Download Owl limpet (Lottia gigantea)

Owl limpet (Lottia gigantea)
¿Tienes alguna duda, sugerencia o corrección acerca de este taxón? Envíanosla y con gusto la
atenderemos.
Foto: (c) icosahedron, todos los derechos reservados
Descripción de EOL Ver en EOL (inglés) →
Introduction 1
Lottia gigantea, the owl limpet, is the largest patellogastropod in North America, capable of reaching
lengths of over 110mm.L. gigantea is commonly found in the middle to high rocky intertidal zone along
the Pacific coast of California and Baja California.L. gigantea adults are easily identified from other
limpet species due to their large size; juveniles (<20mm) can be more difficult to distinguish.
Biology 1
Si z e
L. gigantea individuals are capable of reaching lengths of over 110mm according to historical museum
specimens (Roy et al. 2003; Fenberg 2008). However, individuals of this size are extremely rare today
due to extensive size-selective harvesting.
Growth
Growth rate of L. gigantea is partially dependent on:
Habitat heterogeneity (e.g. rugosity of rocky substrate)
Intraspecific density
Slower growth generally occurs with high habitat heterogeneity and high intraspecific density.
Gen eti cs
Lottia gigantea was recently chosen for whole genome sequencing by the Joint Genome Institute.
Description 2
Often a very large limpet (to 9 or 10 cm long). Apex very near the front margin of the shell (near the first
one-eighth), and decidedly lower than the highest part of the shell, which is posterior to it. The apical
blotch inside this shell appears somewhat like an owl, the muscle scar is often bluish, and the interior
margin of the orifice has a brown band. The exterior of the shell is almost always badly eroded, and is
usually a light brown with whitish spots. Has some radial ribs (often worn), and the margin is alightly
scalloped.
Distribution 3,4
The owl limpet, Lottia gigantea, lives on North America’s Pacific coast, from Baja California, Mexico, to
Washington in the United States. Predation and exploitation have reduced the extent of the species'
northern range, whereas populations in the southern range are relatively stable. The greatest
abundance of this species is found in the middle of its range, offshore of San Diego, California.
Bi ogeograp h i c R egi on s: nearctic (Native ); pacific ocean (Native )
Morphology 3,4
Lottia gigantea gets its name from the brown outline found on the inner surface of its shell which
resembles the silhouette of the tufted Great Horned Owl. Lottia gigantea is North America’s largest
limpet, and adults average 8 to 10 cm in length. As with all prosobranchs, limpets have a mantle, shell,
foot and radula. The mantle secretes a calcium carbonate shell to protect its soft, visceral tissues. The
low, rounded univalve is oval shaped, and its apex is off center and closer to the anterior end. The
rough shell is mottled with light grey and brown colors which camouflage it within its rocky intertidal
habitat. Attached atop the shell, the smaller rough limpet Collisella scabra can often be found, as well
as bluish scars indicating locations of prior hitchhikers.
The muscular foot is its means of locomotion and is light orange in color. The radula is a ribbon of teeth
used to scrape algae off of rocks and other hard substrata. As the anterior teeth are worn down, new
ones are replaced from the posterior end of the radula.
R an ge l en gth : 8 to 10 cm.
Oth er Ph ysi cal Featu res: ectothermic ; heterothermic ; bilateral symmetry
Sexu al Di morp h i sm: sexes alike; female larger
Look alikes 2
How to Di sti n gu i sh from Si mi l ar Sp eci es: This limpet can grow much larger than other species on
our coast. It is the only one (especially the only large one) with the apex so far anterior and lower than
the highest part of the shell.
Habitat 3,4
Lottia gigantea resides in mussel beds and on bare rock in the middle to high rocky intertidal zone. This
narrow, vertical zone is covered by high tide. During the day, a limpet clamps down within its home scar
to prevent desiccation and overheating. Its adhesion is so strong that regardless of its orientation on
the substratum, the limpet is not dislodged by high-energy wave impacts.
R an ge el evati on : 0 to 2 m.
R an ge d ep th : -1 to 0 m.
Hab i tat R egi on s: temperate ; saltwater or marine
Aq u ati c Bi omes: coastal
Oth er Hab i tat Featu res: intertidal or littoral
Trophic strategy 3,4
The female Lottia gigantea is a territorial herbivore that alters its environment by gardening. The limpet
maintains a 1 mm thick algae mat of nearly 1000 square centimeters around its home scar. Garden size
is proportional to shell size. After exposure to approximately 20 minutes of incoming tidal splash, the
limpets begin to graze. While eating, glands on the foot secrete a sticky pedal mucus trail that acts like
fertilizer, trapping bacteria and stimulating algae growth for later consumption. This pedal or
provendering mucus is a nutritional adaptation which also aids in locomotion.
Provendering mucus lasts significantly longer and differs chemically and physically from stationary
mucus. Stationary mucus has a high water content (93.5%) to reduce desiccation while resting on its
home scar between high tides. Provendering mucus contains nourishing proteins and carbohydrates.
Before L. gigantea forages, it encircles its home scar, depositing a lot of provendering mucus which it
retraces on its return trip home.
The female limpet uses its radula to scrape back and forth on rock, removing the surface layer of algae.
Distinctive, parallel scraping marks remain after the day’s feeding. On subsequent days, adjacent areas
within the algae patch are grazed. The female moderately grazes all of its territory in patches over 3-4
days. Careful management promotes long-term benefits, and a competent female can maintain the
same garden for at least 4 years. Removal of a mature female limpet from its home range can have
devastating effects, as trespassing juveniles, non-territorial males, and interspecific species raze the
algal meadow within 2 weeks, leaving nothing to farm. If transplanted to a barren area, Lottia will
generate another 1000 square cm algae garden within approximately 3 weeks.
In contrast, a non-territorial neighboring male does not create a garden; therefore, he has neither
foraging strategy nor resources to protect. Instead, the male is an opportunistic feeder that raids
female gardens, eating indiscriminately and disregarding recent grazing trails. The intrusive male eats
in the garden until detected, then hastily retreats from the alerted female.
An i mal Food s: zooplankton
Pl an t Food s: algae
Oth er Food s: microbes
Pri mary Di et: herbivore (Algivore); planktivore
Associations 3,4
Lottia gigantea are herbivores whose behaviors affect nearby conspecifics as well as other species
within the middle to upper intertidal community. The shells of female owl limpets serve as substrata to
commensal organisms such as small barnacles and limpets including the rough limpet, Lottia digitalis,
and L. pelta. Females are territorial algae gardeners. Preferential removal of a larger female affects the
species composition of the local microhabitat. Smaller limpets consume the unguarded microalgae
while mussels, barnacles, and anemones move in to compete for the newly unoccupied space.
Owl limpets are an important food source for shorebirds such as the American black oystercatcher and
are collected by humans for subsistence and for fishing bait.
Commen sal /Parasi ti c Sp eci es:
Rough limpet, Collisella scabra
Ribbed limpet, Lottia digitalis
Shield limpet, Lottia pelta
Behaviour 3,4
A female Lottia gigantea must come in tactile contact with an intruder before the trespasser is
perceived. Approximately 70% of the time, trespassers are detected. Scientists do not know how the
mucus trails of a female acts as a territory marker; however, female L. gigantea avoid mucus of
conspecific females, indicating chemoreception/chemical sensory ability.
Lottia gigantea can distinguish between grazers, predators, and benign foreign objects. In experiments,
objects such as a human finger, pencil erasers, and steel pegs elicited no response and were likely
perceived by the limpets as obstructions.
Commu n i cati on Ch an n el s: tactile ; chemical
Percep ti on Ch an n el s: tactile ; chemical
Life cycle 3,4
During high tide in January or February, Lottia gigantea annually broadcast spawn directly into the
water. Large amounts of gametes are released from the intertidal zone and swept out by the tide into
the open ocean where they unite with gametes from conspecifics in the process of external fertilization.
The developing larvae are part of the zooplankton which feed on phytoplankton. Scientists have not
determined the length of time required to develop from gametes into veliger larvae, a ciliated freeswimming stage, because the microscopic larvae are indistinguishable from those of other limpets. In
similar Lottia species, Lottia digitalis and Lottia asmi, each take five days to reach metamorphic
competence, transforming to the settlement stage.
Tides, longshore, and Davidson currents return mollusk larvae to shore where they adhere to mussel
shells or hard substrate cracks and crevices within the mussel bed community. Due to the long
stretches of unsuitable sandy beach habitat along the California coast, Lottia gigantea larvae can settle
only within the rocky intertidal coastline where they can continue to grow. Owl limpets are
indistinguishable from other limpets when shell length is less than 15 mm. Between two to three years
old, males transition into females.
Growth rate is slower and highly varied in mussel bed communities. On bare rock, the majority of
growth takes place in spring and summer, and minimal growth occurs in autumn and winter when
limpets allocate resources to gamete development.
Devel op men t - Li fe Cycl e: metamorphosis ; indeterminate growth
Life expectancy 3,4
Based on 100 years of museum collection data, Lottia gigantea are long-lived to 20 years of age.
R an ge l i fesp an
Statu s: wi l d : 20 (high) years.
R an ge l i fesp an
Statu s: cap ti vi ty : N/A (low) hours.
Typ i cal l i fesp an
Statu s: wi l d : N/A (low) hours.
Typ i cal l i fesp an
Statu s: cap ti vi ty : N/A (low) hours.
Reproduction 3,4
During high tides in January or February, owl limpets annually broadcast spawn.
Lottia gigantea is a protandric sequential hermaphrodite, in that an individual begins life as male. A
subordinate male grows well into adulthood within an area of densely aggregated conspecifics, but
after an adult male acquires personal territory, his behavior changes to that of a solitary, dominant,
territorial limpet, thus triggering sex change from male to female.
Adult males are physically smaller and substantially outnumber the larger, solitary females, yet males
produce far less gonadal mass. Less available male gonadal production leads to lower reproduction
within the population. Of potentially greater reproductive stress is human predation.
Humans collect larger individuals for the shell, the muscular foot, and for fish bait. Size-selective
harvesting targets sexually mature females, reducing their overall body size and lowering the
population's reproductive potential. In addition, human selection has driven the evolution of different
life history characteristics in this species. Owl limpets in harvested areas change sex at a smaller size,
and grow more slowly than L. gigantea in Marine Protected Areas where sex change occurs in larger,
faster growing individuals.
Breed i n g i n terval : Owl limpets annually broadcast spawn during January or February winter high
tides
Breed i n g season : January or February
Average age at sexu al or rep rod u cti ve matu ri ty (femal e): 3 years.
R an ge age at sexu al or rep rod u cti ve matu ri ty (mal e): 2 to 3 years.
K ey R ep rod u cti ve Featu res: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious
(sexes separate); sequential hermaphrodite (Protandrous ); fertilization (External ); broadcast (group)
spawning
There is no parental involvement after releasing gametes.
Paren tal In vestmen t: no parental involvement
Shell proteins 5
There are shell matrix proteins (SMPs) that are present in all mollusks. These proteins are an
assemblage of biomolecules that are known to increase the fracture resistance of the shell by severla
orders of magnitude, determine the polymorph of calcium carbonate deposited, and regulate crystal
nucleation, growth initiation and termination (Marine et. al 2013). By studying these proteins in Lottia
gigantea, scientists are able to understand how these proteins evolved and contributed to the overall
diversity and expansion of metazoa life during the Cambrian Period 543 million years ago. From the
calcium carbonate shell in Lottia gigantea, 39 SMPs were discovered through proteomic analysis and
genomic transcriptomic database interrogations. These SMPs suggest that they lie in the shell matrix,
showing highly conserved and linage-specific bioremineralizing proteins (Marie et. al 2013). From this, it
was concluded that there may be an ancestral molluscan SMP that contributes to the diversity of shell
microstructures found in mollusks in present day.
Lottia gigantea can be genotyped for 6 microsatellite markers from populations across California to
explore the genetic structure and diversity of the species and an overall understanding of its exploited
populations (Fenberg et. al 2010). By genotyping this species, it was found that there is no significant
genetic structure or diversity in this California species. However, phenotypic plasticity explains the
reason why there is high gene flow among populations and the differences in their life history,
demography and body size between protected and exploited populations (Fenberg er. al 2010). Even
though phenotypic plasticity effects are difficult to understand, exploited populations can begin to
recover if the proper actions are taken to reduce or eliminate harvesting of L. gigantea. In order to
reduce harvesting, effective management needs to take into account the genetic data,the history,
ecology, biogeography and life history parameters (Fenburg et. al 2010). Therefore, management must
take place to restore exploited populations to further understand whether size-selective harvesting has
had a long-term impact on the biology of this species.
Barcode data: lottia gigantea 6
The following is a representative barcode sequence, the centroid of all available sequences for this
species.
There are 10 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member
of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other
sequences.
ACAATATATTTAATGTTAGGGTTTTGAGGCGGAATTGCCGGGACCACTTTGAGACTTTTAATTCGAGTTCATTTAATACACTCT
-GGTACGCTGTATAACGCAGTTGTTACGGCCCATGCTTTTTTAATAATTTTCTTTATGGTAATGCCGGTCTTAATTGGAGGGTTC
-- end -Download FASTA File
Conservation status 3,4
Marine Protected Areas, or MPAs, offer incidental poaching protection so males and females can grow
larger and more slowly at a more natural rate. In 1999, commercial fishing of Lottia gigantea was
prohibited in California; however, recreational harvesting is permitted with a daily limit of 35
individuals per person. The resilient intertidal limpet population is a human-stressed species. Shifting
baselines of reduced shell length and decreasing population size show the need for effective
monitoring, enforcement, and habitat management; these can be accomplished not only by extending
MPAs in California for intertidal organisms such as L. gigantea, but also for countless marine species
worldwide.
US Fed eral Li st: no special status
CITES: no special status
State of M i ch i gan Li st: no special status
Uses 3,4
There are no known adverse effects of Lottia gigantea on humans.
References
1. © Natural History Museum, London, some rights reserved
2. © Rosario Beach Marine Laboratory, some rights reserved
3. Turner, O. and S. Turner 2013. "Lottia gigantea" (On-line), Animal Diversity Web. Accessed April 27,
2013 at http://animaldiversity.ummz.umich.edu/site/accounts/information/Lottia_gigantea.html
4. © The Regents of the University of Michigan and its licensors, some rights reserved
5. © cpayan, some rights reserved
6. © Barcode of Life Data Systems, some rights reserved