Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
ISSN 10227954, Russian Journal of Genetics, 2013, Vol. 49, No. 4, pp. 441–447. © Pleiades Publishing, Inc., 2013. ANIMAL GENETICS Single Nucleotide Polymorphisms in Caprine Calpastatin Gene1 R. Sharma, A. Maitra, A. K. Pandey, L. V. Singh, and B. P. Mishra National Bureau of Animal Genetic Resources, Karnal132001 (Haryana), India; email: [email protected] Received March 27, 2012; in final form, July 04, 2012 Abstract—The calpains and calpastatin (CAST) make up a major cytosolic proteolytic system, the calpain– calpastatin system, found in mammalian tissues. The relative levels of the components of the calpain–calp astatin system determine the extent of meat tenderization during postmortem storage. Calpastatin (CAST) is a protein inhibitor of the ubiquitous calciumdependent proteases, µcalpain, and mcalpain. Polymor phisms in the bovine, ovine and pig CAST gene have been associated with meat tenderness but little is known about how caprine CAST gene may affect goat meat quality traits. In this study we selected different parts of the CAST gene: (1) that have been previously reported to be polymorphic, intron 5 and 12 and 3'UTR; (2) first time explored (exon 3, 7 and 8 and part of intron 7 and 8) to investigate polymorphic status of caprine CAST gene. Using comparative sequencing ten novel SNPs located in exon 3 and intron 5, 7 and 8 were iden tified. Previously reported SNPs in intron 5, 3'UTR and intron 12 were absent. Sequence analysis revealed a non synonymous amino acid variation in exon 3, which would result in Lys/Arg substitution in the corre sponding protein sequence. Considerable variation was detected in intronic regions. Twentyfour InDel were also recognized in intronic regions (15) and 3'UTR (9). All the sequences shared high homology with pub lished bovine and ovine sequences. Three PCRRFLP loci have been established for further analyzing genetic polymorphism in indigenous goats. DOI: 10.1134/S1022795413040133 1 Polymorphism at the DNA level is key player in animal genetics. Most of research on genetic markers applied to animal breeding is concentrated on analysis of mutations or polymorphisms located within eco nomically important structural genes and linkage of these genes to quantitative trait loci (QTL). A number of potential candidate genes for meat characteristics have been identified in last decade. Allelic variation in the regulatory and structural regions of these genes may affect the gene expression or amino acid sequences and ultimately impact on meat quality traits. Among different candidates, CAST gene seems to be promising as it plays an important role in meat tenderness. Increased postmortem CAST activity has been correlated with reduced meat tenderness [1, 2]. Several alternatively spliced transcript variants of this gene have been described, but the fulllength nature of only some have been determined. Calpastatin plays a central role in regulation of calpains activity in the cell and is considered to be one of major modulators of postmortem protein turnover [3]. Its role in meat ageing has been demonstrated, especially by the strong genetic correlations between calpastatin activity and tenderness measured by Warner–Bratzler shear force. The bovine CAST gene has been mapped BTA7 at the position 117.8 cM is considered as a candidate gene for beef tenderness [4]. The variation of the CAST locus in cattle was a subject of several studies which 1 The article is published in the original. discovered genetic polymorphism in coding and non coding region including 3'untranslated region. Associ ations have been reported between variation in CAST and carcass and meat quality in cattle [5–7] and pigs [8]. Recently Jiao et al. [9] has discussed one associ ated SNP of Chinese commercial cattle breed at g2959A>G of 3'untranslated region. On other hand, Pinto et al. [10] discovered an associated SNP g282C>G of intron 12 in cattle herd. Both mutations corre sponded with a high Warner–Bratzler shear force (WBSF) in cattle herd. In cattle, variation in bovine CAST is utilized commercially in genetic tests: Gene STAR Tenderness and IGENITY TenderGENE (Genetic Solutions Pty. Ltd., Albion, Australia) with former test using G/A SNP in the 3'UTR while later using G/C SNP in intron 5. Despite growing interest in the investigation of CAST involvement with meat quality traits in cattle, pig and sheep, nothing substantial on CAST of caprines have been reported, as of yet. Perusal of liter ature shows that limited information is available on CAST of goat [11, 12] with no studies on indigenous goats from India. Thus the objective of present study was to identify polymorphisms in CAST gene of indig enous goats from India and to determine the allele dis tribution in different Indian goat breeds differing in phenotype (weight and size) and geographical distri bution. Three exons (exon 3, 7 and 8) along with upstream and downstream regions, introns (5, 12) and 3'UTR were amplified, sequenced and analyzed. 441 442 SHARMA et al. Beetal Barbari Sirohi Black Bengal Osmanabadi Ganjam Malabari Geographical distribution of Indian goat breeds selected for CAST polymorphism study. ing up only two samples per herd and only two herds per village. DNA was isolated from blood samples, fol lowing standard procedures [13]. MATERIALS AND METHODS Animals and DNA Source Blood samples were collected from a panel of seven goat breeds from different geographic and agrocli matic parts across India (figure). These breeds differ in weight and size as well (Table 1). The blood samples, collected from jugular veins were kept in EDTA con tained vacutainer (B.D. Bioscience, Germany) fol lowed by storage at –20°C. A total of 42 animals belonging to seven wellrecognized breeds of Indian goat had been taken for study. Each breed was repre sented by six animals. The unrelated animals were selected at random from their breeding tracts by pick PCR Amplification and Sequencing PRIMERSELECT program of LASERGENE software (DNASTAR, Inc., Madison, WI, United States) was used to design three primer pairs of CAST gene. Another three fragments of CAST gene contain ing intron 5, intron 12 and partial 3'UTR was also amplified by designing primer pairs based on the pub lished cattle (Genbank accession number: AY008267 for intron 5 and AF159246 for 3'UTR) and sheep Table 1. Distribution and physical characteristics of selected goat breeds from India Name Barbari Beetal Ganjam Sirohi Black Bengal Osmanabadi Malabari Location Meat: body weight (kg) 12 months Uttar Pradesh Punjab Orissa Rajasthan West Bengal, Bihar, Jharkhand Maharastra Kerala 14.52 ± 0.77 21.83 11.69 ± 0.16 21.27 ± .23 12.60 ± 0.63 15.12 ± 0.24 14.12 ± 0.21 Conformation Small with compact body Large animal Tall, leggy animals Compact medium sized Small animals Tall animals Mediumsized animals RUSSIAN JOURNAL OF GENETICS Vol. 49 No. 4 2013 SINGLE NUCLEOTIDE POLYMORPHISMS 443 Table 2. Primers used for amplification of CAST gene from Indian goats Amplified region Primer sequence (5' to 3') Annealing temperature PCR product size Reference Sequences Exon 3 F: 5'tgatacaggtaactttggattgggtgaa3' R: 5'tgatgaggtaaaagaatgggatgctgac3' 56°C 568 bp Self designed AY834770 Intron 5 F: 5'gttatgaattgctttctactc3' R: 5'atacgattgagagacttcac3' 55°C 614 bp [10] Exon 7 F: 5'gaaacgggctccctggtaaca3' R: 5'attcatttttggtgccttgctctc3' 58°C 416 bp Self designed AY834770 Exon 8 F: 5'ggagaggcagccaagagcaatgaag3' R: 5'ggggtctgttagctctggggtgatt3' 60°C 751 bp Self designed AY834770 Intron 12 F: 5'ctcccactttaagacaacaac3' R: 5'agcctcttctgtagatttctg3' 60°C 448 bp [11] EF669476 3'UTR F: 5'acattctccccacagtgcc3' R: 5'gacagagtctgcgttttgctc3' 64°C 375 bp [9] AF159246 (Genbank accession number: EF669476 for intron 12) sequences (Table 2). Polymerase Chain Reaction (PCR) conditions were optimized and carried out with 50–10 ng of the genomic DNA in a 25 µL reaction volume using icycler (BioRAD, United States). The reaction mixture consisted of 200 µM each of dATP, dCTP, dGTP, dTTP, 1.5 mM MgCl2, 50 pmol primer, 0.5 U Taq polymerase (Bangalore Genei Pvt Ltd., Bangalore, India) and Taq buffer. The PCR was car ried out with initial denaturation at 94°C for 1 min, followed by 30 cycle with denaturation at 94°C for 1 min, annealing at specific Tm of primer pair for 1 min and extension for 1 min at 72°C. The final extension was performed at 72°C for 5 min. The amplicons were checked for their expected sizes on 1.8% agarose gel, enzymatically purified and sequenced by an Auto mated DNA Sequencer (ABI3100 Applied Biosys tem, United States). Bioinformatics Analysis Sequences of amplified regions of CAST gene were analyzed using the LaserGene software package (DNASTAR Inc., Madison, WI). Multiple sequence alignments were performed with MegAlign program of LaserGene software to identify SNPs. The allele and genotype frequencies were calculated for each poly morphism according to Weir [14]. The BLAST algo rithm was used to search the NCBI GenBank (http://www.ncbi.nlm.nih.gov) databases for homolo gous sequences. The coding DNA sequences of differ ent exonic regions were conceptually translated to amino acid sequences using EDITSEQ software. Sequence data from these samples were entered in the NCBI GenBank database under the following accession numbers: exons 3, 7, 8 and introns 5 (JQ073718), 12 (JQ739234) and 3'UTR (JQ073719). RUSSIAN JOURNAL OF GENETICS Vol. 49 No. 4 AY008267 RESULTS AND CONCLUSIONS Because of the economic importance of the caprine species to the livestock industry, it appears clearly essential to reveal some quality information related to CAST gene. In this study, variations and gene specific polymorphisms in the caprine CAST gene was investigated based on automated DNA sequencing and SNP detection, which allowed the detection of novel allele as well as status of previously reported alleles. As complete caprine gene sequence is not yet avail able, bovine CAST gene in the GenBank database (NW_001495281.2) was utilized for analysis of regions of CAST gene in Capra hircus. The sequence informa tion obtained by direct sequencing of the PCR frag ments was used to detect variation in the expressive as well as non expressive regions of CAST gene in Indian goat as compared to exotic cattle (NW_001495281.2). 3126 bp of relevant DNA was sequenced in seven Indian goat breeds that include 222 bp of three exons (exon 3, 7 and 8), 2529 bp of intronic region (intron 3, 5, 6, 7, 8 and 12) and 375 bp of 3'UTR. We report 142 variations in indigenous goat as compared to exotic cattle of which 10 were SNPs, distributed throughout the CAST gene. One SNP was located in exon 3 whereas, rests of the SNPs were observed in introns (Table 3). Multiple alignment and sequence comparison in the present study indicated that both the transcribed and nontranscribed segment of gene have variations and the rate of transition (65.5%), is higher than trans version (17.6%) in Calpastatin gene of Indian goat. Insertions or deletions were absent in transcribed regions of CAST gene whereas, twenty four InDels were observed in other regions. All the 15 variations in exonic regions were transitions only. These variations in transcribed regions are responsible for unique 2013 444 SHARMA et al. Table 3. Variations in CAST gene of indigenous goats from India Region Exon 3 Intron 5 Exon 7 Partial intron 7 Exon 8 Partial intron 8 Intron 12 3'UTR Intron 12 Compared species Number of variations Transition Transversion Insertions/Deletions Number of SNPs Cattle NW_001495281.2 1 25 6 32 8 24 26 20 1 15 6 25 8 15 14 9 0 5 0 5 0 5 8 2 0 5 0 2 0 4 4 9 1 2 0 6 0 1 0 0 Sheep EF669476 8 7 0 1 0 sequence of CAST exons in Indian goat as compared to exotic cattle. Exon 7 and 8 showed more variations than exon 3 in comparison to sequences of cattle from same regions (Table 2). Exon 8 presented 88.4% iden tity at nucleotide level and 87% at amino acid level with 8 substitutions in nucleotide with reflected changes in 3 amino acids. Amino acid changes in its corresponding protein are: aspargine > serine (4th amino acid), alanine > valine (13th amino acid) and glycine > alanine (at 22nd amino acid) of total 23 amino acid long chain. Exon 7 showed 93.1% iden tity at nucleotide level and 83.3% at amino acid level with 6 substitutions in nucleotide with reflected changes in 4 amino acids. Changes included lysine to glutamic acid, threonine to alanine, alanine to valine and alanine to threonine at position 6th, 14th, 18th and 20th of 27 amino acid chain respectively. However, other investigated exon (exon 3) showed conservation of 98.5 and 95.5% at nucleotide and amino acid level respectively with a single non synonymous transition (g82263A>G). Amino acid changes in exon 3, 7 and 8 may provoke functional alterations in the proteolytic activity of calpastatin, with consequent variations in postmortem myofibrillar degradation. Nucleotide sequences of indigenous goats have been screened to identify novel SNPs that can be used in identification of meat quality markers in caprines. The SNP exploration reveals some novel discoveries in Indian goat CAST gene. Ten novel SNPs have been identified among these, only one was in the tran scribed region. The SNP in exon 3 is a nonsynony mous transition (g82263A>G), which changes amino acid (Lys > Arg) at position 21 of 22 amino acid con ceptualized protein sequence. However, this mutation does not induce a change in amino acid subclass since lysine and arginine both belongs to positive polar group. This represents a conserved substitution as both are amino acids with polar group. In all the goat breeds tested, the AA genotype was predominant. GG geno type was observed only in Ganjam and Malabari goat breeds. Whereas, Barbari, Beetal, Sirohi, Black Ben gal and Osmanabadi were less monomorphic with presence of predominantly “A” allele with heterozy gote frequency of 0.22. It is noteworthy that we did not find any more SNPs in other exonic regions. Khan et al. [12] also studied CAST gene exon 1C and ID in two sheep breeds and Beetal goat breed by SSCP method but could not find any polymorphism in goat, though sheep breeds presented different genotypes at studied locus. Majority of observed SNPs (9) were in noncoding region of CAST. Of course, many polymorphisms that affect biological function will occur outside the coding regions of genes. Noncoding DNA sequences are important for regulatory functions. Schenkel et al. [6] identified the AY_008267.1:g282C>G SNP located in intron5 of the bovine CAST gene, which was associ ated with postmortem meat tenderness in crossbred Bos taurus populations. Pinto et al. [10] reported the associated SNP g282C>G in cattle herd where “C” allele was more tender than “G” allele. This SNP is now part of the commercial test panel for identifying superior cattle animals in terms of meat quality traits. For the identification of SNPs in this important region of CAST gene, 614 bp intron 5 was sequence charac terized where allele G of g282C>G SNP was found to be fixed in indigenous goat animals. However two novel SNPs g84659T>C and g84661G>A have been identified in present investigation where true allele T = 0.55 and G = 0.608 dominated over its recessive coun terpart C = 0.45 and 2A = 0.392 respectively (Table 4). The allelic frequency was different between breeds; Black Bengal goat showed a greater frequency of true allele than all other breeds in intron 5 region (Table 5). These SNPs are highly promising for the validation studies in view of proportionate allele distribution, as low frequency of alleles at polymorphic loci impairs association studies between the polymorphism and trait of study. Seven more novel SNPs have been iden tified of which six were in intron 7 and one in intron 8 regions. AA genotype was predominant (53%) whereas, AG (22%) and GG (25%) genotype were in RUSSIAN JOURNAL OF GENETICS Vol. 49 No. 4 2013 SINGLE NUCLEOTIDE POLYMORPHISMS 445 Table 4. Frequency of SNPs in CAST gene of Indian goat Compared region Exon 3 Nucleotide position Exotic cattle (NW_001495281.2) Indian goat Genotype frequency Allele frequency 82263 A G AA = 0.595 AG = 0.216 GG = 0.189 A = 0.703 G = 0.297 84659 T C 84661 G A 90105 G C Intron 5 90144 T C 90149 A G 90255 A G 90283 G A 90306 C T 90413 A G Intron 7 Intron 8 comparable proportion for g90413A>G in intron 8 (Table 4). However, this SNP does not affect the splic ing process, as to our knowledge potential splicing sites might extend no more than 20–30 bases into the intron [15]. However, 9 novel SNPs identified in the intronic region of CAST gene of caprine genome in present study, might be in the linkage disequilibrium with a functional polymorphism. In addition, one or many of these SNPs may also be directly responsible for phenotypic alterations since non coding RNAs transcribed from intron regions (microRNAs) are involved in different biological processes such as tran scriptional and posttranscriptional control of gene expression [16]. In contrast to above mentioned intronic regions, no SNP could be discovered in intron 12. We used the primers to amplify 448 bp region of intron 12 which has been shown to present four SNPs in the ovines [17]. Obtained sequence was compared with (NW_001495281.2) and ovine RUSSIAN JOURNAL OF GENETICS Vol. 49 No. 4 TT = 0.379 TC = 0.351 CC = 0.270 GG = 0.405 GA = 0.405 AA = 0.190 GG = 0.65 CC = 0.35 TT = 0.35 TC = 0.30 CC = 0.35 AA = 0.3 AG = 0.3 GG = 0.4 AA = 0.35 AG = 0.25 GG = 0.40 GG = 0.775 GA = 0.125 AA = 0.1 CC = 0.875 CT = 0.075 TT = 0.05 AA = 0.525 AG = 0.225 GG = 0.250 T = 0.555 C = 0.445 G = 0.608 A = 0.392 G = 0.65 C = 0.35 T = 0.5 C = 0.5 A = 0.45 G = 0.55 A = 0.475 G = 0.525 G = 0.838 A = 0.162 C = 0.913 T = 0.087 A = 0.638 G = 0.362 (EF669476) sequence both. As expected, higher poly morphic variations were observed in cattle (26) as compared to sheep (8) (Table 3). The 3'UTR has gained attention due to its impor tance in regulation of gene functions [18]. It’s impor tant to mention that 3'UTR g2959A>G has been reported to be associated with meat tenderness in cat tle with “A” allele associated with much tender meat [5]. For these reasons, it was considered worthwhile to investigate the same region in indigenous goats. Twenty variations were observed as compared to cattle with G allele being fixed at g2959A>G SNP. 3'UTR plays a pivotal role in the regulation of mRNA 3'end formation stability/degradation, nuclear export, sub cellular localization etc. and thus particularly rich in cisacting regulatory elements [19]. Therefore, it is possible that nucleotide variations may influence these activities, resulting in altered function. However, Corva et al. [20] established SNP2870 A>G in Bos tau 2013 446 SHARMA et al. Table 5. Frequency of CAST gene SNPs in different goat breeds from India Goat breed Compared region SNP Exon 3 Intron 7 Sirohi Malabari Osmanabadi AA = 0.83 GG = 0.17 AA = 0.4 AG = 0.2 GG = 0.4 AA = 0.5 AG = 0.5 TT = 0.5 TC = 0.5 TT = 0.4 CC = 0.6 GG = 0.5 GA = 0.5 GG = 0.4 GA = 0.2 AA = 0.4 GG = 0.33 CC = 0.67 GG = 1 TT = 0.33 CC = 0.67 TC = 0.67 CC = 0.33 AA = 0.33 GG = 0.67 AG = 0.5 GG = 0.5 TT = 0.5 TC = 0.33 CC = 0.17 TT = 0.17 TC = 0.5 CC = 0.33 TT = 0.67 TC = 0.33 GG = 0.67 GA = 33 GG = 0.5 GA = 0.5 GA = 0.5 AA = 0.5 GG = 0.67 GA = 0.33 GG = 0.17 GC = 0.5 CC = 0.33 TT = 0.33 TC = 0.5 CC = 0.17 AA = 0.33 AG = 0.5 GG = 0.17 AA = 0.33 AG = 0.5 GG = 0.17 GG = 0.66 GC = 0.17 CC = 0.17 TT = 0.17 TC = 0.17 CC = 0.66 AA = 0.17 AG = 0.17 GG = 0.66 GG = 0.5 CC = 0.5 GG = 0.5 CC = 0.5 GG = 0.67 CC = 0.33 TT = 0.66 TC = 0.17 CC = 0.17 AA = 0.5 AG = 0.33 GG = 0.17 AA = 0.5 AG = 0.33 GG = 0.17 TT = 0.66 TC = 0.17 CC = 0.17 AA = 0.66 AG = 0.17 GG = 0.17 AA = 0.66 AG = 0.17 GG = 0.17 TT = 0.34 TC = 0.33 CC = 0.33 AA = 0.34 AG = 0.33 GG = 0.33 AA = 0.34 AG = 0.33 GG = 0.33 G84661A A90149G Black Bengal AA = 0.25 AG = 0.5 GG = 0.25 T84659C T90144C Ganjam AA = 0.8 AG = 0.2 AA = 0.83 GG = 0.17 G90105C Beetal AA = 0.4 AG = 0.2 GG = 0.4 TT = 0.33 TC = 0.33 CC = 0.34 A82263G Intron 5 TT = 0.17 TC = 0.33 CC = 0.5 GG = 0.4 GA = 0.2 AA = 0.4 G90283A GG = 0.83 GA = 0.17 GG = 0.66 GA = 0.17 AA = 0.17 GG = 1 GG = 1 GG = 0.5 GA = 0.5 GG = 0.34 GA = 0.33 AA = 0.33 AA = 0.17 AG = 0.33 GG = 0.5 GG = 0.66 GA = 0.17 AA = 0.17 C90306T CC = 1 CC = 1 CC = 0.5 CT = 0.33 TT = 0.17 CC = 0.66 CT = 0.17 TT = 0.17 CC = 1 CC = 1 CC = 1 A90413G AA = 0.5 AG = 0.5 AA = 0.33 AG = 0.34 GG = 0.33 AA = 0.5 GG = 0.5 AA = 0.67 GG = 0.33 AA = 0.5 AG = 0.17 GG = 0.33 AA = 1 AA = 0.33 AG = 0.5 GG = 0.17 A90255G Intron 8 Barbari AA = 0.34 GG = 0.66 rus beef cattle of Argentina which was absent in present studied breeds of Indian goat. CAST gene sequences of indigenous goats were subjected to basic local alignment search to know the sequence homol ogy with the corresponding gene of other species. The BLAST result revealed that similarity with Bos taurus of Exonic regions (exon 3, 7, 8), intron 5 and 3'UTR was 98, 93 and 94% respectively. Since sequence for intron 12 is available for cattle and sheep, it was com pared with both. Intron 12 of caprine CAST gene showed higher homology with Ovis aries (98%) than with Bos taurus (93%). Enzyme restriction sites which recognize the novel SNPs have been identified using NEB cutter V2.0. Three of the 10 SNPs can be detected by PCRRFLP using the digestion of the amplified fragment with Restriction enzymes (Table 6). In silico restriction AA = 0.33 GG = 0.67 map(s) have been generated for all the 3 sites. Restric tion enzymes were selected which resulted in only one cutting site in the PCR product. Since PCRRFLP method are efficient, low cost, reproducible and con venient for laboratories with a limited level of technol ogy worldwide, it should be useful for researchers will ing to work with genetic markers in goats, genotyping in casecontrol association or population genetic studies. Since no phenotypes on meat quality are cur rently available for indigenous goats in India, it will not be possible to link novel SNPs noticed in present study with the traits. Thus SNPs reported here may serve as a marker for potential association with meat quality traits in Indian goats. In conclusion, we have defined ten novel SNPs (polymorphic sites) spanning core regions of caprine CAST gene. It is still conceivable that even more RUSSIAN JOURNAL OF GENETICS Vol. 49 No. 4 2013 SINGLE NUCLEOTIDE POLYMORPHISMS 447 Table 6. Novel restriction sites and characteristics of restriction enzymes for SNPs in CAST gene Gene CAST CAST CAST Region Intron 5 Intron 5 Intron 7 Nucleotide change TT>CC GG>GA/AA TT>CC/CT Restriction enzyme AlwN I HpyCH4V HPyCH4III genetic variation exists as more goats from different breeds will be analyzed and as development of latest techniques will enable variation across the whole CAST gene to be easily assessed. These results will provide a background for more extensive characteriza tion of the caprine CAST gene, its diversity in different goat breeds, and the potential to develop gene markers for meatquality traits. ACKNOWLEDGMENTS We acknowledge the financial Support provided by Network Project on Animal Genetic Resources, Indian Council of agricultural Research, India for car rying out this study. REFERENCES 1. Koohmaraie, M., Killefer, J., Bishop, M.D., et al., CalpastatinBased Methods for Predicting Meat Ten derness, Expression of Muscle Proteinases and Regula tion of Protein Degradation as Related to Meat Quality, Ouali, A., Demeyer, D., and Smulders, F., Eds., Nijmegen: Audet Tijdschrifren B.V., 1995, pp. 395– 412. 2. Pringle, T.D., Williams, S.E., Lamb, B.S., et al., Car cass Characteristics, the Calpain Proteinase System, and Aged Tenderness of Angus and Brahman Crossbred Steers, J. Anim. Sci., 1997, vol. 75, pp. 2955–2961. 3. Goll, D.E., Thompson, V.F., Taylor, R.G., and Chris tiansen, J.A., Role of the Calpain System in Muscle Growth, Biochimie, 1992, vol. 74, pp. 225–237. 4. Bishop, M.D., Koohmaraie, M., Killefer, J., and Kappes, S., Rapid Communication: Restriction Frag ment Length Polymorphisms in the Bovine Calpastatin Gene, J. Anim. Sci., 1993, vol. 71, p. 2277. 5. Casas, E., White, S.N., Wheeler, T.L., et al., Effects of Calpastatin and MicroCalpain Markers in Beef Cattle on Tenderness Traits, J. Anim. Sci., 2006, vol. 84, pp. 520–525. Restriction site Reaction temperature 5'..CAGNN C TG..3 5'..TGCA..3' 5'..TCA C TG..3' 37°C 37°C 37°C 8. Ciobanu, D.C., Bastiaansen, J.M., and Lonergan, S.M., New Alleles in Calpastatin Gene Are Associated with Meat Quality Traits in Pigs, J. Anim. Sci., 2004, vol. 82, pp. 2829–2839. 9. Li, J., Zhang, H., LuPei Gan, et al., Association of CAST Gene Polymorphisms with Carcass and Meat Quality Traits in Chinese Commercial Cattle Herds, AsianAustralasian J. Anim. Sci., 2010, vol. 23, pp. 1405–1411. 10. Pinto, L.F.B., Ferraz1, J.B., Meirelles, S., et al., Asso ciation of SNPs on CAPN1 and CAST Genes with Ten derness in Nellore Cattle, Genet. Mol. Res., 2010, vol. 9, pp. 1431–1442. 11. Zhou, H. and Hickford, J.G.H., Allelic Variation of the Bovine Calpastatin (CAST) Gene, Mol. Cell. Probes, 2008, vol. 22, pp. 129–130. 12. Khan, S.H., Riaz, M.N., Ghaffar, A., and Khan, M.F.U., Calpastatin (CAST) Gene Polymorphism and Its Asso ciation with Average Daily Weight Gain in Balkhi and Kajli Sheep and Beetal Goat Breeds, Pakistan J. Zol., 2012, vol. 44, no. 2, pp. 377–382. 13. Sambrook, J., Fritsch, E.F., and Maniatis, T., Molecu lar Cloning: A Laboratory Manual, New York: Cold Spring Harbor Lab., 1989, 2ed. 14. Weir, B.S., Genetic Data Analysis: methods for discrete population genetic data, Sunderland: Sinauer Associ ates, 1996, 2nd ed. 15. Garrigan, D. and Edwards, S.V., Polymorphism across an Exon–Intron Boundary in an Avian MHC Class II B Gene, Mol. Biol. Evol., 1999, vol. 16, pp. 1599–1606. 16. Nakaya, H.L., Amaral, P.P., Louro, R., et al., Genome Mapping and Expression Analysis of Human Intronic NonCoding RNAs Reveal Tissue Specific Patterns and Enrichment in Genes Related to Regulation of Tran scription, Genome Biol., 2007, vol. 8. R43. http://genomebiology.com 17. Byun, S.O., Zhou, H., and Hickford, J.G.H., Haplo typic Diversity within the Ovine Calpastatin (CAST) Gene, Mol. Biotechnol., 2009, vol. 41, pp. 133–137. 6. Schenkel, F.S., Miller, S.P., Jiang, Z., et al., Associa tion of a Single Nucleotide Polymorphism in the Calp astatin Gene with Carcass and Meat Quality Traits of Beef Cattle, J. Anim. Sci., 2006, vol. 84, pp. 291–299. 18. Hughes, T., Regulation of Gene Expression by Alterna tive Untranslated Regions, Trends Genet., 2006, vol. 22, pp. 119–122. 19. Kubiak, J.E., S l oniewski, K., Oprzdek, J., et al., The Effect of Polymorphisms in the Intron 12 of CAST Gene on Meat Quality of Young Bulls, Anim. Sci. Papers Rep., 2009, vol. 27, pp. 281–292. 7. Van Eenennaam, A.L., Li, J., Thallman, R.M., et al., Validation of Commercial DNA Tests for Quantitative Beef Quality Traits, J. Anim. Sci., 2007, vol. 85, pp. 891–900. 20. Corva, P., Soria, L., Schor, A., et al., Association of CAPN1 and CAST Gene Polymorphisms with Meat Tenderness in Bos taurus Beef Cattle from Argentina, Genet. Mol. Biol., 2007, vol. 30, pp. 1064–1069. RUSSIAN JOURNAL OF GENETICS Vol. 49 No. 4 2013