Download High- versus moderate-intensity aerobic exercise training effects on

J Appl Physiol 114: 1029 –1041, 2013.
First published February 21, 2013; doi:10.1152/japplphysiol.00760.2012.
High- versus moderate-intensity aerobic exercise training effects on skeletal
muscle of infarcted rats
José B. N. Moreira,1 Luiz R. G. Bechara,1 Luiz H. M. Bozi,1 Paulo R. Jannig,1 Alex W. A. Monteiro,1
Paulo M. Dourado,2 Ulrik Wisløff,3 and Patricia C. Brum1
1
School of Physical Education and Sport, University of São Paulo, São Paulo, SP, Brazil; 2Heart Institute, Faculty of
Medicine, University of São Paulo, São Paulo, SP, Brazil; and 3K.G. Jebsen Center of Exercise in Medicine, Norwegian
University of Science and Technology (NTNU), Trondheim, Norway
Submitted 19 June 2012; accepted in final form 15 February 2013
atrophy; heart failure; proteasome; oxidative stress
in systemic diseases have been
described for decades (9, 14, 29, 52), including in heart failure
(HF). Capillary rarefaction, switch from type I (oxidative) to
type II (glycolytic) fibers, impaired metabolism, and skeletal
muscle atrophy have been shown in human and experimental
models of HF (14, 21, 29, 43, 49, 52). This maladaptation
seems to impair skeletal muscle performance, which was
proposed as the main determinant of exercise capacity in
patients with HF (21, 32, 40). Additionally, skeletal muscle
loss was shown to be an independent predictor of mortality in
HF (3).
SKELETAL MUSCLE ABNORMALITIES
Address for reprint requests and other correspondence: P. C. Brum, Escola
de Educação Física e Esporte, Universidade de São Paulo, Av. Professor Mello
Moraes, 65 - Butantã - São Paulo, 05508-900-Brazil (e-mail: [email protected]).
http://www.jappl.org
Recent efforts by researchers have identified possible intracellular mechanisms underlying the skeletal muscle abnormalities in cardiovascular diseases, and promising targets such as
metabolic enzymes, calcium handling-related proteins, antioxidant scavengers, and inflammatory cytokines (9, 12, 39, 46).
However, despite the identification of possible important players and advances in pharmacological treatment for HF over the
last century, no available pharmacological therapy is able to
prevent the onset of HF skeletal myopathy or to prevent or
revert its consequences. Therefore, adjuvant therapies for treating skeletal muscle abnormalities in cardiovascular diseases
must be emphasized and more deeply studied.
Following this rationale, it has been shown that aerobic
exercise training (AET) not only improves cardiac function in
patients with HF, but also promotes a broad range of beneficial
skeletal muscle outcomes such as prevention of skeletal muscle
atrophy, increase in type I muscle fiber percentage, and improvements in metabolic parameters (1, 4, 8, 18, 27), which
altogether, improved functional capacity and led to better
quality of life and longer survival. Such beneficial effects of
AET on impaired skeletal muscle due to cardiovascular diseases have been reported for many years (1, 17, 27, 34),
including important contributions from our group (4, 8, 9, 11);
however, the optimal exercise intensity to elicit maximal outcomes is still a matter of debate among clinicians and researchers. Although moderate-intensity AET is undoubtedly a safe
approach and known to improve ventricular function, skeletal
muscle, and exercise capacity in patients with HF, recent
studies suggest that high-intensity AET, achieved by interval
training, promotes superior outcomes for cardiac patients (35,
60), including additional gains in cardiac function and aerobic
capacity, which is the single best predictor of cardiovascular
mortality (37). Nevertheless, a systematic comparison between
the effects of moderate-intensity and high-intensity AET on
skeletal muscle adaptations in cardiovascular diseases has
never been reported in humans or animal models.
Therefore, in the present study, we compared the effects of
high-intensity AET with those of a matched-volume, moderate-intensity protocol on skeletal muscle of rats submitted to
myocardial infarction (MI), using morphological, metabolic,
and intracellular parameters in skeletal muscles of distinct fiber
type composition.
MATERIALS AND METHODS
Animal model and experimental design. Eight-week-old male
Wistar rats (100 rats were initially purchased from Anilab LTDA,
Paulinia, Brazil) were randomly assigned into MI or fictitious surgery
(SHAM). Rats were deeply anesthetized with ketamine (50 mg/kg ip)
8750-7587/13 Copyright © 2013 the American Physiological Society
1029
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
Moreira JB, Bechara LR, Bozi LH, Jannig PR, Monteiro AW,
Dourado PM, Wisløff U, Brum PC. High- versus moderate-intensity
aerobic exercise training effects on skeletal muscle of infarcted rats. J
Appl Physiol 114: 1029 –1041, 2013. First published February 21,
2013; doi:10.1152/japplphysiol.00760.2012.—Poor skeletal muscle
performance was shown to strongly predict mortality and long-term
prognosis in a variety of diseases, including heart failure (HF).
Despite the known benefits of aerobic exercise training (AET) in
improving the skeletal muscle phenotype in HF, the optimal exercise
intensity to elicit maximal outcomes is still under debate. Therefore,
the aim of the present study was to compare the effects of highintensity AET with those of a moderate-intensity protocol on skeletal
muscle of infarcted rats. Wistar rats underwent myocardial infarction
(MI) or sham surgery. MI groups were submitted either to an untrained (MI-UNT); moderate-intensity (MI-CMT, 60% V̇O2 max); or
matched volume, high-intensity AET (MI-HIT, intervals at 85%
V̇O2 max) protocol. High-intensity AET (HIT) was superior to moderate-intensity AET (CMT) in improving aerobic capacity, assessed by
treadmill running tests. Cardiac contractile function, measured by
echocardiography, was equally improved by both AET protocols.
CMT and HIT prevented the MI-induced decay of skeletal muscle
citrate synthase and hexokinase maximal activities, and increased
glycogen content, without significant differences between protocols.
Similar improvements in skeletal muscle redox balance and deactivation of the ubiquitin-proteasome system were also observed after
CMT and HIT. Such intracellular findings were accompanied by
prevented skeletal muscle atrophy in both MI-CMT and MI-HIT
groups, whereas no major differences were observed between protocols. Taken together, our data suggest that despite superior effects of
HIT in improving functional capacity, skeletal muscle adaptations
were remarkably similar among protocols, leading to the conclusion
that skeletal myopathy in infarcted rats was equally prevented by
either moderate-intensity or high-intensity AET.
1030
High- versus Moderate-Intensity Training in Infarcted Rats
Moreira JB et al.
intensity training, or CMT). High-intensity AET was performed in
such a way that rats run during 3 min at 60% V̇O2 max, followed by
4-min intervals at 85% V̇O2 max (i.e., high-intensity interval training,
or HIT), which was repeated seven times, so each HIT session lasted
for 49 min. CMT and HIT protocols were of matched volume,
meaning that total running distances in each session of either CMT or
HIT were identical; therefore, CMT session duration was adjusted to
match HIT distance (20). A 5-min warmup at 40% V̇O2 max was
performed by both trained groups before each AET session. AET
protocols were performed at 15° inclination 5 days per wk over 8 wk.
At the end of the fourth week, animals were submitted to an additional
exercise test to adjust running intensity. SHAM and MI-UNT animals
were placed on the treadmill twice a week for 10 min each day at 40%
V̇O2 max to maintain running skills.
Skeletal muscle fiber type distribution and cross-sectional area.
Muscles frozen in liquid nitrogen were vertically mounted at L0 in
fixed bases and serially sectioned in cryostat (10-␮m sections). Sections were submitted to myosin ATPase staining after alkali preincubation (pH 10.6) (7). Fiber type distribution and cross-sectional area
(CSA) were evaluated at 200⫻ magnification and analyzed by a
digitalizing unit connected to a computer (Image Pro-Plus, National
Institutes of Health). All analyses were conducted by a single observer
(JBNM) who was blinded to rat identities.
Citrate synthase assay. Muscles were homogenized in phosphate
buffer [50 mM sodium phosphate, 1 mM EDTA and protease inhibitor
cocktail (Sigma-Aldrich, São Paulo, SP, Brazil) pH 7.4] and centrifuged for 15 min at 12,000g and 4°C. The pellet was discarded and the
supernatant was used for the assay. The assay mixture contained 100
mM Tris, 1 mM EDTA, 0.2 mM 5,5=-dithiobis(2-nitrobenzoic acid),
0.1 mM acetyl-CoA, 1% (v:v) Triton X-100, sample (130 ␮g of
soluble proteins per milliliter of total assay), and 0.5 mM oxaloacetate
(added last), as originally described (2). Sample absorbance at 412 nm
was monitored in 96-well plates for 10 min at 25°C, and maximal
citrate synthase activity was measured within the linear range of the
assay.
Hexokinase assay. Muscle homogenates were obtained as described in Citrate synthase assay. Hexokinase (HK) maximal activity
assay was performed in the presence of 75 mM Tris-HCl, 7.5 mM
MgCl2, 0.8 mM EDTA, 1.5 mM KCl, 4 mM mercaptoethanol, 0.4
mM NADP⫹, 2.5 mM ATP, 1.4 units/ml creatine phosphate, 0.05%
(v:v) Triton X-100, excess G6PDH, sample (750 ␮g of soluble
proteins per milliliter of total assay volume) and 1 mM glucose as
substrate (added last), as originally described (62). Sample absorbance
at 340 nm was monitored in 96-well plates for 10 min at 25°C. HK
activity was measured within the linear range of the assay.
Skeletal muscle glycogen content. Approximately 50 mg of tissue
was digested in 400 ␮l of 30% (w:v) KOH (30 min at 100°C),
followed by the addition of 800 ␮l of pure ethanol for glycogen
precipitation (10 min at 100°C). Samples were cooled on ice and
submitted to centrifugation (30 min at 3,000g and 4°C). The supernatant was carefully discarded and the glycogen pellet was suspended
in 1 ml of 5% (v:v) trichloroacetic acid. Each sample (300 ␮l) was
mixed with 600 ␮l of 0.2% anthrone (w:v in 95% sulfuric acid) and
heated (10 min at 100°C). Sample absorbance was read at 620 nm in
10-ml cuvettes and compared with a standard glucose curve. Glycogen concentration was corrected by the exact tissue mass used in the
assay, so glycogen content is expressed as micrograms of glycogen
per milligram of tissue (␮g glycogen/mg muscle).
Superoxide dismutase assay. Superoxide dismutase (SOD) maximal activity assay was based on the inhibition of xanthine/xanthine
oxidase-driven cytochrome C reduction by SOD present in the sample. Muscle homogenates were obtained as described in Citrate
synthase assay. Initially, the cytochrome C reduction rate was followed in the absence of the sample for 5 min at 550 nm (absorbance)
in a mixture containing 1.18 mM xanthine, 19 mM cytochrome C and
xanthine oxidase, diluted in sodium phosphate buffer (50 mM pH 7.8).
Xanthine oxidase concentration was adjusted to obtain a standard rate
J Appl Physiol • doi:10.1152/japplphysiol.00760.2012 • www.jappl.org
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
and xylazine (10 mg/kg ip), followed by left thoracotomy. The
mediastinum was accessed by incision of intercostal muscles between
the third and fourth ribs, the heart was carefully exteriorized, and the
left anterior descending (LAD) coronary artery was occluded with 6/0
thread. After LAD ligation the thorax was closed, and lung collapse
was prevented by rapid withdrawal of air from the pleural cavity.
Sham-operated animals underwent similar left thoracotomy and cardiac exteriorization, with the exception of LAD ligation. Four weeks
after surgical procedures, rats were submitted to echocardiographic
examination and exercise testing for assessment of functional capacity, as described below. At this time point (the fourth week after
surgery), experimental groups were divided in such a way that all
parameters (i.e., functional capacity, cardiac structure, and function)
were similar among the groups of similar cardiac condition (i.e., MI).
SHAM refers to the healthy, fictitiously operated control group,
MI-UNT refers to the group of MI rats that remained untrained during
the 8 wk of postinfarction protocol, MI-CMT refers to MI rats that
were submitted to 8 wk of a continuous moderate-intensity AET
protocol, and MI-HIT refers to MI rats that were submitted to 8 wk of
high-intensity aerobic interval training. AET protocols are described
in detail below. Rats were kept in a temperature-controlled (21°C)
facility with a 12:12-h light:dark cycle and were housed five per cage,
with free access to water and standard laboratory chow (Nuvital
Nutrientes, Colombo, PR, Brazil). Rats were killed by decapitation
and tissue was carefully removed and processed according to the
desired experiment. All experiments were performed in soleus and
plantaris muscle, which were chosen due to their contrasting structural
metabolic characteristics (i.e., fiber type distribution and prevalent
metabolism). All procedures were performed in accordance with the
Guide for the Care and Use of Laboratory Animals (National Institutes of Health, Bethesda, MD) and were approved by the University
of São Paulo’s Ethical Committee (#2008/40).
Echocardiographic evaluation. Rats underwent M-Mode echocardiographic examination before (4 wk after surgery) and after (12 wk
after surgery) experimental protocols. Rats were anesthetized with
ketamine (50 mg/kg ip) and xylazine (10 mg/kg ip) and were placed
in a supine position. Cardiac dimensions were measured by a linear
probe (14 Mhz) and left ventricular fractional shortening (LVFS) was
calculated by the formula LVFS (%) ⫽ [(LVEDD ⫺ LVESD)/
LVEDD] ⫻ 100, where LVEDD means left ventricular end-diastolic
dimension and LVESD means left ventricular end-systolic dimension.
Echocardiographic examination followed the recommendations of the
American College of Echocardiography (45).
Exercise testing and measurement of aerobic capacity. Rats were
submitted to exercise testing before (4 wk after surgery) and after (12
wk after surgery) experimental protocol. Animals were adapted to
treadmill exercise over 5 days (10 min each day) before tests. Rats ran
on a graded treadmill until exhaustion at 15° inclination; the speed
started at 6 m/min and was increased by 3 m/min every 3 min until
rats were unable to run (15). The same test protocol was also used to
measure maximal oxygen uptake (V̇O2 max), when animals were
placed on a treadmill mounted into a metabolic chamber connected
through a tube to an air pump used to maintain airflow inside the
chamber (3,500 ml/min). The tube was serially connected to an
oxygen analyzer, which continuously measured partial oxygen pressure (pO2) throughout the exercise test. Oxygen uptake could then be
calculated by the formula VO2 ⫽ (pO2 room air ⫺ pO2 during test) ⫻
F/m, where F is the airflow through the chamber (3,500 ml/min) and
m is the rat’s body mass in kilograms. V̇O2 max was considered
achieved when oxygen uptake no longer increased despite an increase
in workload (i.e., intensity at which oxygen uptake leveled off ⫽
iV̇O2 max) and rats were no longer able to run. Tests were performed
by an experienced observer (JBNM) who was blinded to rat identities.
Aerobic exercise training protocols. AET protocols started 4 wk
after surgical procedures. Moderate-intensity AET was performed at a
treadmill speed corresponding to 60% V̇O2 max, which was kept
unchanged throughout the entire session (i.e., continuous moderate-
•
High- versus Moderate-Intensity Training in Infarcted Rats
1031
Moreira JB et al.
MI-HIT). SHAM levels were arbitrarily set to 1. Primer sequences
are shown in Table 1.
Protein ubiquitination. Muscle homogenates were mixed with
0.8% (w:v) SDS, 200 mM mercaptoethanol, 0.02% (w:v) bromophenol blue, and 40% (w:v) glycerol, loaded into polyacrylamide gels [25
␮g of soluble proteins; 10% (w:v) acrylamide gels], submitted to
electrophoresis (100 V constant, 1.5 h, room temperature), and electrotransferred to nitrocellulose membranes (100 V constant, 2 h, 4°C).
Unspecific binding of antibodies was prevented by incubation of the
membranes with 5% BSA (w:v) followed by incubation with the
primary antibody against ubiquitin (sc8017; Santa Cruz Biotechnology, Santa Cruz, CA) [overnight under gentle shaking at 4°C, diluted
in solution containing 5% (w:v) BSA, 10 mM Tris-HCl, 150 mM
NaCl, and 0.1% (v:v) Tween-20, pH 7.6]. Membranes were washed
three times (5 min each under gentle shaking at room temperature)
with PBS-Tween solution and later incubated with horseradish-peroxidase (HRP)-conjugated secondary antibody from the same host as
primary (2 h under gentle shaking at room temperature). Antibody
detection was performed in a digitalizing unit (ChemiDoc; BioRad,
São Paulo, Brazil) after incubation with luminol and hydrogen peroxide as HRP substrate. Different membranes were compared by
loading a standard reference sample in all gels and results were
corrected to Ponceau red staining (0.5%, w:v) of the membrane.
Skeletal muscle protein ubiquitination was analyzed in the broadest
molecular weight range as possible. Data are presented as a percentage of the SHAM group (arbitrarily set as 100%). Representative
images of the membranes are provided along with the data.
Protein carbonylation. Protein carbonylation was assessed by measuring the levels of carbonyl groups using the OxyBlot Protein
Detection Kit (s7150; Millipore, Billerica, MA). Soluble proteins (25
␮g) were denatured by 6% (w:v) SDS and derivatized by DNPH for
15 min. The reaction was stopped and proteins were submitted to
electrophoresis and membrane blotting as described under Protein
ubiquitination. Membranes were incubated with anti-DNP primary
antibody and HRP-conjugated secondary antibody, followed by detection in a digitalizing unit (ChemiDoc; BioRad). Different membranes were compared by loading a standard reference sample in all
gels, and results were corrected to Ponceau red staining (0.5%, w:v)
of the membrane. Skeletal muscle protein carbonylation was analyzed
in the broadest molecular weight range possible. Data are presented as
a percentage of the SHAM group (arbitrarily set as 100%). Representative images of the membranes are provided along with the data.
Statistical analysis. Data are presented as mean ⫾ standard error.
Shapiro-Wilks tests were used to verify normal distribution of the
data. Echocardiographic parameters, exercise performance, and aerobic capacity were compared among groups by one-way ANOVA for
Table 1. Primer sequences
Ligase
Primer Sequence
MuRF1 forward
MuRF1 reverse
Atrogin-1 forward
Atrogin-1 reverse
PDK4 forward
PDK4 reverse
PPAR-delta forward
PPAR-delta reverse
TFAM forward
TFAM reverse
PGC1-alpha forward
PGC1-alpha reverse
5=GGCGGGAGGGTTGGGTCTCACTC3=
5=CCCCAATACCCAGCCCCTTCTGC3=
5=TACTAAGGAGGCCCATGGATACT3=
5=GTTGAATCTTCTGGAATCCAGGAT3=
5=CATACTCCACTGCTCCAACGCCTGTG3=
5=GATCTCCTTGAAAATACTTGGCGTAGAGACG3=
5=CCACATCTGTCTGATTCACGCCAGTGAG3=
5=CTTGAAGAGGGGACAGAGACAGGCAGG3=
5=TTCGTGCGGGTTTGTGAAGTTCTTACAC3=
5=CCACGTCATCTAGTAAAGCCCGGAAGG3=
5=GCAGCGGTCTTAGCACTCAGAACCATG3=
5=AGCTCTGAGCAGGGACGTCTTTGTGG3
MuRF1, Muscle RING-Finger-1; Atrogin-1, Atrogin-1/MAFbox; PDK4,
pyruvate dehydrogenase isozyme 4; PPAR-delta, peroxisome proliferatoractivated receptor-delta; TFAM, transcription factor A, mitochondrial;
PGC-1alpha, peroxisome proliferator-activated receptor gamma coactivator
1-alpha.
J Appl Physiol • doi:10.1152/japplphysiol.00760.2012 • www.jappl.org
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
of cytochrome C reduction of 0.025 units of absorbance per minute.
Next, the cytochrome C reduction rate was measured in the presence
of the sample (23). The difference between the two rates was attributed to SOD being present in the tested sample. SOD activity was
measured within the linear range of the assay.
Catalase assay. Muscle homogenates were obtained as described in
Citrate synthase assay. The rate of hydrogen peroxide (H2O2) decomposition by catalase was assessed by following the decay in sample
absorbance at 240 nm (i.e., absorbance of H2O2) for 4 min in the
presence of 10 mM H2O2. Catalase maximal activity was measured
within the linear range of the assay, as described (57).
Glutathione redox status. Reduced (GSH), total (total GSH), and
oxidized glutathione (GSSG) were measured in soleus and plantaris
muscles with the Glutathione Fluorescent Detection Kit (K006-F5;
Arbor Assay, Ann Arbor, MI) following the manufacturer’s instructions. Briefly, a proprietary compound binds to the free thiol groups of
GSH present in the sample to yield a highly fluorescent product (510
nm and 390 nm were emission and excitation wavelengths, respectively). After reading the free GSH concentration, all GSSG in the
sample was reduced to GSH so that total GSH could be assessed.
GSSG was then calculated by the formula (Total GSH ⫺ Free
GSH)/2.
Proteasomal activity. Muscles were homogenized in phosphate
buffer without protease inhibitors (50 mM sodium phosphate, 1 mM
EDTA pH 7.4) and centrifuged for 15 min at 12,000g and 4°C. The
pellet was discarded and the supernatant (soluble proteins) was used
for the assay. 26S proteasome activity was measured as the cleavage
rate of a synthetic fluorescent peptide (Enzo Life Sciences, Farmingdale, NY), a specific substrate of the proteasome chymotrypsin
catalytic site. The reaction mixture contained 25 mM Tris (pH 7.4), 5
mM MgCl2, 25 ␮M ATP, 25 ␮M LLVY-AMC, and the sample (25
␮g of soluble proteins). Fluorescent product formation was followed for 90 min (440 nm and 350 nm were emission and
excitation wavelengths, respectively) at 37°C in the presence or
absence of epoxomicin (20 ␮M), a highly specific inhibitor of
chymotrypsin-like proteasome activity, and the difference between
the two rates was considered as 26S proteasomal activity (chymotrypsin-site).
Quantitative real-time PCR. Messenger RNA (mRNA) levels of
ubiquitin ligases Atrogin-1/MAFbox (atrogin-1) and Muscle RINGFinger-1 (MuRF1) were assessed in soleus and plantaris muscles by
quantitative real-time polymerase chain reaction (qRT-PCR). RNA
was isolated from muscles with Trizol reagent (Invitrogen, São Paulo,
Brazil) following the manufacturer’s instructions. After assessment of
RNA integrity [electrophoresis in agarose gels followed by staining
with Nancy-520 (Sigma-Aldrich, São Paulo, Brazil)], purity (260:280
nm ratio), and concentration (ng/␮l) (spectrophotometry by NanoDrop 2000; Thermo Scientific, Rockford, IL), reverse transcription
was performed using the Revertaid First Strand cDNA synthesis kit
(Fermentas, Glen Burnie, MD). In summary, 2 ␮g of total RNA,
oligo(dT) (0.5 ␮g), RiboLock RNase inhibitor (20 units), 1 mM dNTP
mix, and RevertAid Reverse Transcriptase (200 units) were added to
a reaction buffer performing a 20-␮l final solution (Fermentas), which
was incubated at 42°C for 1 h plus 10 min at 70°C for reverse
transcription termination. After cDNA synthesis, qRT-PCR for target
genes and endogenous reference gene cyclophilin were run separately
and amplifications were performed with an ABI Prism 7500 Sequence
Detection System by using the Maxima SYBR Green/ROX qPCR
Master Mix (Fermentas). Specificity was tested by melting curve
analysis. Results were expressed using the comparative cycle
threshold (Ct) method as described by the manufacturer. The ⌬Ct
values were calculated in every sample for each gene of interest as
Ctgene of interest minus Ctreporter gene; cyclophilin was the control
gene. Calculation of relative changes in mRNA levels (namely
⌬⌬Ct) was performed by subtracting ⌬Ct value of SHAM group
from ⌬Ct values of the other three groups (MI-SED, MI-CMT and
•
1032
High- versus Moderate-Intensity Training in Infarcted Rats
•
Moreira JB et al.
Table 2. Physiological parameters
BW (g)
Lung wet/dry
Incidence of lung edema
Soleus weight (mg)
Soleus weight/BW (mg/g)
Plantaris weight (mg)
Plantaris weight/BW (mg/g)
Heart weight/BW (mg/g)
MI extension, %
SHAM (n ⫽ 9–10)
MI-UNT (n ⫽ 8–11)
MI-CMT (n ⫽ 6–9)
MI-HIT (n ⫽ 9–11)
441 ⫾ 41
4.4 ⫾ 0.1
10%
250.2 ⫾ 10.9
0.55 ⫾ 0.01
441.6 ⫾ 22.0
1.01 ⫾ 0.03
2.83 ⫾ 0.08
423 ⫾ 36
4.7 ⫾ 0.1
63%
208.7 ⫾ 7.1*
0.49 ⫾ 0.02
390.5 ⫾ 13.9
0.94 ⫾ 0.03
3.11 ⫾ 0.08*
27.9 ⫾ 1.4
431 ⫾ 18
4.6 ⫾ 0.1
33%
218.4 ⫾ 9.5
0.51 ⫾ 0.02
445.3 ⫾ 17.0
1.04 ⫾ 0.04
3.05 ⫾ 0.08
27.5 ⫾ 4.4
407 ⫾ 39
4.5 ⫾ 0.1
33%
224.0 ⫾ 9.8
0.55 ⫾ 0.02
441.8 ⫾ 15.5
1.09 ⫾ 0.03
3.18 ⫾ 0.11*
25.1 ⫾ 2.7
BW, body weight; MI, myocardial infarcted; SHAM, healthy control; UNT, untrained; CMT, moderate-intensity training; HIT, high-intensity training. Data
are presented as mean ⫾ SE, except for incidence of lung edema, which is shown as a percentage of animals that displayed lung edema. Lung edema was
considered when the value of lung wet-to-dry ratio was above the average of the SHAM group ⫾ SD. MI extension was calculated as (endocardial ⫹ epicardial
circumference of infarcted tissue)/(endocardial ⫹ epicardial circumference of entire left ventricle) and expressed as a percentage. *P ⬍ 0.05 vs. SHAM.
RESULTS
Physiological parameters. Relevant physiological parameters are presented in Table 2. Body weight at the end of the
protocol was similar among groups. Although lung wet-to-dry
ratio did not differ among groups, 63% of untrained MI rats
presented lung edema, whereas only 33% of animals in each
trained group presented such signs of congestive HF. Soleus
muscle weight was reduced in the MI-UNT group, which did
not occur in either MI-CMT or MI-HIT. Plantaris weight did
not differ among animals. Heart weight-to-body weight was
increased in MI-UNT and MI-HIT groups. MI extension was
similar among all infarcted group.
Cardiac structure and function. Table 3 shows that MI
groups presented severe contractile dysfunction (reduced
LVFS) 4 wk after surgery, to a similar degree among the three
MI groups. Significant LV dilation at systole or diastole was
observed in MI groups 4 wk after surgery, as was thinning of
interventricular septum (Table 3), suggesting that cardiac remodeling occurred along with contractile dysfunction. CMT
and HIT promoted significant and similar improvements in
LVFS, while no temporal effect (Pre- vs. Postprotocol) was
observed in the SHAM and MI-UNT groups (Table 3). No LV
dilation was observed in MI-CMT and MI-HIT groups after the
AET protocol. IVSS returned to SHAM values 12 wk after
surgeries in all MI groups (Table 3). LV posterior wall thickness at systole increased in MI-UNT and MI-CMT groups
between the fourth and twelfth weeks after surgeries (Table 3).
No significant differences in echocardiographic parameters
were observed between MI-CMT and MI-HIT groups. Heart
rate under anesthesia did not differ among groups before or
after the experimental protocol, indicating that deepness of
anesthesia was similar among all groups during echocardiographic examination (Table 3).
Functional capacity. Functional capacity was assessed as
maximal exercise performance in running tests until exhaustion
and V̇O2 max. Figure 1A shows that both AET protocols significantly increased running performance as measured by graded
treadmill tests until exhaustion, whereas superior effects were
observed after HIT. Similarly, although CMT and HIT improved aerobic capacity (V̇O2 max) in MI rats, high-intensity
AET elevated V̇O2 max above that of the SHAM group, which
did not occur after CMT (Fig. 1B). Running intensity at
V̇O2 max (iV̇O2 max) also increased in both trained groups and
was higher in MI-HIT than MI-CMT (Fig. 1C).
Skeletal muscle fiber type distribution and cross-sectional area.
Myosin ATPase staining of skeletal muscle sections revealed that
both moderate- and high-intensity AET increased slow-twitch
fiber (i.e., type I) percentage in soleus muscle (Fig. 2A). CMT also
increased type I fiber percentage in plantaris muscle, whereas
a trend toward increase was observed after HIT (Fig. 2B; P ⫽
Table 3. Echocardiographic data
SHAM
LVFS, %
LVESD, mm
LVEDD, mm
IVSS, mm
IVSD, mm
LVPWS, mm
LVPWD, mm
HRanest, bpm
MI-UNT
MI-CMT
MI-HIT
Pre (n ⫽ 8)
Post (n ⫽ 8)
Pre (n ⫽ 10)
Post (n ⫽ 9)
Pre (n ⫽ 10)
Post (n ⫽ 10)
Pre (n ⫽ 10)
Post (n ⫽ 9)
39.4 ⫾ 1.5
4.82 ⫾ 0.40
7.68 ⫾ 0.39
1.76 ⫾ 0.22
0.85 ⫾ 0.10
2.26 ⫾ 0.06
1.30 ⫾ 0.05
230 ⫾ 8
39.9 ⫾ 1.7
4.94 ⫾ 0.35
8.05 ⫾ 0.42
1.89 ⫾ 0.11
1.15 ⫾ 0.09
2.40 ⫾ 0.14
1.38 ⫾ 0.12
245 ⫾ 16
21.3 ⫾ 1.7*
7.56 ⫾ 0.38*
9.46 ⫾ 0.32*
1.27 ⫾ 0.07*
0.89 ⫾ 0.05
2.08 ⫾ 0.09
1.22 ⫾ 0.10
256 ⫾ 18
22.1 ⫾ 3.8*
7.39 ⫾ 0.62*
9.40 ⫾ 0.45§
1.63 ⫾ 0.15‡
1.00 ⫾ 0.08
2.49 ⫾ 0.17‡
1.34 ⫾ 0.07
258 ⫾ 17
23.0 ⫾ 1.4*
7.04 ⫾ 0.32*
9.14 ⫾ 0.31*
1.36 ⫾ 0.11*
0.98 ⫾ 0.06
1.79 ⫾ 0.14
1.28 ⫾ 0.05
251 ⫾ 10
35.0 ⫾ 2.5†‡
5.42 ⫾ 0.48‡
8.26 ⫾ 0.45
1.83 ⫾ 0.16‡
1.08 ⫾ 0.07
2.45 ⫾ 0.15‡
1.30 ⫾ 0.08
288 ⫾ 22
23.3 ⫾ 2.0*
7.12 ⫾ 0.37*
9.15 ⫾ 0.34*
1.20 ⫾ 0.08*
0.94 ⫾ 0.07
2.16 ⫾ 0.16
1.25 ⫾ 0.06
230 ⫾ 10
31.0 ⫾ 2.6†‡
6.04 ⫾ 0.50‡
8.69 ⫾ 0.48
1.38 ⫾ 0.05‡
0.90 ⫾ 0.04
2.23 ⫾ 0.23
1.14 ⫾ 0.08
242 ⫾ 8
LVFS, left ventricular fractional shortening; LVESD, left ventricular end-systolic diameter; LVEDD, left ventricular end-diastolic diameter; IVSS,
interventricular septum thickness at systole; IVSD, interventricular septum at diastole; LVPWS, left ventricular posterior wall thickness at systole; LVPWD, left
ventricular posterior wall at diastole; HRanest, heart rate under anesthesia; SHAM, healthy controls; Pre, 4 wk after surgical procedure; Post, 12 wk after surgical
procedure; MI, myocardial infarcted; UNT, untrained; CMT, moderate-intensity training; HIT, high-intensity training. *P ⬍ 0.05 vs. SHAM at the same time
point (Pre or Post); †P ⬍ 0.05 vs. MI-UNT at the same time point; ‡P ⬍ 0.05 vs. same group at Preprotocol; §P ⫽ 0.06 vs. SHAM at the same time point.
J Appl Physiol • doi:10.1152/japplphysiol.00760.2012 • www.jappl.org
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
repeated measures (before and after experimental protocols). All other
data were compared among groups by one-way ANOVA. In case of
statistical significance, Duncan post hoc testing was used. Statistical
significance was considered achieved when P ⬍ 0.05. Statsoft Statistica software version 8.0 was used for analysis.
High- versus Moderate-Intensity Training in Infarcted Rats
Moreira JB et al.
1033
0.07). We also measured skeletal muscle fiber CSA to verify
the effects of AET protocols on skeletal muscle trophicity.
MI-UNT animals presented atrophy of type I and type II fibers
of soleus muscle (Fig. 2, C and E), compared with SHAM
animals. Soleus muscle atrophy was not observed in any of the
trained groups and no significant differences between AET
protocols were observed (Fig. 2, C and E). On the other hand,
type I fibers of plantaris were not affected by MI or AET (Fig.
2D). However, reduced CSA of plantaris type II fibers was
observed in MI-UNT and MI-CMT groups, suggesting that
only HIT prevented MI-induced atrophy of plantaris type II
fibers (Fig. 2F).
Skeletal muscle metabolism. Citrate synthase is a pacemaking enzyme of the Krebs cycle; therefore, it is used as an
indicator of cellular aerobic metabolism. Maximal citrate synthase activity trended (P ⫽ 0.07) toward a reduction in soleus
muscle homogenates of MI-UNT animals (Fig. 3A), whereas a
significant decay was observed in the plantaris muscle of
MI-UNT animals when compared with SHAM animals (Fig.
3B). CMT and HIT similarly increased maximal citrate synthase activity in both soleus and plantaris muscles (Fig. 3, A
and B). In turn, hexokinase phosphorylates glucose as a first
reaction of glycolysis; therefore, its maximal activity may
reflect the capacity of anaerobic metabolism, thus we performed hexokinase assays in soleus and plantaris muscles.
Untrained MI rats presented significant impairment of maximal
hexokinase activity in soleus and plantaris muscles, which was
prevented by CMT and HIT (Fig. 3, C and D). No differences
were found between AET protocols for hexokinase activity
(Fig. 3, C and D). Because skeletal muscle glycogen is an
important source of long-term energy and its depletion rate was
shown to be altered in HF (28, 36), we assessed soleus and
plantaris glycogen content. Skeletal muscle glycogen content
was not altered by MI, although both AET protocols substantially increased soleus and plantaris glycogen content (Fig. 3, E
and F), without differences between AET protocols. Considering our findings on citrate synthase activity, we further
performed qPCR to detect possible differences in mRNA levels
of mitochondrial transcriptional factors and genes involved in
mitochondrial biogenesis (Table 4). Despite no statistically
significant differences being observed in the plantaris muscle,
we found that transcription factor A mitochondrial (TFAM)
mRNA levels were significantly reduced in soleus muscle of
MI-UNT animals, and both AET protocols prevented this
reduction. Interestingly, both training protocols reduced
mRNA levels of pyruvate dehydrogenase kinase 4 (PDK4), an
endogenous inhibitor of pyruvate dehydrogenase (PDH),when
compared with the SHAM and MI-UNT groups.
Skeletal muscle redox balance. SOD maximal activity presented as being reduced in soleus muscle of untrained MI rats
(Fig. 4A) and a decay trend (P ⫽ 0.06) was observed in the
plantaris muscles of this group (Fig. 4B). CMT increased SOD
maximal activity, whereas HIT prevented the MI-induced decrease in SOD maximal activity in soleus muscle (Fig. 4A).
Catalase maximal activity was not different among groups in
any of the muscles studied (Fig. 4, C and D). Because glutathione is a powerful antioxidant buffer, we assessed its redox
state in soleus and plantaris muscles. Free glutathione concentration (i.e., GSH, reduced state) was unchanged among groups
in soleus (Fig. 4E) and plantaris (Fig. 4F) muscles. We found
an increased concentration of oxidized glutathione (i.e., gluta-
J Appl Physiol • doi:10.1152/japplphysiol.00760.2012 • www.jappl.org
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
Fig. 1. Functional capacity. Total distance run in graded treadmill running tests
(A), aerobic capacity (V̇O2 max) (B), and running intensity at which V̇O2 max was
reached (iV̇O2 max) (C) 4 (Preprotocol) and 12 wk (Postprotocol) after surgical
procedures in healthy control (SHAM) and myocardial infarcted (MI) rats that
remained untrained (UNT) or underwent either moderate-intensity training
(CMT) or high-intensity training (HIT). V̇O2 max was measured in 6 animals
from each group because V̇O2 max assessment requires individual testing of
each animal. Data are presented as mean ⫾ SEM. *P ⬍ 0.05 vs. SHAM at the
same time point; #P ⬍ 0.05 vs. MI-UNT at the same time point; §P ⬍ 0.05 vs.
Preprotocol of same group; ‡P ⬍ 0.05 vs. all other groups at the same time
point.
•
1034
High- versus Moderate-Intensity Training in Infarcted Rats
•
Moreira JB et al.
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
Fig. 2. Skeletal muscle fiber type distribution
and cross-sectional area (CSA). Skeletal
muscle fiber type distribution in soleus (A)
and plantaris (B); CSA of type I fibers in
soleus (C) and plantaris (D); and CSA of
type II fibers in soleus (E) and plantaris (F)
muscles of SHAM and MI rats that remained
untrained (UNT) or underwent either CMT
or HIT. Data are presented as mean ⫾ SEM.
*P ⬍ 0.05 vs. SHAM; #P ⬍ 0.05 vs. MIUNT.
thione disulfide, or GSSG) in soleus muscle of MI-UNT rats
(Fig. 4G), which did not occur in MI-CMT or MI-HIT rats. We
did not find a statistical difference between MI-CMT and
MI-HIT animals in any of the above-mentioned variables.
Skeletal muscle ubiquitin-proteasome system. Activity of
26S proteasome was evaluated in soleus and plantaris muscles
as an index of the ubiquitin-proteasome system (UPS) activation. Chymotrypsin-like proteasomal activity was increased in
soleus (Fig. 5A) and plantaris (Fig. 5B) muscles of MI-UNT rats,
which was prevented by both AET protocols, and no difference
was observed between CMT and HIT (Fig. 5, A and B). Protein
ubiquitination was also measured because it is the master signal
for proteasomal degradation, and accumulation of ubiquitinated
proteins is observed when excessive protein damage occurs.
Figure 5C shows that MI increased protein ubiquitination in
soleus muscle of untrained rats, which was equally prevented by
CMT and HIT. Protein ubiquitination in plantaris (Fig. 5D) and
protein carbonylation in soleus and plantaris muscles (data not
shown) did not differ among groups. We also assessed mRNA
levels of ubiquitin ligases required in muscle atrophy (6). Soleus
atrogin-1 mRNA levels were reduced by HIT in MI rats (Fig. 5E).
Similarly, MuRF1 mRNA levels were reduced in MI-CMT and
MI-HIT rats compared with SHAM rats (Fig. 5G). When attention
is turned to the plantaris muscle, only MI-UNT animals presented
increased mRNA levels of atrogin-1 (Fig. 5F) compared with
SHAM animals. Plantaris MURF1 mRNA levels were not altered
in any of the MI groups (Fig. 5H).
DISCUSSION
Skeletal muscle abnormalities are known to contribute to
exercise intolerance and low functional capacity in patients
J Appl Physiol • doi:10.1152/japplphysiol.00760.2012 • www.jappl.org
High- versus Moderate-Intensity Training in Infarcted Rats
•
Moreira JB et al.
1035
with cardiac problems (14, 29); however, it is still an underestimated problem for a patient’s prognosis because no available medication is effectively able to counteract its consequences, which highlights the importance of AET as therapy
for cardiovascular diseases.
In this sense, the major finding of this study was that CMT
and HIT equally counteracted skeletal muscle maladaptation in
infarcted rats. We show that skeletal muscle metabolic, structural, and intracellular abnormalities observed in infarcted rats
were prevented by both AET protocols.
Echocardiographic data show that MI groups displayed similar degrees of contractile dysfunction and left ventricular
enlargement 4 wk after the surgeries, compared with SHAM
animals, which corroborate the histological evaluation of MI
extension and indicates that induced cardiac damage was
similar among infarcted groups before training intervention.
Interventricular septum thinning was also depicted in all three
MI groups in the preprotocol evaluation, which when taken
together with contractile dysfunction and ventricular hypertrophy, demonstrates pathological remodeling after MI. More
than 60% of MI-UNT rats presented lung edema along with
contractile dysfunction, suggesting the development of congestive HF in this subset of animals. Only 33% of MI-CMT or
MI-HIT animals presented such a sign, which was not accompanied by contractile dysfunction, because both training protocols substantially improved LVFS and reverted left ventricular enlargement in MI rats to values close to those of SHAM
animals. Corroborating previous findings in human and animal
models (20, 54, 60), we show here that HIT promoted superior
improvements in running performance and aerobic capacity
than CMT, in such a way that MI-HIT presented higher aerobic
capacity than the SHAM group, which was not observed in
the MI-CMT group. Workload at V̇O2 max was also superiorly improved by HIT in MI rats. These data indicate that
J Appl Physiol • doi:10.1152/japplphysiol.00760.2012 • www.jappl.org
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
Fig. 3. Skeletal muscle metabolism. Citrate
synthase maximal activity in soleus (A) and
plantaris (B), hexokinase maximal activity in
soleus (C) and plantaris (D), and glycogen
content in soleus (E) and plantaris (F) muscles of SHAM and MI rats that remained
untrained (UNT) or underwent either CMT
or HIT. Data are presented as mean ⫾ SEM.
*P ⬍ 0.05 vs. SHAM; #P ⬍ 0.05 vs. MIUNT.
1036
High- versus Moderate-Intensity Training in Infarcted Rats
•
Moreira JB et al.
Table 4. mRNA levels of mitochondrial-related genes
Soleus muscle
PDK4
TFAM
PGC-1␣
PPAR-delta
Plantaris muscle
PDK4
TFAM
PGC-1␣
PPAR-delta
SHAM (n ⫽ 8)
MI-UNT (n ⫽ 10)
MI-CMT (n ⫽ 8)
MI-HIT (n ⫽ 10)
1.00 ⫾ 0.16
1.00 ⫾ 0.04
1.00 ⫾ 0.18
1.00 ⫾ 0.13
0.96 ⫾ 0.20
0.80 ⫾ 0.04
0.98 ⫾ 0.25
0.88 ⫾ 0.17
0.40 ⫾ 0.09*†
0.93 ⫾ 0.07
0.59 ⫾ 0.09
0.61 ⫾ 0.10
0.48 ⫾ 0.08*†
0.86 ⫾ 0.07
0.53 ⫾ 0.14
0.62 ⫾ 0.12
1.00 ⫾ 0.38
1.00 ⫾ 0.11
1.00 ⫾ 0.11
1.00 ⫾ 0.20
0.83 ⫾ 0.22
1.07 ⫾ 0.05
1.18 ⫾ 0.13
1.14 ⫾ 0.15
0.54 ⫾ 0.19
1.09 ⫾ 0.09
0.94 ⫾ 0.13
0.89 ⫾ 0.07
0.85 ⫾ 0.15
1.12 ⫾ 0.06
0.92 ⫾ 0.12
0.91 ⫾ 0.11
PDK4, pyruvate dehydrogenase isozyme 4; TFAM, transcription factor A, mitochondrial; PGC-1␣, peroxisome proliferator-activated receptor gamma
coactivator 1-alpha; PPAR-delta, peroxisome proliferator-activated receptor-delta; SHAM, healthy controls; MI, myocardial infarcted; UNT, untrained; CMT,
moderate-intensity training; HIT, high-intensity training. *P ⬍ 0.05 vs. SHAM; †P ⬍ 0.05 vs. MI-UNT.
ingly, protein expression of those components was unaltered in
MI-UNT rats (data not shown), suggesting that TFAM reduction in MI-UNT rats did not result in reduced mitochondrial
biogenesis in soleus muscle. Therefore, training protocols
might control oxidative metabolism by modulating enzyme
activity other than expression, which is further suggested by
the fact that PDK4 mRNA levels was reduced in soleus muscle
of both trained groups. In fact, a lower inhibitory drive over
PDH would thereby result in a higher PDH activity, although
its expression was unchanged among groups in both muscles.
Anaerobic metabolism was also impaired in MI-UNT rats as
suggested by reduced hexokinase activity in both soleus and
plantaris muscles of this group. CMT and HIT effectively
increased hexokinase maximal activity in plantaris muscle,
whereas only HIT improved such a parameter in the soleus
muscle, reinforcing the importance of studying skeletal muscle
comprised of fibers of different characteristics (i.e., oxidative
vs. glycolytic), which may present distinct responses to pathological and physiological stimuli (10, 48). Skeletal muscle
glycogen content was not altered by MI, which has already
been reported in this animal model (36). However, it was also
shown that the rate of glycogen depletion is more pronounced
in patients with HF and in the infarcted rat animal model (28,
36); therefore, the increased glycogen content in both soleus
and plantaris muscles of MI-CMT and MI-HIT groups indicates similar enhancement of metabolic capacity by moderateor high-intensity AET in infarcted rats.
For decades, acknowledgeable studies reported skeletal
muscle atrophy as a major aggravator of HF syndrome (3, 29,
52). Later, the related literature provided reports of distinct
response to atrophic stimuli between different muscles, suggesting that oxidative muscles (e.g., soleus) are more susceptible to damage due to inactivity or unloading, whereas glycolytic muscles (e.g., plantaris or extensor digitorum longus) tend
to be more affected in diseased conditions (42, 47, 51, 58, 59).
Considering that HF is a degenerative and rather complex
disease, there is no absolute agreement on which muscle will
present the most pronounced damage after MI; therefore, we
decided to evaluate both soleus and plantaris muscle due to
their contrasting metabolic properties.
Soleus atrophy in MI rats is demonstrated here by reduced
CSA of type I and type II muscle fibers in MI-UNT rats. Either
CMT or HIT was able to maintain normal CSA of soleus fibers
in MI rats (i.e., similar to SHAM values). Interestingly, plantaris muscle presented a distinct response to pathological (i.e.,
J Appl Physiol • doi:10.1152/japplphysiol.00760.2012 • www.jappl.org
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
HIT promoted superior improvement of functional capacity
than CMT in MI rats.
Depressed skeletal muscle aerobic capacity has already been
reported in HF (52). Pioneer studies identified impaired metabolic capacity in skeletal muscle of patients with HF as a major
alteration and correlating with exercise intolerance (30 –32),
disturbing the dogma that HF affects only the cardiac muscle.
Our data suggest that these metabolic abnormalities were more
pronounced in plantaris muscle, which probably occurred due
to the reduced number of type I (oxidative) fibers in this
muscle, compared with soleus. Reduction of citrate synthase
maximal activity may compromise de novo ATP synthesis
during exercise in MI rats; therefore, the higher maximal
citrate synthase activity in MI-CMT and MI-HIT rats than in
MI-UNT rats suggests aerobic metabolism improvements in
both trained groups. Of particular interest, citrate synthase
maximal activity in soleus muscle positively correlated with
running performance (r ⫽ 0.46, P ⬍ 0.05), whereas the
correlation between left ventricular contractile function and
running performance was not significant (r ⫽ 0.22, P ⬎ 0.12).
It is clear that these findings do not guarantee a causal relationship between skeletal muscle aerobic capacity and running
performance in our model, but they corroborate previous reports from the literature, demonstrating a strong correlation
between skeletal muscle parameters and functional capacity in
patients with HF (24) and important relationships between
metabolic skeletal muscle adaptations and training and improvements in performance (56). An increased percentage of
type I (i.e., oxidative) fibers in soleus and plantaris muscles of
both trained groups is further evidence that CMT and HIT
enhanced skeletal muscle aerobic metabolism in infarcted rats.
Our findings regarding aerobic metabolism corroborate a recent report by Bartlett and colleagues (5) showing that a single
bout of high-intensity interval exercise or continuous exercise
equally induce activation of signaling pathways associated
with mitochondrial biogenesis. Due to this fact, we evaluated
mRNA levels of different mitochondrial transcription factors
and found that both training protocols prevented the reduction
of TFAM gene expression (Table 4). Because TFAM plays a
key role in mitochondrial genome replication, we also hypothesized that mitochondrial density would be reduced in soleus
muscle of MI-UNT rats. To test this hypothesis, we performed
immunoblotting to detect protein levels of the mitochondrial
components ATP synthase, mitochondrial malate dehydrogenase 2 (MDH2), and pyruvate dehydrogenase (PDH). Surpris-
High- versus Moderate-Intensity Training in Infarcted Rats
•
Moreira JB et al.
1037
MI) and physiological (i.e., AET) stimuli. Only type II fibers of
plantaris muscle were atrophied in MI-UNT rats, whereas
CMT presented absolutely no effect in type II CSA in this
muscle and only a modest preventive effect of HIT was
observed, because MI-HIT still presented a strong trend (P ⫽
0.07) toward plantaris type II fiber atrophy. Neither MI nor
AET protocols affected plantaris type I fiber CSA. This differential response to stimuli between type II and type I fibers
might be explained by two main factors: blood supply and
oxidative damage. Although capillary rarefaction in skeletal
muscle in patients with HF has been earlier identified (38), Li
and colleagues more recently demonstrated that type II fibers
display a greater loss of capillarization than type I in an animal
model of HF (26), so the greater lack of perfusion may
aggravate atrophy in type II fibers. The second factor (i.e.,
oxidative damage) was described by Yu and colleagues in a
recent study (61) when they suggested that glycolytic muscle
fibers are subjected to increased damage after a cachectic
J Appl Physiol • doi:10.1152/japplphysiol.00760.2012 • www.jappl.org
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
Fig. 4. Skeletal muscle redox balance. Superoxide dismutase (SOD) maximal activity
in soleus (A) and plantaris (B), catalase maximal activity in soleus (C) and plantaris (D),
reduced glutathione (GSH) concentration in
soleus (E) and plantaris (F), and oxidized
glutathione (GSSG) concentration in soleus
(G) and plantaris (H) muscles of SHAM and
MI rats that remained untrained (UNT) or
underwent either CMT or HIT. Data are
presented as mean ⫾ SEM. *P ⬍ 0.05 vs.
SHAM; #P ⬍ 0.05 vs. MI-UNT.
1038
High- versus Moderate-Intensity Training in Infarcted Rats
•
Moreira JB et al.
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
Fig. 5. Skeletal muscle ubiquitin-proteasome system. 26S
proteasome activity in soleus (A) and plantaris (B), protein
ubiquitination in soleus (C) and plantaris (D), atrogin-1
mRNA levels in soleus (E) and plantaris (F), and MuRF1
mRNA levels in soleus (G) and plantaris (H) muscles of
SHAM and MI rats that remained untrained (UNT) or
underwent either CMT or HIT. Representative blots of
ubiquitin and Ponceau staining of the membrane are presented beneath C and D. Data are presented as mean ⫾
SEM. *P ⬍ 0.05 vs. SHAM.
stimulus due to its reduced production of nitric oxide, which is
an important agent capable of inducing expression of antioxidant enzymes.
Thus considering the important role played by oxidative
stress in skeletal muscle under catabolic states, we conducted
experiments to verify the effects of the two AET protocols on
pro- and antioxidant drive in infarcted rats. We found that AET
protocols prevented the MI-induced impairment of SOD in
both muscles studied, indicating a better scavenging capacity
of reactive oxygen species in trained groups. In addition, we
J Appl Physiol • doi:10.1152/japplphysiol.00760.2012 • www.jappl.org
High- versus Moderate-Intensity Training in Infarcted Rats
Moreira JB et al.
1039
levels. Simonini and colleagues, by using the same rat model of
MI, previously demonstrated that similar skeletal muscle alterations as shown in our study did not correlate with spontaneous
activity levels (49), levels that were not reduced in infarcted
rats. In line with experimental findings, a more recent study in
a human cohort showed that activity levels in patients with HF
were not reduced when compared with healthy control subjects
(55), even though they presented significantly reduced lower
limb muscle function, supporting the idea that inactivity is not
the main driving force behind skeletal myopathy in that population.
This study provides important evidence regarding intracellular pathways that possibly underlie the beneficial AET effects
on skeletal muscle in cardiovascular commitments and, for the
first time, presents a systematic comparison between moderateand high-intensity AET effects on skeletal muscle in a model
of cardiovascular disease. Our data suggest that both CMT and
HIT effectively counteracted metabolic impairment, redox unbalance, and UPS activation that accompanied skeletal muscle
atrophy in a model of ischemic cardiomyopathy. Despite superior effects of HIT in improving functional capacity in
infarcted rats, we conclude that skeletal muscle adaptations
were remarkably similar between CMT and HIT.
Limitations. As reported in several studies (33, 44, 50, 63),
the cardiac and systemic responses to MI are reasonably
variable among animals. This can be partially due to Wistar
rats being an outbred lineage, thus presumably genetically
diverse. In this study we did not observe signs of congestive
HF in all infarcted rats; however, pathological cardiac remodeling (4 and 12 wk after surgeries) and lung edema were
observed in a great number of infarcted rats, particularly those
that remained untrained, as we presented in the article. In
addition, the degree of contractile dysfunction was similar
among the three infarcted groups before training intervention,
and so was MI extension, as evaluated by histology. Although
the beneficial effects of both AET protocols on skeletal muscle
are evidenced in most of our data, we cannot conclude whether
AET protocols reverted or prevented skeletal myopathy in
infarcted rats, due to methodological limitations. This issue can
be solved only by taking skeletal muscle biopsies at different
time points after MI, which is clearly not possible in this
animal model, which calls for studies in human subjects (e.g.,
patients with HF post-MI). We used a synthetic substrate for
assessment of proteasome activity, which does not allow us to
verify which proteins were being degraded by this protease, but
taken together with immunoblotting of ubiquitinated proteins,
this assay provides an important indicator of UPS activation in
skeletal muscle.
ACKNOWLEDGMENTS
We thank Katt C. Mattos and Marcele A. Coelho for technical assistance.
GRANTS
J.B.M. held a master degree scholarship from Fundação de Amparo à
Pesquisa do Estado de São Paulo, Brazil (FAPESP 2009/12640-9). P.C.B.
holds grants from FAPESP (2010/50048-1) and Conselho Nacional de Pesquisa e Desenvolvimento (CNPq 302201/2011-4).
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the author(s).
J Appl Physiol • doi:10.1152/japplphysiol.00760.2012 • www.jappl.org
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
found an increased concentration of glutathione disulfide
(GSSG) in soleus lysates from the MI-UNT group. Reduced
glutathione (GSH) is a potent endogenous antioxidant; therefore, that MI-UNT rats presented increased levels of oxidized
glutathione (GSSG) and normal levels of GSH, suggests a
redox imbalance in soleus muscles of this group, which was
not observed in MI-CMT or MI-HIT groups, whereas no
differences were found between CMT and HIT.
Atrophying muscles are also known to display boosted
catabolic signaling (16), and special attention is driven to the
ubiquitin-proteasome system (UPS), which is responsible for
selective degradation of damaged proteins and required for
skeletal muscle atrophy after hind limb nerve injuries (6).
Therefore, we also evaluated the activation of the UPS by
measuring mRNA levels of two major ubiquitin ligases, protein ubiquitination (the master signal for proteasomal degradation), and maximal activity of 26S proteasome in its chymotrypsin site, the major determinant of overall proteolysis (22).
We observed increased proteasomal activity in both soleus and
plantaris muscles of MI-UNT rats, which did not occur in
MI-CMT and MI-HIT rats, indicating that training protocols
equally prevented proteasomal overactivation. Interestingly,
accumulation of ubiquitinated proteins was found only in the
soleus muscle of MI-UNT, which was also prevented by both
CMT and HIT, without significant difference between AET
protocols. Messenger RNA levels of atrogin-1 and MuRF1
corroborate, at least in part, the data on protein ubiquitination
and proteasomal activity. Protein ubiquitination was not
changed in plantaris muscle, so we show once again a distinct
response between soleus and plantaris muscles, which in this
case might be explained by the fact that only type II fibers
atrophied in plantaris muscle of MI-UNT rats, whereas in the
soleus muscle the amount of damaged proteins was superior
(suggested by atrophy of both type I and type II fibers), and
even an increased protein breakdown (i.e., increased proteasomal activity) was not sufficient to restrain the accumulation
of ubiquitinated proteins. The intriguing fact that soleus muscle
in MI-UNT rats presented higher proteasomal activity and
accumulation of ubiquitinated proteins despite unchanged
MuRF1 and atrogin-1 mRNA levels led us to look for possible
explanations. These two E3 ligases gained extraordinary attention after the discovery that mice lacking either of them would
have blunted atrophic response to denervation (6). However,
several other E3 ligases are able to drive ubiquitination (13,
41), which can partly explain our finding of higher ubiquitination in soleus muscle of MI-UNT rats. In addition, a recent
study demonstrated that MuRF1-null mice experience an exaggerated increase in proteasomal activity after denervation,
despite blunted muscle atrophy (19). Considering those unexpected findings, the authors and other studies showed that two
other factors could be involved in upregulation of proteasomal
activity, even in the complete absence of MuRF1: 1) an
increase in total number of proteasomes and their regulators
(25); and 2) differential regulation of deubiquitinating enzymes
(53), the latter being addressed in a recent publication by our
group (11), when we used a mouse model of heart failure.
One could argue that the observed alterations in MI-UNT
rats might be due to inactivity, other than circulating and local
factors induced by MI. However, there is compelling evidence
in the literature showing that skeletal muscle alterations in
cardiovascular diseases occur independently of lower activity
•
1040
High- versus Moderate-Intensity Training in Infarcted Rats
AUTHOR CONTRIBUTIONS
Author contributions: J.B.M., U.W., and P.C.B. conceived and designed
research; J.B.M., L.R.G.B., L.H.B., P.R.J., A.W.M., P.M.D., and P.C.B.
performed experiments; J.B.M., L.R.G.B., L.H.B., P.R.J., A.W.M., P.M.D.,
and P.C.B. analyzed data; J.B.M., L.R.G.B., L.H.B., P.R.J., A.W.M., P.M.D.,
U.W., and P.C.B. interpreted results of experiments; J.B.M. and P.C.B.
prepared figures; J.B.M., U.W., and P.C.B. drafted manuscript; J.B.M.,
L.R.G.B., U.W., and P.C.B. edited and revised manuscript; J.B.M., L.R.G.B.,
L.H.B., P.R.J., A.W.M., P.M.D., U.W., and P.C.B. approved final version of
manuscript.
18.
19.
20.
REFERENCES
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
Moreira JB et al.
correlation between reduced local inflammation and improved oxidative
capacity in the skeletal muscle. Eur J Cardiovasc Prev Rehabil 12:
393–400, 2005.
Gielen S, Adams V, Möbius-Winkler S, Linke A, Erbs S, Yu J, Kempf
W, Schubert A, Schuler G, Hambrecht R. Anti-inflammatory effects of
exercise training in the skeletal muscle of patients with chronic heart
failure. J Am Coll Cardiol 42: 861–868, 2003.
Gomes AV, Waddell DS, Siu R, Stein M, Dewey S, Furlow JD, Bodine
SC. Upregulation of proteasome activity in muscle RING finger 1-null
mice following denervation. FASEB J 26: 2986 –2999, 2012.
Haram PM, Kemi OJ, Lee SJ, Bendheim MO, Al-Share QY, Waldum
HL, Gilligan LJ, Koch LG, Britton SL, Najjar SM, Wisloff U. Aerobic
interval training vs. continuous moderate exercise in the metabolic syndrome of rats artificially selected for low aerobic capacity. Cardiovasc Res
81: 723–732, 2009.
Jondeau G, Katz SD, Zohman L, Goldberger M, McCarthy M,
Bourdarias JP, LeJemtel TH. Active skeletal muscle mass and cardiopulmonary reserve. Failure to attain peak aerobic capacity during maximal
bicycle exercise in patients with severe congestive heart failure. Circulation 86: 1351–1356, 1992.
Kisselev AF, Akopian TN, Castillo V, Goldberg AL. Proteasome active
sites allosterically regulate each other, suggesting a cyclical bite-chew
mechanism for protein breakdown. Mol Cell 4: 395–402, 1999.
Kuthan H, Haussmann HJ, Werringloer J. A spectrophotometric assay
for superoxide dismutase activities in crude tissue fractions. Biochem J
237: 175–180, 1986.
Lang CC, Chomsky DB, Rayos G, Yeoh TK, Wilson JR. Skeletal
muscle mass and exercise performance in stable ambulatory patients with
heart failure. J Appl Physiol 82: 257–261, 1997.
Li J, Powell SR, Wang X. Enhancement of proteasome function by
PA28␣ overexpression protects against oxidative stress. FASEB J 25:
883–893, 2011.
Li P, Waters RE, Redfern SI, Zhang M, Mao L, Annex BH, Yan Z.
Oxidative phenotype protects myofibers from pathological insults induced
by chronic heart failure in mice. Am J Pathol 170: 599 –608, 2007.
Linke A, Adams V, Schulze PC, Erbs S, Gielen S, Fiehn E, MöbiusWinkler S, Schubert A, Schuler G, Hambrecht R. Antioxidative effects
of exercise training in patients with chronic heart failure: increase in
radical scavenger enzyme activity in skeletal muscle. Circulation 111:
1763–1770, 2005.
Mancini D, Benaminovitz A, Cordisco ME, Karmally W, Weinberg A.
Slowed glycogen utilization enhances exercise endurance in patients with
heart failure. J Am Coll Cardiol 34: 1807–1812, 1999.
Mancini DM, Walter G, Reichek N, Lenkinski R, McCully KK,
Mullen JL, Wilson JR. Contribution of skeletal muscle atrophy to
exercise intolerance and altered muscle metabolism in heart failure.
Circulation 85: 1364 –1373, 1992.
Massie B, Conway M, Yonge R, Frostick S, Ledingham J, Sleight P,
Radda G, Rajagopalan B. Skeletal muscle metabolism in patients with
congestive heart failure: relation to clinical severity and blood flow.
Circulation 76: 1009 –1019, 1987.
Massie BM, Conway M, Rajagopalan B, Yonge R, Frostick S, Ledingham J, Sleight P, Radda G. Skeletal muscle metabolism during
exercise under ischemic conditions in congestive heart failure. Evidence
for abnormalities unrelated to blood flow. Circulation 78: 320 –326, 1988.
Massie BM, Simonini A, Sahgal P, Wells L, Dudley GA. Relation of
systemic and local muscle exercise capacity to skeletal muscle characteristics in men with congestive heart failure. J Am Coll Cardiol 27:
140 –145, 1996.
Minicucci MF, Azevedo PS, Martinez PF, Lima AR, Bonomo C,
Guizoni DM, Polegato BF, Okoshi MP, Okoshi K, Matsubara BB,
Paiva SA, Zornoff LA. Critical infarct size to induce ventricular remodeling, cardiac dysfunction and heart failure in rats. Int J Cardiol 151:
242–243, 2011.
Minotti JR, Johnson EC, Hudson TL, Zuroske G, Murata G, Fukushima E, Cagle TG, Chick TW, Massie BM, Icenogle MV. Skeletal
muscle response to exercise training in congestive heart failure. J Clin
Invest 86: 751–758, 1990.
Moholdt T, Aamot IL, Gran兾oien I, Gjerde L, Myklebust G, Walderhaug L, Brattbakk L, Hole T, Graven T, St兾olen TO, Amundsen BH,
M兾olmen-Hansen HE, St兾oylen A, Wisl兾off U, Sl兾ordahl SA. Aerobic
interval training increases peak oxygen uptake more than usual care
exercise training in myocardial infarction patients: a randomized controlled study. Clin Rehabil 26: 33–44, 2012.
J Appl Physiol • doi:10.1152/japplphysiol.00760.2012 • www.jappl.org
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
1. Adamopoulos S, Coats AJ, Brunotte F, Arnolda L, Meyer T, Thompson CH, Dunn JF, Stratton J, Kemp GJ, Radda GK, Rajagopalan B.
Physical training improves skeletal muscle metabolism in patients with
chronic heart failure. J Am Coll Cardiol 21: 1101–1106, 1993.
2. Alp PR, Newsholme EA, Zammit VA. Activities of citrate synthase and
NAD⫹-linked and NADP⫹-linked isocitrate dehydrogenase in muscle
from vertebrates and invertebrates. Biochem J 154: 689 –700, 1976.
3. Anker SD, Ponikowski P, Varney S, Chua TP, Clark AL, WebbPeploe KM, Harrington D, Kox WJ, Poole-Wilson PA, Coats AJ.
Wasting as independent risk factor for mortality in chronic heart failure.
Lancet 349: 1050 –1053, 1997.
4. Bacurau AV, Jardim MA, Ferreira JC, Bechara LR, Bueno CR Jr,
Alba-Loureiro TC, Negrao CE, Casarini DE, Curi R, Ramires PR,
Moriscot AS, Brum PC. Sympathetic hyperactivity differentially affects
skeletal muscle mass in developing heart failure: role of exercise training.
J Appl Physiol 106: 1631–1640, 2009.
5. Bartlett JD, Hwa Joo C, Jeong TS, Louhelainen J, Cochran AJ,
Gibala MJ, Gregson W, Close GL, Drust B, Morton JP. Matched work
high-intensity interval and continuous running induce similar increases in
PGC-1alpha mRNA, AMPK, p38, and p53 phosphorylation in human
skeletal muscle. J Appl Physiol 112: 1135–1143, 2012.
6. Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA,
Poueymirou WT, Panaro FJ, Na E, Dharmarajan K, Pan ZQ, Valenzuela DM, DeChiara TM, Stitt TN, Yancopoulos GD, Glass DJ.
Identification of ubiquitin ligases required for skeletal muscle atrophy.
Science 294: 1704 –1708, 2001.
7. Brooke MH, Kaiser KK. Muscle fiber types: how many and what kind?
Arch Neurol 23: 369 –379, 1970.
8. Brum PC, Bacurau AV, Medeiros A, Ferreira JC, Vanzelli AS,
Negrão CE. Aerobic exercise training in heart failure: impact on sympathetic hyperactivity and cardiac and skeletal muscle function. Braz J Biol
Res 44: 827–835, 2011.
9. Bueno CR Jr, Ferreira JC, Pereira MG, Bacurau AV, Brum PC.
Aerobic exercise training improves skeletal muscle function and Ca2⫹
handling-related protein expression in sympathetic hyperactivity-induced
heart failure. J Appl Physiol 109: 702–709, 2010.
10. Carlson CJ, Booth FW, Gordon SE. Skeletal muscle myostatin mRNA
expression is fiber-type specific and increases during hindlimb unloading.
Am J Physiol Regul Integr Comp Physiol 277: R601–R606, 1999.
11. Cunha TF, Bacurau AV, Moreira JB, Paixão NA, Campos JC, Ferreira JC, Leal ML, Negrão CE, Moriscot AS, Wisl兾off U, Brum PC.
Exercise training prevents oxidative stress and ubiquitin-proteasome system overactivity and reverse skeletal muscle atrophy in heart failure. PLos
One 7: e41701, 2012.
12. Dalla Libera L, Sabbadini R, Renken C, Ravara B, Sandri M, Betto R,
Angelini A, Vescovo G. Apoptosis in the skeletal muscle of rats with heart
failure is associated with increased serum levels of TNF-alpha and
sphingosine. J Mol Cell Cardiol 33: 1871–1878, 2001.
13. Deshaies RJ, Joazeiro CA. RING domain E3 ubiquitin ligases. Ann Rev
Biochem 78: 399 –434, 2009.
14. Drexler H, Riede U, Munzel T, Konig H, Funke E, Just H. Alterations
of skeletal muscle in chronic heart failure. Circulation 85: 1751–1759,
1992.
15. Ferreira JC, Rolim NP, Bartholomeu JB, Gobatto CA, Kokubun E,
Brum PC. Maximal lactate steady state in running mice: effect of exercise
training. Clin Exp Pharmacol Physiol 34: 760 –765, 2007.
16. Furuno K, Goodman MN, Goldberg AL. Role of different proteolytic
systems in the degradation of muscle proteins during denervation atrophy.
J Biol Chem 265: 8550 –8557, 1990.
17. Gielen S, Adams V, Linke A, Erbs S, Möbius-Winkler S, Schubert A,
Schuler G, Hambrecht R. Exercise training in chronic heart failure:
•
High- versus Moderate-Intensity Training in Infarcted Rats
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
Moreira JB et al.
1041
gene expression that are not explained by reduced activity. Circ Res 79:
128 –136, 1996.
Sjaastad I, Sejersted OM, Ilebekk A, Bjornerheim R. Echocardiographic criteria for detection of postinfarction congestive heart failure in
rats. J Appl Physiol 89: 1445–1454, 2000.
Squier M, Chalk C, Hilton-Jones D, Mills KR, Newsom-Davis J. Type
2 fiber predominance in Lambert-Eaton myasthenic syndrome. Muscle
Nerve 14: 625–632, 1991.
Sullivan MJ, Green HJ, Cobb FR. Skeletal muscle biochemistry and
histology in ambulatory patients with long-term heart failure. Circulation
81: 518 –527, 1990.
Sundaram P, Pang Z, Miao M, Yu L, Wing SS. USP19-deubiquitinating
enzyme regulates levels of major myofibrillar proteins in L6 muscle cells.
Am J Physiol Endocrinol Metab 297: E1283–E1290, 2009.
Tj兾onna AE, St兾olen TO, Bye A, Volden M, Sl兾ordahl SA, Odegård
R, Skogvoll E, Wisl兾off U. Aerobic interval training reduces cardiovascular risk factors more than a multitreatment approach in overweight
adolescents. Clinical Sci (Lond) 116: 317–326, 2009.
Toth MJ, Shaw AO, Miller MS, VanBuren P, LeWinter MM,
Maughan DW, Ades PA. Reduced knee extensor function in heart failure
is not explained by inactivity. Int J Cardiol 143: 276 –282, 2010.
Vollaard NB, Constantin-Teodosiu D, Fredriksson K, Rooyackers O,
Jansson E, Greenhaff PL, Timmons JA, Sundberg CJ. Systematic
analysis of adaptations in aerobic capacity and submaximal energy metabolism provides a unique insight into determinants of human aerobic
performance. J Appl Physiol 106: 1479 –1486, 2009.
Weydert CJ, Cullen JJ. Measurement of superoxide dismutase, catalase
and glutathione peroxidase in cultured cells and tissue. Nat Protoc 5:
51–66, 2010.
Wing SS, Goldberg AL. Glucocorticoids activate the ATP-ubiquitindependent proteolytic system in skeletal muscle during fasting. Am J
Physiol Endocrinol Metab 264: E668 –E676, 1993.
Wing SS, Haas AL, Goldberg AL. Increase in ubiquitin-protein conjugates concomitant with the increase in proteolysis in rat skeletal muscle
during starvation and atrophy denervation. Biochem J 307 (Pt 3): 639 –
645, 1995.
Wisl兾off U, St兾oylen A, Loennechen JP, Bruvold M, Rognmo 兾O,
Haram PM, Tj兾onna AE, Helgerud J, Sl兾ordahl SA, Lee SJ, Videm V,
Bye A, Smith GL, Najjar SM, Ellingsen 兾O, Skjaerpe T. Superior
cardiovascular effect of aerobic interval training vs. moderate continuous
training in heart failure patients: a randomized study. Circulation 115:
3086 –3094, 2007.
Yu Z, Li P, Zhang M, Hannink M, Stamler JS, Yan Z. Fiber typespecific nitric oxide protects oxidative myofibers against cachectic stimuli.
PLos One 3: e2086, 2008.
Zammit VA, Newsholme EA. The maximum activities of hexokinase,
phosphorylase, phosphofructokinase, glycerol phosphate dehydrogenases,
lactate dehydrogenase, octopine dehydrogenase, phosphoenolpyruvate
carboxykinase, nucleoside diphosphatekinase, glutamate-oxaloacetate
transaminase and arginine kinase in relation to carbohydrate utilization in
muscles from marine invertebrates. Biochem J 160: 447–462, 1976.
Zornoff LA, Paiva SA, Minicucci MF, Spadaro J. Experimental myocardium infarction in rats: analysis of the model. Arq Bras Cardiol 93:
434 – 440, 426 – 432, 2009.
J Appl Physiol • doi:10.1152/japplphysiol.00760.2012 • www.jappl.org
Downloaded from http://jap.physiology.org/ by 10.220.32.247 on June 16, 2017
36. Musch TI, Ghaul MR, Tranchitella V, Zelis R. Skeletal muscle glycogen depletion during submaximal exercise in rats with chronic heart
failure. Basic Res Cardiol 85: 606 –618, 1990.
37. Myers J, Prakash M, Froelicher V, Do D, Partington S, Atwood JE.
Exercise capacity and mortality among men referred for exercise testing.
N Engl J Med 346: 793–801, 2002.
38. Nusz DJ, White DC, Dai Q, Pippen AM, Thompson MA, Walton GB,
Parsa CJ, Koch WJ, Annex BH. Vascular rarefaction in peripheral
skeletal muscle after experimental heart failure. Am J Physiol Heart Circ
Physiol 285: H1554 –H1562, 2003.
39. Ohta Y, Kinugawa S, Matsushima S, Ono T, Sobirin MA, Inoue N,
Yokota T, Hirabayashi K, Tsutsui H. Oxidative stress impairs insulin
signal in skeletal muscle and causes insulin resistance in postinfarct heart
failure. Am J Physiol Heart Circ Physiol 300: H1637–H1644, 2011.
40. Okita K, Yonezawa K, Nishijima H, Hanada A, Ohtsubo M, Kohya T,
Murakami T, Kitabatake A. Skeletal muscle metabolism limits exercise
capacity in patients with chronic heart failure. Circulation 98: 1886 –1891,
1998.
41. Paul PK, Bhatnagar S, Mishra V, Srivastava S, Darnay BG, Choi Y,
Kumar A. The E3 ubiquitin ligase TRAF6 intercedes in starvationinduced skeletal muscle atrophy through multiple mechanisms. Mol Cell
Biol 32: 1248 –1259, 2012.
42. Pepato MT, Migliorini RH, Goldberg AL, Kettelhut IC. Role of
different proteolytic pathways in degradation of muscle protein from
streptozotocin-diabetic rats. Am J Physiol Endocrinol Metab 271: E340 –
E347, 1996.
43. Perreault CL, Gonzalez-Serratos H, Litwin SE, Sun X, FranziniArmstrong C, Morgan JP. Alterations in contractility and intracellular
Ca2⫹ transients in isolated bundles of skeletal muscle fibers from rats
with chronic heart failure. Circ Res 73: 405–412, 1993.
44. Pfeffer MA, Pfeffer JM, Steinberg C, Finn P. Survival after an experimental myocardial infarction: beneficial effects of long-term therapy with
captopril. Circulation 72: 406 –412, 1985.
45. Picard MH, Adams D, Bierig SM, Dent JM, Douglas PS, Gillam LD,
Keller AM, Malenka DJ, Masoudi FA, McCulloch M, Pellikka PA,
Peters PJ, Stainback RF, Strachan GM, Zoghbi WA. American Society
of Echocardiography recommendations for quality echocardiography laboratory operations. J Am Soc Echocardiogr 24: 1–10, 2011.
46. Pierce GL, Magyari PM, Aranda JM Jr, Edwards DG, Hamlin SA,
Hill JA, Braith RW. Effect of heart transplantation on skeletal muscle
metabolic enzyme reserve and fiber type in end-stage heart failure patients.
Clin Transplant 21: 94 –100, 2007.
47. Riley DA, Bain JL, Thompson JL, Fitts RH, Widrick JJ, Trappe SW,
Trappe TA, Costill DL. Disproportionate loss of thin filaments in human
soleus muscle after 17-day bed rest. Muscle Nerve 21: 1280 –1289, 1998.
48. Russell AP, Feilchenfeldt J, Schreiber S, Praz M, Crettenand A,
Gobelet C, Meier CA, Bell DR, Kralli A, Giacobino JP, Deriaz O.
Endurance training in humans leads to fiber type-specific increases in
levels of peroxisome proliferator-activated receptor-gamma coactivator-1
and peroxisome proliferator-activated receptor-alpha in skeletal muscle.
Diabetes 52: 2874 –2881, 2003.
49. Simonini A, Long CS, Dudley GA, Yue P, McElhinny J, Massie BM.
Heart failure in rats causes changes in skeletal muscle morphology and
•