Download Comparative reactions of recombinant papaya ringspot viruses with

Journal
of General Virology (2001), 82, 2827–2836. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Comparative reactions of recombinant papaya ringspot viruses
with chimeric coat protein (CP) genes and wild-type viruses on
CP-transgenic papaya
Chu-Hui Chiang,1 Ju-Jung Wang,1 Fuh-Jyh Jan,1 Shyi-Dong Yeh2 and Dennis Gonsalves1
1
2
Department of Plant Pathology, Cornell University NYSAES, Geneva, NY 14456, USA
Department of Plant Pathology, National Chung Hsing University, Taichung 402, Taiwan, ROC
Transgenic papaya cultivars SunUp and Rainbow express the coat protein (CP) gene of the mild
mutant of papaya ringspot virus (PRSV) HA. Both cultivars are resistant to PRSV HA and other
Hawaii isolates through homology-dependent resistance via post-transcriptional gene silencing.
However, Rainbow, which is hemizygous for the CP gene, is susceptible to PRSV isolates from
outside Hawaii, while the CP-homozygous SunUp is resistant to most isolates but susceptible to the
YK isolate from Taiwan. To investigate the role of CP sequence similarity in overcoming the
resistance of Rainbow, PRSV HA recombinants with various CP segments of the YK isolate were
constructed and evaluated on Rainbow, SunUp and non-transgenic papaya. Non-transgenic
papaya were severely infected by all recombinants, but Rainbow plants developed a variety of
symptoms. On Rainbow, a recombinant with the entire CP gene of YK caused severe symptoms,
while recombinants with only partial YK CP sequences produced a range of milder symptoms.
Interestingly, a recombinant with a YK segment from the 5h region of the CP gene caused very mild,
transient symptoms, whereas recombinants with YK segments from the middle and 3h parts of the
CP gene caused prominent and lasting symptoms. SunUp was resistant to all but two recombinants,
which contained the entire CP gene or the central and 3h-end regions of the CP gene and the 3h
non-coding region of YK, and the resulting symptoms were mild. It is concluded that the position
of the heterologous sequences in the recombinants influences their pathogenicity on Rainbow.
Introduction
Pathogen-derived resistance can be mediated by either
protein or RNA (Baulcombe, 1996 ; Beachy, 1993, and
accompanying articles ; Dougherty & Parks, 1995 ; Lomonossoff, 1995 ; Sanford & Johnston, 1985). Lindbo et al. (1993)
were the first to show that the resistance of transgenic
plants expressing various forms of the coat protein (CP) of a
potyvirus is RNA-mediated. They provided evidence that
RNA-mediated protection was sequence-specific and thus
effective only when the transgene has high similarity to the
attacking virus. Numerous other laboratories have confirmed
and extended these observations to viruses in other genera
(English et al., 1996 ; Pang et al., 1996, 2000 ; Prins & Goldbach,
1996). The underlying mechanism of RNA-mediated virus
resistance, also referred to as homology-dependent resistance,
is post-transcriptional gene silencing (PTGS) (Baulcombe,
Author for correspondence : Dennis Gonsalves.
Fax j1 315 787 2389. e-mail dg12!nysaes.cornell.edu
0001-7560 # 2001 SGM
1999 a, b ; English et al., 1997 ; Meins, 2000 ; Wassenegger &
Pelissier, 1998).
Various models have been proposed to explain the
mechanisms that trigger PTGS and produce virus resistance in
transgenic plants that express a transgene that is homologous
to the attacking virus. These include an RNA threshold model
(Dougherty & Parks, 1995 ; Smith et al., 1994), an ectopic
pairing and aberrant RNA model (Baulcombe, 1996 ;
Baulcombe & English, 1996 ; English et al., 1996) and a dsRNAinduced PTGS model (Metzlaff et al., 1997 ; Montgomery &
Fire, 1998 ; Waterhouse et al., 1998). However, all of these
models propose a common sequence-specific RNA-degradation process. Briefly, RNA-dependent RNA polymerase
synthesizes short antisense RNA from the transgene mRNA
and the antisense RNA binds to the complementary regions of
the mRNA in the cytoplasm to form RNA duplexes, which are
then degraded by dsRNA-specific nucleases (Dalmay et al.,
2000 a, b ; Mourrain et al., 2000). Viral RNA in the cytoplasm
is also a target for degradation. Indeed, several recent papers
report the identification of small RNA molecules, 21–25 nt in
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 06:40:34
CICH
C.-H. Chiang and others
length, that correspond to sense and antisense pieces of the
dsRNA or transgene that is introduced into the cytoplasm
(Bass, 2000 ; Dalmay et al., 2000 a, b ; Hamilton & Baulcombe,
1999).
Papaya ringspot virus (PRSV), from the genus Potyvirus, is
the major limiting factor for economic papaya production
throughout the tropics and subtropics, including the state of
Hawaii (Gonsalves, 1998). Two transgenic cultivars, Rainbow
and SunUp, that are resistant to PRSV in Hawaii were recently
commercialized (Gonsalves, 1998 ; Manshardt, 1999). SunUp
was derived from transgenic papaya line 55-1 (Fitch et al.,
1992) and is homozygous for a single insert of the CP gene of
PRSV HA 5-1 (Tennant et al., 2001), a mild mutant of PRSV
HA (Yeh & Gonsalves, 1984). Rainbow is a hybrid of SunUp
and the non-transgenic cultivar ‘ Kapoho ’. It is therefore
hemizygous for the CP gene (Manshardt, 1999). Tennant et al.
(1994, 2001) reported that Rainbow and hemizygous plants of
line 55-1 are resistant to PRSV isolates from Hawaii that share
at least 97 % nt identity to the CP transgene but are susceptible
to isolates from outside Hawaii that have 89–94 % identity to
the transgene. In contrast, SunUp is resistant to a number of
isolates from outside Hawaii.
We recently developed infectious transcripts of PRSV HA
(Chiang & Yeh, 1997), which provide us with a unique
opportunity to produce PRSV HA chimeras that are different
from PRSV HA in their CP sequences. Such chimeras can be
used to determine the relative importance of CP sequence
similarity in breaking the resistance of Rainbow. We constructed a series of such CP recombinants by using whole or
partial CP sequences of PRSV YK, a PRSV isolate with 90 % nt
identity to PRSV HA in the CP sequence (Wang & Yeh, 1997).
Recombinant viruses were able to overcome the resistance of
Rainbow but the symptoms varied from very mild to severe,
depending on the region of the CP gene that was substituted.
Methods
Virus isolates. Two PRSV isolates were used in this study. PRSV
HA is a severe strain originally from Hawaii (Gonsalves & Ishii, 1980) and
PRSV YK is the most common strain in Taiwan (Wang & Yeh, 1997). The
complete nucleotide sequences of HA and YK have been determined
(Wang & Yeh, 1997 ; Yeh et al., 1992). Both genomes are 10326 nt in
length, excluding the poly(A) tail.
Transgenic papaya lines. The commercial transgenic papaya
SunUp and Rainbow used in this work were originally derived from
transgenic line 55-1 (Manshardt, 1999). Line 55-1 was developed by
transforming the Hawaiian papaya cultivar ‘ Sunset ’ with the CP gene of
PRSV HA 5-1 (Fitch et al., 1992), which is a nitrous acid-induced mutant
from the parent strain PRSV HA (Yeh & Gonsalves, 1984). Comparison
of the 3h-terminal 2235 nt of HA with its mild mutant HA 5-1 showed
99n4 % identity (Wang & Yeh, 1992). Their CP gene sequences differ by
2 nt but their 3h non-coding region (NCR) sequences are identical. The
CP-homozygous SunUp was from the R3 generation and was obtained
by crossing R0 transgenic line 55-1 with hermaphroditic ‘ Sunset ’ and
then self-crossing of progenies (Manshardt, 1999). Rainbow is an F1
derived from a cross of SunUp and non-transgenic cultivar ‘ Kapoho ’.
Rainbow and SunUp express the transgene from sequence positions 9257
CICI
to 10168 of PRSV HA 5-1, which corresponds to the entire CP gene
(Quemada et al., 1990) and 51 nt of the 3h NCR (Fig. 1 B). Additionally,
the 5h end of PRSV CP contains an extra 48 nt that encode 16 amino acids
of cucumber mosaic virus (CMV) CP, and an extra 22 nt of the CMV 3h
NCR is fused to the end of the PRSV 3h NCR (Ling et al., 1991).
Generation of recombinant viruses between HA and YK. A
full-length infectious cDNA clone of PRSV HA, designated pT3-HAG
(Chiang & Yeh, 1997), was used to construct different recombinants
between PRSV HA and PRSV YK at the 3h region of the genome.
Clone p3hYKCP, which contains the 1n2 kb 3h region of PRSV YK,
was constructed by using RT–PCR with an upstream primer, 5h
GGCAGGGCCCCATATGTGTCTG 3h, that contains a created ApaI
site (underlined) between positions 9053 and 9074 of YK and with an
oligo(dT) oligonucleotide that has a 5h-terminal NotI site as a downstream
primer. A full-length hybrid virus, designated pHA-3hYK, was obtained
by replacing the ApaI–NotI fragment of pT3-HAG with the corresponding region of p3hYKCP (Fig. 1 A, B). Thus, clone HA-3hYK (Fig.
1 B) contains the entire sequence of PRSV HA except that the 3h-proximal
1n2 kb, consisting of 200 nt of the nuclear inclusion b (NIb) gene, the
complete CP gene (861 nt) and 209 nt of the 3h NCR, is from PRSV YK.
We constructed six other recombinant clones that contained YK
sequences in the 5h region, the central region or the 3h region of the CP
gene (Fig. 1 B). These six full-length chimeric CP constructs were
obtained by replacing cDNA fragments with the common restriction
enzyme sites (ApaI, SwaI, EcoRI and NotI) between pT3-HAG and pHA3hYK (Fig. 1 B). Clones YK-AS, YK-SE, YK-EN, YK-AE and YK-SN were
constructed by exchanging the ApaI–SwaI, SwaI–EcoRI, EcoRI–NotI,
ApaI–EcoRI and SwaI–NotI restriction fragments of pT3-HAG with those
from pHA-3hYK. YK-AS\EN was obtained by replacing the SwaI–EcoRI
fragment of pHA-3hYK with the corresponding fragment from pT3HAG. The sequences of the recombinants were verified by digestion with
enzymes NdeI, SpeI and SacII to identify replacement regions between HA
and YK and by sequencing to confirm the replacement.
Inoculation of papaya. RNA transcripts were synthesized in vitro
by T3 RNA polymerase from NotI-linearized plasmids as described by
Chiang & Yeh (1997). Capped RNA transcripts were then applied
mechanically onto non-transgenic plants of papaya (Carica papaya) with
three true leaves. Initially, inocula (1 g leaves in 15 ml buffer) were from
papaya infected with the in vitro transcript. Subsequently, non-transgenic
papaya and another systemic host, Cucumis metuliferus (Naud.), were also
inoculated and used as the source of recombinant virus for subsequent
tests. However, only tissues from up to three inoculation transfers were
used as inocula. After that, inocula were again obtained from the original
papaya that was infected by the in vitro transcripts. Papaya plants were
inoculated at a young stage, with 5–6 true leaves, or at an older stage,
with 10–12 true leaves. All inoculated plants were kept in a greenhouse
at 21–24 mC and observed for symptoms for 90 days.
Virus detection. Total RNA was extracted from papaya leaves as
described by Levy et al. (1994). The 3h region of the viral genome was
amplified by RT–PCR with upstream and downstream primers respectively corresponding to PRSV HA positions 8868–8897 and
10083–10117. The RT–PCR-generated DNA fragments were sequenced
with an ABI 373 automated sequencer (DNA Sequencing Services,
Cornell University, Ithaca, NY, USA).
Northern blot analysis was used to estimate viral RNA accumulation.
Ten µg total RNA, extracted 45 days post-inoculation (p.i.) from
transgenic Rainbow and non-transgenic papaya, was electrophoresed in
a denaturing formaldehyde–1n2 % agarose gel and blotted onto a Gene
Screen Plus nylon membrane as described by the manufacturer’s manual
(DuPont). A $#P-labelled, random-primed, ApaI\NotI-digested, 1n2 kb
DNA fragment from pT3-HAG, which contained 200 bp of NIb, the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 06:40:34
PRSV recombinants and transgenic papaya
Symptom
type
45 days p.i.
90 days p.i.
Sev
Sev
III
NS
I
I
I
I
II
I/Rec
I
I
II
I/II/Rec
Fig. 1. Schematic strategy for the construction of various PRSV HA recombinants with CP gene segments from PRSV YK and a
summary of their reactions on transgenic Rainbow papaya. (A) Genetic map of PRSV. ApaI–NotI indicates the region used for
replacing the sequence between HA and YK. (B) HA and YK represent the 3h regions of HA and YK. The restriction enzymes
chosen for the replacements (ApaI, SwaI, EcoRI and NotI) are indicated. The numbers between the arrows indicate the
distances in nucleotides. Numbers in parenthesis indicate the numbers of nucleotides that were mismatched with the
corresponding segment of the transgene. Open rectangles indicate HA sequences and shaded rectangles represent YK
sequences. All constructs are aligned to the same scale. Symptom types are those of Rainbow plants that were inoculated at a
young (5–6 leaves) stage : Sev, severe ; NS, no symptoms ; Rec, recovery ; I, prominent vein clearing ; II, many vein flecks ;
III, very few vein flecks. See Fig. 3 for pictures of symptoms.
complete CP gene (861 nt), 209 bp of the NCR and a 36 residue poly(A)
sequence from pT3-HAG, was used as a probe. Bark extracts from stems
of plants that did not have symptoms on leaves but had water-soak
lesions on the stems 4 months after inoculation were assayed by doubleantibody sandwich ELISA (Clark & Adams, 1977) with antiserum to
intact PRSV HA virus (Ling et al., 1991).
Results
Construction and biological activity of recombinant
viruses on non-transgenic plants
PRSV HA was used as the backbone for creating recombinant viruses with PRSV YK sequences because the former
causes severe symptoms on non-transgenic papaya and is
nearly homologous to PRSV HA 5-1, a mild, nitrous acidinduced mutant of HA. HA 5-1 has only two nucleotide
differences from PRSV HA in the CP and none in the 3h NCR
(Wang & Yeh, 1992 ; Fig. 1). SunUp and Rainbow express the
CP gene of PRSV HA 5-1, and initial work showed that these
plants are susceptible to YK.
Seven full-length PRSV HA recombinant constructs were
generated by replacing segments of the HA genome with
corresponding segments from YK (Fig. 1). Since a suitable
restriction enzyme site at the 5h end of the CP gene in PRSV
HA was not available, an ApaI site in the NIb gene 200 bp
upstream from the CP gene was chosen to perform the DNA
replacements between HA and YK. Consequently, recombinant viruses HA-3hYK, YK-AS, YK-AE and YK-AS\EN also
contained 200 bp of NIb from YK. A NotI site was created
downstream of the poly(A) tail to make constructs HA-3hYK,
YK-EN, YK-SN and YK-AS\EN. The NotI restriction site was
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 06:40:34
CICJ
C.-H. Chiang and others
(A)
Absorbance
(C)
4·0
3·5
3·0
2·5
2·0
1·5
1·0
0·5
0·0
YK
YK-AE
YK-AS/EN
HA
H
8
(B)
Top expanded leaf at 12 days p.i.
Absorbance
Absorbance
Top expanded leaf at 8 days p.i.
4·0
3·5
3·0
2·5
2·0
1·5
1·0
0·5
0·0
10
12
14
16
18
20
Time (days after inoculation)
4·0
3·5
3·0
2·5
2·0
1·5
1·0
0·5
0·0
12
14
16
18
20
Time (days after inoculation)
Top expanded leaf at 14 days p.i.
14
16
18
20
Time (days after inoculation)
Fig. 2. ELISA detection of PRSV HA (>) and YK (
) and recombinants YK-AS/EN (i) and YK-AE (4) in leaves of infected
non-transgenic papaya. Samples were collected at periodic intervals from the same three leaves of test plants and tested by
ELISA. Sampled leaves were positioned as the top expanded leaf at 8 (A), 12 (B), and 14 (C) days p.i. The results are the
mean ELISA readings of four or five plants from two experiments. $, Healthy non-transgenic papaya. The readings were taken
after 1 h of substrate hydrolysis.
also used to linearize the plasmids prior to in vitro transcription
(Chiang & Yeh, 1997). Thus, recombinants HA-3hYK, YK-EN,
YK-SN and YK-AS\EN contained an extra 158 nt of the 3h
NCR sequence from YK compared with the transgene (Fig. 1).
Comparisons of the YK segments of the recombinant
viruses to corresponding regions of the transgene are shown in
Fig. 1. The replacement segments of recombinant clone HA3hYK showed 76 nt differences out of 861 in the PRSV HA 51 CP sequence and 8 nt differences out of 51 in the 3h NCR
region. The YK replacement segment of the recombinant YKAS had the lowest nucleotide sequence identity to the CP
transgene (87n5 % ; 33 of 263 nt different) ; this region corresponded to the variable N terminus and part of the core region
of the CP (Shukla et al., 1988). The YK segment of recombinant
YK-SE had an identity of 92n3 % (32 of 415 nt different) ; the
YK segment originated from the core region of the CP (Shukla
et al., 1988). The recombinant YK-EN contained a YK segment
that corresponded to the conserved C-terminal and core
regions of the CP (94n0 % identity ; 11 of 183 nt different) and
the first 51 nt of the 3h NCR (84n3 % identity ; 8 of 51 nt
different). Recombinants YK-AE, YK-SN and YK-AS\EN
contained combinations of two YK segment replacements, as
shown in Fig. 1 (B).
The biological activity of the recombinants was tested on
non-transgenic papaya. Papaya mechanically inoculated with
in vitro transcripts corresponding to the recombinants showed
symptoms similar to those induced by PRSV HA. Symptoms
developed 8–11 days p.i. and consisted of severe mosaic, leaf
distortion and stunting of the plants. RT–PCR and sequencing
from the inoculated non-transgenic plants verified that the
infection was from the proper recombinant viruses (data not
shown). Furthermore, these recombinants appeared stable in
CIDA
that they induced similar symptoms in non-transgenic papaya
following serial passages for over a year.
The relative titres of several recombinants (HA-3hYK, HAAE and HA-AS\EN) in non-transgenic papaya were also
compared with those of HA and YK. Two or three selected
non-inoculated leaves (top expanded leaf at 8, 12 and 14 or 16
days p.i.) were monitored for virus by ELISA at about 2 day
intervals up to 20 days p.i. Additionally, comparisons of local
lesion production on Chenopodium quinoa were done with HA3hYK, HA and YK. ELISA readings of HA-AE and HA-AS\EN
were similar to HA and YK over time (Fig. 2 A–C). Virus was
first detected by ELISA in the top expanded leaf (Fig. 2 A) at
12–14 days p.i. and detection by ELISA coincided with the
appearance of symptoms on the sampled leaves. The virus titre
was maximal in all leaves starting 16–18 days p.i. The
recombinant HA-3hYK also showed virus titres similar to those
of HA and YK (data not shown). Furthermore, leaf extracts of
papaya sampled 15 days after inoculation with HA, YK or HA3hYK induced similar numbers of local lesions (Table 1). In
similar tests, ELISA analysis of Cucumis metuliferus inoculated
with the isolates showed that these plants also developed
similar titres (data not shown). Taken together, these results
show that the recombinants HA-3hYK, HA-AE and HAAS\EN replicate and move in a similar way to HA and YK in
non-transgenic papaya and Cucumis metuliferus.
Comparative reactions of SunUp and Rainbow to PRSV
HA and YK
Plants of homozygous SunUp and hemizygous Rainbow,
which express the CP gene of PRSV HA 5-1, were resistant to
PRSV HA when inoculated at the 5–6 (young) or 10–12 (older)
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 06:40:34
PRSV recombinants and transgenic papaya
Table 1. Infectivity of tissue extracts from non-transgenic
papaya inoculated with PRSV HA, YK or HA-3hYK
Non-transgenic papaya plants at the 5–6 leaf stage were inoculated on
the lowest two leaves. Leaf extracts (1 : 20 dilution) from inoculated
papaya were taken 15 days after inoculation and applied to leaves of
Chenopodium quinoa. The position of each leaf was designated at the
time of inoculation. Numbers of local lesions are means from four
inoculated Chenopodium quinoa leaves. Differences in numbers of local
lesions were not significant (α l 0n05). Analyses were done with the
SAS general linear models and Tukey’s studentized range test.
Local lesions produced by PRSV
Virus
HA
HA-3hYK
YK
Leaf 2 from top
Leaf 3 from top
135
126
84
102
91
67
true-leaf stages (Table 2 ; Fig. 3 A). In contrast, transgenic
plants challenged with PRSV YK at either young or older
developmental stages showed severe mosaic symptoms (Table
2 ; Fig. 3 B), although symptom expression was delayed
compared with non-transgenic plants. Rainbow showed 2–3
day and 4–6 day symptom delays, respectively, at the young
and older stages, while SunUp showed 3–5 day and 10–18 day
delays, respectively, when challenged at the young and older
stages.
Recombinant viruses induce differential symptoms on
Rainbow
Transgenic plants were challenged with PRSV HA-3hYK,
which contained the whole viral genome from HA except that
the CP gene, 200 nt of NIb and 209 nt of the NCR were from
YK. All of the inoculated Rainbow plants became infected and
developed severe symptoms when they were challenged at the
young stage (Table 2 ; Fig. 3 C), whereas only 27 % (12\44) of
the SunUp plants became infected, and these plants showed
mild symptoms consisting of vein flecks (Table 2). Symptom
development was delayed by 4–6 days in Rainbow and 14–20
days in SunUp compared with non-transgenic plants. When
transgenic plants were challenged at an older stage, 72 %
(13\18) of Rainbow plants became infected, showing milder
symptoms with some yellow spots on the leaves and less leaf
distortion, and symptoms were delayed by 11–22 days. None
of the transgenic SunUp plants inoculated at the older stage
developed symptoms.
All six recombinant viruses with various segments of YK
CP (Fig. 1) induced severe symptoms on Cucumis metuliferus
and non-transgenic papaya (Table 3), but variable reactions
appeared on Rainbow and SunUp plants. None of the
recombinants with only partial CP sequences of YK were able
to infect SunUp with the exception of recombinant YK-SN,
which infected only 16 % of the inoculated plants and caused
very mild symptoms, consisting of a few small yellow spots
(Table 3). However, Rainbow plants that were challenged with
these recombinant viruses developed a range of symptoms,
which were milder than those caused by HA-3hYK (Fig. 3 D–F ;
Table 3). The symptoms were grouped into three types. Type
I symptoms (Fig. 3 D) were characterized by extensive vein
clearing on leaves early in the test (45 days p.i.) and leaf
distortion at a later stage (90 days p.i.). Type II symptoms (Fig.
3 E) were less severe than type I and consisted of many vein
flecks in newly developed leaves (45 days p.i.), with variable
symptom expression later on (90 days p.i.). Type III symptoms
(Fig. 3 F) consisted of a few vein flecks at 45 days p.i., and the
new leaves were symptomless at 90 days p.i.
Table 2. Response of papaya plants inoculated with PRSV isolates HA and YK and hybrid
virus HA-3hYK
Symptoms at 45 days p.i. are scored as : NS, no symptoms ; Sev, severe symptoms ; M, mild symptoms. The
frequency gives the number of plants with symptoms\number of plants tested.
Rainbow
Virus
HA
YK
HA-3hYK
SunUp
Non-transgenic
Papaya growth stage*
Frequency
Type
Frequency
Type
Frequency
Type
Young
Old
Young
Old
Young
Old
0\15
0\7
34\34
7\7
47\47
13\18
NS
NS
Sev
Sev
Sev
M‡
0\14
0\5
34\34
5\5
12\44
0\18
NS
NS
Sev
Sev
M†
NS
8\8
5\5
13\13
6\6
19\19
15\15
Sev
Sev
Sev
Sev
Sev
Sev
* Papaya plants were inoculated at the 5–6 true leaf stage (young) or the 10–12 true leaf stage (old).
† Mild symptoms with vein flecks.
‡ Mild symptoms with few yellow spots.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 06:40:34
CIDB
C.-H. Chiang and others
Fig. 3. Symptoms of transgenic Rainbow plants inoculated with different viruses. (A) NS : No symptoms, inoculation with HA.
(B) Sev : Severe symptoms caused by YK. (C) Sev : Severe symptoms, similar to (B), caused by HA-3hYK. (D) Type I : vein
clearing, typically caused by YK-SE, -EN and -SN. (E) Type II : many vein flecks, caused by YK-AE and YK-AS/EN. (F) Type III :
few vein flecks, caused by YK-AS. Plants were inoculated at a young (5–6 leaves) stage. Symptoms were recorded at 45 days
p.i.
Table 3. Inoculation of Rainbow and SunUp plants with PRSV HA recombinants containing segments of the CP gene of
PRSV YK
Inocula were from papaya plants originally infected with in vitro-capped RNA transcripts or subsequently from serially infected plants. Plants were
inoculated at the young (5–6 true leaf) stage. SE, Symptom expression. Symptoms were observed at 45 days p.i. and are scored as : NS, no
symptoms ; Sev, severe symptoms ; I, prominent vein clearing ; II, many vein flecks ; III, very few vein flecks ; M, mild symptoms with few yellow
spots. Numbers of plants with symptoms\numbers of plants tested are also given.
Transgenic
Virus
YK-AS
YK-SE
YK-EN
YK-AE
YK-SN
YK-AS\EN
Corresponding
transgene segment (bp)
Rainbow
SE
SunUp
SE
Sunrise
SE
463
415
392
878
807
855
263
415
234
678
649
497
14\20
19\20
20\21
14\20
15\20
9\21
III
I
I
II
I
II
0\18
0\18
0\18
0\18
3\19
0\19
NS
NS
NS
NS
M
NS
7\7
7\7
7\7
7\7
7\7
7\7
Sev
Sev
Sev
Sev
Sev
Sev
Recombinant viruses YK-SE, YK-EN and YK-SN caused
type I symptoms in 75–95 % of the inoculated Rainbow plants.
These recombinants contained the YK fragments at the central
and\or the 3h end of CP and 3h NCR. Transgenic Rainbow
plants inoculated with recombinant virus YK-AS, on the other
CIDC
Non-transgenic
Replaced segment
from YK to HA (bp)
hand, showed type III symptoms. It will be recalled that
recombinant YK-AS contained the full length of the HA
sequence except that the 3h end of NIb (200 nt) and the 5h end
of CP (263 nt) were from YK (Fig. 1). The recombinant viruses
YK-AE and YK-AS\EN respectively caused type II symptoms
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 06:40:34
PRSV recombinants and transgenic papaya
Fig. 4. Analysis of viral RNA accumulation in the fourth (from top) leaf
from transgenic Rainbow (RB) and non-transgenic Sunrise (SR) plants.
Papaya plants were inoculated with HA, a Hawaii PRSV strain ; YK, a
Taiwan PRSV strain, or the various recombinant viruses. The sample
labelled YK-AS1 was taken from the fourth (from top) leaf with very few
flecks. Sample YK-AS2 was taken from the second (from top) leaf without
symptoms. Fifty ng of in vitro transcripts from pT3-HAG was used as a
positive control. Mock, Inoculated with buffer. (A) Northern blot analysis of
total plant RNA hybridized with a 32P-labelled, 1n2 kb DNA specific for
the 3h end of PRSV HA, including 200 nt of NIb, the complete CP and 3h
NCR. The positions of markers (in kb) are shown on the left. (B) Ethidium
bromide-stained gel.
on 70 and 43 % of inoculated Rainbow plants. These recombinants had YK sequences for the first two-thirds of the CP
region and for the first and third parts of the CP region,
respectively (Fig. 1). Furthermore, plants infected with these
recombinants showed variable symptoms at 90 days p.i. For
example, 14 of 20 transgenic Rainbow plants challenged with
YK-AE showed type II symptoms at 45 days p.i. and 2 of 14
developed type I symptoms at 90 days p.i., while the other 12
plants showed recovery, with no symptoms or type III
symptoms on young leaves. Similarly, when YK-AS\EN was
inoculated to Rainbow, 9 of 21 inoculated plants showed type
II symptoms at 45 days p.i. However, at the later development
stage (90 days p.i.), three of these nine Rainbow plants
developed type I symptoms, five showed recovery and the
other plant remained with type II symptoms.
Northern blot analysis of total RNA from Rainbow plants
infected with different recombinants revealed that symptom
severity was correlated with viral RNA accumulation (Fig. 4).
Rainbow plants infected with YK-SE, YK-EN or YK-SN, which
caused type I symptoms, and YK-AE or YK-AS\EN, which
caused type II symptoms, had relatively high levels of RNA
accumulation (Fig. 4). In contrast, very little or no viral RNA
was detected in Rainbow plants infected with YK-AS (type III
symptoms). As expected, a large amount of viral RNA was
detected in non-transgenic plants infected by PRSV HA, while
no viral RNA was detected in Rainbow plants inoculated with
HA. The weaker signals in the YK- and HA-3hYK-infected
plants (Fig. 4) were probably due to the relatively low
similarity of the probe to the YK segment (described in
Methods). The probe was derived from PRSV HA, which has
88n8 % sequence identity to YK in the corresponding region
(Wang & Yeh, 1997).
Since recombinant YK-AS induced very mild type III
symptoms in 70 % (14\20) of inoculated Rainbow plants, we
wanted to determine whether higher doses of YK-AS would
infect a higher percentage of Rainbow plants and cause more
severe symptoms. Crude leaf saps from YK-AS-infected
Cucumis metuliferus plants diluted 1 : 5 and 1 : 10 were applied
onto papaya with 5–6 true leaves. Although 85 % (6\7) and
50 % (3\6) of the Rainbow plants inoculated with the 1 : 5 and
1 : 10 dilutions became infected, only type III symptoms were
observed.
Some Rainbow plants that initially showed type II
symptoms recovered at a later stage, with leaves being
symptomless, although the stems still showed water-soak
lesions. Virus was apparently still present in the stem tissue,
since ELISA analysis of six recovered Rainbow plants gave 2to 5-fold higher readings than mock-inoculated Rainbow
plants (A of 1n8–1n0 compared with 0n4).
%!&
Discussion
We have shown that Rainbow, a transgenic papaya that
expresses the CP gene of the mild mutant of PRSV HA, is
resistant to PRSV HA but develops severe symptoms when
infected with PRSV YK or with a PRSV HA recombinant
containing the full-length CP gene of YK. Furthermore, PRSV
HA recombinants with less than full-length CP gene segments
of PRSV YK induce severe symptoms on non-transgenic
papaya and variable, but on the whole milder, symptoms on
Rainbow. Interestingly, an HA recombinant with a YK CP
gene segment from the 5h region, which has the lowest
comparative nucleotide sequence identity to the transgene,
produced much milder symptoms than recombinants with YK
CP gene segments from the middle and 3h end. Thus, we show
for the first time that the virulence of recombinant PRSV on
Rainbow is influenced more by the position than by the degree
of sequence similarity between the recombinant CP gene and
the transgene.
Our conclusion that the virulence of our recombinants on
Rainbow is affected more by the position rather than the
degree of sequence similarity is based on several observations.
The YK-AS recombinant, which has a 263 nt YK segment with
87n5 % sequence identity (33 mismatched nt) to the corresponding region of the transgene, induced very mild type III
symptoms on Rainbow, in contrast to the more prominent
type I symptoms induced by YK-SE and YK-EN recombinants,
which respectively have 92n3 and 91n9 % nt identity to the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 06:40:34
CIDD
C.-H. Chiang and others
transgene. Furthermore, the length of the YK replacement
segment does not account for the different symptoms induced,
since the YK segments in the YK-EN and YK-AS recombinants
are similar in length (234 and 263 nt ; Fig. 1). Also, the different
symptoms that the recombinants produced on Rainbow are
apparently not due to their inherent capacity to replicate, as all
recombinants produced severe symptoms on non-transgenic
plants.
A plausible explanation for the differential virulence of the
recombinants on Rainbow is that the PTGS mechanism is
preferentially targeted to the middle and 3h regions of the virus
transgene. Thus, recombinant YK-AS, which has 99n9 %
identity to the middle and 3h end of the virus transgene, would
be degraded more effectively (and thus produce very mild type
III symptoms) than YK-SN, which has only 92n2 % identity to
the middle and 3h end of the transgene. This would also explain
the type I symptoms produced by the YK-SE and YK-EN
recombinants. Other investigations on homology-dependent
virus resistance have shown that the PTGS mechanism is
preferentially directed against the 3h end region of the
transgene (e.g. English et al., 1996 ; Metzlaff et al., 1997 ; Sijen
et al., 1996 ; Sonoda et al., 1999). On the other hand, reports
have shown (i) that the target sites of some transgenic lines are
scattered throughout the transgene (Jacobs et al., 1999 ; Sonoda
et al., 1999) and (ii) that the 5h- and 3h-terminal coding regions
of the mRNA may be relatively inefficient targets for the
silencing machinery (Jacobs et al., 1999).
The suggested preferential PTGS targeting to the middle
and 3h end of the transgene does not account fully for the
intermediate type II symptoms induced on Rainbow by the
recombinants YK-AE and YK-AS\EN, which contain YK
segments of the 5h end plus the middle or 3h end of the CP gene
(Table 3 ; Fig. 1). We would expect these recombinants to
produce type I symptoms, since other recombinants with YK
segments from the middle or 3h regions of the CP gene
produced type I symptoms. Furthermore, these type II
symptom-producing recombinants infected an average of 56 %
(23\41) of the inoculated Rainbow plants compared with 89 %
(54\61) of the plants inoculated with type I symptomproducing recombinants (Table 2). Taken together, it seems
that the presence of the YK 5h CP segment reduced the
virulence of recombinants that would otherwise produce type
I symptoms on Rainbow. Furthermore, these recombinants
were as virulent as YK or HA on non-transgenic papaya, which
rules out the possibility that the differences in symptoms were
due the recombinants being inherently less virulent. At present,
we have no explanation for this observation. It should be
noted, however, that plants with type II symptoms at 45 days
p.i. showed variable symptoms (type I or II or recovery ; see
Fig. 1) at 90 days p.i. In contrast, plants with type I symptoms
at 45 days p.i. still had the same symptoms at 90 days p.i.
(Fig. 1).
Additionally, the differential virulence of the HA-3hYK
recombinant and YK on Rainbow and SunUp is difficult to
CIDE
explain solely by the concept of homology-dependent resistance. Since the genomes of HA-3hYK and YK have identical
CP and 3h NCR sequences, they should have equal virulence on
Rainbow and SunUp. Instead, HA-3hYK produced only mild
symptoms on older Rainbow and on young SunUp plants, and
did not infect older SunUp plants, whereas YK caused severe
symptoms on Rainbow and SunUp plants that were inoculated
at all stages (see Table 1). The observed differences are not due
to HA-3hYK being inherently less virulent than YK, as our
results show that HA-3hYK replicates and moves as well as YK
and HA in non-transgenic papaya (Table 1). Thus, our results
suggest that virus sequences or genes that do not correspond
to the transgene may affect the phenotypic reaction of the
transgenic plant. Several reports (Anandalakshmi et al., 1998 ;
Brigneti et al., 1998 ; Kasschau & Carrington, 1998 ; Voinnet et
al., 1999) have shown that HC-Pro of potyviruses can act as a
suppressor of PTGS. Thus, if the HC-Pro of YK is more
effective than the HC-Pro of HA in suppressing PTGS of
infected plants, YK would be expected to replicate better than
HA-3hYK in Rainbow and SunUp plants. The HC-Pro of HA
and YK share 86n5 and 95n6 % nucleotide and amino acid
sequence identity (Wang & Yeh, 1997). The availability of
infectious clones of HA (Chiang & Yeh, 1997) and the stability
of recombinants that contain segments of HA and YK (this
work) will allow us to test experimentally whether HC-Pro
contributes to the above observation on Rainbow and SunUp.
We also show here that zygosity and development stage
affect the resistance of transgenic plants to recombinants. Our
results confirm and extend those of Tennant et al. (2001), who
tested Rainbow and SunUp with different PRSV isolates but
did not use recombinants. Others have shown similar effects of
zygosity and development stage on the resistance of other
virus–transgenic plant systems (Goodwin et al., 1996 ; Jan et al.,
2000 ; Pang et al., 1996), but the experiments were not done
with recombinant viruses.
Resistance-breaking strains could conceivably emerge
through recombination of PRSV strains from Hawaii with
transgenic papaya that express the CP or other genes of PRSV
strains that overcome the resistance of Rainbow or SunUp.
Thus, the Rainbow–PRSV system is a good model for
investigating critically the risk of viruses arising through
recombination of PRSV with heterologous PRSV transgenes in
papaya.
This work was supported in part by grants from the Biotechnology
Risk Assessment Research Grants Program (no. 97-39210-5005) and the
Hawaii Papaya Administrative Committee to D. Gonsalves. C.-H. Chiang
was partly supported by a fellowship from the Ministry of Education,
Taiwan.
References
Anandalakshmi, R., Pruss, G. J., Ge, X., Marathe, R., Mallory, A. C.,
Smith, T. H. & Vance, V. B. (1998). A viral suppressor of gene silencing
in plants. Proceedings of the National Academy of Sciences, USA 95,
13079–13084.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 06:40:34
PRSV recombinants and transgenic papaya
Bass, B. L. (2000). Double-stranded RNA as a template for gene
silencing. Cell 101, 235–238.
Baulcombe, D. C. (1996). Mechanisms of pathogen-derived resistance
to viruses in transgenic plants. Plant Cell 8, 1833–1844.
Baulcombe, D. (1999 a). Viruses and gene silencing in plants. Archives
of Virology Supplementum 15, 189–201.
Baulcombe, D. C. (1999 b). Fast forward genetics based on virusinduced gene silencing. Current Opinion in Plant Biology 2, 109–113.
Baulcombe, D. C. & English, J. J. (1996). Ectopic pairing of homologous
DNA and post-transcriptional gene silencing in transgenic plants. Current
Opinion in Biotechnology 7, 173–180.
Beachy, R. N. (1993). Introduction : transgenic resistance to plant
viruses. Seminars in Virology 4, 327–328.
Brigneti, G., Voinnet, O., Li, W. X., Ji, L. H., Ding, S. W. & Baulcombe,
D. C. (1998). Viral pathogenicity determinants are suppressors of
transgene silencing in Nicotiana benthamiana. EMBO Journal 17,
6739–6746.
Chiang, C.-H. & Yeh, S.-D. (1997). Infectivity assays of in vitro and in
vivo transcripts of papaya ringspot potyvirus. Botanical Bulletin of
Academia Sinica 38, 153–163.
Clark, M. F. & Adams, A. N. (1977). Characteristics of the microplate
method of enzyme-linked immunosorbent assay for the detection of plant
viruses. Journal of General Virology 34, 475–483.
Dalmay, T., Hamilton, A., Mueller, E. & Baulcombe, D. C. (2000 a).
Potato virus X amplicons in Arabidopsis mediate genetic and epigenetic
gene silencing. Plant Cell 12, 369–379.
Dalmay, T., Hamilton, A., Rudd, S., Angell, S. & Baulcombe, D. C.
(2000 b). An RNA-dependent RNA polymerase gene in Arabidopsis is
required for posttranscriptional gene silencing mediated by a transgene
but not by a virus. Cell 101, 543–553.
Dougherty, W. G. & Parks, T. D. (1995). Transgenes and gene
suppression : telling us something new ? Current Opinion in Cell Biology 7,
399–405.
English, J. J., Mueller, E. & Baulcombe, D. C. (1996). Suppression of
virus accumulation in transgenic plants exhibiting silencing of nuclear
genes. Plant Cell 8, 179–188.
English, J. J., Davenport, G. F., Elmayan, T., Vaucheret, H. &
Baulcombe, D. C. (1997). Requirement of sense transcription for
homology-dependent virus resistance and trans-inactivation. Plant Journal
12, 597–603.
Fitch, M. M. M., Manshardt, R. M., Gonsalves, D., Slightom, J. L. &
Sanford, J. C. (1992). Virus resistant papaya derived from tissues
bombarded with the coat protein gene of papaya ringspot virus.
Bio\Technology 10, 1466–1472.
Gonsalves, D. (1998). Control of papaya ringspot virus in papaya : a
case study. Annual Review of Phytopathology 36, 415–437.
Gonsalves, D. & Ishii, M. (1980). Purification and serology of papaya
ringspot virus. Phytopathology 70, 1028–1032.
Goodwin, J., Chapman, K., Swaney, S., Parks, T. D., Wernsman, E. A. &
Dougherty, W. G. (1996). Genetic and biochemical dissection of
Jan, F.-J., Pang, S.-Z., Tricoli, D. M. & Gonsalves, D. (2000). Evidence
that resistance in squash mosaic comovirus coat protein-transgenic plants
is affected by plant developmental stage and enhanced by combination of
transgenes from different lines. Journal of General Virology 81, 2299–2306.
Kasschau, K. D. & Carrington, J. C. (1998). A counterdefensive strategy
of plant viruses : suppression of posttranscriptional gene silencing. Cell
95, 461–470.
Levy, L., Lee, I. M. & Hadidi, A. (1994). Simple and rapid preparation of
infected plant tissue extracts for PCR amplification of virus, viroid, and
MLO nucleic acids. Journal of Virological Methods 49, 295–304.
Lindbo, J. A., Silva-Rosales, L., Proebsting, W. M. & Dougherty, W. G.
(1993). Induction of a highly specific antiviral state in transgenic plants :
implications for regulation of gene expression and virus resistance. Plant
Cell 5, 1749–1759.
Ling, K., Namba, S., Gonsalves, C., Slightom, J. L. & Gonsalves, D.
(1991). Protection against detrimental effects of potyvirus infection in
transgenic tobacco plants expressing the papaya ringspot virus coat
protein gene. Bio\Technology 9, 752–758.
Lomonossoff, G. P. (1995). Pathogen-derived resistance to plant
viruses. Annual Review of Phytopathology 33, 323–343.
Manshardt, R. M. (1999). ‘ UH Rainbow ’ papaya. University of Hawaii
College of Tropical Agriculture and Human Resources, New Plants for
Hawaii-1. Honolulu : University of Hawaii College of Tropical Agriculture and Human Resources.
Meins, F., Jr (2000). RNA degradation and models for posttranscriptional gene silencing. Plant Molecular Biology 43, 261–273.
Metzlaff, M., O’Dell, M., Cluster, P. D. & Flavell, R. B. (1997). RNAmediated RNA degradation and chalcone synthase A silencing in petunia.
Cell 88, 845–854.
Montgomery, M. K. & Fire, A. (1998). Double-stranded RNA as a
mediator in sequence-specific genetic silencing and co-suppression. Trends
in Genetics 14, 255–258.
Mourrain, P., Beclin, C., Elmayan, T., Feuerbach, F., Godon, C., Morel,
J. B., Jouette, D., Lacombe, A. M., Nikic, S., Picault, N., Remoue, K.,
Sanial, M., Vo, T. A. & Vaucheret, H. (2000). Arabidopsis SGS2 and
SGS3 genes are required for posttranscriptional gene silencing and
natural virus resistance. Cell 101, 533–542.
Pang, S. Z., Jan, F. J., Carney, K., Stout, J., Tricoli, D. M., Quemada,
H. D. & Gonsalves, D. (1996). Post-transcriptional transgene silencing
and consequent tospovirus resistance in transgenic lettuce are affected by
transgene dosage and plant development. Plant Journal 9, 899–909.
Pang, S. Z., Jan, F. J., Tricoli, D. M., Russell, P. F., Carney, K. J., Hu,
J. S., Fuchs, M., Quemada, H. D. & Gonsalves, D. (2000). Resistance
to squash mosaic comovirus in transgenic squash plants expressing its
coat protein genes. Molecular Breeding 6, 87–93.
Prins, M. & Goldbach, R. (1996). RNA-mediated virus resistance in
transgenic plants. Archives of Virology 141, 2259–2276.
Quemada, H., L’Hostis, B., Gonsalves, D., Reardon, I. M., Heinrikson,
R., Hiebert, E. L., Sieu, L. C. & Slightom, J. L. (1990). The nucleotide
transgenic RNA-mediated virus resistance. Plant Cell 8, 95–105.
Hamilton, A. J. & Baulcombe, D. C. (1999). A species of small antisense
RNA in posttranscriptional gene silencing in plants. Science 286,
950–952.
sequences of the 3h-terminal regions of papaya ringspot virus strains W
and P. Journal of General Virology 71, 203–210.
Sanford, J. C. & Johnston, S. A. (1985). The concept of parasite-derived
resistance – deriving resistance genes from the parasite’s own genome.
Journal of Theoretical Biology 113, 395–405.
Jacobs, J. J. M. R., Sanders, M., Bots, M., Andriessen, M., van Eldik,
G. J., Litiere, K., Van Montagu, M. & Cornelissen, M. (1999). Sequences
Shukla, D. D., Strike, P. M., Tracy, S. L., Gough, K. H. & Ward, C. W.
(1988). The N and C termini of the coat proteins of potyviruses are
throughout the basic β-1,3-glucanase mRNA coding region are targets
for homology dependent post-transcriptional gene silencing. Plant Journal
20, 143–152.
surface-located and the N terminus contains the major virus-specific
epitopes. Journal of General Virology 69, 1497–1508.
Sijen, T., Wellink, J., Hiriart, J.-B. & van Kammen, A. (1996). RNA-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 06:40:34
CIDF
C.-H. Chiang and others
mediated virus resistance : role of repeated transgenes and delineation to
targeted regions. Plant Cell 8, 2277–2294.
Smith, H. A., Swaney, S. L., Parks, T. D., Wernsman, E. A. & Dougherty,
W. G. (1994). Transgenic plant virus resistance mediated by untrans-
latable sense RNAs : expression, regulation, and fate of nonessential
RNAs. Plant Cell 6, 1441–1453.
Sonoda, S., Mori, M. & Nishiguchi, M. (1999). Homology-dependent
virus resistance in transgenic plants with the coat protein gene of sweet
potato feathery mottle potyvirus : target specificity and transgene
methylation. Phytopathology 89, 385–391.
Tennant, P. F., Gonsalves, C., Ling, K. S., Fitch, M., Manshardt, R.,
Slightom, J. L. & Gonsalves, D. (1994). Differential protection against
papaya ringspot virus isolates in coat protein gene transgenic papaya and
classically cross-protected papaya. Phytopathology 84, 1359–1366.
Tennant, P., Fermin, G., Fitch, M. M., Manshardt, R. M., Slightom, J. L.
& Gonsalves, D. (2001). Papaya ringspot virus resistance of transgenic
Rainbow and SunUp is affected by gene dosage, plant development, and
coat protein homology. European Journal of Plant Pathology (in press).
Voinnet, O., Pinto, Y. M. & Baulcombe, D. C. (1999). Suppression of
gene silencing : a general strategy used by diverse DNA and RNA viruses
of plants. Proceedings of the National Academy of Sciences, USA 96,
14147–14152.
CIDG
Wang, C.-H. & Yeh, S.-D. (1992). Nucleotide sequence comparison of
the 3h-terminal regions of severe, mild, and non-papaya infecting strains
of papaya ringspot virus. Archives of Virology 127, 345–354.
Wang, C.-H. & Yeh, S.-D. (1997). Divergence and conservation of the
genomic RNAs of Taiwan and Hawaii strains of papaya ringspot
potyvirus. Archives of Virology 142, 271–285.
Wassenegger, M. & Pelissier, T. (1998). A model for RNA-mediated
gene silencing in higher plants. Plant Molecular Biology 37, 349–362.
Waterhouse, P. M., Graham, M. W. & Wang, M. B. (1998). Virus
resistance and gene silencing in plants can be induced by simultaneous
expression of sense and antisense RNA. Proceedings of the National
Academy of Sciences, USA 95, 13959–13964.
Yeh, S. D. & Gonsalves, D. (1984). Evaluation of induced mutants of
papaya ringspot virus for control by cross protection. Phytopathology 74,
1086–1091.
Yeh, S.-D., Jan, F.-J., Chiang, C.-H., Doong, T.-J., Chen, M.-C., Chung,
P.-H. & Bau, H.-J. (1992). Complete nucleotide sequence and genetic
organization of papaya ringspot virus RNA. Journal of General Virology
73, 2531–2541.
Received 22 November 2000 ; Accepted 16 July 2001
Published ahead of print (27 July 2001) in JGV Direct as
DOI 10.1099/vir.0.17560-0
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 06:40:34