Download Breast Cancer Malignant Processes are

Journal of Cancer 2016, Vol. 7
2035
Ivyspring
Journal of Cancer
International Publisher
Research Paper
2016; 7(14): 2035-2044. doi: 10.7150/jca.15200
Breast Cancer Malignant Processes are Regulated by
Pax-5 Through the Disruption of FAK Signaling
Pathways
Sami Benzina1,2, Jason Harquail1,2, Roxann Guerrette1,2, Pierre O’Brien1,2, Stéphanie Jean1,2, Nicolas
Crapoulet1 and Gilles A. Robichaud1,2
1.
2.
Department of Chemistry and Biochemistry, Université de Moncton, Moncton, NB, Canada E1A 3E9.
Atlantic Cancer Research Institute, Moncton, NB, Canada E1C 8X3.
 Corresponding author: Gilles A. Robichaud, Université de Moncton, Moncton, NB, Canada, E1A 3E9. [email protected]; Tel: (506)858-4320; Fax:
(506)858-4541.
© Ivyspring International Publisher. Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited. See
http://ivyspring.com/terms for terms and conditions.
Received: 2016.02.04; Accepted: 2016.08.03; Published: 2016.10.22
Abstract
The study of genetic factors regulating breast cancer malignancy is a top priority to mitigate the
morbidity and mortality associated with this disease. One of these factors, Pax-5, modulates
cancer aggressiveness through the regulation of various components of the epithelial to
mesenchymal transitioning (EMT) process. We have previously reported that Pax-5 expression
profiles in cancer tissues inversely correlate with those of the Focal Adhesion Kinase (FAK), a
potent activator of breast cancer malignancy. In this study, we set out to elucidate the molecular
and regulatory relationship between Pax-5 and FAK in breast cancer processes. Interestingly, we
found that Pax-5 mediated suppression of breast cancer cell migration is dependent of FAK
activity. Our mechanistic examination revealed that Pax-5 inhibits FAK expression and activation.
We also demonstrate that Pax-5 is a potent modulator of FAK repressors (p53 and miR-135b) and
activator (NFκB) which results in the overall suppression of FAK-mediated signaling cascades.
Altogether, our findings bring more insight to the molecular triggers regulating phenotypic
transitioning process and signaling cascades leading to breast cancer progression.
Key words: FAK, Pax-5, Breast cancer, EMT-MET, NFκB, migration, metastasis.
Introduction
Breast cancer is the most common cancer
diagnosed in women worldwide. Specifically,
metastasis is responsible for 90% of deaths in patients
suffering from this disease. Despite major efforts in
metastasis research, specific details on how cancer
cells actually initiate the metastatic pathway are still
lacking. In general, breast cancer cells encompass
phenotypic changes between epithelial and
mesenchymal states. In the epithelial-mesenchymal
transition (EMT), tumor cells acquire motility and
invasive properties to spread into distant organs via
the
circulatory
system.
Inversely,
the
mesenchymal-epithelial transition (MET) allows
metastatic cancer cells to revert to an epithelial
program to form secondary tumors in new tissue
environments (reviewed in [1]).
One of the hallmarks of EMT in carcinoma and a
critical signaling molecule involved in tumor
malignancy is the Focal Adhesion Kinase 1 (FAK).
FAK is a non-receptor protein tyrosine kinase that
localizes to cellular focal adhesions or cell contacts
with the extracellular matrix to regulate cancer
aggressiveness and progression. In response to cell
adhesion,
FAK
is
initially
activated
by
autophosphorylation of Tyr397 which promotes the
interaction with Src homology 2 (SH2) domain
containing proteins, such as Src family (reviewed in
[2, 3]). The binding of Src family kinases onto FAK
http://www.jcancer.org
Journal of Cancer 2016, Vol. 7
induces the phosphorylation of several other tyrosine
residues located on FAK which results in FAK kinase
activity and signaling via the mitogen-activated
protein kinases/MAPKs (i.e. ERK1/2, JNK and p38)
[4-7].
FAK regulates cell spreading, adhesion,
migration, proliferation and angiogenesis; processes
that are all involved in cancer progression [3, 8].
Aberrant FAK-mediated signaling has been correlated
with a number of cancer types including brain [9, 10],
breast [11-13], thyroid [14], prostate [15] and colon
[12-16]. FAK also plays a key role in EMT through
focal adhesion turnover which allows the tumor cell
to increase both its migratory and invasive properties
[17, 18]. As a result, FAK expression correlates with
breast tumor invasion, metastatic potential and poor
disease outcome [12, 13, 19, 20]. Although the effects
of FAK activation and signaling in cancer malignancy
are well described, very few studies have elucidated
upstream mechanisms regulating FAK activity during
cellular phenotypic transitioning processes leading to
breast cancer progression.
Recently, we and others have reported roles for
the Pax-5 transcription factor in breast cancer
epithelial features that are reminiscent of MET [21,
22]. Pax-5 is a member of the Paired Box (PAX) gene
family which control gene expression programs
pivotal in cellular processes such as proliferation,
differentiation and apoptosis [23-25]. Pax-5 is
normally found in, and required for the development
of B cells, embryonic central nervous system and
adult testis [26-28]. In addition to its potent role as an
oncogene in lymphoid cancer lesions, Pax-5 has been
increasingly linked to other types of cancer including
breast cancer [21, 29-33]. Intriguingly, Pax-5 seems to
confer an anti-proliferative effect in most carcinomas
studied in contrast to its stimulatory effect on B cell
proliferation [21, 34]. Most importantly, we and others
show that Pax-5 expression reduces mesenchymal
marker expression, colony formation and migratory
capabilities while concomitantly inducing epithelial
characteristics in invasive breast carcinoma cells [21,
22, 35].
It is still unclear how phenotypic transitioning
processes are initiated and coordinated during the
metastatic cascade of breast cancer cells. However, we
have previously reported that the expression profiles
of pro-epithelial factor Pax-5 inversely correlate with
those from pro-malignant FAK [22]. We therefore set
out to establish and elucidate a possible regulatory
mechanism between the Pax-5 transcription factor
and FAK in breast cancer processes. In this study, we
demonstrate that Pax-5 is a potent inhibitor of FAK
expression and activity leading to the concomitant
suppression of aggressive features in breast cancer
2036
cells. Our findings bring new insight into the
regulatory triggers controlling FAK expression and
activities during the phenotypic transitioning
processes of breast cancer malignancy.
Materiel and Methods
Cell culture and reagents
The MDA-MB-231 (MB231) (mammary ductal
carcinoma, HTB-26); MCF7 (mammary ductal
carcinoma, HTB-22); and BT549 (mammary ductal
carcinoma, HTB-122) cells lines were obtained from
the American Type Culture Collection (Rockville,
MD, USA). MB231 cell lines were cultured in DMEM
high glucose medium supplemented with 10% fetal
bovine serum (FBS) and L-glutamine (2 mM). BT549
were cultured in RPMI 1640 medium supplemented
with 10% FBS, L-glutamine (2mM) and bovine insulin
(0.01 mg/mL). MCF7 cells were maintained in DMEM
low glucose medium supplemented with 10% FBS
and L-glutamine (2 mM). Cell culture media and
reagents were obtained from HyClone (ThermoFisher
Scientific, Burlington, ON, Canada) except for the FBS
which was provided by PAA Laboratories
(Dartmouth, MA, USA). The FAK chemical inhibitor,
FAK inhibitor 14 (CAS No. 4506-66-5), was purchased
from Cayman chemicals (Ann Arbor, Michigan 48108
USA); TNFα from ThermoFisher; and pifithrin-α (a
p53 inhibitor) from Sigma-Aldrich (Oakville, ON,
Canada).
Plasmids and transfections
Transient overexpression of Pax-5 and FAK were
performed using transfections with the human Pax-5
recombinant gene cloned into pcDNA3.1 as
previously described [36] and cloned recombinant
FAK [37] generously provided by Dr. Vita
Golubovskaya (Roswell Park Cancer Institute,
Buffalo, NY). BT549 cells stably expressing Pax-5
(BT549-Pax5) were generated using the Gateway
cloning system (ThermoFisher Scientific) Briefly, the
full-length Pax-5 cDNA devoid of a stop codon was
generated by PCR (forward: 5’-GGGGACAA
GTTTGTACAAAAAAGCAGGCTTCAAAATGGATT
TAGAGAAAAATTATCCGAC-3’
and
reverse:
5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCT
CTGTGACGGTCATAGGCAGTGGCGGC-3’)
and
integrated into the pDONR™221 vector to form the
entry clones. The correct entry clones were confirmed
by sequencing and then subcloned by recombination
into the pLenti4/TO/V5-DEST lentiviral-expressing
vector. BT549-Pax5 Zeocin-resistant clones were then
selected, expanded and characterized for stable
recombinant of Pax-5 using Western blot and
qRT-PCR. Transfections of DNA plasmids were
http://www.jcancer.org
Journal of Cancer 2016, Vol. 7
performed with the XtremeGene 9 reagent (Roche,
Branford, CT, USA) as previously described [38].
Briefly, cells were seeded in six-well plates 24 h
pre-transfection at a density of 5×105 cells/well. Cells
were then incubated with a DNA-reagent complex
(ratio of 1 μg of DNA/3 µL of reagent) for 24 h in
media with reduced serum without antibiotics. We
also made use of luciferase-based reporter gene
constructs such as the renilla-luciferase (pRL)
(Promega, Madison,WI, USA), pNFκB-luciferase
(Promega), the p53 responsive p21 promoter
luciferase construct (p21-luc) (generously provided by
Dr. G. Matlashewski, McGill University, Montreal,
Canada) [39], the Pax-5 responsive CD19 promoter
(CD19-luc) [40] and the FAK-luciferase construct[41]
(generously provided by Dr. Vita Golubovskaya,
Roswell Park Cancer Institute, NY).
Gene
suppression
experiments
were
accomplished
using
a
transfection
mixture
RNA-mediated suppression systems. Cells were
seeded in six-well plates (5×105 cells/well), grown for
24 h, and transfected with either 100 pmol of siRNA
targeting Pax-5 (ON-TARGET plus, Dharmacon,
Rockford,
IL,
USA);
or,
18
pmol/L
of
hsa-anti-miR-135b (ThermoFisher Scientific) using
Lipofectamine 2000 (ThermoFisher Scientific) in
OPTI-MEM with reduced serum. Controls include
treatments with a non-specific (non-silencing) siRNA
(Dharmacon) or scrambled non-targeting anti-miRs
(ThermoFisher Scientific) respectively.
Western blot analysis
Cells (106) were lysed using 0.1 mL of 2X whole
cell lysate (WCL) buffer (0.125M Tris pH 6.8, Glycerol
0.2 g/mL, 4.0% SDS) along with freshly added 10 µL
phenylmethylsulfonyl fluoride (PMSF, 10 mg/mL), 5
µL/ml of protease inhibitor cocktail set III (Millipore,
Billerica, MA. USA), 10 μL/ml sodium orthovanadate
(100 mM) and 10 µL/mL phosphatase inhibitor
cocktail 1 (Sigma-Aldrich). Protein content was
measured using the Bicinchoninic acid protein assay
(ThermoFisher Scientific). Equal amounts of protein
were then submitted to a 12% SDS–polyacrylamide
gel electrophoresis. Proteins were then transferred
onto a polyvinylidene fluoride membrane (PVDF)
(Millipore, Billerica, MA, USA), blocked with 5%
non-fat milk and probed with either anti-Pax-5 (New
England Peptide), anti-FAK (#05-537, Millipore,
Billerica, MA, USA), anti-phospho-FAK (#AF4528,
R&D Systems, Minneapolis, MN, USA), anti-p38
(#9212, Cell Signaling, Boston, MA, USA), anti-Paxilin
(#2542, Cell Signaling, Boston, MA, USA), anti-JNK
(#9252, Cell Signaling, Boston, MA, USA),
anti-phospho-JNK (#9251, Cell Signaling, Boston,
MA,
USA),
anti-Src
(#05-184,
Millipore),
2037
anti-phospho-Src (Tyr418) (#07-909, Millipore), IKKα
(#ab32041), Abcam, Cambridge, MA, USA),
IKKβ (#ab32135), Abcam), phospho-IKK(α and β)
(#ab194528, Abcam), or anti-G3PDH (#2275-PC-100,
Trevigen, Gaithersburg, MD, USA) antibodies. After
washings, membranes were incubated with
Horseradish peroxydase (HRP)-conjugated antibodies
(ThermoFisher Scientific) and visualized by
chemiluminescence according to the manufacturer’s
protocol (SuperSignal West Dura, Thermo Scientific).
Migration assays
Transwell migration assays were performed as
previously described [38]. Briefly, cells were starved
in DMEM containing only 0.1% FBS for 16 hours
previous to the seeding into tissue culture transwell
inserts (Greiner Bio-One, NC, USA). The inserts were
first coated with 250 µl of gelatin 0.1%
(Sigma-Aldrich). Following an incubation at 37°C for
2 hours, excess coating was then removed and 200 µl
of suspended cells (50 000 cells/well) in DMEM 0.1%
FBS were added to the inserts. The transwells were
then placed in a well containing DMEM 0.1% FBS and
incubated at 37°C for 1 hour. Next, they were moved
into wells containing DMEM 20% and incubated for 9
hours at 37°C. The negative control inserts were
moved into wells containing DMEM 0.1%. After
incubation, cells that passed through the membrane
were harvested with trypsin and submitted to a cell
viability
with
CellTiter-Blue
(Promega)
for
quantification and comparison.
Luciferase reporter gene assays
Luciferase-based reporter gene assays were
performed in cells using the Dual-Glo luciferase
system (Promega). Transfections included 200 ng of
renilla-luciferase (pRL) (Promega) as an internal
control in addition to 1.8 µg of firefly-based luciferase
plasmid. 48 h post-transfection, cells were lysed and
analyzed for luciferase activity using a luminometer
(BMG Fluostar, ThermoFisher Scientific). Relative
reporter activity was calculated and normalized based
on renilla-luciferase activity which reflected
transfection efficiency. At least three separate
experiments were performed, each in triplicate.
PCR and qRT-PCR assays
Reverse transcriptions were performed on
purified total RNA retrieved from live cells by Trizol
Reagent (ThermoFisher Scientific) according to
manufacturer’s instructions. Levels of gene
expression were verified by Taqman PCR as
previously described [42]. Reaction mixtures were
composed of 20 nM of Taqman PCR primers
(ThermoFisher Scientific) and cDNA, diluted in water
http://www.jcancer.org
Journal of Cancer 2016, Vol. 7
to a total of 12.5 µL where 12.5 µL of 2X iQ SYBR
Green Supermix (BioRad, Mississauga, Ontario,
Canada) was added. Reactions were run in an
Eppendorf Realplex real time PCR apparatus
(Eppendorf, Ontario, Canada) with the following
parameters: 2-minute initial denaturation, 35 cycles of
30 sec at 95°C, 30 sec at 60°C (optics on), 30 sec at
72°C. Each PCR assay was performed in triplicates on
at least three separate biological replicates.
Comparative expression levels were calculated using
the ∆∆Ct method of Livak and Schmittgen, (2001) [43],
using the hypoxanthine ribosyltransferase (HPRT)
transcript as a normalizing control.
Taqman PCR on non-coding miRNA was
performed on miRNA enriched lysates using the
mirVanaTM miRNA isolation kit (ThermoFisher
Scientific). MiRNAs were reverse transcribed using
the TaqMan® microRNA Reverse Transcription Kit
(ThermoFisher Scientific) followed by Taqman assays
(ThermoFisher Scientific) for the respective miRNA
studied using the Realplex PCR apparatus. Relative
expression levels from each miRNA were normalized
using the expression levels of RNU48 as an internal
control by Taqman (Life Technologies).
2038
cell model transfected with Pax-5 and evaluated the
expression levels of: p38, JNK, paxillin, PI3K, AKT
and HEF-1 by Western blot (Figure 1B). As expected,
we found that the expression levels from the majority
of signaling components located downstream of FAK
were attenuated by Pax-5. More precisely, Pax-5
slightly suppressed the expression of Src, JNK, AKT
and HEF-1. On the other hand, Pax-5 completely
abrogated the levels of p38, phosphorylated JNK, and
paxillin. We were unable to detect any PI3K levels in
our cell models (data not shown). Altogether, our
results further support a role for Pax-5 as a repressor
of the FAK-induced signaling cascade in breast cancer
cells.
Results
Pax-5 regulates FAK activation and
FAK-mediated signal transduction
The roles of Pax-5 (pro-epithelial) and FAK
(pro-mesenchymal) in breast cancer phenotype
identity have been well established. We have
previously shown that Pax-5 expression levels
inversely correlate with those from FAK in cancer
cells [22]. We thus set out to establish the effects of
Pax-5 overexpression on FAK expression and
phosphorylation levels (active form). MCF7 and
MB231 breast cancer cells were transiently transfected
with Pax-5 or the empty vector alone pcDNA3.1 and
submitted to Western blot analysis for the evaluation
of total and phosphorylated forms of FAK (Figure
1A). Interestingly, Pax-5 overexpression suppressed
total FAK expression in both MCF7 and MB231 breast
cancer cell lines. In addition, Pax-5 transfected cells
also displayed attenuated phosphorylated forms of
FAK. Control samples were also performed which
include Pax-5 recombinant expression and GAPDH as
an internal loading control. These results strongly
suggest that Pax-5 is a modulator of FAK expression
and activation in breast cancer cells.
To further extend our studies of Pax-5-mediated
regulation of FAK, we examined whether
Pax-5-mediated suppression of FAK would also affect
commonly known downstream effectors of the FAK
cascade. We thus made use of the MCF7 breast cancer
Figure 1: Pax-5 suppresses FAK protein levels and FAK-mediated
cascades. Western blot was performed on MCF7 and MB231 cells either
non-transfected (NT); or, transfected with the control empty pcDNA vector (pCT)
and Pax-5. (A) Protein expression levels were studied for Pax-5, FAK,
phosphorylated-FAK (P-FAK) and GAPDH used as an internal control. (B)
Expression levels from downstream signaling components of FAK were also evaluated
by Western blot for p38, JNK, phosphorylated-JNK (P-JNK), paxillin, AKT, HEF-1 and
GAPDH used as a loading control. The presented data is the calculated mean of three
independent samples and is representative of three different experiments.
To elucidate the regulatory mechanisms of
Pax-5-mediated suppression of FAK expression, we
examined the capacity of Pax-5 to regulate FAK gene
transcription in breast cancer cells. Using Taqman
assays, we analyzed FAK mRNA expression in MCF7
cells transfected with Pax-5. Surprisingly, no
significant differences in FAK transcript levels were
observed between Pax-5 or vector-transfected cells
http://www.jcancer.org
Journal of Cancer 2016, Vol. 7
(Figure 2A). We then proceeded with luciferase-based
reporter gene under the control of the human FAK
promoter region (FAK-luc). We found that Pax-5
transfected cells only displayed a mild decrease in
FAK reporter activities (figure 2B).
To assess the role of Pax-5 in FAK protein
stabilization, we examined the expression levels of
Src, phosphorylated Src and calpain, two known
regulators of FAK protein stability [44, 45]. Using
Western blot on Pax-5 transfected MCF7 and MB231
cells, we found that Pax-5 slightly attenuates Src and
phosphorylated-Src levels in MCF7 with no apparent
changes to calpain levels when compared to the
GAPDH loading control (Figure 2C).
2039
Pax-5 regulates FAK modulators
Given that FAK transcriptional control was very
moderate following Pax-5 transfection, we expanded
our studies to examine the potential of Pax-5 to affect
other commonly known regulators of FAK gene
expression. We next evaluated the effects of Pax-5 on
two potent transcriptional factors previously shown
to bind and regulate the FAK promoter, p53
(repressor) and NFκB (activator) [41]. Using reporter
gene assays, we found that Pax-5 transfected MCF7
cells displayed greater p21-Luc activity and repressed
NFκB-Luc activity respectively in comparison to
vector-transfected control cells (Figure 3A). We also
repeated these experiments in the malignant MB231
breast model and observed the same (Pax-5 induced
p21-Luc activity and repressed NFκB-Luc activity
respectively) (Figure 3A).
Figure 2: Pax-5-modulates FAK protein levels by indirect mechanisms. MCF7 cells transfected with either the empty vector (pcDNA) or Pax-5 were analyzed for (A)
FAK mRNA expression using Taqman PCR assays and standardized against the HPRT housekeeping gene. The presented data is the calculated mean and representative of three
different experiments in relation to the non-transfected parental cell line. (B) FAK promoter transactivation potential was assessed using dual reporter gene assays (Promega)
with the FAK promoter region cloned upstream from the firefly luciferase gene [41]. Normalization of luciferase activity was performed using non-inducible renilla luciferase and
plotted in relative light units (RLU) to each respective control sample. (C) Western blot was performed on transfected or non-transfected (NT) MCF7 and MB231 cells. Protein
expression levels were studied for Pax-5, calpain (CAPN), Src, phosphorylated-Src (P-Src) and GAPDH as an internal control. Results are representative of triplicate
experiments.
http://www.jcancer.org
Journal of Cancer 2016, Vol. 7
Given the marked suppression of NFκB-dependent reporter activity by Pax-5, we further examined
the effects of Pax-5 on the NFκB signaling cascade.
More specifically, we assessed the ability of Pax-5 to
modulate the expression and activation of IκB inhibitors (IKK) in breast cancer cells (MCF7 and MB231) by
Western blot. We found that Pax-5 inhibited total
IKKα and IKKβ in addition to phosphorylated-IKK in
MB231 cells (Figure 3B). On the other hand, Pax-5 did
not significantly alter IKKα expression in MCF7
where IKKβ was undetectable. Our results support a
role for Pax-5-mediated suppression of IKK
expression and activity (notably in aggressive breast
cancer cells) which consequently leads to inhibition of
NFκB activity in breast cancer cells.
To further examine whether Pax-5-induced
suppression of FAK is dependent upon NFκB or p53
activities, we performed rescue experiments using
MB231 cells transfected with Pax-5 and treated with
either TNFα (NFκB activator) or pifithrin (p53
inhibitor). As expected, Pax-5 transfection resulted in
a 60% decrease of FAK expression in Western blot
(Figure 3C). However, although TNFα treatments
alone induced FAK expression (1.94 fold), TNFα did
not rescue FAK expression in Pax-5 transfected cells.
On the other hand, when Pax-5-transfected cells were
treated with pifithrin (p53 inhibitor), FAK expression
was increased 38 % (from 0.44 to 0.70) in Pax-5
bearing cells. These results suggest that p53 is an
important modulator of Pax-5-induced suppression of
FAK in breast cancer cells.
To pursue our elucidation of Pax-5-mediated
effects on FAK regulators, we also studied the
possible Pax-5-induced modulation of non-coding
RNAs regulating FAK expression. Recent studies
have reported that the human micro-RNA 135b
(miR-135b) targets FAK mRNA for inhibition [46].
Cells were thus transfected with Pax-5 where
miR-135b was assessed by Taqman PCR and
standardized according to RNU48 levels used as an
internal control. We found that Pax-5 induced
miR-135b expression levels 5 fold in comparison to
vector transfected controls (Figure 3D). Globally, we
show that Pax-5 is an important modulator of FAK
regulators such as p53, NFκB and miR-135b leading to
the suppression of FAK expression and activation.
Pax-5 regulates aggressiveness of breast
cancer through FAK
We have previously shown that the expression
levels
of
Pax-5
(pro-epithelial)
and
FAK
(pro-mesenchymal) inversely correlate during breast
cancer progression. To determine whether Pax-5
suppresses breast cancer invasiveness through the
mediated inhibition of FAK, we conducted several
2040
rescue experiments using conditional expression of
both Pax-5 and FAK on breast cancer migration
properties. First, we evaluated cell migration in the
epithelial-dominant MCF7 cell line which were
knocked-down for Pax-5 endogenous expression
using a pool of siRNAs (siPax-5) in addition to
concomitantly inhibiting FAK using the FAK-specific
chemical inhibitor 14. As expected, control treatments
which consisted of untouched cells; scrambled siRNA
transfection; and FAK inhibitor 14-treated cells did
not migrate (Figure 4A). In contrast, MCF7 with
suppressed levels of Pax-5 (siPax-5) increased cell
migration 2.4-fold over scrambled siRNA transfected
controls. More importantly, the observed induction of
migration in Pax-5 attenuated cells was completely
abolished when FAK was inhibited by chemical
treatment (Figure 4A). These findings suggest that the
induction of cell migration in Pax-5 downregulated
cells is FAK dependant.
To confirm our observations, we also studied cell
migration in mesenchymal-dominant BT549 cells
stably transfected with either the Pax-5 gene
(BT549-Pax5) or the empty vector alone as a control
(BT549-CT). As expected, invasive BT549-CT control
cells demonstrated cell migration which was slightly
enhanced (31%) by FAK transfection (pFAK) (Figure
4B). In contrast, cells transfected with recombinant
Pax-5 (BT549-Pax5) decreased cell migration by 67%.
More interestingly, FAK transfection in BT549-Pax5
cells partially rescued migration properties. Overall,
our results suggest that Pax-5 mediated suppression
of breast cancer cell migration is dependent of FAK
activity.
Discussion
Breast cancer metastasis is a multistep process,
which consists of a cancer cell acquiring new
biological processes and transitioning between
phenotypic identities (EMT-MET) to colonize new
environments. At the present time, it is still not
entirely known how and when EMT and MET
programs are coordinated. We and others have
recently reported that the expression of Pax-5 in
cancer cells suppresses mesenchymal properties and
concomitantly
promotes
epithelial
features
reminiscent of MET [21, 22, 35]. Moreover, we have
shown that the expression levels of pro-epithelial
factor Pax-5 inversely correlate with those from
pro-malignant FAK in cancer cells [22] thus
suggesting a molecular relationship between these
genes which could lead to the modulation of
EMT-MET processes. In this study, we demonstrate
that Pax-5 acts as a potent inhibitor of FAK expression
and activity leading to the concomitant suppression of
aggressive features in breast cancer cells.
http://www.jcancer.org
Journal of Cancer 2016, Vol. 7
2041
Figure 3: Pax-5 regulates FAK expression modulators p53, NFκB and miR135b. (A) Breast cancer cells transfected with either the empty vector (pCT) or Pax-5 were
analyzed for p53 (using the p53 responsive p21 promoter element/p21-luc) [39], NFκB (NFκB-luc) and Pax-5 (using the Pax-5 responsive CD19 promoter/CD19-luc) [40]
transactivation potential in MCF7 (left panel) and MB231 (right panel) using dual reporter gene assays (Promega). Normalization of firefly luciferase activity was performed using
non-inducible renilla luciferase and plotted in relative light units (RLU) to each respective control. (B) Western blot was performed on MB231 and MCF7 cells which were either
non transfected (NT); or, transfected with the pcDNA control vector (pCT) and Pax-5 to reveal the expression levels of Pax-5, IKK-α, IKK-β and phosphorylated-IKK-α/β
(P-IKK-α/β) and GAPDH as an internal control. (C) MB231 cells transfected with Pax-5 or the empty vector (pCT) were either left untreated (-) or treated with TNFα (20ng/ml)
or pifithrin (PFT, 30µM) for 24h and examined for FAK, Pax-5 and GAPDH expression by Western blot. Expression ratios (FAK/GAPDH) were determined using pixel densities
using ImageJ software. (D) MCF7 cells were also examined for miR-135b expression levels using Taqman PCR which was standardized against the RNU48 small nucleolar RNA
used as a housekeeping gene. The presented data is the calculated mean of three independent experiments in triplicates samples and plotted in relation to non-treated parental
cells (*p <0.05).
http://www.jcancer.org
Journal of Cancer 2016, Vol. 7
2042
Figure 4: Pax-5-mediated suppression of breast cancer migration is FAK dependent. (A) Migration assays were performed on MCF7 cells transfected with
Pax-5-targeting siRNAs (siPax-5) or non-targeting control siRNAs (CT-siRNA) and treated with the FAK inhibitor (inhibitor 14) (FAK inhib.) using transwell chambers. Results
are the calculated mean of raw fluorescence and representative of triplicate experiments. (B) Migration assays were also performed on BT549 cells stably expressing the empty
control pLenti4 vector (BT549-CT) or Pax-5 (BT549-Pax-5) which were transiently transfected for FAK recombinant expression (pFAK) [37] or the control vector (pCT). The
data is presented in fold change relative to control cells and is the calculated mean of three independent samples represented from three different experiments (*p <0.05).
In an attempt to elucidate the molecular
mechanisms supporting Pax-5-mediated suppression
of FAK, we first assessed the potential of the Pax-5
transcription factor to modulate FAK gene expression.
This hypothesis was supported by chromatin
immunoprecipitation
(ChIP)
sequencing
data
provided by the ENCODE project (HudsonAlpha
Institute for Biotechnology) [47] which found that the
human
FAK
promoter
region
is
co-immunoprecipitated using Pax-5 antibodies. These
observations thus suggested that the FAK gene
promoter is targeted for Pax-5 binding and
transactivation (data not shown). In addition, these
findings correlate with the JASPAR CORE database
which also demonstrates the presence of multiple
Pax-5 binding motifs within the FAK promoter region
[48].
Surprisingly,
despite
the
significant
downregulation of FAK protein levels by Pax-5, we
were unable to detect any significant changes in
neither FAK transcriptional levels; nor FAK reporter
gene activity following Pax-5 conditional expression
in the breast cancer model tested.
We extended our study to examine the impact of
Pax-5 on previously reported modulators of FAK
expression. The most significant effects of Pax-5 were
observed on the promoter activities of p53 and NFκB,
two potent transcription factors known to bind and
regulate the FAK promoter [41]. First, we found that
Pax-5 induces p53 which has previously been
reported in breast cancer cells [21]. Rescue
experiments also validate that p53 may be a
prominent means for Pax-5 to inhibit FAK expression.
On the other hand, we also observed that Pax-5 is a
potent inhibitor of NFκB which has previously been
shown to induce FAK expression. Although we were
unable to validate NFκB as a direct mediator of
Pax-5-induced suppression of FAK, these findings are
interesting given that NFκB-targeted genes are
associated with EMT [49] and breast cancer
malignancy [50-52]. Mechanistically, NFκB is usually
sequestered in the cytoplasm by its natural inhibitor
(IκB) which is regulated by the IκB kinase (IKK)
complex composed of the catalytic kinases IKKα and
IKKβ (reviewed in [53, 54]). Upon cell activation, IKKs
phosphorylate IκB which is degraded and allows
nuclear import of NFκB to exert its role as a
http://www.jcancer.org
Journal of Cancer 2016, Vol. 7
transcription factor on mesenchymal cancer genes.
Accordingly, we found that recombinant expression
of Pax-5 significantly suppressed both IKKα and
IKKβ expression and phosphorylation events in the
mesenchymal-dominant MB231 breast cancer cell line.
These results further validate the suppressive role of
Pax-5 on NFκB activation. Studies have also shown
that FAK and NFκB can mutually activate each other
in cancer processes [41, 55, 56]. In this case, the
suppressive effects of Pax-5 on each component of the
NFκB/FAK cascade would greatly enhance breast
cancer cell epithelialisation and inhibit tumor
malignancy. Indeed, these results concur with reports
showing that elevated Pax-5 expression in primary
breast tumor sites correlates with lower risk of disease
progression and relapse [22]. Our findings thus
strongly support a beneficial role for Pax-5 expression
in breast primary tumors.
We also investigated possible Pax-5-regulated
miRNAs capable of targeting FAK inhibition.
MiRNAs are small non-coding RNAs that bind the
3'UTR of mRNAs, which result in the degradation or
translation inhibition of the target mRNAs [57].
Aberrantly expressed miRNAs are frequently
associated with a variety of cancers including breast
cancers [58-60]. Among these miRNAs, the miR-135
family (miR-135a and miR-135b) is remarkably
regulated in carcinogenesis. MiR-135a has been
identified to increase apoptosis and decrease
proliferation in classic Hodgkin lymphoma by
targeting JAK2 [61]. On the other hand, miR-135a and
miR-135b promote colon cancer by targeting the
tumor suppressor APC (Adenoma Polyposis Coli)
[62]. Recently, miR-135b was reported to target FAK
resulting in the suppression of cancer cell invasion
[46]. In our study, we found that Pax-5 induced
miR-135b expression in breast cancer cells which
would again increase Pax-5's capacity to
downregulate FAK protein expression and suppress
breast cancer progression.
Altogether, our study describes a new role for
Pax-5 as a FAK inhibitor and tumor suppressor of
breast cancer processes. Mechanistically, we
demonstrate that Pax-5 inhibits FAK expression and
activation indirectly through the regulation of FAK
modulators (notably through p53). These findings are
striking given that Pax-5 is a potent oncogene in
lymphoid cancers [63]. The study herein suggests that
Pax-5-mediated suppression of breast cancer
aggressiveness is largely due to FAK inhibition. These
finding are of particular interest given the association
of FAK in invasive cancers and the interest in FAK
targeting as a promising anticancer strategy [64, 65].
2043
Acknowledgements
Research funds were provided by grants from
the New Brunswick (NB) Innovation Foundation, the
Canadian Breast Cancer Foundation-Atlantic Chapter,
the Canadian Breast Cancer Society/QEII Foundation,
and the NB Health Research Foundation (NBHRF).
GAR is supported by a Canadian Institutes of Health
Research (CIHR) New Investigator Award; SB is
supported by the Beatrice Hunter Cancer Research
Institute (BHCRI) with funds provided by the Terry
Fox Strategic Health Research Training Program in
Cancer Research at CIHR in partnership with the NB
Health Research Foundation and The Roses of Hope
Foundation (La Vie en Rose Foundation); JH is
supported by a trainee award from the BHCRI with
funds provided by the Canadian Breast Cancer
Foundation, Atlantic Region and the NBHRF as part
of The Terry Fox Strategic Health Research Training
Program in Cancer Research at CIHR; and RG is a
trainee in the Cancer Research Training Program of
the BHCRI, with funds provided by the Canadian
Breast Cancer Foundation – Atlantic Region and the
NBHRF.
Conflict of interest
We have no potential conflicts of interest to
disclose.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Yao D, Dai C, Peng S. Mechanism of the mesenchymal-epithelial transition
and its relationship with metastatic tumor formation. Mol Cancer Res. 2011; 9:
1608-20.
McLean GW, Carragher NO, Avizienyte E, Evans J, Brunton VG, Frame MC.
The role of focal-adhesion kinase in cancer - a new therapeutic opportunity.
Nat Rev Cancer. 2005; 5: 505-15.
Golubovskaya VM, Kweh FA, Cance WG. Focal adhesion kinase and cancer.
Histol Histopathol. 2009; 24: 503-10.
Zhao J, Guan JL. Signal transduction by focal adhesion kinase in cancer.
Cancer Metastasis Rev. 2009; 28: 35-49.
Bouchard V, Demers MJ, Thibodeau S, Laquerre V, Fujita N, Tsuruo T, et al.
Fak/Src signaling in human intestinal epithelial cell survival and anoikis:
differentiation state-specific uncoupling with the PI3-K/Akt-1 and MEK/Erk
pathways. Journal of cellular physiology. 2007; 212: 717-28.
Huang C, Rajfur Z, Borchers C, Schaller MD, Jacobson K. JNK phosphorylates
paxillin and regulates cell migration. Nature. 2003; 424: 219-23.
Horowitz JC, Rogers DS, Sharma V, Vittal R, White ES, Cui Z, et al.
Combinatorial activation of FAK and AKT by transforming growth
factor-beta1 confers an anoikis-resistant phenotype to myofibroblasts. Cell
Signal. 2007; 19: 761-71.
Luo M, Guan JL. Focal adhesion kinase: a prominent determinant in breast
cancer initiation, progression and metastasis. Cancer Lett. 2010; 289: 127-39.
Canel M, Secades P, Rodrigo JP, Cabanillas R, Herrero A, Suarez C, et al.
Overexpression of focal adhesion kinase in head and neck squamous cell
carcinoma is independent of fak gene copy number. Clin Cancer Res. 2006; 12:
3272-9.
Gutenberg A, Bruck W, Buchfelder M, Ludwig HC. Expression of tyrosine
kinases FAK and Pyk2 in 331 human astrocytomas. Acta Neuropathol. 2004;
108: 224-30.
Cance WG, Craven RJ, Weiner TM, Liu ET. Novel protein kinases expressed in
human breast cancer. Int J Cancer. 1993; 54: 571-7.
Cance WG, Harris JE, Iacocca MV, Roche E, Yang X, Chang J, et al.
Immunohistochemical analyses of focal adhesion kinase expression in benign
and malignant human breast and colon tissues: correlation with preinvasive
and invasive phenotypes. Clin Cancer Res. 2000; 6: 2417-23.
Lark AL, Livasy CA, Dressler L, Moore DT, Millikan RC, Geradts J, et al. High
focal adhesion kinase expression in invasive breast carcinomas is associated
with an aggressive phenotype. Mod Pathol. 2005; 18: 1289-94.
http://www.jcancer.org
Journal of Cancer 2016, Vol. 7
14. Kim SJ, Park JW, Yoon JS, Mok JO, Kim YJ, Park HK, et al. Increased
expression of focal adhesion kinase in thyroid cancer: immunohistochemical
study. J Korean Med Sci. 2004; 19: 710-5.
15. Lacoste J, Aprikian AG, Chevalier S. Focal adhesion kinase is required for
bombesin-induced prostate cancer cell motility. Mol Cell Endocrinol. 2005;
235: 51-61.
16. Lark AL, Livasy CA, Calvo B, Caskey L, Moore DT, Yang X, et al.
Overexpression of focal adhesion kinase in primary colorectal carcinomas and
colorectal liver metastases: immunohistochemistry and real-time PCR
analyses. Clin Cancer Res. 2003; 9: 215-22.
17. Bailey KM, Liu J. Caveolin-1 up-regulation during epithelial to mesenchymal
transition is mediated by focal adhesion kinase. J Biol Chem. 2008; 283:
13714-24.
18. Cicchini C, Laudadio I, Citarella F, Corazzari M, Steindler C, Conigliaro A, et
al. TGFbeta-induced EMT requires focal adhesion kinase (FAK) signaling. Exp
Cell Res. 2008; 314: 143-52.
19. Pylayeva Y, Gillen KM, Gerald W, Beggs HE, Reichardt LF, Giancotti FG. Rasand PI3K-dependent breast tumorigenesis in mice and humans requires focal
adhesion kinase signaling. J Clin Invest. 2009; 119: 252-66.
20. Lightfoot HM, Jr., Lark A, Livasy CA, Moore DT, Cowan D, Dressler L, et al.
Upregulation of focal adhesion kinase (FAK) expression in ductal carcinoma
in situ (DCIS) is an early event in breast tumorigenesis. Breast Cancer Res
Treat. 2004; 88: 109-16.
21. Vidal LJ, Perry JK, Vouyovitch CM, Pandey V, Brunet-Dunand SE, Mertani
HC, et al. PAX5alpha enhances the epithelial behavior of human mammary
carcinoma cells. Mol Cancer Res. 2010; 8: 444-56.
22. Crapoulet N, O'Brien P, Ouellette RJ, Robichaud GA. Coordinated expression
of Pax-5 and FAK1 in metastasis. Anticancer Agents Med Chem. 2011; 11:
643-9.
23. Strachan T, Read AP. PAX genes. Curr Opin Genet Dev. 1994; 4: 427-38.
24. Tremblay P, Gruss P. Pax: genes for mice and men. Pharmacol Ther. 1994; 61:
205-26.
25. Robson EJ, He SJ, Eccles MR. A PANorama of PAX genes in cancer and
development. Nat Rev Cancer. 2006; 6: 52-62.
26. Hagman J, Wheat W, Fitzsimmons D, Hodsdon W, Negri J, Dizon F.
Pax-5/BSAP: regulator of specific gene expression and differentiation in B
lymphocytes. Curr Top Microbiol Immunol. 2000; 245: 169-94.
27. Rolink AG, Schaniel C, Busslinger M, Nutt SL, Melchers F. Fidelity and
infidelity in commitment to B-lymphocyte lineage development. Immunol
Rev. 2000; 175: 104-11.
28. Adams B, Dorfler P, Aguzzi A, Kozmik Z, Urbanek P, Maurer-Fogy I, et al.
Pax-5 encodes the transcription factor BSAP and is expressed in B
lymphocytes, the developing CNS, and adult testis. Genes Dev. 1992; 6:
1589-607.
29. Vouyovitch CM, Vidal L, Borges S, Raccurt M, Arnould C, Chiesa J, et al.
Proteomic analysis of autocrine/paracrine effects of human growth hormone
in human mammary carcinoma cells. Adv Exp Med Biol. 2008; 617: 493-500.
30. Palmisano WA, Crume KP, Grimes MJ, Winters SA, Toyota M, Esteller M, et
al. Aberrant promoter methylation of the transcription factor genes PAX5
alpha and beta in human cancers. Cancer Res. 2003; 63: 4620-5.
31. Ross DT, Scherf U, Eisen MB, Perou CM, Rees C, Spellman P, et al. Systematic
variation in gene expression patterns in human cancer cell lines. Nat Genet.
2000; 24: 227-35.
32. Ellsworth RE, Seebach J, Field LA, Heckman C, Kane J, Hooke JA, et al. A gene
expression signature that defines breast cancer metastases. Clin Exp
Metastasis. 2009; 26: 205-13.
33. Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI gene
expression and hybridization array data repository. Nucleic Acids Res. 2002;
30: 207-10.
34. Liu W, Li X, Chu ES, Go MY, Xu L, Zhao G, et al. Paired box gene 5 is a novel
tumor suppressor in hepatocellular carcinoma through interaction with p53
signaling pathway. Hepatology. 2011; 53: 843-53.
35. Schebesta A, McManus S, Salvagiotto G, Delogu A, Busslinger GA, Busslinger
M. Transcription factor Pax5 activates the chromatin of key genes involved in
B cell signaling, adhesion, migration, and immune function. Immunity. 2007;
27: 49-63.
36. Robichaud GA, Nardini M, Laflamme M, Cuperlovic-Culf M, Ouellette RJ.
Human Pax-5 C-terminal isoforms possess distinct transactivation properties
and are differentially modulated in normal and malignant B cells. J Biol Chem.
2004; 279: 49956-63.
37. Beviglia L, Golubovskaya V, Xu L, Yang X, Craven RJ, Cance WG. Focal
adhesion kinase N-terminus in breast carcinoma cells induces rounding,
detachment and apoptosis. Biochem J. 2003; 373: 201-10.
38. Cormier K, Harquail J, Ouellette RJ, Tessier PA, Guerrette R, Robichaud GA.
Intracellular expression of inflammatory proteins S100A8 and S100A9 leads to
epithelial-mesenchymal transition and attenuated aggressivity of breast
cancer cells. Anticancer Agents Med Chem. 2014; 14: 35-45.
39. Ghosh A, Stewart D, Matlashewski G. Regulation of human p53 activity and
cell localization by alternative splicing. Mol Cell Biol. 2004; 24: 7987-97.
40. Nutt SL, Morrison AM, Dorfler P, Rolink A, Busslinger M. Identification of
BSAP (Pax-5) target genes in early B-cell development by loss- and
gain-of-function experiments. EMBO J. 1998; 17: 2319-33.
41. Golubovskaya V, Kaur A, Cance W. Cloning and characterization of the
promoter region of human focal adhesion kinase gene: nuclear factor kappa B
and p53 binding sites. Biochim Biophys Acta. 2004; 1678: 111-25.
2044
42. Robichaud GA, Perreault JP, Ouellette RJ. Development of an isoform-specific
gene suppression system: the study of the human Pax-5B transcriptional
element. Nucleic Acids Res. 2008; 36: 4609-20.
43. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods.
2001; 25: 402-8.
44. Franco SJ, Rodgers MA, Perrin BJ, Han J, Bennin DA, Critchley DR, et al.
Calpain-mediated proteolysis of talin regulates adhesion dynamics. Nat Cell
Biol. 2004; 6: 977-83.
45. Carragher NO, Westhoff MA, Fincham VJ, Schaller MD, Frame MC. A novel
role for FAK as a protease-targeting adaptor protein: regulation by p42 ERK
and Src. Curr Biol. 2003; 13: 1442-50.
46. Golubovskaya VM, Sumbler B, Ho B, Yemma M, Cance WG. MiR-138 and
MiR-135 directly target focal adhesion kinase, inhibit cell invasion, and
increase sensitivity to chemotherapy in cancer cells. Anticancer Agents Med
Chem. 2014; 14: 18-28.
47. Consortium EP, Birney E, Stamatoyannopoulos JA, Dutta A, Guigo R,
Gingeras TR, et al. Identification and analysis of functional elements in 1% of
the human genome by the ENCODE pilot project. Nature. 2007; 447: 799-816.
48. Mathelier A, Zhao X, Zhang AW, Parcy F, Worsley-Hunt R, Arenillas DJ, et al.
JASPAR 2014: an extensively expanded and updated open-access database of
transcription factor binding profiles. Nucleic Acids Res. 2014; 42: D142-7.
49. Maier HJ, Schmidt-Strassburger U, Huber MA, Wiedemann EM, Beug H,
Wirth T. NF-kappaB promotes epithelial-mesenchymal transition, migration
and invasion of pancreatic carcinoma cells. Cancer Lett. 2010; 295: 214-28.
50. Chua HL, Bhat-Nakshatri P, Clare SE, Morimiya A, Badve S, Nakshatri H.
NF-kappaB represses E-cadherin expression and enhances epithelial to
mesenchymal transition of mammary epithelial cells: potential involvement of
ZEB-1 and ZEB-2. Oncogene. 2007; 26: 711-24.
51. Huber MA, Azoitei N, Baumann B, Grunert S, Sommer A, Pehamberger H, et
al. NF-kappaB is essential for epithelial-mesenchymal transition and
metastasis in a model of breast cancer progression. J Clin Invest. 2004; 114:
569-81.
52. Min C, Eddy SF, Sherr DH, Sonenshein GE. NF-kappaB and epithelial to
mesenchymal transition of cancer. J Cell Biochem. 2008; 104: 733-44.
53. Shen RR, Hahn WC. Emerging roles for the non-canonical IKKs in cancer.
Oncogene. 2011; 30: 631-41.
54. Prasad S, Ravindran J, Aggarwal BB. NF-kappaB and cancer: how intimate is
this relationship. Mol Cell Biochem. 2010; 336: 25-37.
55. Sonoda Y, Matsumoto Y, Funakoshi M, Yamamoto D, Hanks SK, Kasahara T.
Anti-apoptotic role of focal adhesion kinase (FAK). Induction of
inhibitor-of-apoptosis proteins and apoptosis suppression by the
overexpression of FAK in a human leukemic cell line, HL-60. J Biol Chem.
2000; 275: 16309-15.
56. Wang X, Chen Q, Xing D. Focal adhesion kinase activates NF-kappaB via the
ERK1/2 and p38MAPK Pathways in amyloid-beta25-35-induced apoptosis in
PC12 cells. J Alzheimers Dis. 2012; 32: 77-94.
57. Guo H, Ingolia NT, Weissman JS, Bartel DP. Mammalian microRNAs
predominantly act to decrease target mRNA levels. Nature. 2010; 466: 835-40.
58. Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H, Hagan JP, et al.
MicroRNA expression patterns to differentiate pancreatic adenocarcinoma
from normal pancreas and chronic pancreatitis. Jama. 2007; 297: 1901-8.
59. Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, et al.
MicroRNA gene expression deregulation in human breast cancer. Cancer Res.
2005; 65: 7065-70.
60. Zhao G, Wang B, Liu Y, Zhang JG, Deng SC, Qin Q, et al. miRNA-141,
downregulated in pancreatic cancer, inhibits cell proliferation and invasion by
directly targeting MAP4K4. Molecular cancer therapeutics. 2013; 12: 2569-80.
61. Navarro A, Diaz T, Martinez A, Gaya A, Pons A, Gel B, et al. Regulation of
JAK2 by miR-135a: prognostic impact in classic Hodgkin lymphoma. Blood.
2009; 114: 2945-51.
62. Nagel R, le Sage C, Diosdado B, van der Waal M, Oude Vrielink JA, Bolijn A, et
al. Regulation of the adenomatous polyposis coli gene by the miR-135 family
in colorectal cancer. Cancer Res. 2008; 68: 5795-802.
63. O'Brien P, Morin P, Jr., Ouellette RJ, Robichaud GA. The Pax-5 gene: a
pluripotent regulator of B-cell differentiation and cancer disease. Cancer Res.
2011; 71: 7345-50.
64. van Nimwegen MJ, van de Water B. Focal adhesion kinase: a potential target
in cancer therapy. Biochem Pharmacol. 2007; 73: 597-609.
65. Parsons JT, Slack-Davis J, Tilghman R, Roberts WG. Focal adhesion kinase:
targeting adhesion signaling pathways for therapeutic intervention. Clin
Cancer Res. 2008; 14: 627-32.
http://www.jcancer.org