Download Single nucleotide polymorphisms in caprine calpastatin gene

ISSN 10227954, Russian Journal of Genetics, 2013, Vol. 49, No. 4, pp. 441–447. © Pleiades Publishing, Inc., 2013.
ANIMAL GENETICS
Single Nucleotide Polymorphisms in Caprine Calpastatin Gene1
R. Sharma, A. Maitra, A. K. Pandey, L. V. Singh, and B. P. Mishra
National Bureau of Animal Genetic Resources, Karnal132001 (Haryana), India;
email: [email protected]
Received March 27, 2012; in final form, July 04, 2012
Abstract—The calpains and calpastatin (CAST) make up a major cytosolic proteolytic system, the calpain–
calpastatin system, found in mammalian tissues. The relative levels of the components of the calpain–calp
astatin system determine the extent of meat tenderization during postmortem storage. Calpastatin (CAST) is
a protein inhibitor of the ubiquitous calciumdependent proteases, µcalpain, and mcalpain. Polymor
phisms in the bovine, ovine and pig CAST gene have been associated with meat tenderness but little is known
about how caprine CAST gene may affect goat meat quality traits. In this study we selected different parts of
the CAST gene: (1) that have been previously reported to be polymorphic, intron 5 and 12 and 3'UTR;
(2) first time explored (exon 3, 7 and 8 and part of intron 7 and 8) to investigate polymorphic status of caprine
CAST gene. Using comparative sequencing ten novel SNPs located in exon 3 and intron 5, 7 and 8 were iden
tified. Previously reported SNPs in intron 5, 3'UTR and intron 12 were absent. Sequence analysis revealed a
non synonymous amino acid variation in exon 3, which would result in Lys/Arg substitution in the corre
sponding protein sequence. Considerable variation was detected in intronic regions. Twentyfour InDel were
also recognized in intronic regions (15) and 3'UTR (9). All the sequences shared high homology with pub
lished bovine and ovine sequences. Three PCRRFLP loci have been established for further analyzing genetic
polymorphism in indigenous goats.
DOI: 10.1134/S1022795413040133
1
Polymorphism at the DNA level is key player in
animal genetics. Most of research on genetic markers
applied to animal breeding is concentrated on analysis
of mutations or polymorphisms located within eco
nomically important structural genes and linkage of
these genes to quantitative trait loci (QTL). A number
of potential candidate genes for meat characteristics
have been identified in last decade. Allelic variation in
the regulatory and structural regions of these genes
may affect the gene expression or amino acid
sequences and ultimately impact on meat quality
traits. Among different candidates, CAST gene seems
to be promising as it plays an important role in meat
tenderness. Increased postmortem CAST activity has
been correlated with reduced meat tenderness [1, 2].
Several alternatively spliced transcript variants of this
gene have been described, but the fulllength nature of
only some have been determined. Calpastatin plays a
central role in regulation of calpains activity in the cell
and is considered to be one of major modulators of
postmortem protein turnover [3]. Its role in meat
ageing has been demonstrated, especially by the strong
genetic correlations between calpastatin activity and
tenderness measured by Warner–Bratzler shear force.
The bovine CAST gene has been mapped BTA7 at the
position 117.8 cM is considered as a candidate gene
for beef tenderness [4]. The variation of the CAST
locus in cattle was a subject of several studies which
1 The article is published in the original.
discovered genetic polymorphism in coding and non
coding region including 3'untranslated region. Associ
ations have been reported between variation in CAST
and carcass and meat quality in cattle [5–7] and pigs
[8]. Recently Jiao et al. [9] has discussed one associ
ated SNP of Chinese commercial cattle breed at
g2959A>G of 3'untranslated region. On other hand,
Pinto et al. [10] discovered an associated SNP g282C>G
of intron 12 in cattle herd. Both mutations corre
sponded with a high Warner–Bratzler shear force
(WBSF) in cattle herd. In cattle, variation in bovine
CAST is utilized commercially in genetic tests: Gene
STAR Tenderness and IGENITY TenderGENE
(Genetic Solutions Pty. Ltd., Albion, Australia) with
former test using G/A SNP in the 3'UTR while later
using G/C SNP in intron 5.
Despite growing interest in the investigation of
CAST involvement with meat quality traits in cattle,
pig and sheep, nothing substantial on CAST of
caprines have been reported, as of yet. Perusal of liter
ature shows that limited information is available on
CAST of goat [11, 12] with no studies on indigenous
goats from India. Thus the objective of present study
was to identify polymorphisms in CAST gene of indig
enous goats from India and to determine the allele dis
tribution in different Indian goat breeds differing in
phenotype (weight and size) and geographical distri
bution. Three exons (exon 3, 7 and 8) along with
upstream and downstream regions, introns (5, 12) and
3'UTR were amplified, sequenced and analyzed.
441
442
SHARMA et al.
Beetal
Barbari
Sirohi
Black Bengal
Osmanabadi
Ganjam
Malabari
Geographical distribution of Indian goat breeds selected for CAST polymorphism study.
ing up only two samples per herd and only two herds
per village. DNA was isolated from blood samples, fol
lowing standard procedures [13].
MATERIALS AND METHODS
Animals and DNA Source
Blood samples were collected from a panel of seven
goat breeds from different geographic and agrocli
matic parts across India (figure). These breeds differ in
weight and size as well (Table 1). The blood samples,
collected from jugular veins were kept in EDTA con
tained vacutainer (B.D. Bioscience, Germany) fol
lowed by storage at –20°C. A total of 42 animals
belonging to seven wellrecognized breeds of Indian
goat had been taken for study. Each breed was repre
sented by six animals. The unrelated animals were
selected at random from their breeding tracts by pick
PCR Amplification and Sequencing
PRIMERSELECT program of LASERGENE
software (DNASTAR, Inc., Madison, WI, United
States) was used to design three primer pairs of CAST
gene. Another three fragments of CAST gene contain
ing intron 5, intron 12 and partial 3'UTR was also
amplified by designing primer pairs based on the pub
lished cattle (Genbank accession number: AY008267
for intron 5 and AF159246 for 3'UTR) and sheep
Table 1. Distribution and physical characteristics of selected goat breeds from India
Name
Barbari
Beetal
Ganjam
Sirohi
Black Bengal
Osmanabadi
Malabari
Location
Meat: body weight (kg)
12 months
Uttar Pradesh
Punjab
Orissa
Rajasthan
West Bengal, Bihar, Jharkhand
Maharastra
Kerala
14.52 ± 0.77
21.83
11.69 ± 0.16
21.27 ± .23
12.60 ± 0.63
15.12 ± 0.24
14.12 ± 0.21
Conformation
Small with compact body
Large animal
Tall, leggy animals
Compact medium sized
Small animals
Tall animals
Mediumsized animals
RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 4
2013
SINGLE NUCLEOTIDE POLYMORPHISMS
443
Table 2. Primers used for amplification of CAST gene from Indian goats
Amplified
region
Primer sequence (5' to 3')
Annealing
temperature
PCR product size
Reference
Sequences
Exon 3
F: 5'tgatacaggtaactttggattgggtgaa3'
R: 5'tgatgaggtaaaagaatgggatgctgac3'
56°C
568 bp
Self designed AY834770
Intron 5
F: 5'gttatgaattgctttctactc3'
R: 5'atacgattgagagacttcac3'
55°C
614 bp
[10]
Exon 7
F: 5'gaaacgggctccctggtaaca3'
R: 5'attcatttttggtgccttgctctc3'
58°C
416 bp
Self designed AY834770
Exon 8
F: 5'ggagaggcagccaagagcaatgaag3'
R: 5'ggggtctgttagctctggggtgatt3'
60°C
751 bp
Self designed AY834770
Intron 12
F: 5'ctcccactttaagacaacaac3'
R: 5'agcctcttctgtagatttctg3'
60°C
448 bp
[11]
EF669476
3'UTR
F: 5'acattctccccacagtgcc3'
R: 5'gacagagtctgcgttttgctc3'
64°C
375 bp
[9]
AF159246
(Genbank accession number: EF669476 for intron 12)
sequences (Table 2). Polymerase Chain Reaction
(PCR) conditions were optimized and carried out with
50–10 ng of the genomic DNA in a 25 µL reaction
volume using icycler (BioRAD, United States). The
reaction mixture consisted of 200 µM each of dATP,
dCTP, dGTP, dTTP, 1.5 mM MgCl2, 50 pmol primer,
0.5 U Taq polymerase (Bangalore Genei Pvt Ltd.,
Bangalore, India) and Taq buffer. The PCR was car
ried out with initial denaturation at 94°C for 1 min,
followed by 30 cycle with denaturation at 94°C for 1
min, annealing at specific Tm of primer pair for 1 min
and extension for 1 min at 72°C. The final extension
was performed at 72°C for 5 min. The amplicons were
checked for their expected sizes on 1.8% agarose gel,
enzymatically purified and sequenced by an Auto
mated DNA Sequencer (ABI3100 Applied Biosys
tem, United States).
Bioinformatics Analysis
Sequences of amplified regions of CAST gene were
analyzed using the LaserGene software package
(DNASTAR Inc., Madison, WI). Multiple sequence
alignments were performed with MegAlign program of
LaserGene software to identify SNPs. The allele and
genotype frequencies were calculated for each poly
morphism according to Weir [14]. The BLAST algo
rithm was used to search the NCBI GenBank
(http://www.ncbi.nlm.nih.gov) databases for homolo
gous sequences. The coding DNA sequences of differ
ent exonic regions were conceptually translated to
amino acid sequences using EDITSEQ software.
Sequence data from these samples were entered in
the NCBI GenBank database under the following
accession numbers: exons 3, 7, 8 and introns 5
(JQ073718), 12 (JQ739234) and 3'UTR (JQ073719).
RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 4
AY008267
RESULTS AND CONCLUSIONS
Because of the economic importance of the
caprine species to the livestock industry, it appears
clearly essential to reveal some quality information
related to CAST gene. In this study, variations and
gene specific polymorphisms in the caprine CAST
gene was investigated based on automated DNA
sequencing and SNP detection, which allowed the
detection of novel allele as well as status of previously
reported alleles.
As complete caprine gene sequence is not yet avail
able, bovine CAST gene in the GenBank database
(NW_001495281.2) was utilized for analysis of regions
of CAST gene in Capra hircus. The sequence informa
tion obtained by direct sequencing of the PCR frag
ments was used to detect variation in the expressive as
well as non expressive regions of CAST gene in Indian
goat as compared to exotic cattle (NW_001495281.2).
3126 bp of relevant DNA was sequenced in seven
Indian goat breeds that include 222 bp of three exons
(exon 3, 7 and 8), 2529 bp of intronic region (intron 3,
5, 6, 7, 8 and 12) and 375 bp of 3'UTR. We report
142 variations in indigenous goat as compared to
exotic cattle of which 10 were SNPs, distributed
throughout the CAST gene. One SNP was located in
exon 3 whereas, rests of the SNPs were observed in
introns (Table 3).
Multiple alignment and sequence comparison in
the present study indicated that both the transcribed
and nontranscribed segment of gene have variations
and the rate of transition (65.5%), is higher than trans
version (17.6%) in Calpastatin gene of Indian goat.
Insertions or deletions were absent in transcribed
regions of CAST gene whereas, twenty four InDels
were observed in other regions. All the 15 variations in
exonic regions were transitions only. These variations
in transcribed regions are responsible for unique
2013
444
SHARMA et al.
Table 3. Variations in CAST gene of indigenous goats from India
Region
Exon 3
Intron 5
Exon 7
Partial intron 7
Exon 8
Partial intron 8
Intron 12
3'UTR
Intron 12
Compared species Number of variations Transition Transversion Insertions/Deletions
Number
of SNPs
Cattle
NW_001495281.2
1
25
6
32
8
24
26
20
1
15
6
25
8
15
14
9
0
5
0
5
0
5
8
2
0
5
0
2
0
4
4
9
1
2
0
6
0
1
0
0
Sheep EF669476
8
7
0
1
0
sequence of CAST exons in Indian goat as compared
to exotic cattle. Exon 7 and 8 showed more variations
than exon 3 in comparison to sequences of cattle from
same regions (Table 2). Exon 8 presented 88.4% iden
tity at nucleotide level and 87% at amino acid level
with 8 substitutions in nucleotide with reflected
changes in 3 amino acids. Amino acid changes in its
corresponding protein are: aspargine > serine
(4th amino acid), alanine > valine (13th amino acid)
and glycine > alanine (at 22nd amino acid) of total
23 amino acid long chain. Exon 7 showed 93.1% iden
tity at nucleotide level and 83.3% at amino acid level
with 6 substitutions in nucleotide with reflected
changes in 4 amino acids. Changes included lysine to
glutamic acid, threonine to alanine, alanine to valine
and alanine to threonine at position 6th, 14th, 18th
and 20th of 27 amino acid chain respectively. However,
other investigated exon (exon 3) showed conservation
of 98.5 and 95.5% at nucleotide and amino acid level
respectively with a single non synonymous transition
(g82263A>G). Amino acid changes in exon 3, 7 and 8
may provoke functional alterations in the proteolytic
activity of calpastatin, with consequent variations in
postmortem myofibrillar degradation.
Nucleotide sequences of indigenous goats have
been screened to identify novel SNPs that can be used
in identification of meat quality markers in caprines.
The SNP exploration reveals some novel discoveries in
Indian goat CAST gene. Ten novel SNPs have been
identified among these, only one was in the tran
scribed region. The SNP in exon 3 is a nonsynony
mous transition (g82263A>G), which changes amino
acid (Lys > Arg) at position 21 of 22 amino acid con
ceptualized protein sequence. However, this mutation
does not induce a change in amino acid subclass since
lysine and arginine both belongs to positive polar
group. This represents a conserved substitution as both
are amino acids with polar group. In all the goat breeds
tested, the AA genotype was predominant. GG geno
type was observed only in Ganjam and Malabari goat
breeds. Whereas, Barbari, Beetal, Sirohi, Black Ben
gal and Osmanabadi were less monomorphic with
presence of predominantly “A” allele with heterozy
gote frequency of 0.22. It is noteworthy that we did not
find any more SNPs in other exonic regions. Khan
et al. [12] also studied CAST gene exon 1C and ID in
two sheep breeds and Beetal goat breed by SSCP
method but could not find any polymorphism in goat,
though sheep breeds presented different genotypes at
studied locus.
Majority of observed SNPs (9) were in noncoding
region of CAST. Of course, many polymorphisms that
affect biological function will occur outside the coding
regions of genes. Noncoding DNA sequences are
important for regulatory functions. Schenkel et al. [6]
identified the AY_008267.1:g282C>G SNP located in
intron5 of the bovine CAST gene, which was associ
ated with postmortem meat tenderness in crossbred
Bos taurus populations. Pinto et al. [10] reported the
associated SNP g282C>G in cattle herd where “C”
allele was more tender than “G” allele. This SNP is
now part of the commercial test panel for identifying
superior cattle animals in terms of meat quality traits.
For the identification of SNPs in this important region
of CAST gene, 614 bp intron 5 was sequence charac
terized where allele G of g282C>G SNP was found to
be fixed in indigenous goat animals. However two
novel SNPs g84659T>C and g84661G>A have been
identified in present investigation where true allele T =
0.55 and G = 0.608 dominated over its recessive coun
terpart C = 0.45 and 2A = 0.392 respectively (Table 4).
The allelic frequency was different between breeds;
Black Bengal goat showed a greater frequency of true
allele than all other breeds in intron 5 region (Table 5).
These SNPs are highly promising for the validation
studies in view of proportionate allele distribution, as
low frequency of alleles at polymorphic loci impairs
association studies between the polymorphism and
trait of study. Seven more novel SNPs have been iden
tified of which six were in intron 7 and one in intron 8
regions. AA genotype was predominant (53%)
whereas, AG (22%) and GG (25%) genotype were in
RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 4
2013
SINGLE NUCLEOTIDE POLYMORPHISMS
445
Table 4. Frequency of SNPs in CAST gene of Indian goat
Compared
region
Exon 3
Nucleotide
position
Exotic cattle
(NW_001495281.2)
Indian goat
Genotype frequency
Allele frequency
82263
A
G
AA = 0.595
AG = 0.216
GG = 0.189
A = 0.703
G = 0.297
84659
T
C
84661
G
A
90105
G
C
Intron 5
90144
T
C
90149
A
G
90255
A
G
90283
G
A
90306
C
T
90413
A
G
Intron 7
Intron 8
comparable proportion for g90413A>G in intron 8
(Table 4). However, this SNP does not affect the splic
ing process, as to our knowledge potential splicing
sites might extend no more than 20–30 bases into the
intron [15]. However, 9 novel SNPs identified in the
intronic region of CAST gene of caprine genome in
present study, might be in the linkage disequilibrium
with a functional polymorphism. In addition, one or
many of these SNPs may also be directly responsible
for phenotypic alterations since non coding RNAs
transcribed from intron regions (microRNAs) are
involved in different biological processes such as tran
scriptional and posttranscriptional control of gene
expression [16]. In contrast to above mentioned
intronic regions, no SNP could be discovered in
intron 12. We used the primers to amplify 448 bp
region of intron 12 which has been shown to present
four SNPs in the ovines [17]. Obtained sequence was
compared with (NW_001495281.2) and ovine
RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 4
TT = 0.379
TC = 0.351
CC = 0.270
GG = 0.405
GA = 0.405
AA = 0.190
GG = 0.65
CC = 0.35
TT = 0.35
TC = 0.30
CC = 0.35
AA = 0.3
AG = 0.3
GG = 0.4
AA = 0.35
AG = 0.25
GG = 0.40
GG = 0.775
GA = 0.125
AA = 0.1
CC = 0.875
CT = 0.075
TT = 0.05
AA = 0.525
AG = 0.225
GG = 0.250
T = 0.555
C = 0.445
G = 0.608
A = 0.392
G = 0.65
C = 0.35
T = 0.5
C = 0.5
A = 0.45
G = 0.55
A = 0.475
G = 0.525
G = 0.838
A = 0.162
C = 0.913
T = 0.087
A = 0.638
G = 0.362
(EF669476) sequence both. As expected, higher poly
morphic variations were observed in cattle (26) as
compared to sheep (8) (Table 3).
The 3'UTR has gained attention due to its impor
tance in regulation of gene functions [18]. It’s impor
tant to mention that 3'UTR g2959A>G has been
reported to be associated with meat tenderness in cat
tle with “A” allele associated with much tender meat
[5]. For these reasons, it was considered worthwhile to
investigate the same region in indigenous goats.
Twenty variations were observed as compared to cattle
with G allele being fixed at g2959A>G SNP. 3'UTR
plays a pivotal role in the regulation of mRNA 3'end
formation stability/degradation, nuclear export, sub
cellular localization etc. and thus particularly rich in
cisacting regulatory elements [19]. Therefore, it is
possible that nucleotide variations may influence these
activities, resulting in altered function. However,
Corva et al. [20] established SNP2870 A>G in Bos tau
2013
446
SHARMA et al.
Table 5. Frequency of CAST gene SNPs in different goat breeds from India
Goat breed
Compared region SNP
Exon 3
Intron 7
Sirohi
Malabari
Osmanabadi
AA = 0.83
GG = 0.17
AA = 0.4
AG = 0.2
GG = 0.4
AA = 0.5
AG = 0.5
TT = 0.5
TC = 0.5
TT = 0.4
CC = 0.6
GG = 0.5
GA = 0.5
GG = 0.4
GA = 0.2
AA = 0.4
GG = 0.33
CC = 0.67
GG = 1
TT = 0.33
CC = 0.67
TC = 0.67
CC = 0.33
AA = 0.33
GG = 0.67
AG = 0.5
GG = 0.5
TT = 0.5
TC = 0.33
CC = 0.17
TT = 0.17
TC = 0.5
CC = 0.33
TT = 0.67
TC = 0.33
GG = 0.67
GA = 33
GG = 0.5
GA = 0.5
GA = 0.5
AA = 0.5
GG = 0.67
GA = 0.33
GG = 0.17
GC = 0.5
CC = 0.33
TT = 0.33
TC = 0.5
CC = 0.17
AA = 0.33
AG = 0.5
GG = 0.17
AA = 0.33
AG = 0.5
GG = 0.17
GG = 0.66
GC = 0.17
CC = 0.17
TT = 0.17
TC = 0.17
CC = 0.66
AA = 0.17
AG = 0.17
GG = 0.66
GG = 0.5
CC = 0.5
GG = 0.5
CC = 0.5
GG = 0.67
CC = 0.33
TT = 0.66
TC = 0.17
CC = 0.17
AA = 0.5
AG = 0.33
GG = 0.17
AA = 0.5
AG = 0.33
GG = 0.17
TT = 0.66
TC = 0.17
CC = 0.17
AA = 0.66
AG = 0.17
GG = 0.17
AA = 0.66
AG = 0.17
GG = 0.17
TT = 0.34
TC = 0.33
CC = 0.33
AA = 0.34
AG = 0.33
GG = 0.33
AA = 0.34
AG = 0.33
GG = 0.33
G84661A
A90149G
Black
Bengal
AA = 0.25
AG = 0.5
GG = 0.25
T84659C
T90144C
Ganjam
AA = 0.8
AG = 0.2
AA = 0.83
GG = 0.17
G90105C
Beetal
AA = 0.4
AG = 0.2
GG = 0.4
TT = 0.33
TC = 0.33
CC = 0.34
A82263G
Intron 5
TT = 0.17
TC = 0.33
CC = 0.5
GG = 0.4
GA = 0.2
AA = 0.4
G90283A
GG = 0.83
GA = 0.17
GG = 0.66
GA = 0.17
AA = 0.17
GG = 1
GG = 1
GG = 0.5
GA = 0.5
GG = 0.34
GA = 0.33
AA = 0.33
AA = 0.17
AG = 0.33
GG = 0.5
GG = 0.66
GA = 0.17
AA = 0.17
C90306T
CC = 1
CC = 1
CC = 0.5
CT = 0.33
TT = 0.17
CC = 0.66
CT = 0.17
TT = 0.17
CC = 1
CC = 1
CC = 1
A90413G
AA = 0.5
AG = 0.5
AA = 0.33
AG = 0.34
GG = 0.33
AA = 0.5
GG = 0.5
AA = 0.67
GG = 0.33
AA = 0.5
AG = 0.17
GG = 0.33
AA = 1
AA = 0.33
AG = 0.5
GG = 0.17
A90255G
Intron 8
Barbari
AA = 0.34
GG = 0.66
rus beef cattle of Argentina which was absent in
present studied breeds of Indian goat. CAST gene
sequences of indigenous goats were subjected to basic
local alignment search to know the sequence homol
ogy with the corresponding gene of other species. The
BLAST result revealed that similarity with Bos taurus
of Exonic regions (exon 3, 7, 8), intron 5 and 3'UTR
was 98, 93 and 94% respectively. Since sequence for
intron 12 is available for cattle and sheep, it was com
pared with both. Intron 12 of caprine CAST gene
showed higher homology with Ovis aries (98%) than
with Bos taurus (93%).
Enzyme restriction sites which recognize the novel
SNPs have been identified using NEB cutter V2.0.
Three of the 10 SNPs can be detected by PCRRFLP
using the digestion of the amplified fragment with
Restriction enzymes (Table 6). In silico restriction
AA = 0.33
GG = 0.67
map(s) have been generated for all the 3 sites. Restric
tion enzymes were selected which resulted in only one
cutting site in the PCR product. Since PCRRFLP
method are efficient, low cost, reproducible and con
venient for laboratories with a limited level of technol
ogy worldwide, it should be useful for researchers will
ing to work with genetic markers in goats, genotyping
in casecontrol association or population genetic
studies. Since no phenotypes on meat quality are cur
rently available for indigenous goats in India, it will
not be possible to link novel SNPs noticed in present
study with the traits. Thus SNPs reported here may
serve as a marker for potential association with meat
quality traits in Indian goats.
In conclusion, we have defined ten novel SNPs
(polymorphic sites) spanning core regions of caprine
CAST gene. It is still conceivable that even more
RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 4
2013
SINGLE NUCLEOTIDE POLYMORPHISMS
447
Table 6. Novel restriction sites and characteristics of restriction enzymes for SNPs in CAST gene
Gene
CAST
CAST
CAST
Region
Intron 5
Intron 5
Intron 7
Nucleotide change
TT>CC
GG>GA/AA
TT>CC/CT
Restriction enzyme
AlwN I
HpyCH4V
HPyCH4III
genetic variation exists as more goats from different
breeds will be analyzed and as development of latest
techniques will enable variation across the whole
CAST gene to be easily assessed. These results will
provide a background for more extensive characteriza
tion of the caprine CAST gene, its diversity in different
goat breeds, and the potential to develop gene markers
for meatquality traits.
ACKNOWLEDGMENTS
We acknowledge the financial Support provided by
Network Project on Animal Genetic Resources,
Indian Council of agricultural Research, India for car
rying out this study.
REFERENCES
1. Koohmaraie, M., Killefer, J., Bishop, M.D., et al.,
CalpastatinBased Methods for Predicting Meat Ten
derness, Expression of Muscle Proteinases and Regula
tion of Protein Degradation as Related to Meat Quality,
Ouali, A., Demeyer, D., and Smulders, F., Eds.,
Nijmegen: Audet Tijdschrifren B.V., 1995, pp. 395–
412.
2. Pringle, T.D., Williams, S.E., Lamb, B.S., et al., Car
cass Characteristics, the Calpain Proteinase System,
and Aged Tenderness of Angus and Brahman Crossbred
Steers, J. Anim. Sci., 1997, vol. 75, pp. 2955–2961.
3. Goll, D.E., Thompson, V.F., Taylor, R.G., and Chris
tiansen, J.A., Role of the Calpain System in Muscle
Growth, Biochimie, 1992, vol. 74, pp. 225–237.
4. Bishop, M.D., Koohmaraie, M., Killefer, J., and
Kappes, S., Rapid Communication: Restriction Frag
ment Length Polymorphisms in the Bovine Calpastatin
Gene, J. Anim. Sci., 1993, vol. 71, p. 2277.
5. Casas, E., White, S.N., Wheeler, T.L., et al., Effects of
Calpastatin and MicroCalpain Markers in Beef Cattle
on Tenderness Traits, J. Anim. Sci., 2006, vol. 84,
pp. 520–525.
Restriction site
Reaction temperature
5'..CAGNN C TG..3
5'..TGCA..3'
5'..TCA C TG..3'
37°C
37°C
37°C
8. Ciobanu, D.C., Bastiaansen, J.M., and Lonergan, S.M.,
New Alleles in Calpastatin Gene Are Associated with
Meat Quality Traits in Pigs, J. Anim. Sci., 2004, vol. 82,
pp. 2829–2839.
9. Li, J., Zhang, H., LuPei Gan, et al., Association of
CAST Gene Polymorphisms with Carcass and Meat
Quality Traits in Chinese Commercial Cattle Herds,
AsianAustralasian J. Anim. Sci., 2010, vol. 23,
pp. 1405–1411.
10. Pinto, L.F.B., Ferraz1, J.B., Meirelles, S., et al., Asso
ciation of SNPs on CAPN1 and CAST Genes with Ten
derness in Nellore Cattle, Genet. Mol. Res., 2010, vol. 9,
pp. 1431–1442.
11. Zhou, H. and Hickford, J.G.H., Allelic Variation of the
Bovine Calpastatin (CAST) Gene, Mol. Cell. Probes,
2008, vol. 22, pp. 129–130.
12. Khan, S.H., Riaz, M.N., Ghaffar, A., and Khan, M.F.U.,
Calpastatin (CAST) Gene Polymorphism and Its Asso
ciation with Average Daily Weight Gain in Balkhi and
Kajli Sheep and Beetal Goat Breeds, Pakistan J. Zol.,
2012, vol. 44, no. 2, pp. 377–382.
13. Sambrook, J., Fritsch, E.F., and Maniatis, T., Molecu
lar Cloning: A Laboratory Manual, New York: Cold
Spring Harbor Lab., 1989, 2ed.
14. Weir, B.S., Genetic Data Analysis: methods for discrete
population genetic data, Sunderland: Sinauer Associ
ates, 1996, 2nd ed.
15. Garrigan, D. and Edwards, S.V., Polymorphism across
an Exon–Intron Boundary in an Avian MHC Class II
B Gene, Mol. Biol. Evol., 1999, vol. 16, pp. 1599–1606.
16. Nakaya, H.L., Amaral, P.P., Louro, R., et al., Genome
Mapping and Expression Analysis of Human Intronic
NonCoding RNAs Reveal Tissue Specific Patterns and
Enrichment in Genes Related to Regulation of Tran
scription, Genome Biol., 2007, vol. 8. R43.
http://genomebiology.com
17. Byun, S.O., Zhou, H., and Hickford, J.G.H., Haplo
typic Diversity within the Ovine Calpastatin (CAST)
Gene, Mol. Biotechnol., 2009, vol. 41, pp. 133–137.
6. Schenkel, F.S., Miller, S.P., Jiang, Z., et al., Associa
tion of a Single Nucleotide Polymorphism in the Calp
astatin Gene with Carcass and Meat Quality Traits of
Beef Cattle, J. Anim. Sci., 2006, vol. 84, pp. 291–299.
18. Hughes, T., Regulation of Gene Expression by Alterna
tive Untranslated Regions, Trends Genet., 2006, vol. 22,
pp. 119–122.
19. Kubiak, J.E., S l oniewski, K., Oprzdek, J., et al., The
Effect of Polymorphisms in the Intron 12 of CAST
Gene on Meat Quality of Young Bulls, Anim. Sci.
Papers Rep., 2009, vol. 27, pp. 281–292.
7. Van Eenennaam, A.L., Li, J., Thallman, R.M., et al.,
Validation of Commercial DNA Tests for Quantitative
Beef Quality Traits, J. Anim. Sci., 2007, vol. 85,
pp. 891–900.
20. Corva, P., Soria, L., Schor, A., et al., Association of
CAPN1 and CAST Gene Polymorphisms with Meat
Tenderness in Bos taurus Beef Cattle from Argentina,
Genet. Mol. Biol., 2007, vol. 30, pp. 1064–1069.
RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 4
2013