Download (湯政豪), D.Y.Lai(賴東洋)

Comparative Biochemistry and Physiology, Part A 163 (2012) 302–310
Contents lists available at SciVerse ScienceDirect
Comparative Biochemistry and Physiology, Part A
journal homepage: www.elsevier.com/locate/cbpa
Effects of salinity acclimation on Na +/K +–ATPase responses and FXYD11 expression
in the gills and kidneys of the Japanese eel (Anguilla japonica)
Cheng-Hao Tang a, b, Dong-Yang Lai c, Tsung-Han Lee c, d,⁎
a
Institute of Marine Biotechnology, National Dong Hwa University, Pingtung 944, Taiwan
National Museum of Marine Biology and Aquarium, Pingtung 944, Taiwan
Department of Life Sciences, National Chung Hsing University, Taichung 402, Taiwan
d
Department of Biological Science and Technology, China Medical University, Taichung 404, Taiwan
b
c
a r t i c l e
i n f o
Article history:
Received 8 May 2012
Received in revised form 25 July 2012
Accepted 30 July 2012
Available online 3 August 2012
Keywords:
Na+/K+–ATPase
FXYD protein
Cortisol
Japanese eel
a b s t r a c t
Na +/K +–ATPase (NKA) is a primary active pump provides the driving force for ion-transporting systems in
the osmoregulatory tissues of teleosts. Therefore, modulation of NKA expression or activity and its regulatory
subunit, FXYD protein, is essential for teleosts in salinity adaptation. To understand the mechanisms for modulation of NKA in catadromous fishes, NKA expression and activity, cloning and mRNA expression of FXYD11
(AjFXYD11) were examined in Japanese eel (Anguilla japonica) exposed to fresh water (FW) and seawater
(SW; 35‰). Expression and activity of NKA as well as mRNA expression of AjFXYD11 in gills were elevated
in SW eel compared to FW eel. Conversely, NKA responses in eel kidneys were higher in FW group than
SW group, whereas no significant difference was found in renal AjFXYD11 expression between the two
groups. Comparison of NKA activity and AjFXYD11 expression between two osmoregulatory tissues
suggested that AjFXYD11 plays a specific, functional role in gills. However, since cortisol plays an important
role for regulation of ion transport in teleost SW acclimation and gill AjFXYD11 expression was elevated in
SW eel, the organ culture approach was used to study the effect of cortisol on gill AjFXYD11 mRNA expression. Our results revealed that cortisol treatment increased the levels of gill AjFXYD11 transcripts. This finding suggested that cortisol could be involved in the regulation of NKA by altering AjFXYD11 expression
during the process of SW acclimation in A. japonica. Taken together, the differential expression of branchial
and renal NKA and AjFXYD11 implicated their roles in the osmotic homeostasis of Japanese eel exposed to
environments of different salinities.
© 2012 Elsevier Inc. All rights reserved.
1. Introduction
Maintaining a stable internal environment is essential for animals
to adapt to a variety of habitats. In response to changes in environmental salinity, ion-transporting epithelia play crucial homeostatic
roles in modulating ion fluxes. Moreover, gills and kidneys are the
most important organs for osmoregulation in teleosts (Marshall and
Grosell, 2006). The fundamental transporters responsible for ion
movement across gill and kidney epithelia have been widely studied
(Perry et al., 2003; Evans et al., 2005; Marshall and Grosell, 2006;
Katoh et al., 2008; Hwang et al., 2011). Among these transporters,
Na +/K +–ATPase (NKA) is a membrane-spanning protein that couples
the exchange of two extracellular K + ions for three intracellular Na +
ions to the hydrolysis of one molecule of ATP (Post and Jolly, 1957).
Because NKA is a primary active pump (Blanco and Mercer, 1998;
Bystriansky and Kaplan, 2007), it is crucial not only for sustaining
⁎ Corresponding author at: Department of Life Sciences, National Chung Hsing
University, Taichung 402, Taiwan. Tel.: +886 4 2285 6141; fax: +886 4 2285 1797.
E-mail address: [email protected] (T.-H. Lee).
1095-6433/$ – see front matter © 2012 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.cbpa.2012.07.017
intracellular homeostasis, but also for providing a driving force for
many transporting systems within fish gills and kidneys (Hirose et
al., 2003; Perry et al., 2003; Marshall and Grosell, 2006; Hwang and
Lee, 2007).
Changes in NKA activity occur in the osmoregulatory organs of
animals when confronted with changes in environmental salinity
(Marshall, 2002; Hirose et al., 2003; Burg et al., 2007). Moreover,
NKA activity is tightly regulated by various factors including intracellular Na+ concentration, changes in gene and protein expression of its
essential subunits, isoform switching and phosphorylation (Blanco and
Mercer, 1998; Therien and Blostein, 2000; Feraille and Doucet, 2001;
Richards et al., 2003; Bystriansky and Kaplan, 2007). In addition, small
regulatory subunits of NKA including several members of the FXYD protein family have been identified that may play an important role in modulating NKA activity. The transmembrane domain and the FXYD motif of
FXYD proteins have been shown to bind to the α- and β-subunits of NKA
and modulate NKA activity by affecting the apparent affinities for intracellular Na+ and extracellular K+ ions (Pu et al., 2001; Crambert et al., 2002;
Garty et al., 2002; Geering et al., 2003; Crambert et al., 2005; Garty and
Karlish, 2006; Geering, 2006; Delprat et al., 2007). It is well known
that modulation of NKA activity is important for acclimation of fish to
C.-H. Tang et al. / Comparative Biochemistry and Physiology, Part A 163 (2012) 302–310
hypotonic and hypertonic environments (Marshall, 2002; Hwang and
Lee, 2007). Although the potential role of FXYD proteins in fish has received less attention than in mammals, some orthologous and
paralogous FXYD members have been studied in the elasmobranch,
spiny dogfish (Squalus acanthias) (Mahmmoud et al., 2000, 2003), freshwater (FW) teleost, zebrafish (Danio rerio) (Saito et al., 2010), anadromous teleost, Atlantic salmon (Salmo salar) (Tipsmark, 2008; Tipsmark
et al., 2010) and euryhaline species, including the spotted green pufferfish
(Tetraodon nigroviridis) (Wang et al., 2008), and tilapia (Oreochromis
mossambicus) (Tipsmark et al., 2011).
Nevertheless, little is known about the role of FXYD proteins in the
osmoregulatory organs of catadromous teleost. Japanese eel (Anguilla
japonica) is a catadromous species with remarkable euryhalinity
(Kaneko et al., 2008). To survive in a wide range of environmental salinities throughout their life cycle or different cultured conditions, the
eel is equipped with mechanisms for acclimation to both hypotonic
and hypertonic environments. Moreover, increase in branchial NKA
activity was observed in eel adapted to hypertonic condition
(Marshall, 2002; Hirose et al., 2003; Hwang and Lee, 2007). Recent
studies indicated that FXYD11 mRNA is highly expressed in fish gills
and its expression levels are altered by changes of environmental salinities (Saito et al., 2010; Tipsmark et al., 2010; 2011). It is therefore
hypothesized that FXYD11 may be involved in the regulation of NKA
activity in the catadromous eel. To test this hypothesis and clarify the
gill specificity of FXYD11 in the catadromous teleost, we investigated
the correlation between FXYD11 expression and NKA expression (i.e.,
mRNA and protein expression and specific activity) in osmoregulatory organs (gill and kidney) of A. japonica acclimated to fresh water
(FW) and seawater (SW). In addition, because the corticosteroid, cortisol, is an important hormone involved in hypo- and
hyperosmoregulation (Sakamoto et al., 2001; Marshall and Grosell,
2006; Sakamoto and McCormick, 2006), we used an in vitro organ
culture to evaluate whether cortisol plays a role in the
osmoregulation of eel gills by affecting the expression levels of
AjFXYD11. This study assessed the effects of environmental salinity
and cortisol signaling on FXYD11 expression to explore the possible
role of FXYD11 in salinity adaptation in a catadromous species.
2. Materials and methods
2.1. Fish and experimental environments
Yellow Japanese eel (A. japonica) with a body mass of 200±14.5 g
and total length of 53.4±2.2 cm were obtained from a fish farm in
Taiwan. SW (35‰) was prepared from local tap water supplemented
with the appropriate amounts of synthetic sea salt (Aquarium Systems,
Mentor, OH, USA). Eels were reared in FW or SW at 21±1 °C with a
daily 12 h photoperiod for at least one week before experiments. Feeding
was terminated 48 h prior to the following experiments. The water was
continuously circulated through fabric-floss filters, and fish were fed commercial pellets daily. The use protocol for the experimental fish was
reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the National Chung Hsing University (IACUC Approval
No. 98–103) to T.-H.L.
2.2. Tissue collection
The eels were anesthetized by immersion in 100 mg/L MS-222
diluted in aquarium water (Sigma-Aldrich, St Louis, MO, USA). Following anesthesia, the fish were decapitated and sampled immediately
after sacrifice. The studied tissues (i.e., gills, kidneys, intestine, liver,
muscle and skin) were removed. For RNA extraction and immunoblotting analysis, the organs were directly immersed into liquid nitrogen
immediately after removal and subsequently homogenized.
303
2.3. Cloning of fxyd11 in A. japonica
Using the European eel (Anguilla anguilla) transcriptome database (EeelBase; http://compgen.bio.unipd.it/eeelbase/), we retrieved
AaFXYD11 (name: eu_c14786) gene sequences. To clone A. japonica
FXYD11 (AjFXYD11), the AaFXYD11 sequence was used as a template
to design the primer pair for conducting reverse transcription polymerase chain reaction (RT-PCR). The primer pair for AjFXYD11 and
glyceraldehyde-3-phosphate dehydrogenase (AjGAPDH; Accession
number: AB075021) (as an internal control) were designed using
Primer3 software (http://frodo.wi.mit.edu/primer3/input.htm). The
sequences of primer pairs for AjFXYD11 and AjGAPDH were as follows (5′ to 3′): AjFXYD11, forward: TTGAGCTGCTAGAAGATG and reverse: GTCAATCTATGGCTCCTC; AjGAPDH, forward: GCGCCAGCCAGA
ACATCATC and reverse: CGTTAAGCTCGGGGATGACC.
2.4. Total RNA extraction and RT-PCR analysis
Each total RNA sample from the various tissues of eel was extracted
with the TriPure Isolation Reagent (Roche, Mannheim, Germany) following the manufacturer's instructions. The RNA pellet was dissolved
in 30 μL of sterilized DDW (i.e., distilled and deionized water) and treated with the RNA clean-up protocol from the RNAspin Mini RNA isolation
kit (GE Health Care, Piscataway, NJ, USA) following the manufacturer's
instructions, to eliminate genomic DNA contamination. Extracted RNA
samples were stored at −80 °C after isolation. The concentration and
quality of extracted RNA were measured by NanoDrop 2000 (Thermo,
Wilmington, DE, USA). Purified RNA with an A260/A280 ratio between
1.8 and 2.0 was used for all RNA experiments. First-strand cDNA was
synthesized from 2 μg of total RNA by iScript™ cDNA synthesis kit
(Bio-Rad, Hercules, CA, USA) following the manufacturer's instructions.
For RT-PCR analysis, 2 μL of first-strand cDNA was used as a template
in a 50 μL final reaction volume containing 0.2 mM dNTP, 1.25 units of
Ex Taq polymerase (Takara, Otsu, Shiga, Japan), and 0.2 μM of each
primer. The reaction of PCR amplification of AjFXYD11and AjGAPDH
was performed under the following conditions: 5 min denaturation at
95 °C for one cycle followed by 29 cycles of denaturation at 95 °C
(1 min), annealing at 56 °C (1 min) for AjFXYD11or 60 °C (1 min) for
AjGAPDH, extension at 72 °C (30 s), and a final single extension at
72 °C for 5 min. The PCR products were analyzed by 1.5% agarose gels
containing the Safeview DNA stain (GeneMark, Taipei, Taiwan) to confirm the expected molecular weight of a single amplification product.
The nucleotide sequence of the PCR products was examined by direct
sequence analysis (Tri-I Biotech, Taipei, Taiwan).
2.5. Real-Time PCR
Expression levels of AjFXYD11 and Na +/K+–ATPase (AjNKA)
α-subunit (ATP1A1) (Accession number: X76108) (Cutler et al., 1995;
Tse et al., 2006) were quantified by MiniOpticon real-time PCR system
(Bio-Rad Laboratories). Real-time PCR primers used to analyze gene expression of AjFXYD11and NKA α-subunit were designed using Primer3
software (http://frodo.wi.mit.edu/primer3/input.htm) with the following sequences (5′ to 3′): AjFXYD11, forward: CTTATCCTCAGCATCACC
CG and reverse: GGCTACGAATTGGAGGCTTG; AjNKA α-subunit, forward: TCTGATGTCTCCAAGCAGGC and reverse: CTGGTCAGGGTGTAG
GC; AjGAPDH, forward: GCGCCAGCCAGAACATCATC and reverse: CGTT
AAGCTCGGGGATGACC. A standard curve was constructed for each target gene to optimize the template cDNA concentration and to verify
that the threshold cycle (Ct) fell into an acceptable range. The amplification efficiency for standard curves of the primer pairs used for real-time
PCR analysis was within the range of 95–100%. Real-time PCR reactions
contained 8 μL of cDNA (20× dilution), 0.5 μM of primer pair, and 10 μL
of 2× SYBR Green Supermix (Bio-Rad). The conditions for all real-time
PCR reactions were as follows: 95 °C for 5 min, followed by 40 cycles
of 98 °C for 10 s and 60 °C for 20 s. All samples were run in triplicate.
304
C.-H. Tang et al. / Comparative Biochemistry and Physiology, Part A 163 (2012) 302–310
Non-template control reactions were conducted with sterile deionized
water instead of cDNA template to determine the background signal
levels. A melting curve analysis was performed after each reaction
to confirm the efficiency of the conditions for real-time PCR and to
verify that no primer dimers or other nonspecific products were synthesized during the reactions. AjGAPDH was used as an internal control for normalization of AjFXYD11 and AjNKA α-subunit since the
mRNA expression of AjGAPDH was similar in different tissues and
with salinity and cortisol treatments in our preliminary test. For
each unknown sample, the comparative Ct method with the following
formula: 2 ^ [(Cttarget, n − CtGAPDH, n) − (Cttarget, c − CtGAPDH, c)] (Livak
and Schmittgen, 2001) was used to obtain the corresponding values of
target gene where Ct corresponded to the threshold cycle number.
and incubated at room temperature (26–28 °C) for 2 h with secondary
antibody (1:12,000 dilution). The immunoreactive bands were developed with Immobilon Western Chemiluminescent HRP Substrate
(Millipore) and imaged with a ChemiDoc (Bio-Rad). To verify even
loading of the crude membrane fractions, the total protein amount of
each lane on the blots was quantified after staining the membranes
with Ponceau S (Romero-Calvo et al., 2010) and analyzing images of
the blot using MCID software (ver. 7.0, rev. 1.0; Imaging Research, St.
Catharines, ON, Canada). Results were converted to numerical values
to compare the relative protein abundance of the immunoreactive
bands. The relative protein abundance of branchial and renal NKA
α-subunit protein in each sample was defined as the ratio of antibody/Ponceau S.
2.6. Preparation of crude membrane fractions
2.9. Specific NKA activity
The procedure of preparation of crude membrane fractions of gill
and kidney was performed according to Tang and Lee (2011). The eel
were anesthetized by immersion in 100 mg/L MS-222 diluted in aquarium water (Sigma) and then the gills and kidneys of the fish were
excised and blotted dry immediately. The samples were immersed
in liquid nitrogen and placed into ice-cold homogenization buffer
(250 mM sucrose, 1 mM EDTA, 30 mM Tris, pH 7.4). Homogenization
was performed in 2 mL tubes using the Polytron PT1200E homogenizer
(Lucerne, Switzerland) at maximal speed for 15 s. Debris, nuclei, and
lysosomes were removed by low-speed centrifugation (13,000 g for
10 min, 4 °C). The remaining supernatant was centrifuged at medium
speed (20,800 ×g for 1 h, 4 °C). The resulting pellet was resuspended
in homogenization buffer and stored at −80 °C. The pelleted fraction
contained large fragments of the plasma membrane along with membranes from the Golgi and the endoplasmic reticulum, but no small
cytoplasmic vesicles as they typically do not pellet down unless greater
forces (100,000×g for> 1 h) are applied (Alberts et al., 1994). This fraction is therefore referred to as the crude membrane fraction. Aliquots of
crude cell membrane fractions were saved for protein determination
analysis. Protein concentrations were determined with BCA Protein
Assay Kit (Pierce, Hercules, CA, USA) using bovine serum albumin
(Pierce) as a standard. The crude membrane fractions were stored at
−80 °C until the immunoblotting experiments.
A method using 96-well microplate to measure the inorganic
phosphate concentrations for determination of NKA activity was
performed according to Tang et al. (2010) with minor modification.
Aliquots of the suspension of the gill and kidney crude membrane
fractions, prepared as described above, were used to determine the
protein concentration and NKA enzyme activity. The reaction medium (final concentration: 100 mM imidazole–HCl buffer, pH 7.6,
125 mM NaCl, 75 mM KCl, 7.5 mM MgCl2) was prepared according
to Hwang et al. (1988). Then 10 μL crude membrane fractions, 50 μL
10 mM ouabain (specific inhibitor of NKA) or deionized water and
100 μL 10 mM Na2ATP were added to 340 μL of the reaction medium.
The enzyme activity was defined as the difference between the inorganic phosphate liberated in the presence and absence of ouabain in
the reaction mixture. The reaction mixture was incubated at 28 °C
for 20 min followed by immediate ice bath for 10 min to stop the
reaction (Cheng et al., 1999). Because van der Heijden et al. (1997)
and Sardella et al. (2008) have demonstrated that the specific NKA
activity was measured at the exposed temperature of fish would correlate with the level of in vivo activity. Therefore, the reaction was
run at 28 °C in this study. The concentration of inorganic phosphate
was measured according to Doulgerakia et al. (2002). The colorimetric reagent consisted of 1% Tween-20 and 0.75% ammonium molybdate in 0.9 M H2SO4. The reaction mixtures and colorimetric reagent
were mixed in a 1:1 (v/v) ratio and then the concentration of inorganic
phosphate in each of the samples was determined by a microplate reader (VERSAmax, Molecular Devices, Sunnyvale, CA, USA) at 405 nm. Each
sample was determined in triplicate. Some protocols determine the
concentration of inorganic phosphate by measuring the color of molybdenum blue, which is the reduced product of phosphomolybdate. The
instability of color formation and reagents, however, were variables in
those protocols. The formation of the unreduced phosphomolybdate
in the present study is directly proportional to the amounts of inorganic
phosphate.
2.7. Antibodies
The primary antibody used in this study was α5, a mouse monoclonal
antibody (Developmental Studies Hybridoma Bank, Iowa City, IA, USA)
raised against the α-subunit of avian NKA. The secondary antibody used
in this study was horseradish peroxidase (HRP)-conjugated goat antimouse IgG (Jackson Immunoresearch, West Baltimore Pike, PA, USA).
2.8. Immunoblotting
Immunoblotting procedures were performed according to Tang
and Lee (2011). Proteins of the membrane fraction were heated
together with the 6 × sample buffer (12% SDS and 30% glycerol,
62.5 mM Tris (pH 6.8), 0.6 M dithiothreitol, 0.06% bromophenol
blue) at 37 °C for 30 min. The prestained protein molecular weight
marker was purchased from Fermentas (SM0671; Hanover, MD,
USA). All samples were separated by electrophoresis on sodium dodecyl
sulfate-containing 7.5% polyacrylamide gels (15 μg of protein/lane). The
separated proteins were then transferred to polyvinylidene fluoride
(PVDF) membranes (Millipore, Bedford, MA, USA) by electroblotting.
After preincubation for 3 h in PBST buffer (phosphate-buffered saline
containing 0.075% Tween-20) containing 5% (w/v) nonfat dried milk
to minimize nonspecific binding, the membranes were incubated for
2 h at room temperature (26°–28 °C) with primary antibody (α5) diluted in 1% bovine serum albumin (BSA) and 0.05% sodium azide in
PBST (1:5000 dilution). Then, the membranes were washed in PBST
2.10. Organ culture
The effect of a single dose of cortisol (10 μg/mL) on the mRNA expression level of branchial AjFXYD11 was examined in vitro using the organ
culture approach. Preparation of gill filaments for organ culture was
performed following the methods previously described in McCormick
and Bern (1989). The culture medium was Leibovitz-15 (L-l 5) containing
292 μg/mL L-glutamine with 25 mM N-2-hydroxyethylpiperazine-N′-2ethanesulfonic acid (HEPES) buffer and 4 mg/mL BSA (GeneMark) was
added immediately before use and adjusted to pH 7.5 with NaOH. Gill
arches from FW-acclimated eel were excised and placed in sterile Petri
dishes containing sterile L-l5 placed on ice. Gill filaments were separated
immediately above the septum and gently dissociated by passage through
a pipette. Excised gill filaments were placed in 2 mL L-15 containing
500 U/mL penicillin and 500 μg/mL streptomycin. Gill filaments were
preincubated in this media at 20–22 °C for 4 h with gentle shaking.
C.-H. Tang et al. / Comparative Biochemistry and Physiology, Part A 163 (2012) 302–310
Then gill filaments were transferred to L-15 containing 50 U/mL penicillin and 50 μg/mL streptomycin with or without 10 μg/mL cortisol
sodium-hydrocortisone-hemisuccinate (Sigma). The dosage of cortisol
has been used in previous studies (Kiilerich et al., 2007; Tipsmark et
al., 2010). After 18 h, the incubation was terminated by freezing the
gill blocks in liquid nitrogen (Tipsmark et al., 2010). Total RNA extraction and real-time PCR analysis were executed as described above.
2.11. Analysis of plasma osmolality and muscle water contents (MWC)
A. japonica blood was collected from the heart with 1 mL heparinized syringes and 29 G needles, and then the blood samples were
centrifuged at 1000 ×g at 4 °C for 10 min. Plasma osmolality was
measured immediately by using the Wescor 5520 Vapro Osmometer (Logan, UT, USA). The procedure used to measure MWC was
conducted according to Tang et al. (2009). MWC was measured gravimetrically after drying the samples at 100 °C for 48 h.
2.12. Statistical analysis
In the acclimation experiments, statistical significance was determined using Student's t-test (P b 0.05) for group data analysis. Values
were expressed as means ± S.E.M.
305
3. Results
3.1. mRNA and protein expression and activity of Na +/K +–ATPase (NKA)
in gills and kidneys
Real-time polymerase chain reaction (PCR) analysis revealed that
the relative mRNA levels of gill NKA α-subunit were significantly
higher in SW-acclimated Japanese eel (A. japonica) than fresh water
(FW)-acclimated individuals (Fig. 1A). Quantification of single, 105 kDa
immunoreactive bands (Fig. 1B) from each group showed that the relative
protein abundance of the SW-acclimated individuals were significantly
higher than FW-acclimated individuals (Fig. 1C). Furthermore, the pattern of branchial NKA specific activity was positively correlated with
branchial mRNA and protein levels and activity of gill NKA was significantly elevated in SW group compared with FW group (Fig. 1D).
The pattern of renal NKA mRNA and protein expression and specific
activity was different from the pattern observed in gills. The transcript
levels of renal NKA α-subunit were higher in FW eel than SW eel
(Fig.2A). Immunoblotting analysis showed that renal NKA α-subunit
in FW and SW eel also resulted in a single immunoreactive band approximately 105 kDa (Fig. 2B). However, the protein abundance of
renal NKA α-subunit in the FW-acclimated eel was significantly higher
than that in SW-acclimated eel (Fig. 2C). Similarly, NKA specific activity
in kidneys of FW group was higher than that in SW group (Fig. 2D).
Fig. 1. Branchial Na+/K+–ATPase (NKA) expression and activity in Japanese eel (Anguilla japonica) acclimated to fresh water (FW) and seawater (SW); n = 5 for each experiment.
(A) mRNA expression of gill NKA α-subunit were analyzed by real-time PCR. The expression levels were significantly higher in the SW group than the FW group. (B) A representative immunoblot of gills from eel acclimated to FW and SW probed with a primary antibody to NKA α-subunit (α5) confirming a single immunoreactive band with molecular
weight of about 105 kDa. (C) Relative protein abundance of gill NKA α-subunit was significantly higher in SW eel than FW eel. (D) Gill NKA activity was measured in FW and
SW acclimated eel. Gill NKA activity of SW group was significantly higher than that of FW group. The asterisk indicated a significant difference by Student's t-test (P b 0.05). Values
are means ± S.E.M. M, marker.
306
C.-H. Tang et al. / Comparative Biochemistry and Physiology, Part A 163 (2012) 302–310
3.2. Japanese eel (A. japonica) FXYD11 (AjFXYD11)
Bioinformatics tools including the European eel (A. anguilla) transcriptome database (EeelBase; http://compgen.bio.unipd.it/eeelbase/),
the National Center for Biotechnology Information (NCBI) database,
and BLAST were used to clone the AjFXYD11 gene. The entire cDNA
nucleotide sequence of the AjFXYD11 was cloned with a PCR based
method. The 213 bp cDNA sequence of AjFXYD11 (Accession number: JQ867188) encoded a deduced protein with 70 amino acid residues. The amino acid sequence shared 76% and 69% homology with
previously published FXYD11 sequences from Atlantic salmon (S. salar)
(NP_001117201 and NP_001117200) (Tipsmark, 2008) and zebrafish
(D. rerio) (XP_003200301) (Saito et al., 2010), respectively. According to
the hydropathy plot analysis, AjFXYD11 contained one transmembrane
domain (32–54 residue of AjFXYD11 amino acid sequence; gray background in Fig. 3), which was highly conserved in the other FXYD proteins
(40–70% identity). Thr60 (circled in Fig. 3) is a predicted site of phosphorylation by protein kinase C. Asn66 and Asn69 are the predicted sites of glycosylation (dotted box in Fig. 3). Based on the alignment, AjFXYD11
protein contains a conserved FXYD motif (solid line box in Fig. 3).
3.3. Tissue distribution of AjFXYD11
Reverse transcription (RT)-PCR with cDNA from the studied tissues (gills, kidneys, intestine, liver, muscle and skin) of FW eel was
Fig. 3. Nucleotide sequence and deduced amino acid sequence of Japanese eel (Anguilla
japonica) FXYD11 (AjFXYD11). The boxes indicate the highly similar FXYD motif (solid
line) and two glycine residues (dashed line). The transmembrane domain is shaded
gray.
performed to determine the distribution of AjFXYD11 mRNA and
glyceraldehyde-3-phosphate dehydrogenase (AjGAPDH) mRNA was
used as the loading control. After 40 cycles of RT-PCR reaction with the
specific primers of AjFXYD11, the expected 319 bp product was detected
in gill tissue of FW eel (Fig. 4A). A more sensitive approach, real-time PCR,
was further performed to quantify the mRNA abundance in the various
eel tissues. AjFXYD11 mRNA expression was the strongest in gills,
where the AjFXYD11 mRNA abundance was 177-fold higher than in kidneys and more than 2000-fold higher than in any other tissues. The relative order of the levels of AjFXYD11 mRNA expression in the studied
Fig. 2. Renal Na+/K+–ATPase (NKA) expression and activity in Japanese eel (Anguilla japonica) acclimated to fresh water (FW) and seawater (SW); n = 5 for each experiment.
(A) mRNA expression of renal NKA α-subunit were analyzed by real-time PCR. The expression levels were significantly higher in the FW group than the SW group. (B) A representative immunoblot of kidneys from eel acclimated to FW and SW probed with a primary antibody to NKA α-subunit (α5). A single immunoreactive band with molecular weight of
about 105 kDa was shown. The immunoreactive bands of FW eel were more intense than SW individuals. (C) Relative protein abundance of kidney NKA α-subunit was significantly
higher in FW eel than SW eel. (D) Renal NKA activity was measured in FW and SW acclimated eel. Renal NKA activity of SW group was significantly higher than that of FW group.
The asterisk indicated a significant difference by Student's t-test (P b 0.05). Values are means ± S.E.M. M, marker.
C.-H. Tang et al. / Comparative Biochemistry and Physiology, Part A 163 (2012) 302–310
307
tissues was as follows: gills>kidneys>intestine>liver>muscle>skin
(Fig. 4B).
3.4. Effects of environmental salinity and cortisol on AjFXYD11 mRNA
expression
The relative expression of AjFXYD11 mRNA in gills and kidneys of
eel acclimated to FW and SW was examined by real-time PCR. Compared to FW eel, SW eel expressed higher levels of branchial AjFXYD11
mRNA (Fig. 5A). However, the levels of renal AjFXYD11 mRNA were
similar between FW and SW groups (Fig. 5B). The expression of gill
AjFXYD11 transcripts was higher in cortisol treatment (10 μg/mL)
than control after in vitro culture for 18 h (Fig. 6).
3.5. Plasma osmolality and muscle water contents (MWC)
Plasma osmolality of A. japonica acclimated to environments of different salinities was maintained within a range appropriate for physiological
homeostasis, although the plasma osmolality was slightly but significantly higher in SW group (Fig. 7A). There was no significant difference in the
MWC between eel exposed to FW and SW (Fig. 7B).
4. Discussion
The maintenance of a stable internal environment is crucial for animals to survive in a variety of habitats. Salinity is one of the major abiotic
factors that influence physiological homeostasis in aquatic organisms
(Kültz and Burg, 1998; Boeuf and Payan, 2001; Deane and Woo, 2004;
2009). Ion-transporting epithelia, such as those found in gills and kidneys,
play important roles in modulating ion fluxes in response to changes in
environmental salinity. Among the transporters that modulate ion fluxes,
Na+/K+–ATPase (NKA) is a primary active pump responsible for the active transport of Na+ out of and K+ into animal cells (Post and Jolly,
1957). NKA is essential for maintaining intracellular homeostasis as
Fig. 5. mRNA abundance of gill and kidney FXYD11 in fresh water (FW) and seawater
(SW) Japanese eel (Anguilla japonica) (AjFXYD11); n = 5 for each experiment.
(A) mRNA levels of branchial AjFXYD11 was significantly higher in the SW group
than the FW group. (B) No significant difference was found in renal AjFXYD11 expression between the FW and SW groups. The asterisk indicated a significant difference by
Student's t-test (P b 0.05). Values are means ± S.E.M.
well as for energizing ion-transporting systems in animals (Blanco and
Mercer, 1998; Bystriansky and Kaplan, 2007; Vagin et al., 2007).
In the present study, real-time PCR and immunoblotting analyses
revealed that the levels of mRNA and protein expression of the
NKA α-subunit were significantly higher in gills of the Japanese eel
(A. japonica) acclimated to seawater (SW) than in A. japonica acclimated to fresh water (FW) (Fig. 1A–C). This suggests that the elevation of branchial NKA activity in SW A. japonica (Fig. 1D) results from
Fig. 4. (A) Distribution of Japanese eel (Anguilla japonica) FXYD11 gene in freshwater (FW)
A. japonica (AjFXYD11) tissues by reverse transcription (RT)-PCR analysis. A. japonica
glyceraldehyde-3-phosphate dehydrogenase (AjGAPDH) was applied as an internal control
for all cDNAs used in the analysis. 319 bp product was detectable in gills by RT-PCR analysis.
(B) Quantitative mRNA expression of AjFXYD11 was analyzed by real-time PCR (n=5).
AjFXYD11 was detected in all examined tissues and the relative expression levels among
the tissues were as follows: gills>kidneys>intestines≈liver≈muscle≈skin. G, gill; K, kidney; I, intestine; L, liver; M, muscle, Sk, skin.
Fig. 6. Effects of cortisol on FXYD11 mRNA expression in gill blocks from fresh water
(FW) acclimated Japanese eel (Anguilla japonica) (AjFXYD11); n= 5 for all groups.
mRNA abundance of gill AjFXYD11 was significantly induced by cortisol treatment.
The asterisk indicated a significant difference by Student's t-test (P b 0.05). Values are
means ± S.E.M.
308
C.-H. Tang et al. / Comparative Biochemistry and Physiology, Part A 163 (2012) 302–310
Fig. 7. (A) Plasma osmolality and (B) muscle water contents (MWC) in Japanese eel
(Anguilla japonica) acclimated to fresh water (FW) and seawater (SW); n=5 for all groups.
Plasma osmolality was significantly higher in SW-exposed (288.8±1.97 mOsm/kg) fish
than FW-exposed (271.2±1.74 mOsm/kg) individuals. There was no significant difference in MWC between FW- and SW-exposed eel.
increasing the transcript and protein levels of branchial NKA α-subunit.
This is similar to previous reports of NKA expression or activity in tilapia
(O. mossambicus) (Lee et al., 2003), pufferfish (T. nigroviridis) (Lin et al.,
2004), sailfin molly (Poecilia latipinna) (Yang et al., 2009) and salmonid
species (Hwang and Lee, 2007). Recently, salinity-dependent expression
of two NKA α-subunit isoforms, α1a and α1b, was reported in salmonid
fish (Richards et al., 2003; Bystriansky et al., 2006; 2007). It is worth to
identify and analyze the expression of NKA α1a and α1b in eel to clarify
the involvement of switch of two isoforms in modulation of NKA activity
in eel gills.
Unlike NKA expression and activity in gills, those of eel kidney are
poorly understood. Our results revealed that renal NKA expression
(mRNA and protein) and activity of FW-acclimated eel were higher
than those of SW-acclimated eel (Fig. 2). Similarly, a significant increase
in renal NKA activity has been previously reported in kidneys of other
FW-acclimated euryhaline species such as killifish (Fundulus heteroclitus)
(Epstein et al., 1969), thicklip gray mullet (Crenimugil labrosus) (Lasserre,
1971; Gallis and Bourdichon, 1976), European sea bass (Dicentrarchus
labrax) (Lasserre, 1971; Venturini et al., 1992; Nebel et al., 2005), thinlip
mullet (Liza ramada) (Gallis and Bourdichon, 1976), striped bass (Morone
saxatilis) (Madsen et al., 1994), black seabream (Mylio macrocephalus)
(Kelly et al., 1999), pufferfish (T. nigroviridis) (Lin et al., 2004), three sturgeon species (Acipenser ruthenus, A. gueldenstaedtii, and A. stellatus)
(Krayushkina et al., 2006), and milkfish (Chanos chanos) (Tang et al.,
2010). The primary function of teleost kidneys is to excrete excess
water while reabsorbing most of the filtered solutes. To minimize salt
loss, FW teleosts reabsorb approximately 95% of the NaCl that enters the
glomerular filtrate (Miyazaki et al., 2002; Marshall and Grosell, 2006). Elevation of NKA expression and activity in FW eel kidneys might indicate
the role of renal NKA in energizing ion reabsorption for the homeostasis
of euryhaline teleosts exposed to hypotonic environment (Tang et al.,
2010).
In addition to changes in the expression of the NKA α-subunit, different members (FXYD1–7) of the FXYD protein family have been
identified as regulators of NKA. For instance, FXYD protein-mediated
regulation of NKA activity has been widely examined in mammals
(Geering et al., 2003; Crambert et al., 2005; Garty and Karlish, 2006;
Geering, 2006; Delprat et al., 2007). The first fish FXYD protein
(FXYD10; Phospholemman-like) was identified in shark rectal glands
(Mahmmoud et al., 2000). Recently, eight FXYD proteins (FXYD2,
FXYD5–9 and FXYD11–12) have been identified in the Atlantic salmon (S. salar) and have been characterized for their tissue-specific
expression and their relationship to salinity adaptation (Tipsmark,
2008). Of these eight FXYD proteins, FXYD11 has been reported to
be highly expressed in fish gills (Tipsmark, 2008; Saito et al., 2010;
Tipsmark et al., 2010; Tipsmark et al., 2011). In the present study,
we cloned the FXYD11 gene from the catadromous teleost, Japanese
eel (AjFXYD11), which we identified based on homology with the
characteristic FXYD motif and the possession of a transmembrane
domain similar to other vertebrate FXYD proteins (Fig. 3). The FXYD
motif is essential for the structural interaction with NKA (Geering et
al., 2003; Garty and Karlish, 2006; Geering, 2006). Interestingly, the
FXYD motif of AjFXYD11 was present as FXYN harboring an asparagine
residue where an aspartate residue is typically found (Fig. 3). This
amino acid substitution (D to N) in FXYD11 has also been reported in
Atlantic salmon (Tipsmark, 2008) and zebrafish (Saito et al., 2010).
Therefore, to realize the functional effect of FXYD11 is necessary in
the future works. Then it will be interesting to examine the effect of
this amino acid substitution in the FXYD motif on modulation of NKA
properties. Moreover, to determine whether AjFXYD11 expression occurs exclusively in the gills, mRNA expression of AjFXYD11 in various
tissues was investigated. RT-PCR results showed that AjFXYD11 was
expressed exclusively in eel gills (Fig. 4A), which is similar to previous
findings in zebrafish (Saito et al., 2010). The real-time PCR, a more sensitive transcript detection technique, was used in previous studies of Atlantic salmon (Tipsmark, 2008) and tilapia (Tipsmark et al., 2010) to
examine the expression levels of FXYD11 in various tissues. Using the
real-time PCR, we detected AjFXYD11 mRNA in all examined tissues
and the branchial abundance of AjFXYD11 transcript was the highest
(approximately 130-fold) among all examined organs (Fig. 4B). The results suggest that teleost FXYD11 likely has a conserved function in gills.
Furthermore, the abundance of branchial AjFXYD11 was
salinity-dependent and increased in parallel with NKA activity in
SW-acclimated eel (Fig. 5A). Similar findings have been reported in Atlantic salmon, where the protein amounts of FXYD11 and NKA
α-subunit were simultaneously elevated in gills of SW-acclimated individuals (Tipsmark et al., 2010). Saito et al. (2010) used antisense
morpholino oligonucleotides targeting FXYD11 to show that FXYD11
expression correlated with NKA expression in the zebrafish. Additionally, the colocalization and interaction between FXYD11 and NKA has
been demonstrated in previous experiments (Saito et al., 2010;
Tipsmark et al., 2010). Collectively, these and our results presumed
that AjFXYD11 plays an osmoregulatory role involved in interaction
with NKA in gills. In the eel kidneys, the mRNA abundance of AjFXYD11
was higher than in all other tissues examined except for the gills
(Fig. 4B). However, the levels of renal AjFXYD11 mRNA expression
were similar between FW- and SW-acclimated eel (Fig. 5B). In the
long-term acclimation, the pattern of AjFXYD11 expression was inconsistent with salinity-dependent NKA activity in eel kidneys. These data
indicated that AjFXYD11 may be more involved in interaction with
NKA in gills rather than in kidneys of A. japonica.
Changes in the osmoregulatory properties of fish gills are elicited by
changes in gill specific ion-transport proteins. Previous studies have
C.-H. Tang et al. / Comparative Biochemistry and Physiology, Part A 163 (2012) 302–310
found that expression levels of gill-specific ion transport protein
expression are largely coordinated by changes in circulating cortisol
levels (McCormick, 2001; Sakamoto et al., 2001). Because the evidences
have shown that cortisol plays a hypoosmoregulatory role in several teleosts, cortisol is considered to be a classical SW adaptation hormone
(McCormick, 2001; Mancera and McCormick, 2007). In the eel, an
increase in cortisol levels acts primarily to promote the mechanisms
of SW adaptation (McCormick, 2001). Moreover, the absence of cortisol via interrenalectomy or hypophysectomy results in a reduction in
the activities of gill NKA (McCormick, 2001). In our study, branchial
AjFXYD11 expression was elevated in eel acclimated to SW. Furthermore, since in vitro organ culture showed that AjFXYD11 mRNA levels
in gills treated in vitro with cortisol were higher than the control, cortisol would play an important role in maintaining gill AjFXD11 mRNA
levels (Fig. 6). Gill FXYD11 expression was higher in cortisol treatment
has also been found in the Atlantic salmon (Tipsmark et al., 2010) and
tilapia (Tipsmark et al., 2011). The cortisol-dependent regulation of
FXYD11 expression probably indicates the fact that FXYD11 is most
closely related to the mammalian corticosteroid hormone-induced factor, FXYD4 (Tipsmark, 2008). Thus, we propose that cortisol might
participate in modulation of the correlation between AjFXYD11 and
NKA through maintaining gill AjFXYD11 levels when A. japonica are
exposed to SW.
NKA is the major energizer of ion-transporting systems in osmoregulatory tissues of teleosts. Therefore, FXYD proteins may be expected to
play an important role in osmoregulation of these tissues. By analyzing
the effects of environmental salinity and cortisol on FXYD11 expression,
the present study provides evidence showing a tight correlation between gill NKA and AjFXYD11 in the catadromous species, A. japonica.
Alteration of branchial and renal NKA expression and activity, and gill
AjFXYD11 expression in response to FW and SW acclimation showed
their close relationship to physiological homeostasis such as stable plasma osmolality and muscle water contents (Fig. 7). Moreover, this study
is the first to examine and compare NKA expression and activity in relation to FXYD11 expression in the gills and kidneys simultaneously to
illustrate the tissue specificity of FXYD in fish. Future investigations
should focus on the role of different FXYD proteins in the regulation of
NKA in osmoregulatory tissues to determine whether kidney-specific
FXYD genes are expressed in teleosts and the time-course experiments
will be conducted to explore the transient changes of AjFXYD11 expression in the Japanese eel.
Acknowledgments
The monoclonal antibody α5 was purchased from the Developmental
Studies Hybridoma Bank (DSHB) maintained by the Department of Pharmacology and Molecular Sciences, John Hopkins University School of
Medicine, Baltimore, MD, and the Department of Biological Sciences, University of Iowa, Iowa City, IA, under Contract N01-HD-6-2915, NICHD,
USA. This study was supported in part by a grant from the National Science Council (NSC 99-2321-B-005-013-MY3) and in part from the ATU
plan of the Ministry of Education, Taiwan (No. 100 S0901), to T.-H.L.
Appendix A. Supplementary data
Supplementary data to this article can be found online at http://
dx.doi.org/10.1016/j.cbpa.2012.07.017.
References
Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K., Watson, J.D., 1994. Molecular Biology
of the Cell, 3rd ed. Garland Publishing, London.
Blanco, G., Mercer, R.W., 1998. Isozymes of the Na–K–ATPase: heterogeneity in structure, diversity in function. Am. J. Physiol. Renal Physiol. 275, F633–F650.
Boeuf, G., Payan, P., 2001. How should salinity influence fish growth? Comp. Biochem.
Physiol. C: Toxicol. Pharmacol. 130, 411–423.
309
Burg, M.B., Ferraris, J.D., Dmitrieva, N.I., 2007. Cellular response to hyperosmotic stresses. Physiol. Rev. 87, 1441–1474.
Bystriansky, J.S., Kaplan, J.H., 2007. Sodium pump localization in epithelia. J. Bioenerg.
Biomembr. 39, 373–378.
Bystriansky, J.S., Richards, J.G., Schulte, P.M., Ballantyne, J.S., 2006. Reciprocal expression of gill Na+/K+–ATPase alpha-subunit isoforms α1a and α1b during seawater
acclimation of three salmonid fishes that vary in their salinity tolerance. J. Exp. Biol.
209, 1848–1858.
Bystriansky, J.S., Frick, N.T., Richards, J.G., Schulte, P.M., Ballantyne, J.S., 2007. Wild Arctic char (Salvelinus alpinus) upregulate gill Na+, K+–ATPase during freshwater
migration. Physiol. Biochem. Zool. 80, 270–282.
Cheng, S.X., Aizman, O., Nairn, A.C., Greengard, P., Aperia, A., 1999. [Ca2+]i determines
the effects of protein kinases A and C on activity of rat renal Na+, K+–ATPase.
J. Physiol. 518, 37–46.
Crambert, G., Fuzesi, M., Garty, H., Karlish, S., Geering, K., 2002. Phospholemman
(FXYD1) associates with Na,K–ATPase and regulates its transport properties.
Proc. Natl. Acad. Sci. U. S. A. 99, 11476–11481.
Crambert, G., Li, C., Claeys, D., Geering, K., 2005. FXYD3 (Mat-8), a new regulator of Na,
K–ATPase. Mol. Biol. Cell 16, 2363–2371.
Cutler, C.P., Sanders, I.L., Hazon, N., Cramb, G., 1995. Primary sequence, tissue specificity and expression of the Na+, K+–ATPase alpha 1 subunit in the European eel
(Anguilla anguilla). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 111, 567–573.
Deane, E.E., Woo, N.Y., 2004. Differential gene expression associated with euryhalinity
in sea bream (Sparus sarba). Am. J. Physiol. Regul. Integr. Comp. Physiol. 287,
R1054–R1063.
Deane, E.E., Woo, N.Y., 2009. Modulation of fish growth hormone levels by salinity,
temperature, pollutants and aquaculture related stress: a reivew. Rev. Fish. Biol.
Fish. 19, 97–120.
Delprat, B., Schaer, D., Roy, S., Wang, J., Puel, J.L., Geering, K., 2007. FXYD6 is a novel regulator of Na, K–ATPase expressed in the inner ear. J. Biol. Chem. 282, 7450–7456.
Doulgerakia, A., Papadopoulou-Daifotib, Z., Tsakirisa, S., 2002. Effects of L-phenylalanine
on acetylcholinesterase and Na+, K+–ATPase activities in suckling rat frontal cortex, hippocampus and hypothalamus. Z. Naturforsch. 57c, 182–188.
Epstein, F.H., Manitius, A., Weinstein, E., Katz, A.I., Pickford, G.E., 1969. Sodium- and
potassium-activated adenosine triphosphatase in kidneys of Fundulus heteroclitus
adapted to fresh and salt water. Yale J. Biol. Med. 41, 388–393.
Evans, D.H., Piermarini, P.M., Choe, K.P., 2005. The multifunctional fish gill: dominant
site of gas exchange, osmoregulation, acid–base regulation, and excretion of
nitrogenous waste. Physiol. Rev. 85, 97–177.
Feraille, E., Doucet, A., 2001. Sodium–potassium–adenosinetriphosphatase-dependent
sodium transport in the kidney: hormonal control. Physiol. Rev. 81, 345–418.
Gallis, J.L., Bourdichon, M., 1976. Changes of (Na+–K+) dependent ATPase activity in
gills and kidneys of two mullets Chelon labrosus (Risso) and Liza ramada (Risso)
during fresh water adaptation. Biochimie 58, 625–627.
Garty, H., Karlish, S.J., 2006. Role of FXYD proteins in ion transport. Annu. Rev. Physiol.
68, 431–459.
Garty, H., Lindzen, M., Scanzano, R., Aizman, R., Fuzesi, M., Goldshleger, R., Farman, N.,
Blostein, R., Karlish, S.J., 2002. A functional interaction between CHIF and Na–K–
ATPase: implication for regulation by FXYD proteins. Am. J. Physiol. Renal Physiol.
283, F607–F615.
Geering, K., 2006. FXYD proteins: new regulators of Na–K–ATPase. Am. J. Physiol. Renal
Physiol. 290, F241–F250.
Geering, K., Beguin, P., Garty, H., Karlish, S., Fuzesi, M., Horisberger, J.D., Crambert, G.,
2003. FXYD proteins: new tissue- and isoform-specific regulators of Na,K–ATPase.
Ann. N. Y. Acad. Sci. 986, 388–394.
Heijden, A., Verbost, P., Eygensteyn, J., Li, J., Bonga, S., Flik, G., 1997. Mitochondria-rich
cells in gills of tilapia (Oreochromis mossambicus) adapted to fresh water or sea
water: quantification by confocal laser scanning microscopy. J. Exp. Biol. 200, 55–64.
Hirose, S., Kaneko, T., Naito, N., Takei, Y., 2003. Molecular biology of major components
of chloride cells. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 136, 593–620.
Hwang, P.P., Lee, T.H., 2007. New insights into fish ion regulation and mitochondrion-rich
cells. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 148, 479–497.
Hwang, P.P., Sun, C.M., Wu, S.M., 1988. Characterization of gill Na+–K+-activated adenosine
triphosphatase from tilapia Oreochromis mossambicus. Bull. Inst. Zool. Acad. Sin. 27,
49–56.
Hwang, P.P., Lee, T.H., Lin, L.Y., 2011. Ion regulation in fish gills: Recent progress in the
cellular and molecular mechanisms. Am. J. Physiol. Regul. Integr. Comp. Physiol.
301, R28–R47.
Kaneko, T., Watanabe, S., Lee, K.M., 2008. Functional morphology of mitochondrionrich cells in euryhaline and stenohaline teleosts. Aqua-BioSci. Monogr. 1, 1–62.
Katoh, F., Cozzi, R.R., Marshall, W.S., Goss, G.G., 2008. Distinct Na+/K+/2Cl− cotransporter
localization in kidneys and gills of two euryhaline species, rainbow trout and killifish.
Cell Tissue Res. 334, 265–281.
Kelly, S.P., Chow, I.N.K., Y.S., Woo, N., 1999. Alterations in Na+–K+ATPase activity and
gill chloride cell morphometrics of juvenile black sea bream (Mylio macrocephalus)
in response to salinity and ration size. Aquaculture 172, 351–367.
Kiilerich, P., Kristiansen, K., Madsen, S.S., 2007. Cortisol regulation of ion transporter
mRNA in Atlantic salmon gill and the effect of salinity on the signaling pathway.
J. Endocrinol. 194, 417–427.
Krayushkina, L.S., Semenova, O.G., Vyushina, A.V., 2006. Level of serum cortisol and
Na+/K+ATP–ase activity of gills and kidneys in different acipenserids. J. Appl.
Ichthyol. 22, 182–187.
Kültz, D., Burg, M., 1998. Evolution of osmotic stress signaling via MAP kinase cascades.
J. Exp. Biol. 201, 3015–3021.
Lasserre, P., 1971. Increase of (Na+ plus K+)-dependent ATPase activity in gills and
kidneys of two euryhaline marine teleosts, Crenimugil labrosus (Risso, 1826) and
310
C.-H. Tang et al. / Comparative Biochemistry and Physiology, Part A 163 (2012) 302–310
Dicentrarchus labrax (Linnaeus, 1758), during adaptation to fresh water. Life. Sci. II
10, 113–119.
Lee, T.H., Feng, S.H., Lin, C.H., Hwang, Y.H., Huang, C.L., Hwang, P.P., 2003. Ambient
salinity modulates the expression of sodium pumps in branchial mitochondriarich cells of Mozambique tilapia, Oreochromis mossambicus. Zool. Sci. 20, 29–36.
Lin, C.H., Tsai, R.S., Lee, T.H., 2004. Expression and distribution of Na, K–ATPase in gill
and kidney of the spotted green pufferfish, Tetraodon nigroviridis, in response to
salinity challenge. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 138, 287–295.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2-△△CT method. Methods 25, 402–408.
Madsen, S.S., McCormick, S.D., Young, G., Endersen, J.S., 1994. Physiology of seawater
acclimation in the striped bass, Morone saxatilis (Walbaum). Fish Physiol. Biochem.
13, 1–11.
Mahmmoud, Y.A., Vorum, H., Cornelius, F., 2000. Identification of a phospholemman-like
protein from shark rectal glands. Evidence for indirect regulation of Na, K–ATPase by
protein kinase c via a novel member of the FXYDY family. J. Biol. Chem. 275,
35969–35977.
Mahmmoud, Y.A., Cramb, G., Maunsbach, A.B., Cutler, C.P., Meischke, L., Cornelius, F.,
2003. Regulation of Na, K-ATPase by PLMS, the phospholemmanlike protein from
shark: molecular cloning, sequence, expression, cellular distribution, and functional effects of PLMS. J. Biol. Chem. 278, 37427–37438.
Mancera, J.M., McCormick, S.D., 2007. Role of prolactin, growth hormone, insulin-like
growth factor and cortisol in teleost osmoregulation. In: Baldisserotto, B., Mancera,
J.M., Kapoor, B.G. (Eds.), Fish Osmoregulation. Science Publishers, pp. 497–515.
Marshall, W.S., 2002. Na+, Cl−, Ca2+ and Zn2+ transport by fish gills: retrospective
review and prospective synthesis. J. Exp. Zool. 293, 264–283.
Marshall, W.S., Grosell, M., 2006. Ion transport, osmoregulation and acid–base balance.
In: Evans, D.H., Clairborne, J.B. (Eds.), The Physiology of Fishes. CRC Press, Boca
Raton, pp. 177–230.
McCormick, S.D., 2001. Endocrine control of osmoregulation in fish. Am. Zool. 41,
781–794.
McCormick, S.D., Bern, H.A., 1989. In vitro stimulation of Na+–K+–ATPase activity and
ouabain binding by cortisol in coho salmon gill. Am. J. Physiol. Regul. Integr. Comp.
Physiol. 256, R707–R715.
Miyazaki, H., Kaneko, T., Uchida, S., Sasaki, S., Takei, Y., 2002. Kidney-specific chloride
channel, OmClC–K, predominantly expressed in the diluting segment of freshwateradapted tilapia kidney. Proc. Natl. Acad. Sci. U. S. A. 99, 15782–15787.
Nebel, C., Romestand, B., Negre-Sadargues, G., Grousset, E., Aujoulat, F., Bacal, J.,
Bonhomme, F., Charmantier, G., 2005. Differential freshwater adaptation in juvenile
seabass Dicentrarchus labrax: involvement of gills and urinary system. J. Exp. Biol.
208, 3859–3871.
Perry, S.F., Shahsavarani, A., Georgalis, T., Bayaa, M., Furimsky, M., Thomas, S.L., 2003.
Channels, pumps, and exchangers in the gill and kidney of freshwater fishes:
their role in ionic and acid–base regulation. J. Exp. Zool. A Comp. Exp. Biol. 300,
53–62.
Post, R.L., Jolly, P.C., 1957. The linkage of sodium, potassium, and ammonium active
transport across the human erythrocyte membrane. Biochim. Biophys. Acta 25,
118–128.
Pu, H.X., Cluzeaud, F., Goldshleger, R., Karlish, S.J., Farman, N., Blostein, R., 2001. Functional
role and immunocytochemical localization of the gamma a and gamma b forms of the
Na, K–ATPase gamma subunit. J. Biol. Chem. 276, 20370–20378.
Richards, J.G., Semple, J.W., Bystriansky, J.S., Schulte, P.M., 2003. Na+/K+–ATPase
alpha-isoform switching in gills of rainbow trout (Oncorhynchus mykiss) during
salinity transfer. J. Exp. Biol. 206, 4475–4486.
Romero-Calvo, I., Ocón, B., Martínez-Moya, P., Suárez, M.D., Zarzuelo, A., MartínezAugustin, O., de Medina, F.S., 2010. Reversible Ponceau staining as a loading control
alternative to actin in Western blots. Anal. Biochem. 401, 318–320.
Saito, K., Nakamura, N., Ito, Y., Hoshijima, K., Esaki, M., Zhao, B., Hirose, S., 2010. Identification
of zebrafish Fxyd11a protein that is highly expressed in ion-transporting epithelium of
the gill and skin and its possible role in ion homeostasis. Front. Physiol. 1, 1–14.
Sakamoto, T., McCormick, S.D., 2006. Prolactin and growth hormone in fish osmoregulation.
Gen. Comp. Endocrinol. 147, 24–30.
Sakamoto, T., Uchida, K., Yokota, S., 2001. Regulation of the ion-transporting
mitochondrion-rich cell during adaptation of teleost fishes to different salinities.
Zool. Sci. 18, 1163–1174.
Sardella, B.A., Kültz, D., Cech Jr., J.J., Brauner, C.J., 2008. Salinity-dependent changes in
Na+/K+–ATPase content of mitochondria-rich cells contribute to differences in
thermal tolerance of Mozambique tilapia. J. Comp. Physiol. B: Biochem. Syst. Environ.
Physiol. 178, 249–256.
Tang, C.H., Lee, T.H., 2011. Ion-deficient environment induces the expression of basolateral
chloride channel, ClC-3-like protein, in gill mitochondrion-rich cells for chloride
uptake of the tilapia Oreochromis mossambicus. Physiol. Biochem. Zool. 84, 54–67.
Tang, C.H., Tzeng, C.S., Hwang, L.Y., Lee, T.H., 2009. Constant muscle water contents and
renal HSP90 expression reflect the osmotic homeostasis in euryhaline teleosts acclimatized to different environmental salinities. Zool. Stud. 48, 435–441.
Tang, C.H., Wu, W.Y., Tsai, S.C., Yoshinaga, T., Lee, T.H., 2010. Elevated Na+/K+–ATPase
responses and its potential role in triggering ion reabsorption in kidneys for
homeostasis of marine euryhaline milkfish (Chanos chanos) when acclimated to
hypotonic fresh water. J. Comp. Physiol. B: Biochem. Syst. Environ. Physiol. 180,
813–824.
Therien, A.G., Blostein, R., 2000. Mechanisms of sodium pump regulation. Am. J. Physiol.
Cell Physiol. 279, C541–C566.
Tipsmark, C.K., 2008. Identification of FXYD protein genes in a teleost: tissue-specific
expression and response to salinity change. Am. J. Physiol. Regul. Integr. Comp.
Physiol. 294, R1367–R1378.
Tipsmark, C.K., Mahmmoud, Y.A., Borski, R.J., Madsen, S.S., 2010. FXYD-11 associates
with Na+–K+–ATPase in the gill of Atlantic salmon: regulation and localization
in relation to changed ion-regulatory status. Am. J. Physiol. Regul. Integr. Comp.
Physiol. 299, R1212–R1223.
Tipsmark, C.K., Breves, J.P., Seale, A.P., Lerner, D.T., Hirano, T., Grau, E.G., 2011.
Switching of Na+, K+–ATPase isoforms by salinity and prolactin in the gill of a
cichlid fish. J. Endocrinol. 209, 237–244.
Tse, W.K., Au, D.W., Wong, C.K., 2006. Characterization of ion channel and transporter
mRNA expressions in isolated gill chloride and pavement cells of seawater acclimating eels. Biochem. Biophys. Res. Commun. 346, 1181–1190.
Vagin, O., Sachs, G., Tokhtaeva, E., 2007. The roles of the Na, K–ATPase beta 1 subunit in
pump sorting and epithelial integrity. J. Bioenerg. Biomembr. 39, 367–372.
Venturini, G., Cataldi, E., Marino, G., Pucci, P., Garibaldi, L., Bronzi, P., Cataudella, S., 1992.
Serum ions concentration and ATPase activity in gills, kidney and oesophagus of
European sea bass (Dicentrarchus labrax, Pisces, Perciformes) during acclimation trials
to fresh water. Comp. Biochem. Physiol. A Physiol. 103, 451–454.
Wang, P.J., Lin, C.H., Hwang, H.H., Lee, T.H., 2008. Branchial FXYD protein expression in response to salinity change and its interaction with Na+/K+–ATPase of the euryhaline
teleost Tetraodon nigroviridis. J. Exp. Biol. 211, 3750–3758.
Yang, W.K., Hseu, J.R., Tang, C.H., Chung, M.J., Wu, S.M., Lee, T.H., 2009. Na+/K+–ATPase
expression in gills of the euryhaline sailfin molly, Poecilia latipinna, is altered in
response to salinity challenge. J. Exp. Mar. Biol. Ecol. 375, 41–50.
H s FXYD 7
34
Ss FXYD 7 b
98
Ss FXYD 7 a
H s FXYD 2
hs FXYD8
81
H s FXYD 6
22
13
Ss FXYD8
34
Ss FXYD 6
95
20
100
Ss FXYD 12 c
Ss FXYD 12 b
Ss FXYD 1 2a
10
100
20
Ss FXYD 1 1b
s s FXYD 11a
75
D rFXYD 11
93
A jFXYD 11
H s FXYD 5
32
Ss FXYD 9b
100
30
Ss FXYD 9a
14
100
Ss FXYD 5b
Ss FXYD 5a
76
Ss FXYD2
H s FXYD 4
87
H s FXYD 3
24
H s FXYD 1
PmFXYD
0.1
Fig. S1. Phylogenetic analysis of FXYD proteins based on amino acid sequences using the
neighbor-joining method. The tree was generated using FXYD protein sequences from
human [Homo sapiens (Hs)], zebrafish [Danio rerio (Dr)], Atlantic salmon [Salmo salar (Ss)]
and Japanese eel [Anguilla japonica (Aj)]. A sea lamprey [Petromyzon
Marinus (Pm)] member of the gene family was used as the outgroup (accession no.
CO551377). Numbers represent bootstrap values in percentage of 1,000 replicates. The
accession numbers of the sequences used are as follow: HsFXYD1, AAH32800; HsFXYD2,
EAW67326; HsFXYD3, NP_001129483; HsFXYD4, NP_775183; HsFXYD5,
NP_001158077; HsFXYD6, NP_001158303; HsFXYD7, NP_071289; HsFXYD8, P58550;
DrFXYD11, XP_003200301; SsFXYD2, BK006252; SsFXYD5a, BK006253; SsFXYD5b,
BK006254; SsFXYD6, BK006241; SsFXYD7a, BK006245; SsFXYD7b, BK006246;
SsFXYD8, BK006242; SsFXYD9a, BK006243; SsFXYD9b, BK006244; SsFXYD11a,
NP_001117201; SsFXYD11b, NP_001117200; SsFXYD12a, BK006249; SsFXYD12b,
BK006250; SsFXYD12c, BK006251 and AjFXYD11, AFK24487.