Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Name_____________________________________ Section_______ TA_____________ 7.012 Problem Set 4 Please print out this problem set and answer the questions on the printout. Answers to this problem set are to be turned in at the box outside 68-120 before 3:00, Friday Oct 10th. Problem sets will not be accepted late. Solutions will be posted at: http://stellar.mit.edu/S/course/7/fa08/7.012/index.html Question 1 Below is a partial sequence of a coding region, base pairs 61-102 of a 600 base pair open reading frame. The underlined codon indicates the correct reading frame of this gene. 61 102 5’ ATCTGGGCTAATACCGCCAACTATATAAACACCCACATTTCG 3’ 3’ TAGACCCGATTATGGCGGTTGATATATTTGTGGGTGTAAAGC 5’ a) What is the mRNA sequence within this region. b) What peptide does this part of the mRNA encode? c) How does the resulting peptide change if the sequence is altered as shown below? Also identify the type of mutation. i) original: altered: 5’ ATCTGGGCTAATACCGCCAACTATATAAACACCCACATTTCG 3’ 5’ ATCTGGGCTAACACCGCCAACTATATAAACACCCACATTTCG 3’ ii) original: altered: 5’ ATCTGGGCTAATACCGCCAACTATATAAACACCCACATTTCG 3’ 5’ ATCTGGGCTAATACCGCCAACTATTAAAACACCCACATTTCG 3’ iii) original: altered: 5’ ATCTGGGCTAATACCGCCAACTATATAAACACCCACATTTCG 3’ 5’ ATCTGGGCTAAAACCGCCAACTATATAAACACCCACATTTCG 3’ 1 Name_____________________________________ Section_______ TA_____________ Question 1 continued iv) original: altered: (delete 6 base pairs) 5’ ATCTGGGCTAATACCGCCAACTATATAAACACCCACATTTCG 3’ 5’ ATCTGGGCTAATACC------TATATAAACACCCACATTTCC 3’ v) 5’ ATC--TGGGCTAATACCGCCAACTATATAAACACCCACATTTCG 3’ 5’ ATCATTGGGCTAATACCGCCAACTATATAAACACCCACATTTCC 3’ original: altered: (insert 2 base pairs) d) Of the various mutations given above, which one(s) would most dramatically affect the function of the protein encoded by this gene? Explain your answer. 2 Name_____________________________________ Section_______ TA_____________ Question 2 You discover a type of bacteria that is able to tolerate high levels of toxic compounds such as toluene. Realizing the commercial importance of these bacteria you decide to characterize the pathway that allows them to tolerate toxic levels of toluene. You discover three distinct enzymes enzyme A, B and C that are expressed at high levels when the bacterial cells encounter toluene. These enzymes then act sequentially to convert toluene into less toxic intermediates and finally to glycerides that serve as the building blocks for lipids. The genes encoding these three enzymes are organized into an operon as shown below. REG Promoter for regulator protein Enzyme A Enzyme B Enzyme C W region Promoter for enzymes A, B , and C Assume that the regulator protein binds to the W region to influence transcription of enzymes A, B, and C. a) Propose two different models that would allow the presence of toluene to alter the expression of enzymes A, B and C. You may assume that the regulator protein binds to toluene. b) Imagine that you were to identify a loss-of-function mutant that fails to express the enzymes A, B and C even in the presence of high concentration of toluene. Assume that the location of the mutation is unknown. Can either of your models for part (a) be eliminated as an option? Explain. c) Imagine that you were to identify a loss-of-function mutant that fails to express the enzymes A, B and C even in the presence of high concentration of toluene. Assume that the location of the mutation is in the W region. Can either of your models for part (a) be eliminated as an option? Explain. 3 Name_____________________________________ Section_______ TA_____________ Question 3 You were introduced to the lac operon which is comprised of the lacZ, lacY and lacA genes, a promoter for lac Z, Y and A (Plac), an operator (O) and a repressor (I) [with it’s own promoter (PI)]. a) The lack operon has a low, basal level of transcription, even in the absence of lactose. This basal level of transcription is crucial for the induction of the lac operon once lactose is present. Why is this so? X-gal and isopropyl-β-D-thiogalactopyranoside (IPTG) can both serve as useful tools in the study of the lac operon. X-gal is a colorless lactose analog that when broken down by β-galactosidase turns blue, it does not bind to the repressor protein. Unlike X-gal, IPTG cannot be broken down by β-galactosidase, but it can bind to the repressor protein. You can see a photo of blue colonies at http://www.mun.ca/biology/scarr/Blue_&_White_Colonies.html. b) If you wanted to screen colonies for the expression of β-galactosidase would you use X-gal or the IPTG in the experiment? Explain. c) If you wanted to induce expression of β-galactosidase in a growing population of cells for a very long time would you use X-gal or the IPTG in the experiment? Explain. d) To further characterize the genes of the lac operon you generate partial diploids (i.e. cells engineered to have an extra copy of a specific gene or genes). For each of the partial diploids below give the expected β-galactosidase activity in the presence or absence of lactose. Indicate if the diploid is inducible, uninducible, or constitutive. β-galactosidase activity Diploids With lactose without lactose I+ Plac+O+Z+Y+/I+ Plac +O+Z+Y+ I+Plac- O+Z+Y+/I+ Plac +O+Z-YI+Plac- O+Z+Y+/I- Plac +O+Z+Y+ I+Plac+ O-Z+Y+/I+ Plac +O+Z-YI-Plac+ O-Z+Y+/I+ Plac +O+Z+Y+ high basal Inducible, uninducible, or constitutive inducible 4 Name_____________________________________ Section_______ TA_____________ Question 3 continued e) You come across bacterial cells that have a single mutation that renders these cells incapable of using many alternative sugars like lactose, maltose, or arabinose. Which gene would you expect is mutated in these cells? f) You are working with the bacterial cells that utilize glucose as the the preferred carbon source. You grow these bacterial cells in culture medium that contains a small amount of glucose and a large amount of lactose. At different time intervals you measure and plot the concentration of ATP/cell as shown below. ATP/cell I II Time • Explain the sharp decline in ATP at the end of phase 1. • What would you predict would occur if you continue to measure ATP levels in phase 2 for many days? Explain your answer. 5 Name_____________________________________ Section_______ TA_____________ Question 4 Using a eukaryotic cell line you decide to study a transmembrane protein, protein X. You develop three mutant cell lines that do not properly localize protein X to the plasma membrane. You stain these cell lines with a fluorescent dye binds specifically to protein X and visualize the stained cells with a fluorescence microscope and obtain the following data. Cell type Location of flourescence Normal cells Cell line 1 Cell line 2 Cell line 3 Plasma membrane Cytosolic Outside the cell Nucleus Describe a mutation that could explain the localization pattern seen in each cell line. Cell line 1: Cell Line 2: Cell Line 3: 6