Download Positive Feedback Activation of Estrogen

Published OnlineFirst July 7, 2009; DOI: 10.1158/0008-5472.CAN-08-4924
Published Online First on July 7, 2009 as 10.1158/0008-5472.CAN-08-4924
Endocrinology
Positive Feedback Activation of Estrogen Receptors by the
CXCL12-CXCR4 Pathway
1,2
1,2
1,2
1,2
Karine Sauvé, Julie Lepage, Mélanie Sanchez, Nikolaus Heveker, and André Tremblay
1,2,3
1
Research Center, CHU Ste-Justine, and Departments of 2Biochemistry and 3Obstetrics and Gynecology, University of Montreal,
Montréal, Quebec, Canada
Abstract
Induction of estrogen-regulated gene transcription by estrogen receptors ERA and ERB plays an important role in breast
cancer development and growth. High expression of the
chemokine receptor CXCR4 and its ligand CXCL12/stromal
cell-derived factor 1 (SDF-1) has also been correlated with
aggressive breast tumor phenotypes. Here, we describe a
positive regulatory loop between the CXCR4/SDF-1 signaling
pathway and ER transcriptional competence in human breast
cancer cells. Treatment of breast carcinoma MCF-7 cells with
SDF-1 increased ER transcriptional activity and expression
of ER target genes, including SDF-1 itself. These effects were
blocked by the antiestrogen ICI-182780 and by CXCR4 silencing and, conversely, estrogen-induced gene expression and
growth of MCF-7 cells were impaired on CXCR4 inhibition.
Both ERA and ERB were activated by SDF-1 in the presence
of CXCR4 and by overexpression of a constitutively active
CXCR4, indicating that CXCR4 signals to both receptors. In
particular, ERB was able to translate the effects of SDF-1 on its
own expression, as well as enhance activator protein 1 (AP-1)
containing genes cyclin D1 and c-Myc in the presence of
tamoxifen. This correlated with an increased ERB occupancy
of responsive promoters at both estrogen-responsive and AP-1
elements. Ser-87, a conserved mitogen-activated protein
kinase site in ERB, was highly phosphorylated by SDF-1,
revealing an essential role of the AF-1 domain in response
to CXCR4 activation. These results identify a complete autocrine loop between the CXCR4/SDF-1 and ERA/ERB signaling
pathways that dictates ER-dependent gene expression and
growth of breast cancer cells. [Cancer Res 2009;69(14):5793–800]
Introduction
Estrogens play a pivotal role in reproductive physiology but are
also oncogenic in breast cancers. Regulation of target gene
expression by estrogens is mediated through direct interaction
with the estrogen receptors ERa and ERh, which belong to the
nuclear hormone receptor family of ligand-activated transcription
factors (1). Transcription by ERs involves not only interaction with
their cognate estrogen response element (ERE) within target
promoters but also tethered interactions with AP-1 transcription
factors (2). The activation function AF-2 located in the COOHterminal region of ERs responds to hormone to initiate a
Note: Supplementary data for this article are available at Cancer Research Online
(http://cancerres.aacrjournals.org/).
Requests for reprints: André Tremblay, Research Center, Ste-Justine Hospital,
3175 Côte Ste-Catherine, Montréal, Québec, Canada H3T 1C5. Phone: 514-345-4931;
Fax: 514-345-4988; E-mail: [email protected].
I2009 American Association for Cancer Research.
doi:10.1158/0008-5472.CAN-08-4924
www.aacrjournals.org
combinatorial recruitment of coactivators that facilitate chromatin remodeling and transcription (3, 4). However, the cellular
mechanisms involved in ER AF-1 activation are poorly understood.
It is known that in response to many growth factors, such as
epidermal growth factor (EGF), insulin-like growth factor I, and
heregulins, the activation of ERs is associated with phosphorylation
of the AF-1 domain (5–7).
CXCR4 is a seven-transmembrane-domain G-protein–coupled
receptor, which is activated by the chemokine stromal cell–derived
factor 1 (SDF-1; also referred to as CXCL12). The receptor is widely
expressed in different tissues and is a prominent chemokine
receptor on cancer cells. The chemotactic properties of SDF-1 have
been widely associated with metastasis of several epithelial and
hematopoietic cancers including breast, prostate, ovary, and lung
cancers (8, 9). Initial findings that breast cancer cells, as opposed to
surrounding healthy tissue, express CXCR4 have revealed that
CXCR4-mediated chemotaxis of cancer cells was mainly involved in
the dissemination of metastases to SDF-1–producing target tissues,
such as lung, liver, and bone marrow (10). However, although these
studies clearly showed the deleterious consequences of CXCR4
expression by cancer cells, the process by which the expression
of CXCR4 is selected before metastasis is not explained. It was
generally believed that CXCR4 signaling does not promote cell
growth. Nonetheless, several findings suggest that CXCR4 confers tumor growth advantages before metastasis dissemination,
namely, as a survival factor, by inducing the expression of integrins
and matrix metalloproteases associated with invasive phenotypes
(11, 12) and neovascularization (13).
Studies of hormone action in human breast cancer cells have
been widely informative on the mitogenic actions of estrogens in
ER-positive tumors. The identification of several estrogen-induced
genes from ERa-positive tumor cells has provided valuable
prognostic tools for predicting ER responsiveness to endocrine
treatment (14). SDF-1 has been identified as an estrogen-regulated
gene in ERa-positive ovarian and breast cancer cells, suggesting a
direct pathway by which estrogen may induce SDF-1 production
through ERa (15).
Here we show an autologous regulation of SDF-1 through
increased ERa and ERh transcriptional activity in response to SDF1, which confers growth potential to breast cancer cells. We further
show that the CXCR4/SDF-1 pathway promotes ERh AF-1
phosphorylation at Ser-87 and enables ERh responsiveness at AP1 sites despite the presence of tamoxifen. Our findings provide a
mechanism by which the CXCR4/SDF-1 and ER signaling pathways
mutually contribute to a positive autocrine/paracrine feedback
loop in breast cancer.
Materials and Methods
Plasmids. Expression pCMX plasmids coding for human and mouse ERa
and ERh and ERh serine to alanine mutants have been described (16–18).
5793
Cancer Res 2009; 69: (14). July 15, 2009
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2009 American Association for Cancer
Research.
Published OnlineFirst July 7, 2009; DOI: 10.1158/0008-5472.CAN-08-4924
Cancer Research
The estrogen-responsive EREtkLuc reporter (18) and the AP-1coll-luciferase
reporter (19), which contains a fragment (pos. 73 to +63) of the collagenase promoter with an AP-1 element, were described. Plasmids coding for
CXCL12/SDF-1a (Invivogen) and for human CXCR4 and its constitutive
D132N (NRY) and defective D84N and N119K mutant forms were described
(20, 21).
Cell culture. Human breast cancer MCF-7 and human embryonic kidney
293 cells were routinely maintained in DMEM (Sigma) supplemented with
10% and 5% fetal bovine serum, respectively. MCF-7 cells that stably express
a ERE-luciferase reporter (17) were grown in the same conditions as parental MCF-7 cells. ERh-expressing stable Hs578t breast cancer cells
(Hs-ERh) have been described (22).
Transfection and luciferase assay. Cells were seeded in phenol red–
free DMEM supplemented with charcoal dextran–treated serum before
transfections, and luciferase assays done as described (17, 18). Cells were
treated for 16 h with 10 nmol/L 17h-estradiol (E2), 2.5 to 25 nmol/L
recombinant SDF-1, 10 nmol/L ICI-182780, 5 Amol/L 4-hydroxytamoxifen
(OHT), 50 Amol/L PD98059 inhibitor (BioMOL Research Labs), and CXCR4
antagonists AMD3100 and T140 (also known as 4F-benzoyl-TN14003). Luciferase values were determined from at least three independent experiments done in duplicate.
RNA isolation and quantitative PCR. Complementary DNA was
prepared from MCF-7 cells and Hs578t stable clones as described (23),
and PCR amplification was done in a volume of 20 AL with 0.5 to 1 AL of
reverse transcription reaction for 25 to 35 cycles. PCR products were
analyzed on a MX3000P (Stratagene) and on gel (Alpha Innotech).
Sequences of PCR primers are available on request. Values are derived
from three to five separate experiments and normalized to glyceraldehyde3-phosphate dehydrogenase expression.
Cell proliferation assay. Cell proliferation was measured by using the
[3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl]tetrazolium bromide (MTT) assay
essentially as described (17). MCF-7 cells were seeded at low density in
phenol red–free DMEM supplemented with dextran charcoal–treated
serum. Treatments with 10 nmol/L E2 in the presence or absence of
1 Amol/L AMD3100 inhibitor were started the following day and
maintained in fresh medium every subsequent day. All samples were
assayed in triplicate from three to four independent experiments.
Chromatin immunoprecipitation assay. Chromatin immunoprecipitation (ChIP) assays were done as previously described (17, 24). MCF-7 cells
were treated with E2, tamoxifen, and SDF-1 for 40 min. Primer pairs were
designed to encompass proximal/distal ERE and AP-1 sites of estrogenresponsive promoters (17, 25, 26).
Cell lysates, immunoprecipitation, and immunoblotting. Site-specific phosphorylation of ERh was determined by immunoprecipitation and
Western blot analysis. MCF-7 cells were serum depleted for 24 h and treated
with 25 nmol/L SDF-1 before lysis in TBS containing 0.1% Triton X-100,
1 mmol/L sodium orthovanadate, 1 mmol/L sodium fluoride, 0.1 mmol/L
phenylmethylsulfonyl fluoride, and protease inhibitor cocktail (Roche).
Immunoprecipitation was done using an anti-ERh antibody (Santa Cruz)
and Western blot analysis was done using a phospho-specific Ser-87 ERh
antibody (Santa-Cruz). Phosphorylated extracellular signal–regulated kinase
(Erk) was determined by Western blot analysis using an anti–phospho
Erk1/2 antibody (Cell Signaling).
RNA interference. To silence CXCR4 expression, small hairpin RNA
(shRNA) duplexes targeting the sequence TGGAGGGGATCAGTATATACA of
human CXCR4 (shCXCR4) were inserted into the pLVTH lentiviral vector for
small interfering RNA production. Viral particles were produced in 293T
cells as described (27) and used to infect MCF-7 cells. CXCR4 efficient
knockdown was monitored by Western blot analysis (data not shown).
Results
CXCR4 is required for estrogen-dependent gene expression
and growth of human breast cancer cells. To assess the role of
the CXCR4/SDF-1 axis on ER-mediated transcription, ERa- and
ERh-positive human breast cancer MCF-7 cells stably transfected
Cancer Res 2009; 69: (14). July 15, 2009
with a ERE-luciferase reporter (17) were used. We observed
that the increase in ER activity following E2 treatment was further
augmented by exogenous addition of SDF-1 to cells, suggesting
that SDF-1 can potentiate the ER response to estrogen (Fig. 1A).
The role of CXCR4 in these effects was supported by addition of
T140 and AMD3100, two antagonists of CXCR4, which both
reduced, in a dose-dependent manner, ER activation by E2 (Fig. 1B).
Similarly, MCF-7 cells transfected with an inactive D84N CXCR4
mutant also exhibited a decrease in ER activity. These findings
indicate that estrogen-dependent ER response can be positively
modulated through CXCR4 activation by SDF-1.
In line with a previous report that the SDF-1 gene is regulated by
estrogen (15), we found a 5.5-fold increase in SDF-1 expression in
response to E2 compared with untreated cells as determined by
real-time PCR (Fig. 1C). Interestingly, the increase in SDF-1
expression was reduced by 55% in the presence of the T140
antagonist (Fig. 1C), which suggests that CXCR4 is involved in the
regulation of SDF-1 gene. Other known ER-regulated genes,
such as progesterone receptor (PR), pS2/TFF1, and EB-1, as well
as cyclin D1 and c-Myc, which contain AP-1 sites that can mediate
estrogen responsiveness, were all regulated similarly (Fig. 1C). The
contribution of CXCR4 was further assessed using the MTT
proliferation assay, in which the growth dependency of MCF-7 cells
on prolonged treatment with E2 was significantly reduced with the
use of AMD3100 (Fig. 1D). Taken together, these results point
toward an important role of CXCR4/SDF-1 to participate in the
estrogenic response of MCF-7 cells and the ability of SDF-1 to
potentiate these effects.
SDF-1 up-regulates ER activity and target gene expression in
the absence of estrogen. To further substantiate that SDF-1 can
promote ER function, we observed that ER activity was increased
by SDF-1 independently of estrogen in MCF-7 cells (Fig. 2A).
Overexpression of wild-type (wt) CXCR4 or the constitutively active
D132N mutant also increased basal ER activity in MCF-7 cells
(Fig. 2B), suggesting a CXCR4-ER regulatory pathway. In line with
our results on the requirement of CXCR4 in maintaining estrogeninduced SDF-1 expression (Fig. 1C), a 2-fold increase in SDF-1
expression was observed in MCF-7 cells treated with SDF-1,
supporting the autologous regulation of SDF-1 gene (Fig. 2C). Such
effect was abrogated by the antiestrogen ICI-182780, further
establishing an essential role of ER in mediating the response to
SDF-1. Other ER target genes were similarly up-regulated by SDF-1
(Fig. 2C), which also enhanced MCF-7 cell growth in the absence of
estrogen (Supplementary Fig. S1). Silencing CXCR4 expression in
MCF-7 cells strongly impaired the response of EB-1 and PR gene
expression to SDF-1 (Fig. 2D), in line with an essential role of
CXCR4 in mediating responsiveness to SDF-1 in MCF-7 cells.
Activation of ERA and ERB by the SDF-1/CXCR4 axis. As
MCF-7 cells express both ER isoforms, therefore precluding the
exact role of each receptor in the cellular response to SDF-1, we
performed ERE-driven luciferase assays using human 293 cells
transfected with either receptor. In such condition, both ERa and
ERh were activated by SDF-1 with or without estrogen, and these
responses were dependent on the presence and the integrity of
CXCR4, as shown with the use of CXCR4 antagonist and mutant
forms (Fig. 3). We also determined that SDF-1 produced by cells
can signal ERa and ERh in a paracrine fashion, using a coculture
system in which CXCR4- and ERa- or ERh-expressing ERE-Luc
reporter 293 cells were incubated with cells transfected with a SDF1 encoding plasmid (Supplementary Fig. S2). These results indicate
that CXCR4 can promote the activity of ERa and ERh isoforms.
5794
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2009 American Association for Cancer
Research.
Published OnlineFirst July 7, 2009; DOI: 10.1158/0008-5472.CAN-08-4924
SDF-1 Transactivates ERa and ERb in Breast Cancer Cells
Figure 1. The SDF-1/CXCR4 pathway
stimulates ER-dependent response in
breast cancer cells. A, luciferase activity of
stable ERE reporter–expressing MCF-7
cells treated with 10 nmol/L E2 and
SDF-1 for 16 h. Results are normalized
to h-galactosidase activity and expressed
as fold response compared with
vehicle-treated cells. B, MCF-7 cells were
treated with 10 nmol/L E2 with or without
0.2 and 1 Ag/mL of CXCR4 antagonists
T140 or AMD3100 for 16 h. Cells were
also transfected with increasing amounts
of an inactive D84N CXCR4 plasmid.
Luciferase activity is expressed as
in A. C, real-time reverse
transcription-PCR (RT-PCR) analysis on
MCF-7 cells treated with 10 nmol/L E2 with
or without 1 Ag/mL T140 for 16 h.
D, MTT proliferation assay on MCF-7 cells
treated with 10 nmol/L E2 in the absence or
presence of 1 Ag/mL AMD3100.
Results are expressed as percent change
from untreated cells set at 100%.
SDF-1 induces ERB-dependent gene expression in breast
cancer cells. To further address the ability of ERh to transduce the
effects of SDF-1 in a breast cancer cell context, we used Hs578t cells
stably expressing ERh (22) and which are CXCR4 positive (data not
shown). As shown in Fig. 4A, stable expression of ERh conferred
estrogen responsiveness in terms of target gene expression, as
opposed to stable mock control cells (Hs-empty). Addition of SDF-1
to Hs-ERh cells also increased the expression of PR, EB-1, and SDF-1,
providing additional evidence that SDF-1 can positively modulate its
own expression through ERh in breast cancer cells.
SDF-1 promotes ERB assembly to proximal and distal
estrogen-responsive promoters. To address the specific role
of endogenously expressed ERh in the response to SDF-1, we
performed ChIP on the estrogen response regions of ER-regulated
promoters. In parallel with E2, treatment of MCF-7 cells with
increasing doses of SDF-1 induced a strong association of ERh with
the proximal ERE region of the SDF-1, PR , and pS2 genes (Fig. 4B).
Interestingly, such increased occupancy of the SDF-1 promoter is
consistent with the autologous regulation of the SDF-1 gene and
further shows that the SDF-1 gene is a target of ERh. Recent
genome-wide location analyses of ERa binding sites based on
ChIP-on-chip approaches have identified, along with proximal
EREs, more distal cis-regulatory enhancer elements that, for certain
genes, were reported to confer estrogen responsiveness (26, 28).
Given the strong incidence of ERh to up-regulate PR in response to
SDF-1 (Fig. 4A), we then tested whether ERh could associate with
the distal enhancer region located f100 kb downstream of the
www.aacrjournals.org
transcriptional start site of the PR gene (28, 29). Indeed, we
found that ERh was even more recruited to the distal PR enhancer
region in response to E2 and SDF-1, compared with the proximal
promoter (Fig. 4B). These findings provide evidence that ERh
can share the use of proximal and distal promoter elements
originally identified with ERa, and that ERh activating signals, such
as with SDF-1, facilitate such recruitment to up-regulate estrogenresponsive genes in breast cancer cells.
SDF-1 enhances tamoxifen-induced transcription of AP-1
site by ERB. Whereas antiestrogens, including tamoxifen, are
known to efficiently inhibit the expression of ERE-regulated genes,
transcription via an AP-1 element by ERa and ERh can be
enhanced by tamoxifen, possibly explaining how certain antiestrogens exhibit estrogen-like effects on cell growth (2, 30). We
then tested whether SDF-1 could modulate ERh activity on a
AP-1 luciferase reporter. As expected, and also observed by
others (2), E2 alone had minimal effect on AP-1 response to ERh,
whereas tamoxifen led to a 4.5-fold increase in AP-1 transcription
(Fig. 4C). However, a near 2-fold increase in AP-1 activity was
observed in both cases following SDF-1 treatment, suggesting
that SDF-1 is by itself able to regulate ERh activity on an AP-1
site. These results were correlated in Hs-ERh cells regardless
of the presence of tamoxifen, with a 2.1- and 2.0-fold increase
in the expression of cyclin D1 and c-Myc, respectively (Fig. 4D),
two estrogen-regulated genes that contain AP-1 sites (30, 31).
To ensure a potential role of AP-1 site, we performed ChIP on the
AP-1 site located in the proximal promoter of CcnD1 reported to
5795
Cancer Res 2009; 69: (14). July 15, 2009
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2009 American Association for Cancer
Research.
Published OnlineFirst July 7, 2009; DOI: 10.1158/0008-5472.CAN-08-4924
Cancer Research
Figure 2. SDF-1 promotes ligandindependent ER activation and target
gene expression. A, luciferase activity of
stably ERE reporter–expressing MCF-7
cells treated with 25 nmol/L SDF-1 or
1 Ag/mL T140 for 16 h. B, MCF-7 cells
were transfected with a plasmid encoding
CXCR4 or its constitutively active D132N
mutant and then harvested for luciferase
activity as in A. C, MCF-7 cells were
treated for 16 h with 25 nmol/L SDF-1 in
the absence or presence of 10 nmol/L
ICI-182780, before real-time RT-PCR
analysis. D, RT-PCR analysis in MCF-7
cells treated with 10 nmol/L E2 or 25 nmol/L
SDF-1 for 16 h. CXCR4 expression
was silenced by infecting cells with a
shCXCR4-carrying lentiviral vector
compared with a negative control shRNA.
tether ERa in response to E2 (25). This region was found potent
in recruiting ERh in response to tamoxifen, which was further
increased by addition of SDF-1 (Fig. 4E). These data suggest that
SDF-1 can transduce a promiscuous ERh/AP-1 relationship at the
CcnD1 promoter in MCF-7 cells.
The CXCR4-mediated activation of ERB at ERE and AP-1
sites is AF-1 dependent. Given the ability of the CXCR4/SDF-1
pathway to exert activation of ERh at both ERE and AP-1 sites
regardless of the presence of ER ligands, we evaluated the role
of ERh AF-1, and in particular Ser-106 and Ser-124, identified to
mediate mouse ERh activation in response to ras and growth
factors (5, 7, 16). We observed that disruption of Ser-106, either
alone or in combination with Ser-94 and/or Ser-124, abolished the
activation of ERh by SDF-1 on an ERE reporter, identifying Ser-106
as critical for ERh modulation by CXCR4/SDF-1 (Fig. 5A). Similarly,
when tested on an AP-1 reporter, the S106A mutant was unable to
respond to CXCR4/SDF-1 modulation in the presence of tamoxifen
(Fig. 5B). These results highlight the role of Ser-106 in mediating
ERh responsiveness to CXCR4 signaling at both ERE and AP-1 sites.
SDF-1 induces phosphorylation of ERB at Ser-87 in MCF-7
cells. Mouse ERh Ser-106 is part of a consensus site for mitogenactivated protein kinase (MAPK)–mediated phosphorylation that
is highly conserved among vertebrates and which perfectly matches
with Ser-87 of the human ERh, the difference in numbering being
attributable to a 19-amino-acid shorter form of the human versus
mouse isoform. As previously reported (32), we found that CXCR4
activation by SDF-1 efficiently promoted Erk activation in transfected 293 cells, and this effect was severely impaired by addition
of the CXCR4 antagonists T140 and AMD3100 (Supplementary
Cancer Res 2009; 69: (14). July 15, 2009
Fig. S3B). Such activation of Erk through CXCR4 was found essential
in providing transcriptional response of ERh to SDF-1 (Fig. 5C) and
correlated with an increased phosphorylation of mouse ERh at
Ser-106 (Supplementary Fig. S3C) and an accelerated ERh degradation through this site (Supplementary Fig. S4). This identifies Ser-106
as a crucial determinant that couples ERh transcriptional competence and turnover in response to the CXCR4/SDF-1 pathway.
To confirm these observations in human breast cancer cells, we
observed increased Erk activation levels in MCF-7 cells treated with
SDF-1 (Fig. 5D), paralleled with an increased human ERh phosphorylation at Ser-87 (Fig. 5E). Silencing CXCR4 contributed to severely
impaired Erk activation and ERh Ser-87 phosphorylation by SDF-1
(Fig. 5D and E). These findings identify ERh Ser-87 as a regulatory site
targeted by the SDF-1/CXCR4 pathway in human breast cancer cells.
Discussion
Both ERs and CXCR4/SDF-1 play pivotal roles in breast cancer.
Previous data showing that estrogen promoted expression of the
CXCR4 ligand SDF-1 have linked the two pathways. In the current
study, we show that not only do ERs activate the CXCR4/SDF-1
pathway but, conversely, CXCR4 signaling also promotes ER
transcriptional activation, thereby establishing a complete autocrine loop for breast cancer cell growth. Our conclusions are
supported by results showing that CXCR4 activation, by either the
agonist SDF-1 or activating mutations in the CXCR4 receptor,
increases ER-dependent transcription of either ERE- or AP-1–
driven reporters and target genes in cancer cells. CXCR4-mediated
ER transcriptional activation occurred both in the presence and
5796
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2009 American Association for Cancer
Research.
Published OnlineFirst July 7, 2009; DOI: 10.1158/0008-5472.CAN-08-4924
SDF-1 Transactivates ERa and ERb in Breast Cancer Cells
absence of ER ligands (estradiol or tamoxifen) and affected both
ERa and ERh. The ability of SDF-1 to signal the recruitment of ERh
to the estrogen-responsive promoter region of the SDF-1 gene with
subsequent SDF-1 expression emphasizes an autologous positive
feedback regulation of SDF-1 in ER-positive breast cancer cells.
The phosphorylation of ERh at Ser-87 by SDF-1, correlated with
receptor transcriptional activation and increased turnover, provides a mechanism by which the AF-1 mediates ER responsiveness
to CXCR4/SDF-1 and the Erk1/2 pathway in cancer cells.
Whereas the role of the SDF-1/CXCR4 axis in metastasis is well
documented (8–10, 33), its potential implication in tumorigenic
steps before metastasis remains less clear. Recent reports showing
that SDF-1 expression was increased by estradiol, resulting in
mitogenic effects in ERa-positive ovarian and breast cancer cells
(15), and on the requirement of steroid receptor coactivator SRC-1
(34) suggested that such early steps of tumorigenesis may involve
ERs. In the current study, we show a correlation between estrogendependent proliferating gene activation by CXCR4 and SDF-1–
promoted growth of ER-positive MCF-7 breast cancer cells. Our
observations that transcription of ER-regulated genes was induced
by SDF-1 but abrogated by antiestrogen ICI-182780 suggest that the
mitogenic effect of SDF-1 in these cells requires functional ERs. We
show that by targeting both ERa and ERh, transduction of CXCR4
signaling by SDF-1 allows a direct regulation of ER-responsive
genes, including the SDF-1 gene, independently of estrogen
stimulation. This interplay between the CXCR4/SDF-1 pathway
and ER-mediated transcription defines an autocrine/paracrine
feed-forward loop (Fig. 6), providing a possible explanation of how
CXCR4 activation participates in the maintenance of continuous
cancer cell proliferation. Whether this phenomenon occurs before
CXCR4-mediated metastatic dissemination is uncertain, but it
raises the intriguing possibility that autologous and continuous
CXCR4 activity maintained through ER activation by hormone and/
or enhanced Erk signaling may participate in priming metastasis.
Our observation that regulation of ERa and ERh activity by SDF1 occurs in the presence as well as in the absence of hormone
points toward an important contribution of the AF-1 function in
conferring ER responsiveness to SDF-1 signaling. Such active role of
AF-1 was further substantiated by the demonstration that SDF-1
leads to AF-1 phosphorylation at Ser-106 of mouse ERh and the
corresponding Ser-87 of human ERh. Indeed, the AF-1 domain of
ERh contains many putative phosphorylation sites, of which Ser106 and Ser-124 were described to be directly phosphorylated
by Erk1/2, resulting in receptor AF-1 activation in response to EGF
or ras and subsequent recruitment of transcriptional coactivators SRC-1 and cyclic AMP–responsive element binding proteinbinding protein (7, 16, 35). The critical role of Ser-106 was also
important to mediate ERh response to the CXCR4/SDF-1 axis at
both ERE and AP-1 sites. Altogether, our results emphasize a
prominent role for the CXCR4/SDF-1 axis to affect ERh activity
through AF-1 phosphorylation to achieve distinct transcriptional
events as well as concerted actions with the AF-2.
It has previously been reported that ERh is able to regulate the
activity of the AP-1 transcription factor (2). We here show that the
CXCR4/SDF-1 axis increases ERh recruitment and subsequent
transcriptional potential of ERE- and AP-1–regulated genes in the
context of breast cancer cells. Importantly, we found an increased
expression of two AP-1–regulated genes, cyclin D1 and c-Myc,
which are commonly overexpressed in primary breast tumors and
recognized markers of early steps in breast tumorigenesis (36). Our
findings that the CXCR4/SDF-1 axis stimulates ERh assembly and
activity at AP-1 sites brought potential implications for resistance
Figure 3. The SDF-1/CXCR4 axis activates
ERa and ERh. A, luciferase activity of 293
cells transfected with ERa or ERh construct
in the presence of wt CXCR4 or its inactive
N119K mutant. Cells were then treated
with 10 nmol/L E2 with or without 25 nmol/L
SDF-1 or 1 Ag/mL T140. B, 293 cells were
transfected with ERa or ERh in the presence
of CXCR4 plasmid, and then treated as in
A but in the absence of E2. C, similar to
B except that CXCR4 D132N active mutant
or D84N inactive mutant was tested.
www.aacrjournals.org
5797
Cancer Res 2009; 69: (14). July 15, 2009
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2009 American Association for Cancer
Research.
Published OnlineFirst July 7, 2009; DOI: 10.1158/0008-5472.CAN-08-4924
Cancer Research
Figure 4. SDF-1 induces ERh occupancy and transcription of ERE and AP-1 genes in breast cancer cells. A, Hs578t cells stably expressing ERh (Hs-ERb) and
their corresponding negative clones (Hs-empty ) were treated with 10 nmol/L E2 or 25 nmol/L SDF-1 for 16 h and then subjected to gene expression analysis.
B, ChIP analysis on MCF-7 cells treated with 10 nmol/L E2 or 5 or 25 nmol/L SDF-1 for 40 min. Fold changes of ChIP signals are expressed relative to untreated cells.
C, 293 cells were transfected with the AP-1coll-Luc reporter and ERh plasmid, followed by treatments with 10 nmol/L E2, 5 Amol/L tamoxifen (OHT), and/or 25 nmol/L
SDF-1 for 16 h. D, Hs-ERh cells were treated with 5 Amol/L OHT in the absence or presence of 25 nmol/L SDF-1 for 16 h before gene expression analysis.
E, ChIP analysis on MCF-7 cells treated with 5 Amol/L OHT in the absence or presence of 5 or 25 nmol/L SDF-1 for 40 min. Fold changes are expressed as in B .
of cancer cells to antiestrogen treatment. Resistance to prolonged
tamoxifen exposure is a major clinical problem, which develops in
two thirds of women treated for breast cancer, such that aggressive
metastatic dissemination of tumor cells eventually ensues with a
poor prognosis (14). The cellular mechanisms by which ER-positive
tumor cells overcome antiestrogen effects and exhibit excessive
proliferation remain uncertain at present. Our results are consistent
with the possibility that the autocrine regulation and coupling
between ER-regulated pathways and the CXCR4/SDF-1 axis may
function despite the presence of tamoxifen. Indeed, the capacity of
Figure 5. Role of the conserved
AF-1 Ser-87 of ERh in mediating
responsiveness to the CXCR4/SDF-1
pathway. A, luciferase activity of 293
cells transfected with EREtkLuc in the
presence of CXCR4 and serine to alanine
mutants of mouse ERh (schematically
represented) and treated with 10 nmol/L
E2 with or without 25 nmol/L SDF-1 for
16 h. B, 293 cells were transfected with
the AP-1coll-Luc reporter and wt or
S106A ERh, followed by treatment with
5 Amol/L tamoxifen (OHT ) and 25 nmol/L
SDF-1 for 16 h. C, 293 cells were
transfected as in A and luciferase
activity was determined in response to
25 nmol/L SDF-1 with or without 50 Amol/L
PD98059. D, Western blot analysis of
MCF-7 cells treated with 25 nmol/L
SDF-1 for the indicated time periods.
CXCR4 expression was silenced by
infection with a shRNA-carrying lentiviral
vector. E, MCF-7 cells were treated as
in D before immunoprecipitation of ERh.
Western blot analysis was done using
anti–phospho-Ser-87 ERh antibody.
The effect of CXCR4 silencing on ERh
phosphorylation is also shown.
Cancer Res 2009; 69: (14). July 15, 2009
5798
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2009 American Association for Cancer
Research.
Published OnlineFirst July 7, 2009; DOI: 10.1158/0008-5472.CAN-08-4924
SDF-1 Transactivates ERa and ERb in Breast Cancer Cells
Figure 6. A proposed model for the positive autocrine
loop between ERs and the CXCR4/SDF-1 pathway.
Activation of ERa or ERh by estrogen induces
SDF-1 gene expression, which in turn triggers
Erk1/2 activation through interaction with its cognate
CXCR4 receptor. For ERh, the enhanced Erk activity
results in the phosphorylation of Ser-87 in the AF-1
domain and subsequent receptor transcriptional
activation. Such feed-forward mechanism between
ERs and CXCR4 is proposed to promote the growth
potential of breast cancer cells.
ERh to enhance AP-1 activity and gene expression by SDF-1 and its
promiscuity with the AP-1 region of cyclin D1 promoter were both
maintained in the presence of tamoxifen, in line with previous
reports that AP-1 regulates transcription of cyclin D1 in the presence
of antiestrogens (30). Our observations that this process may require
Erk activation to phosphorylate ERh Ser-87 are consistent with
altered MAPK transduction pathways and enhanced AP-1 signaling
associated with tamoxifen resistance (37). Elevated MAPK activity
produced a mitogenic phenotype in MCF-7 cells (38), and enhanced
Erk1/2 activity was measured in tumors from ER-positive breast
cancer patients maintained on tamoxifen (39). Although tamoxifen
efficiently uncouples coactivator SRC-1 potentiation from ER AF-2
function, no such effect was observed on AF-1 activity on Erk1/2
activation (16, 35). It is therefore tempting to speculate that the
ability of CXCR4 signaling to target and up-regulate AF-1 activity
during tamoxifen exposure might supplant AF-2 as the primary
route of ER activation in tamoxifen-resistant breast cancer cells.
Our data show not only that ERh up-regulates the expression of
SDF-1, as also observed for ERa (15) but also that SDF-1 increases
ERa and ERh activity, thereby extending the role of CXCR4 to ER
signaling in breast cancer cells (Fig. 6). Although not referred as a
perfect ERE (15, 40), the estrogen response region of the SDF-1 gene
was highly potent in recruiting ERh in response to SDF-1, which
identifies the SDF-1 gene as a target of ERh, and further provides a
mechanism by which the autologous regulation of the SDF-1 gene
can occur in breast cancer cells. Similarly, recruitment of ERh to
other estrogen-responsive promoters, such as PR and pS2, supports
the ability of ERh to increase gene expression in the context of
enhanced SDF-1 production. In the case of PR, the apparent
propensity of ERh to bind distal as well as proximal EREs points
toward a complex interplay that likely involves cooperating factors
to facilitate gene transcription (41). CXCR4 was also reported to be
www.aacrjournals.org
enhanced by estradiol in endometrial adenocarcinoma (42) and
breast tumor xenografts (43). Altogether, these data suggest that
both components of the CXCR4/SDF-1 axis, the receptor and the
ligand, are likely to be regulated in an ER-dependent fashion.
Recent reports have identified the chemokine receptor CXCR7 as
an additional receptor for SDF-1, with potential implication in
tumor development (44, 45). Our findings do not rule out the
implication of CXCR7 in the effect of SDF-1 in MCF-7 cells. However, our observation that CXCR4 silencing impairs the modulation
of ER-dependent gene expression and Erk-mediated ERh phosphorylation suggests that functional CXCR4 is required for
transducing these effects by SDF-1 in MCF-7 cells. Notwithstanding
its implication in sustaining the growth of breast cancer cells and
its potential to affect CXCR4 function (46), the role of CXCR7 in
regulating estrogen-dependent functions remains as yet uncharacterized and deserves further investigation.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Acknowledgments
Received 12/24/08; revised 4/27/09; accepted 5/13/09; published OnlineFirst 7/7/09.
Grant support: Canadian Institutes of Health Research, Cancer Research Society,
Inc., and the Canadian Foundation for Innovation.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Julie Martin for technical assistance and members of the laboratory for
critical reading and useful comments. K. Sauvé is supported by graduate student
awards from the Groupe de Recherche sur le Médicament de l’Université de Montréal
and from the Fondation de l’Hôpital Ste-Justine; J. Lepage holds an award from
the Natural Sciences and Engineering Research Council of Canada; M. Sanchez from
the Fondation de l’Hôpital Ste-Justine; and N. Heveker and A. Tremblay are New
Investigators of the Canadian Institutes of Health Research.
5799
Cancer Res 2009; 69: (14). July 15, 2009
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2009 American Association for Cancer
Research.
Published OnlineFirst July 7, 2009; DOI: 10.1158/0008-5472.CAN-08-4924
Cancer Research
References
1. Mangelsdorf DJ, Thummel C, Beato M, et al. The
nuclear receptor superfamily: the second decade. Cell
1995;83:835–9.
2. Paech K, Webb P, Kuiper GGJM, et al. Differential
ligand activation of estrogen receptors ERa and ERh at
AP1 sites. Science 1997;277:1508–10.
3. Glass CK, Rosenfeld MG. The coregulator exchange in
transcriptional functions of nuclear receptors. Genes
Dev 2000;14:121–41.
4. McKenna NJ, O’Malley BW. Combinatorial control of
gene expression by nuclear receptors and coregulators.
Cell 2002;108:465–74.
5. Sanchez M, Tremblay A. Growth factor signaling to
estrogen receptors in hormone dependent cancers. In:
Sinnett D, editor. Molecular genetics of cancer. Kerala:
Research Signpost; 2005. p. 149–85.
6. Kato S, Endoh H, Masuhiro Y, et al. Activation of the
estrogen receptor through phosphorylation by mitogenactivated protein kinase. Science 1995;270:1491–4.
7. Tremblay GB, Tremblay A, Copeland NG, et al.
Cloning, chromosomal localization and functional
analysis of the murine estrogen receptor h. Mol
Endocrinol 1997;11:353–65.
8. Taichman RS, Cooper C, Keller ET, Pienta KJ,
Taichman NS, McCauley LK. Use of the stromal cellderived factor-1/CXCR4 pathway in prostate cancer
metastasis to bone. Cancer Res 2002;62:1832–7.
9. Zlotnik A. Chemokines in neoplastic progression.
Semin Cancer Biol 2004;14:181–5.
10. Muller A, Homey B, Soto H, et al. Involvement of
chemokine receptors in breast cancer metastasis.
Nature 2001;410:50–6.
11. Burger M, Glodek A, Hartmann T, et al. Functional
expression of CXCR4 (CD184) on small-cell lung cancer
cells mediates migration, integrin activation, and
adhesion to stromal cells. Oncogene 2003;22:8093–101.
12. Bartolome RA, Galvez BG, Longo N, et al. Stromal
cell-derived factor-1a promotes melanoma cell invasion
across basement membranes involving stimulation of
membrane-type 1 matrix metalloproteinase and Rho
GTPase activities. Cancer Res 2004;64:2534–43.
13. Darash-Yahana M, Pikarsky E, Abramovitch R, et al.
Role of high expression levels of CXCR4 in tumor growth,
vascularization, and metastasis. FASEB J 2004;18:1240–2.
14. Jordan VC, O’Malley BW. Selective estrogen-receptor
modulators and antihormonal resistance in breast
cancer. J Clin Oncol 2007;25:5815–24.
15. Hall JM, Korach KS. Stromal cell-derived factor 1, a
novel target of estrogen receptor action, mediates the
mitogenic effects of estradiol in ovarian and breast
cancer cells. Mol Endocrinol 2003;17:792–803.
16. Tremblay A, Tremblay GB, Labrie F, Giguere V.
Ligand-independent recruitment of SRC-1 to estrogen
receptor h through phosphorylation of activation
function AF-1. Mol Cell 1999;3:513–9.
17. St Laurent V, Sanchez M, Charbonneau C, Tremblay
A. Selective hormone-dependent repression of estrogen
receptor h by a p38-activated ErbB2/ErbB3 pathway. J
Steroid Biochem Mol Biol 2005;94:23–37.
Cancer Res 2009; 69: (14). July 15, 2009
18. Picard N, Charbonneau C, Sanchez M, et al.
Phosphorylation of activation function-1 regulates
proteasome-dependent nuclear mobility and E6-AP
ubiquitin ligase recruitment to the estrogen receptor
h. Mol Endocrinol 2008;22:317–30.
19. Webb P, Lopez GN, Uht RM, Kushner PJ. Tamoxifen
activation of the estrogen receptor/AP-1 pathway:
potential origin for the cell-specific estrogen-like effects
of antiestrogens. Mol Endocrinol 1995;9:443–56.
20. Berchiche YA, Chow KY, Lagane B, et al. Direct
assessment of CXCR4 mutant conformations reveals
complex link between receptor structure and Gai
activation. J Biol Chem 2007;282:5111–5.
21. Brelot A, Heveker N, Montes M, Alizon M. Identification of residues of CXCR4 critical for human
immunodeficiency virus coreceptor and chemokine
receptor activities. J Biol Chem 2000;275:23736–44.
22. Sanchez M, Sauvé K, Picard N, Tremblay A. The
hormonal response of estrogen receptor h is decreased
by the PI3K/Akt pathway via a phosphorylationdependent release of CREB-binding protein. J Biol Chem
2007;282:4830–40.
23. Rodrigue-Way A, Demers A, Ong H, Tremblay A. A
growth hormone-releasing peptide promotes mitochondrial biogenesis and a fat burning-like phenotype
through scavenger receptor CD36 in white adipocytes.
Endocrinology 2007;148:1009–18.
24. Avallone R, Demers A, Rodrigue-Way A, et al. A
growth hormone-releasing peptide that binds scavenger
receptor CD36 and ghrelin receptor upregulates ABC
sterol transporters and cholesterol efflux in macrophages through a PPARg-dependent pathway. Mol
Endocrinol 2006;20:3165–78.
25. Cicatiello L, Addeo R, Sasso A, et al. Estrogens and
progesterone promote persistent CCND1 gene activation during G1 by inducing transcriptional derepression
via c-Jun/c-Fos/estrogen receptor (progesterone receptor) complex assembly to a distal regulatory element
and recruitment of cyclin D1 to its own gene promoter.
Mol Cell Biol 2004;24:7260–74.
26. Carroll JS, Meyer CA, Song J, et al. Genome-wide
analysis of estrogen receptor binding sites. Nat Genet
2006;38:1289–97.
27. Nadra K, Anghel SI, Joye E, et al. Differentiation of
trophoblast giant cells and their metabolic functions are
dependent on peroxisome proliferator-activated receptor h/y. Mol Cell Biol 2006;26:3266–81.
28. Hua S, Kallen CB, Dhar R, et al. Genomic analysis of
estrogen cascade reveals histone variant H2A Z
associated with breast cancer progression. Mol Syst Biol
2008;4:188.
29. Carroll JS, Liu XS, Brodsky AS, et al. Chromosomewide mapping of estrogen receptor binding reveals longrange regulation requiring the forkhead protein FoxA1.
Cell 2005;122:33–43.
30. Liu MM, Albanese C, Anderson CM, et al. Opposing
action of estrogen receptors a and h on cyclin D1 gene
expression. J Biol Chem 2002;277:24353–60.
31. Dubik D, Shiu RP. Mechanism of estrogen activation of c-myc oncogene expression. Oncogene 1992;7:
1587–94.
5800
32. Montes M, Tagieva NE, Heveker N, Nahmias C,
Baleux F, Trautmann A. SDF-1-induced activation of
ERK enhances HIV-1 expression. Eur Cytokine Netw
2000;11:470–7.
33. Lee BC, Lee TH, Avraham S, Avraham HK. Involvement of the chemokine receptor CXCR4 and its ligand
stromal cell-derived factor 1a in breast cancer cell
migration through human brain microvascular endothelial cells. Mol Cancer Res 2004;2:327–38.
34. Kishimoto H, Wang Z, Bhat-Nakshatri P, Chang D,
Clarke R, Nakshatri H. The p160 family coactivators
regulate breast cancer cell proliferation and invasion
through autocrine/paracrine activity of SDF-1a/
CXCL12. Carcinogenesis 2005;26:1706–15.
35. Tremblay A, Giguere V. Contribution of steroid
receptor coactivator-1 and CREB binding protein in
ligand-independent activity of estrogen receptor h.
J Steroid Biochem Mol Biol 2001;77:19–27.
36. Butt AJ, Caldon CE, McNeil CM, Swarbrick A,
Musgrove EA, Sutherland RL. Cell cycle machinery:
links with genesis and treatment of breast cancer. Adv
Exp Med Biol 2008;630:189–205.
37. Pearce ST, Jordan VC. The biological role of estrogen
receptors a and h in cancer. Crit Rev Oncol Hematol
2004;50:3–22.
38. Martin LA, Farmer I, Johnston SR, Ali S, Marshall C,
Dowsett M. Enhanced estrogen receptor (ER) a, ERBB2,
and MAPK signal transduction pathways operate during
the adaptation of MCF-7 cells to long term estrogen
deprivation. J Biol Chem 2003;278:30458–68.
39. Gee JM, Robertson JF, Ellis IO, Nicholson RI.
Phosphorylation of ERK1/2 mitogen-activated protein
kinase is associated with poor response to antihormonal therapy and decreased patient survival in
clinical breast cancer. Int J Cancer 2001;95:247–54.
40. Zhu Y, Sullivan LL, Nair SS, et al. Coregulation of
estrogen receptor by ERBB4/HER4 establishes a growthpromoting autocrine signal in breast tumor cells. Cancer
Res 2006;66:7991–8.
41. Carroll JS, Brown M. Estrogen receptor target gene:
an evolving concept. Mol Endocrinol 2006;20:1707–14.
42. Kubarek L, Jagodzinski PP. Epigenetic up-regulation
of CXCR4 and CXCL12 expression by 17h-estradiol
and tamoxifen is associated with formation of DNA
methyltransferase 3B4 splice variant in Ishikawa
endometrial adenocarcinoma cells. FEBS Lett 2007;581:
1441–8.
43. Harvell DM, Richer JK, Allred DC, Sartorius CA,
Horwitz KB. Estradiol regulates different genes in human
breast tumor xenografts compared with the identical cells
in culture. Endocrinology 2006;147:700–13.
44. Burns JM, Summers BC, Wang Y, et al. A novel
chemokine receptor for SDF-1 and I-TAC involved in
cell survival, cell adhesion, and tumor development.
J Exp Med 2006;203:2201–13.
45. Miao Z, Luker KE, Summers BC, et al. CXCR7 (RDC1)
promotes breast and lung tumor growth in vivo and is
expressed on tumor-associated vasculature. Proc Natl
Acad Sci U S A 2007;104:15735–40.
46. Thelen M, Thelen S. CXCR7, CXCR4 and CXCL12: an
eccentric trio? J Neuroimmunol 2008;198:9–13.
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2009 American Association for Cancer
Research.
Published OnlineFirst July 7, 2009; DOI: 10.1158/0008-5472.CAN-08-4924
Positive Feedback Activation of Estrogen Receptors by the
CXCL12-CXCR4 Pathway
Karine Sauvé, Julie Lepage, Mélanie Sanchez, et al.
Cancer Res Published OnlineFirst July 7, 2009.
Updated version
Supplementary
Material
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
doi:10.1158/0008-5472.CAN-08-4924
Access the most recent supplemental material at:
http://cancerres.aacrjournals.org/content/suppl/2009/06/22/0008-5472.CAN-08-4924.DC1
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2009 American Association for Cancer
Research.