6178.
21. Arendrup M, Hansen JE, Clausen H, Nielsen C,
Mathiesen LR, Nielsen JO. Antibody to histoblood group A antigen neutralizes HIV produced
by lymphocytes from blood group A donors but
not from blood group B or O donors. AIDS. 1991;
5:441-444.
22. Preece AF, Strahan KM, Devitt J, Yamamoto F,
Gustafsson K. Expression of ABO or related antigenic carbohydrates on viral envelopes leads to
neutralization in the presence of serum containing specific natural antibodies and complement.
Blood. 2002;99:2477-2482.
23. Stager S, Alexander J, Kirby AC, et al. Natural
antibodies and complement are endogenous adjuvants for vaccine-induced CD8⫹ T-cell responses. Nat Med. 2003;9:1287-1292.
24. Soda Y, Shimizu N, Jinno A, et al. Establishment
of a new system for determination of coreceptor
usages of HIV based on the human glioma NP-2
cell line. Biochem Biophys Res Commun. 1999;
258:313-321.
25. Yamamoto F, Hakomori S. Sugar-nucleotide donor specificity of histo-blood group A and B transferases is based on amino acid substitutions.
J Biol Chem. 1990;265:19257-19262.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 JUNE 2005 䡠 VOLUME 105, NUMBER 12
26. Strahan KM, Gu F, Preece AF, Gustavsson I,
Andersson L, Gustafsson K. cDNA sequence and
chromosome localization of pig alpha 1,3 galactosyltransferase. Immunogenetics. 1995;41:101105.
27. Simmons G, Wilkinson D, Reeves JD, et al. Primary, syncytium-inducing human immunodeficiency virus type 1 isolates are dual-tropic and
most can use either Lestr or CCR5 as coreceptors for virus entry. J Virol. 1996;70:8355-8360.
28. Simmons G, Reeves JD, McKnight A, et al.
CXCR4 as a functional coreceptor for human immunodeficiency virus type 1 infection of primary
macrophages. J Virol. 1998;72:8453-8457.
29. Neil S, Martin F, Ikeda Y, Collins M. Postentry restriction to human immunodeficiency virus-based
vector transduction in human monocytes. J Virol.
2001;75:5448-5456.
30. McKnight A, Clapham, PR, Schulz, TF. Detection
of HIV entry into cells. In: Karn J, ed. HIV: a practical approach. Vol 1. Oxford: IRL Press; 1995:
130-141.
HIV INCORPORATES ABO BLOOD GROUPS
gp120 envelope glycoprotein in complex with the
CD4 receptor and a neutralizing human antibody.
Nature. 1998;393:648-659.
33. O’Brien SJ, Moore JP. The effect of genetic variation in chemokines and their receptors on HIV
transmission and progression to AIDS. Immunol
Rev. 2000;177:99-111.
34. Carrington M, O’Brien SJ. The influence of HLA
genotype on AIDS. Annu Rev Med. 2003;54:535551.
35. Saifuddin M, Hedayati T, Atkinson JP, Holguin
MH, Parker CJ, Spear GT. Human immunodeficiency virus type 1 incorporates both glycosyl
phosphatidylinositol-anchored CD55 and CD59
and integral membrane CD46 at levels that protect from complement-mediated destruction.
J Gen Virol. 1997;78(Pt 8):1907-1911.
36. Martinko JM, Vincek V, Klein D, Klein J. Primate
ABO glycosyl-transferases: evidence for transspecies evolution. Immunogenetics. 1993;37:
274-278.
31. Moore JP, Jarrett RF. Sensitive ELISA for the
gp120 and gp160 surface glycoproteins of HIV-1.
AIDS Res Hum Retroviruses. 1988;4:369-379.
37. Hutson AM, Atmar RL, Marcus DM, Estes MK.
Norwalk virus-like particle hemagglutination by
binding to H histo-blood group antigens. J Virol.
2003;77:405-415.
32. Kwong PD, Wyatt R, Robinson J, Sweet RW, Sodroski J, Hendrickson WA. Structure of an HIV
38. Seymour RM, Allan MJ, Pomiankowski A, Gustafsson K. Evolution of the human ABO polymor-
4699
phism by two complementary selective pressures. Proc R Soc Lond B Biol Sci. 2004;271:
1065-1072.
39. Ochsenbein AF, Zinkernagel RM. Natural antibodies and complement link innate and acquired
immunity. Immunol Today. 2000;21:624-630.
40. Aho K, Pyhala R, Visakorpi R. ABO associated
genetic determinant in H1N1 influenza. Tissue
Antigens. 1980;16:310-313.
41. Naikhin AN, Katorgina LG, Tsaritsyna IM, et al.
[Indicators of collective immunity to influenza depending on the blood group and sex of the population]. Vopr Virusol. 1989;34:419-423.
42. Ali S, Niang MA, N’Doye I, et al. Secretor polymorphism and human immunodeficiency virus
infection in Senegalese women. J Infect Dis.
2000;181:737-739.
43. Sullivan NJ. Antibody-mediated enhancement of
viral disease. In: Burton DR, ed. Antibodies in Viral Infection: Current Topics in Microbiology and
Immunology. Berlin, Germany: Springer; 2002:
145-169.
44. Fauci AS. HIV and AIDS: 20 years of science. Nat
Med. 2003;9:839-843.
45. Medzhitov R, Janeway CA Jr. Innate immune recognition and control of adaptive immune responses. Semin Immunol. 1998;10:351-353.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2005 105: 4693-4699
doi:10.1182/blood-2004-11-4267 originally published online
February 22, 2005
HIV-1 incorporates ABO histo-blood group antigens that sensitize
virions to complement-mediated inactivation
Stuart J. D. Neil, Áine McKnight, Kenth Gustafsson and Robin A. Weiss
Updated information and services can be found at:
http://www.bloodjournal.org/content/105/12/4693.full.html
Articles on similar topics can be found in the following Blood collections
Immunobiology (5489 articles)
Transfusion Medicine (278 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.