Download Molecular analysis of 9 new families with chronic granulomatous

PHAGOCYTES
Molecular analysis of 9 new families with chronic granulomatous disease caused
by mutations in CYBA, the gene encoding p22phox
Julie Rae, Deborah Noack, Paul G. Heyworth, Beverly A. Ellis, John T. Curnutte, and Andrew R. Cross
Chronic granulomatous disease is a rare
inherited disorder caused by nonexistent
or severely decreased phagocyte superoxide production that results in a severe
defect in host defense and consequent
predisposition to microbial infection. The
enzyme responsible for generating the
superoxide, NADPH oxidase, involves at
least 5 protein components. The absence
of, or a defect in, any 1 of 4 of these
proteins (p22phox, p47phox, p67phox, or
gp91phox) gives rise to the known types of
chronic granulomatous disease. One of
the rarest forms of the disease is due to
defects in the CYBA gene encoding
p22phox, which together with gp91phox
forms flavocytochrome b558, the catalytic
core of NADPH oxidase. To date, only 9
kindreds with p22phox deficiency have
been described in the literature comprising 10 mutant alleles. Four polymorphisms in the CYBA gene have also been
reported. Here we describe 9 new, unrelated kindreds containing 12 mutations, 9
of which are novel. In addition, we report
3 new polymorphisms. The novel muta-
tions are (a) deletion of exons 2 and 3, (b)
a missense mutation in exon 3 (T155=C),
(c) a splice site mutation at the 58 end of
intron 3, (d) a missense mutation in exon
2 (G74=T), (e) a nonsense mutation in
exon 1 (G26=A), (f) a missense mutation
in exon 4 (C268=T), (g) a frameshift in
exon 3 due to the insertion of C at C162,
(h) a nonsense mutation in exon 2
(G107=A), and (i) a missense mutation in
exon 2 (G70=A). (Blood. 2000;96:1106-1112)
r 2000 by The American Society of Hematology
Introduction
Chronic granulomatous disease (CGD) is a rare inherited disorder
of the innate immune system caused by genetic defects in the
superoxide-generating NADPH oxidase of phagocytes.1 In the
absence of superoxide (O22) production by these cells, microbial
pathogens are not killed efficiently, and the host is left vulnerable to
recurrent, life-threatening infections. NADPH oxidase activity
requires the participation of at least 5 proteins. Two of them,
gp91phox and p22phox, together form a heterodimeric flavin and
heme-containing protein, flavocytochrome b558, the catalytic core
of the enzyme. Flavocytochrome b558 is present in the specific
granule and plasma membranes of resting neutrophils. In contrast,
p47phox, p67phox, and p40phox form a complex located in the cytosolic
compartment of resting neutrophils. This complex translocates to
the membrane and associates with flavocytochrome b558 during
oxidase activation. The small GTP-binding protein, Rac2 is also
required for oxidase activity, and associates with the membrane
during the activation process (review by Clark2). Defects in the
genes encoding 4 of the phox proteins (gp91phox, p22phox, p47phox,
and p67phox) are known to cause CGD. The protein p40phox has been
strongly implicated in NADPH oxidase regulation, but its role is
unclear at present. No disorders have been recognized that are due
to mutations in the p40phox gene (NCF-4), although p40phox levels
are reduced in p67phox-deficient CGD.3,4 Until very recently, no
genetic defects in Rac2 have been reported, which may be because
such a defect produces a lethal phenotype, or because there are
sufficient levels of the closely related Rac1 present in the phagocytes to compensate for any loss of Rac2. (Rac1 can substitute for
Rac2 in cell-free systems of oxidase activation.)5-7 However, a
single missense mutation in Rac2 has recently been reported to
cause a CGD-like condition in 1 individual. The patient was
heterozygous for the mutation but severely affected, suggesting that the amino acid substitution acts in a dominantnegative fashion. 8,9
In myeloid cells, the absence of p22phox protein because of
genetic defects also results in the loss of gp91phox expression and
vice versa, indicating that each of these proteins requires the other
for mutual stability. However, this is apparently not true of all cell
types, as gp91phox and p22phox are stably expressed in the absence of
their partners in COS7 cells.10 The primary structure of p22phox
suggests it contains 4 membrane-spanning domains in the Nterminal two-thirds of the molecule, and a proline-rich domain in
the C-terminal cytoplasmic tail. Such proline-rich regions can
mediate protein-protein association by binding to SH3 domains
that are found in a variety of proteins involved in signal transduction, including the cytosolic phox proteins. The proline-rich
domain of p22phox binds the N-terminal SH3 domain of p47phox, and
this interaction is believed to play a dominant role in promoting the
association of the cytosolic complex, containing p40phox, p47phox,
and p67phox, with flavocytochrome b558 (reviewed in Heyworth et
al11 and DeLeo and Quinn12).
The incidence of CGD is estimated to be approximately 1 in
200 000 to 250 000 individuals. The most common form (approximately 65%) is X-linked and is due to defects in the CYBB gene
that codes for gp91phox. The remaining approximately 35% of cases
are inherited in an autosomal recessive manner. A22 CGD (ie, CGD
resulting from a defect in p22phox) is one of the rarest forms of the
From the Department of Immunology, Genentech Inc, South San Francisco;
and the Department of Molecular & Experimental Medicine, The Scripps
Research Institute, La Jolla, CA.
cine, MEM-241, The Scripps Research Institute, 10550 N Torrey Pines Rd, La
Jolla, CA 92037; e-mail: [email protected].
Submitted February 17, 2000; accepted March 31, 2000.
Supported by National Institutes of Health Grant Nos. RO1 AI 24838 (A.R.C),
CA68276 (P.G.H.), and RR00833 (to the GCRC at TSRI).
Reprints: Andrew R. Cross, Department of Molecular & Experimental Medi-
1106
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
r 2000 by The American Society of Hematology
BLOOD, 1 AUGUST 2000 • VOLUME 96, NUMBER 3
BLOOD, 1 AUGUST 2000 • VOLUME 96, NUMBER 3
disease, accounting for only 6% of cases. The protein p22phox is
encoded by the CYBA gene, located on chromosome 16q24.13 The
approximately 600-base pair (bp) open reading frame is divided
into 6 exons spanning about 8.5-kilobase (kb). Carriers of the
autosomal recessive forms of CGD can be difficult to detect, as they
typically appear normal by the nitroblue tetrazolium slide test and
have rates of O22production within the normal range. Identification
of mutations in individuals with autosomally inherited forms of
CGD provides the only effective basis for detecting carriers among
family members or performing prenatal diagnoses. In the case of
A22 CGD, patients from only 9 families (18 alleles, 10 different
mutations) have been reported so far in the literature.13-17 Here we
report an additional 9 families and describe 12 mutations, 9 of
which are novel, and 3 new polymorphisms. These polymorphisms
are of potential interest because of a recent report that the C214
wild-type genotype (His72) is associated with a higher risk of
coronary heart disease than the rarer T214 (Tyr72) genotype18
although this association could not be confirmed by others.19-21
Another recent report describes a positive association of a polymorphism in the 38 untranslated region with heart disease.22 These
associations may be due to a putative role for p22phox in the activity
of a recently described isoform of flavocytochrome b558 that is
involved in mitogenic signaling 23.24
Patients, materials, and methods
Patients with chronic granulomatous disease
and family members
Patient 1 is a 2-year-old Hispanic boy whose mother and father are second
cousins. He has a history of recurrent cervical adenitis, inguinal lymphadenitis, and perirectal abscess from the age of 3 months. A male sibling died
at the age of 4 months from a sudden onset of a gastrointestinal infection. A
male cousin died at birth secondary to respiratory problems, and another
male cousin is thought to have died of multiple infections associated with
swollen joints.
Patient 2 is the son of unrelated parents with no family history of CGD.
He had recurrent infections and liver abscesses by the age of 2, a kidney
infection at age 4, and hepatic abscesses at age 8, at which time he was
diagnosed with CGD. After treatment with prophylactic antibiotics, and
with the exception of a liver abscess at age 12, he remained well until age
19. After discontinuing prophylactic antibiotic treatment, he developed 2
hepatic abscesses and a soft tissue abscess over his lower rib cage at
age 25. He died at age 29 from gram-negative septicemia after a brief
hospitalization.
Patient 3 is a 3-month-old girl with no family history of CGD. She was
diagnosed after pneumonia caused by Aspergillus.
Patient 4 is a female with no clinical or family history available. Only
DNA from the patient and her mother could be obtained.
Patient 5, a 2-year-old boy of unrelated parents, was referred after a
history of chronic otitis media, recurrent skin infections, chronic dacryocystitis, intermittent diarrhea, and a leg abscess. There is no known family
history of CGD.
Patient 6 is the 25-year-old daughter of first cousins from Southern
India. Two siblings (1 male, 1 female) both died at age 6, probably as a
result of CGD as determined from a review of pathology sections showing
the presence of multiple granuloma in lung and lymph nodes. The patient
had recurrent pulmonary infections and fever from the age of 10 months,
and was diagnosed with CGD at age 8. She has continued to have recurrent
lung infections, an episode of malaria, and a bone abscess from which
Pseudomonas aeruginosa was isolated.
Patients 7 and 7a, are sisters, 15 and 19 years of age. The elder sister has
had multifocal osteomyelitis from which Burkholderia gladioli was cultured, and also chronic immune thrombocytopenia.
MUTATIONAL ANALYSIS OF CYBA
1107
Patient 8 is a 5-year-old girl with no known family history of CGD or
intermarriage.
Patient 9 is a 6-year-old Hispanic girl diagnosed with CGD after an
episode of Serratia osteomyelitis. A chest x-ray examination showed the
presence of multiple tiny granuloma. A male sibling died in childhood. The
parents were not known to be related.
Blood samples
Blood samples were obtained from patients and their family members
(where available) by their physicians, following the procedures and
appropriate consent protocols approved by the Human Subjects Committee
of The Scripps Research Institute.
Neutrophil functional assays
Clinical diagnoses of CGD were confirmed by examination of the capacity
of neutrophils to produce O22 using the nitroblue tetrazolium (NBT) slide
test, spectrophotometric assay of cytochrome c reduction, and/or flow
cytometry (using dihydrorhodamine [DHR] or dichlorofluorescein [DCF]),
as previously described.25 The presence of flavocytochrome b558 was
ascertained using reduced-minus-oxidized difference spectroscopy26; protein immunoblotting27 and/or by flow cytometry using monoclonal antibody 7D5.28-29
Preparation of DNA, amplification by polymerase chain
reaction, and sequencing
Genomic DNA was isolated from whole blood using Puregene DNA
Isolation Kits (Gentra Systems, Inc, Minneapolis, MN) or from EBVtransformed cell lines. In the latter case, 1 3 107 cells in phosphate-buffered
saline (PBS) were pelleted, all but 200 µL of the supernatant removed and
the remainder processed using the QIAamp Blood kit (Qiagen, Valencia,
CA). In one patient, total RNA was isolated from whole blood using the
RNeasy Blood Mini kit (Qiagen, Valencia, CA) and reverse transcriptasepolymerase chain reaction (RT-PCR) was performed using the Omniscript
Reverse Transcriptase and Taq DNA Polymerase (Qiagen, Valencia, CA).
The following buffer was used for the amplification of each exon: 33.5
Table 1. Oligonucleotide primers used in this study for the amplification
of the CYBA gene
Intronic primers
1LA
ccagccgggttcgtgtc
1RA2
tggcgccccacttccccaccctgt
2LA8
ggtggcccacagtaggtagagaa
2RA8
gctcactgtgaagtggctcccca
2RA6
cgcccaccccagcctcag
3LA
ctgagctgggctgttcctt
3RA
ccacccaaccctgtgagc
4LA
caaaggagtcccgagtgg
4RA
gctccaagccctcctgag
5LA
ccctgggtctgcagtctgcct
5RA
cccaggctcacacttgctccca
5LB
cctgagactttgttggcct
5RB
ggcttcaagggccatgcgtgt
6LA5
cctctctgagtggcagtcaca
6RA3
cggccttcgctgcgttta
6LB
cctgtcccagggccccta
6RB
atgcaggtgggtgcacct
Exonic primers
cDNA 1F
ATGGGGCAGATCGAGTGGGCCAT
cDNA 2F
CTCATCACCGGGGGCATCGT
cDNA 2R
GAAGCGCCCAGCTGTGGCCACGAT
cDNA 3R
GGGTACTCCAGCAGGCACACAA
cDNA 4R
GATGCAGGACGGCCCGAACAT
cDNA 5F
CTGCTGGCCACCATCCTTGGGA
cDNA 5F2
CTGGCCATTGCGAGCGGCA
cDNA 6F
CAGATCGGAGGCACCATCA
cDNA 6R
TCACACGACCTCGTCGGTCAC
1108
BLOOD, 1 AUGUST 2000 • VOLUME 96, NUMBER 3
RAE et al
Table 2. Biochemical characteristics of the patients with CGD
Flavocytochrome
b558
NBT %
positive
cells*
Patient
Normal range
(n . 100)
.90
1 (male)
nd
2 (male)
O2
2
DCF/DHR†
Heme
content
pmol/107
cells§
122 6 26
74 6 13
1
nd
negative
0
0
negative
0
nd
negative
nd
negative
100%
0%
0
3 (female)
Protein
content/
flow
cytometry
O2
2
nmol/min/107
cells‡
nd
4 (female)
0
0%
5 (male)
0
6 (female)
0
7 and 7a (female)
0
0
8 (female)
0
nd
9 (female)
0
0.2
5.0%
0
0
negative
,5
negative
0
negative
nd
negative
0
negative
CGD 5 chronic granulomatous disease; NBT 5 nitroblue tetrazolium; DCF 5
dichlorofluorescein; DHR 5 dihydrorhodamine; nd 5 not done.
*Using the Nitroblue Tetrazolium slide test.25
†By flow cytometry using DHR or DCF. Values represent % fluorescence
compared with PMA-stimulated normal cells.
‡Using the superoxide dismutase-inhibitable rate of cytochrome c reduction.25
§Determined spectrophotometrically.26
mmol/L Tris-HCl, (pH 8.8), 8.3 mmol/L (NH4)2SO4, 3.35 mmol/L MgCl2,
85 µg/mL bovine serum albumin (BSA), 5% DMSO, 0.125 mmol/L each
dNTP, 90 ng each specific primer, 2.5 units AmpliTaq polymerase, 500 ng
genomic DNA. The primers used are shown in Table 1.
For thermocycling, the following conditions were used: For exons 1
through 5, an initial denaturation at 94°C for 3 minutes then 30 cycles of
94°C for 5 seconds, 70°C for 1 minute, followed by a 7-minute extension at
72°C. For exon 6, an initial denaturation at 94°C for 3 minutes then 30
cycles of 94°C for 30 seconds, 63°C for 15 seconds, 72°C for 30 seconds,
followed by a 7-minute extension at 72°C.
Amplified segments were purified using a QIAquick PCR purification
kit (Qiagen, Valencia, CA) and sequenced in both directions using the ABI
Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE
Applied Biosystems, Foster City, CA). Exons 1 through 5 were sequenced
using reactions mixtures as follows: 2 µL Ready Reaction Premix, 3 µL 5X
Sequencing Buffer, 10 ng primer, and 2 µL PCR product in a 20 µL total
reaction volume. Exon 6 was sequenced using undiluted BigDye Terminators: 8 µL Ready Reaction Premix, 20 ng primer, and 4 µL PCR product in a
20 µL total reaction volume. Sequencing reactions were purified in 96-well
MicroAmp Trays (PE Applied Biosystems, Foster City, CA) by precipitating with 80 µL 75% isopropanol.
The complementary DNA (cDNA) numbering system we have used
here follows the standard convention that 11 is the A of the initiator ATG
codon. This differs from the numbering of some sequences deposited in
GenBank (accession numbers M21186 and J03774). Twenty-eight should
be subtracted from the GenBank sequence number to make the initiator 11.
We have followed the standard system of designating the CGD phenotype
thus: A221 represents normal levels of expression of nonfunctional p22phox
protein; A222 represents diminished expression of p22phox, and A22°
represents an absence of p22phox expression.
Results
Absence of NADPH oxidase activity and flavocytochrome b558
in patients with CGD
The biochemical findings on the patients are reported in Table 2. In
all cases, no significant O22 production was detected by NBT
staining, cytochrome c reduction, or by flow cytometry using DHR
or DCF, or a combination of these methods. Patient 6 showed a
small amount of O22 generation by DCF assay, but gp91phox or
p22phox were undetectable by immunoblot, suggesting a complete,
or near complete absence of flavocytochrome b558. Similarly, none
of the other patients showed any evidence for gp91phox or p22phox
polypeptides by immunoblot. Where possible, the parents of the
patients were analyzed biochemically; values for O22, and flavocytochrome b558 content were in the normal to low-normal range.
Having demonstrated the absence of flavocytochrome b558 in
these patients, genetic analysis was undertaken. Because the most
common cause of CGD is X-linked and involves defects in the
CYBB gene (coding for gp91phox), the male patients in this study
(patients 1, 2, and 5) were initially analyzed for defects in the
gp91phox gene by single strand conformational polymorphism.30 In
each case, the results were normal. Conversely, it was considered
most likely that female patients deficient in flavocytochrome b558
had a primary defect in CYBA. Except in individuals with a highly
skewed X-chromosome inactivation, or with a XO karyotype, a
defect in CYBB is unlikely to be the cause of CGD in females.
Consequently, all 6 exons of the CYBA gene (coding for p22phox)
were sequenced in each patient. Primers were chosen such that
were greater than or equal to 16 intronic nucleotides at the 58 ends,
and at least 12 intronic nucleotides at the 38 ends of each exon were
sequenced, to increase the chances of detecting mutations that
result in splicing errors (Table 1).
Patient 1. Attempts to amplify exons 2 and 3 individually from
genomic DNA of patient 1 were unsuccessful. Exons 1, 4, 5, and 6
amplified normally, testifying to the integrity of the DNA and
raising the possibility of a deletion within the gene. PCR amplification of the patient’s genomic DNA from exon 1 to exon 4 (the
shortest PCR practicable) produced a single fragment of approximately 3.0-kb, in contrast to the normal 4.0-kb fragment (Figure
1A). These results indicate that the patient is homozygous for a
genomic deletion of exons 2 and 3. Products of both sizes were
Table 3. Mutations in the CYBA gene identified in this study
Patient
Maternal allele
Amino acid
change
Paternal allele
Amino acid
change
1
Exons 2-3 deleted (homozygous)
2
T155 = C (homozygous)
Missense: Leu52 = Pro
T155 = C (homozygous)
Missense: Leu52 = Pro
3
C244 deleted* (homozygous)
Frameshift
C244 deleted* (homozygous)
Frameshift
A22°
4
intron 3 58 gt = tt (homozygous)
Ssplice mutation
Intron 3 58 gt = tt (homozygous)
Splice mutation
A22°
5
G74 = T
Missense: Gly25 = Val
G26 = A
Nonsense: Trp9 = Stop
A22°
6
C268 = T (homozygous)
Missense: Arg90 = Trp
C268 = T (homozygous)
Missense: Arg90 = Trp
A22°
7 and 7a
Insertion C at C162
Frameshift
C268 = T
Missense: Arg90 = Trp
A22°
8
G107 = A
Nonsense: Trp36 = Stop
G70 = A
Missense: Gly24 = Arg
A22°
9
C354 = A
Ser118 = Arg
C354 = A
Ser118 = Arg
A22°
CGD 5 chronic granulomatous disease.
*Previously seen in a heterozygous patient.
Exons 2-3 deleted (homozygous)
CGD
type
A22°
A22°
BLOOD, 1 AUGUST 2000 • VOLUME 96, NUMBER 3
MUTATIONAL ANALYSIS OF CYBA
1109
Table 4. Polymorphisms identified in the CYBA gene
Nucleotide change
Amino acid
change
237 intron 1 38 a = g
N/A
1 normal homozygous g
3 normal heterozygotes
6 normal homozygous a
A179 = C
Lys60 = Thr
1 normal heterozygote
C214 = T
His72 = Tyr
Previously reported13
G403 = A
Glu135 = Lys
Healthy mother of patient
1 homozygous
G480 = A
Silent
2 normal homozygous A
59 normal homozygous A
3 heterozygous
42 normal homozygous G
Previously reported16
C521 = T
Ala174 = Val
3 normal homozygous T
8 normal homozygous C
Previously reported13
124 of 38 untranslated
N/A
3 normal homozygous g
1 heterozygote
7 homozygous a
Previously reported16
amplified from his mother (Figure 1A) and father (not shown),
demonstrating that they are both carriers of this deletion. Analysis
of the cDNA of the patient revealed 2 products, a major messenger
RNA (mRNA) species of 443 bp, corresponding to the skipping of
exons 2 and 3, and a minor species of 359 bp, corresponding to the
skipping of exons 2, 3, and 4 (Figure 1B). The patient and his
mother are also homozygous for a previously unreported polymorphism, the father is heterozygous. This novel polymorphism was
the substitution of A for G at nucleotide 403 in exon 6. This causes
the nonconservative substitution of lysine for glutamic acid at
amino acid 135. Seventy-five normal individuals were sequenced
without finding another allele of this type (Table 4), but in view of
the mother’s good health and positive DHR test, we conclude this
represents a rare polymorphism.
Patient 2. This patient was homozygous for a T-to-C transition
at nucleotide 155 in exon 3. This missense mutation results in the
substitution of proline for leucine at position 52. No other patient or
normal subject has been found who carry this mutation indicating
that it is unlikely to be a benign polymorphism. No other defects
were found in the patient’s CYBA gene. As expected, his mother
was heterozygous for this substitution. DNA from the father was
not available.
Patient 3. This patient was homozygous for the deletion of
C244 in exon 4. This frameshift results in a stop codon at amino
acid position 190. The parents, who are not known to be related,
were both found to be carriers of this single base pair deletion. This
defect has been described previously in an unrelated patient who
was heterozygous for this mutation.13
Patient 4. Genomic sequencing of DNA from patient 4 revealed a homozygous splice-site mutation in intron 3, converting
;
Figure 1. Molecular mass analysis of PCR products derived from amplification of genomic DNA and of mRNA species derived by reverse
transcriptase PCR. (A) PCR amplification of exons 1 to 4 of genomic DNA from
patient 1, his mother, and a normal control was performed as described in ‘‘Patients,
materials, and methods.’’ The normal product is approximately 4.0-kb, and the
product derived from amplification of exons 1 and 4 with exons 2 and 3 deleted is
approximately 3.0-kb. (B) RT-PCR of mRNA prepared from whole blood was
performed as described in ‘‘Patients, materials, and methods.’’ Left lane, markers;
right lanes, 5, 10 and 13 µL of PCR product. The upper band is derived from a mRNA
with exons 2 and 3 skipped, the lower band is derived from a mRNA species with
exons 2, 3, and 4 skipped.
1110
BLOOD, 1 AUGUST 2000 • VOLUME 96, NUMBER 3
RAE et al
the 58 gtgag=ttgag. This splicing error results in the loss of exon 3
as detected by RT-PCR. The patient’s mother carries this mutation,
the father was not available for study.
Patient 5. This patient was identified as a compound heterozygote for 2 mutations in his CYBA gene. The first allele contained a
nonsense mutation, a transition of G26=A in exon 1, leading to a
stop codon and truncation of the p22phox polypeptide at amino acid
9 (Figure 2A). This mutation was inherited from his father and was
also found in his sister. The second allele had a G=T transition at
nucleotide 74 in exon 2 (Figure 2B). This results in the substitution
of glycine 25 with the larger and more hydrophobic valine.
Although this is generally regarded as a relatively conservative
substitution, it apparently leads to an unstable product, as no
protein could be detected in the patient’s neutrophils. As expected,
the mother is a heterozygous carrier of this mutation and a normal
allele. The patient’s sister does not carry the mutated maternal
allele and does not have CGD.
Patient 6. Through genomic sequencing of DNA from patient
6, we discovered a homozygous C=T transition at nucleotide 268.
This causes the nonconservative replacement of arginine 90 with
tryptophan and the loss of p22phox. The patient’s parents are first
cousins, and both are carriers of this mutation.
Patients 7 and 7a. Two sisters, patients 7 and 7a, were
identified as compound heterozygotes. The maternal allele contained the insertion of C at nucleotide 162 in exon 3 causing a
frameshift and a stop codon at amino acid 73. The paternal allele
contains a missense mutation C268=T; predicting the nonconservative amino acid change arginine 90= tryptophan. This is the
same mutation found in patient 6, but the families are not known to
be related.
Patient 8. This patient is a compound heterozygote, with the
allele inherited from her mother containing a nonsense mutation at
A
B
Figure 2. Sequence analysis of exon 1 and 2 in patient 5. Panel A: Sequence
analysis of exon 1 of the CYBA gene of patient 5 and his family members. The patient,
his father, and sister are all heterozygous for A at nucleotide 26, producing a
nonsense codon at amino acid 9. The normal control shows only G at position 26.
Panel B: Sequence analysis of exon 2 of the CYBA gene of patient 5 and his family
members. The patient is homozygous for T at nucleotide 74, causing the replacement
of glycine 25 with valine. The patient’s mother is heterozygous as seen by the
presence of both G and T at position 74. The patient’s father and sister do not carry
this allele as seen by the appearance of only the G at this position.
nucleotide 107, G=A in exon 2, predicting tryptophan 36 being
changed to a stop codon. The patient’s second mutation, a transition
of G=A at nucleotide 70, also in exon 2, causes a missense defect
predicting the nonconservative substitution of an arginine residue
for glycine at position 24. The father was not available for study.
Patient 9. This patient is homozygous for the substitution of
nucleotide 354 C=A, causing the replacement of serine 118 with
arginine. As expected, both parents were carriers of this mutation.
This defect has been described before in another homozygous
patient also of Hispanic heritage.13
Polymorphisms in the CYBA gene
During the course of these studies, we identified a number of
polymorphisms (listed in Table 4) in addition to those described
above. These polymorphisms include 2 nonconservative amino
acid substitutions: lysine 60= threonine caused by an A=C
transversion at nucleotide 179 (found 1 allele of 59 studied); and
glutamic acid 135= lysine caused by a G=A transition at
nucleotide 403.
Discussion
Before this study, only 10 different mutations in the CYBA gene had
been identified as causing A22 CGD. These mutations were found
in patients from 9 kindreds encompassing 18 alleles (Cross et al31
and references therein). In addition, 4 polymorphisms in the gene
had been documented. Here we report on 10 new patients from 9
families in whom we identified 12 mutations, 9 of which are novel.
We also identified 3 previously unreported polymorphisms. Consistent with previous studies of mutations causing CGD, our results
show a wide variety of defects, insertions, deletions, and substitutions leading to missense, nonsense, frameshift, and splice-site
mutations, with no preponderance of common affected alleles or
‘‘hot-spots.’’ This heterogeneity has been seen in studies of the
X-linked gp91phox gene (CYBB),14,30,32 the autosomal p67phox gene
(NCF-2),33-34 and the earlier studies of CYBA.31 The exception to
this pattern is the overwhelming preponderance of a GT deletion
(DGT) at the beginning of exon 2 of the NCF-1 gene, causing
p47phox-deficiency, the second most common form of CGD. This
unusual finding is explained by the presence of at least 1, and
probably more, highly homologous pseudogenes that contain the
DGT sequence.35-36 Relatively frequent recombination events between the wild-type gene and the pseudogene(s) account for the
prevalent nature of the DGT genotype, and give rise to the single
most common disease-causing allele in CGD.
Two of the mutations identified in this study have been
described previously. The deletion of C244, which we found to be
homozygous in the genomic DNA of patient 3, was first described
in a compound heterozygote reported by Dinauer and coworkers.13
In that case, the other mutant allele carried a missense mutation
G269=A, (arginine 90=glutamine). These patients are not known
to be related. Patient 9 was found to be homozygous for C354=A,
this mutation was found previously in another patient also heterozygous for this change.13 Although these patients are not thought to be
related, both are of Hispanic origin and this may reflect the
presence of a rare mutant allele in the Hispanic population.
Surprisingly, in the 17 unrelated kindreds with A22 CGD, 4
have changes causing missense mutations at arginine 90. The first
of these patients was heterozygous for a G269=A transition,
resulting in the replacement of arginine 90 with glutamine.13 This
same mutation was found in a homozygous state in a patient whose
BLOOD, 1 AUGUST 2000 • VOLUME 96, NUMBER 3
MUTATIONAL ANALYSIS OF CYBA
parents were first cousins.16 We have found a second mutation that
causes a change at this amino acid residue in 2 unrelated families.
Patients 7 and 7a were heterozygous, and patient 6 was homozygous for a C=T transition at the adjacent nucleotide 268. This
mutation results in the replacement of the arginine with tryptophan
rather than glutamine. It is possible that this is a mutational hot
spot, because these 4 events appear to have occurred independently.
Both missense mutations result in the A22° phenotype.
Of the 9 different missense mutations known, including the 4
that are described here, only 1 results in the expression of stable
protein (the A221 phenotype). In that instance, the patient was
homozygous for the substitution of proline 156 with glutamine.15
This particular substitution was very informative functionally, as
biochemical analysis showed that it resulted in the failure of p47phox
to translocate to the membrane. Proline 156 is within a short
proline-rich region in the cytoplasmic tail of p22phox (amino acids
151-160) and the profound effect of its alteration to glutamine
highlights the importance of this region of the p22phox molecule in
interactions with an SH3 domain in p47phox.37
It is noteworthy that all the missense mutations reported so far
that result in the A22° phenotype cause amino acid substitutions
within the putative membrane-spanning domains of p22phox, whereas
the mutation causing the A221 phenotype and the 4 known
polymorphic amino acid residues fall outside these regions (Figure
3). We speculate that amino-acid substitutions in membranespanning domains are poorly tolerated and lead to unstable protein,
particularly if they involve changes in charge or hydrophobicity.
Outside the membrane-spanning domain, even nonconservative
changes seem to be better tolerated. For example, the histidine
72= tyrosine and glutamic acid 135= lysine polymorphisms both
lead to normal levels of functional p22phox.
During the course of this study, we found examples of all 4 of
the polymorphisms previously reported in the literature (Table
4);13,16 in addition, we also found 3 new polymorphisms, 2 of which
produced amino acid substitutions. The first, lysine 60= arginine,
is a conservative substitution predicted to be located in a cytoplasmic loop between the central 2 membrane-spanning domains of
p22phox. The second, glutamine 135= lysine, is a less conservative
change, located close to the cytoplasmic side of the membrane.
Polymorphisms within p22phox may have significance for certain
disease susceptibilities. Inoue and colleagues18 have recently
reported a significant association between the C214 genotype
(histidine 72) and coronary artery disease, compared with the T214
genotype (tyrosine 72), although these findings have not been
confirmed by others.19-21 It has been postulated that p22phox forms
part of an isoform of NADPH oxidase that may play a signaling
role in nonphagocytic cells38 and very recently such an enzyme has
been described.24 Polymorphic forms of p22phox might have differential effects in such systems.
1111
Figure 3. Pictorial representation of p22phox. The shaded areas represent the
putative transmembrane regions. The N-terminus and C-terminus are both cytoplasmic. The stippled area is the proline-rich sequence (amino acids 151-160) that
mediates a protein/protein interaction with p47phox. Note that all missense mutations
that result in the complete loss of protein (the A22° phenotype) are located within the
transmembrane regions, whereas the mutation causing the A221 phenotype, as well
as the polymorphic amino acids, are located outside the membrane.
The difficulty of detecting heterozygotes carrying exonic deletions is illustrated in the family of patient 1. Detection cannot be
achieved by direct sequencing alone, because the primers will
always amplify the normal sequence (for example, the parents of
patient 1 appear normal by sequencing). Instead, analysis of the
size of fragments generated by PCR amplification of genomic DNA
or cDNA must be used to identify carriers as shown in Figure 1.
Carrier detection is of great importance for genetic counseling
and prenatal diagnosis. In the case of X-linked CGD, this is usually
relatively easy, because female carriers (who are mostly healthy)
generally exhibit 2 populations of cells (due to X-chromosome
inactivation), 1 positive for NADPH oxidase activity and 1
negative. These distinct populations can readily be distinguished
biochemically using the NBT slide test or DHR flow cytometry.
The situation with the autosomal recessive forms of CGD is quite
different, however. Generally, carriers of autosomal recessive CGD
have uniform populations of neutrophils that are capable of
generating amounts of O22 within the normal range and the
individuals concerned have no obvious clinical manifestations. In
the relatively few heterozygotes for p22phox-deficiency in whom
cellular flavocytochrome b558 concentrations have been measured,
these too appear within normal limits. Consequently, the only
reliable way of testing for such carriers is by molecular genetic
analysis.
Acknowledgment
We are grateful to Valerie Moreau for her skilled secretarial
assistance.
References
1. Roos D, Curnutte JT. Chronic granulomatous disease. In: Ochs H, Puck J, Smith E, eds. Primary
Immunodeficiency Diseases, A Molecular and
Genetic Approach. New York, NY: Oxford University Press; 1997.
4. Wientjes FB, Hsuan JJ, Totty NF, Segal AW.
P40phox, a third cytosolic component of the activation complex of the NADPH oxidase to contain
src homology 3 domains. Biochem J. 1993;296:
557-561.
2. Clark RA. Activation of the neutrophil respiratory
burst oxidase. J Infect Dis. 1999;179:S309-S317.
5. Knaus UG, Heyworth PG, Evans T, Curnutte JT,
Bokoch GM. Regulation of phagocyte oxygen
radical production by the GTP-binding protein
Rac 2. Science. 1991;254:1512-1515.
3. Tsunawaki S, Mizunari H, Nagata M, Tatsuzawa
O, Kuratsuji T. A novel cytosolic component,
p40phox, of respiratory burst oxidase associates
with p67phox and is absent in patients with chronic
granulomatous disease who lack p67phox. Biochem Biophys Res Commun. 1994;199:13781387.
AW. Activation of the NADPH oxidase involves
the small GTP-binding protein p21 rac1. Nature.
1991;353:668-670.
8. Ambruso DR, Knall C, Panepinto J, et al.
Human Rac2 deficiency: a novel syndrome
of neutrophil (PMN) dysfunction and recurrent
bacterial infections [abstract]. Blood. 1999;94:
615a.
6. Kwong CH, Malech HL, Rotrosen D, Leto TL.
Regulation of the human neutrophil NADPH oxidase by rho-related G-proteins. Biochemistry.
1993;32:5711-5717.
9. Williams DA, Tao W, Yang F, et al. Mutation of
Rac2, a hematopoietic specific Rho-GTPase, is
associated with multiple neutrophil functional defects in a patient with recurrent infections [abstract]. Blood. 1999;94:616a.
7. Abo A, Pick E, Hall A, Totty N, Teahan C, Segal
10. Yu L, Quinn MT, Cross AR, Dinauer MC. Gp91phox
1112
BLOOD, 1 AUGUST 2000 • VOLUME 96, NUMBER 3
RAE et al
is the heme binding subunit of the superoxidegenerating oxidase. Proc Natl Acad Sci U S A.
1998;95:7993-7998.
11. Heyworth PG, Curnutte JT, Badwey JA. Structure
and regulation of NADPH oxidase of phagocytic
leukocytes: insights from chronic granulomatous
disease. In: Serhan CN, Ward PA, eds. Molecular
and Cellular Basis of Inflammation. 1st ed.
Totowa, NJ: Humana Press; 1998:165.
12. DeLeo FR, Quinn MT. Assembly of the phagocyte
NADPH oxidase: molecular interaction of oxidase
proteins. J Leukoc Biol. 1996;60:677-691.
13. Dinauer MC, Pierce EA, Bruns GAP, Curnutte JT,
Orkin SH. Human neutrophil cytochrome b light
chain (p22phox): gene structure, chromosomal localization and mutations in cytochrome-negative
autosomal recessive chronic granulomatous disease. J Clin Invest. 1990;86:1729-1737.
14. Roos D, de Boer M, Kuribayashi F, et al. Mutations in the X-linked and autosomal recessive
forms of chronic granulomatous disease. Blood.
1996;87:1663-1681.
15. Dinauer MC, Pierce EA, Erickson RW, et al. Point
mutation in the cytoplasmic domain of the neutrophil p22phox cytochrome b subunit is associated
with a nonfunctional NADPH oxidase and chronic
granulomatous disease. Proc Natl Acad Sci U S
A. 1991;88:11231-11235.
16. de Boer M, de Klein A, Hossle J-P, et al. Cytochrome b558-negative, autosomal recessive
chronic granulomatous disease: two new mutations in the cytochrome b558 light chain of the
NADPH oxidase (p22phox). Am J Hum Genet.
1992;51:1127-1135.
17. Hossle JP, de Boer M, Seger RA, Roos D. Identification of allele-specific p22phox mutations in a
compound heterozygous patient with chronic
granulomatous disease by mismatch PCR and
enzyme analysis. Hum Genet. 1994;93:24372442.
18. Inoue I, Kawashima S, Kanazawa K, Yamada S,
Akita H, Yokoyama M. Polymorphism of the
NADH/NADPH oxidase p22phox gene in patients
with coronary artery disease. Circulation. 1998;
97:135-137.
19. Li A, Prasad A, Mincemoyer R, et al. Relationship
of the C242T p22phox gene polymorphism to an-
giographic coronary heart disease and endothelial function. Am J Med Genet. 1999;86:57-61.
with CGD and their carrier mothers. Blood. 1987;
69:1404-1408.
20. Cai H, Duarte N, Wilken DEL, Wang XL. NADH/
NADPH oxidase p22phox C242T polymorphism
and coronary heart disease in the Australian
population. Eur J Clin Invest. 1999;29:744-748.
30. Rae J, Newburger PE, Dinauer MC, et al.
X-linked chronic granulomatous disease: mutations in the CYBB gene encoding the gp91phox
component of the respiratory burst oxidase. Am J
Hum Genet. 1998;62:1320-1331.
21. Saha N, Sanghera DK, Kamboh MI. The p22phox
polymorphism C242T is not associated with CHD
risk in Asian Indians and Chinese. Eur J Clin Invest. 1999;29:999-1002.
22. Gardemann A, Mages P, Katz N, Tillmanns H,
Haberbosch W. The p22phox A640G gene polymorphism but not the C242T gene variation is
associated with coronary heart disease in younger individuals. Atherosclerosis. 1999;145:315323.
23. Ushio-Fukai M, Zafari AM, Fukui T, Ishizaka N,
Griendling KK. P22phox is a critical component of
the superoxide-generating NADH/NADPH oxidase system and regulates angiotensis II-induced
hypertrophy in vascular smooth muscle cells. J
Biol Chem. 1996;71:23317-23321.
24. Suh Y-A, Arnold RS, Lassegue B, et al. Cell transformation by the superoxide-generating oxidase
Mox1. Nature. 1999;401:79-82.
25. Cross AR, Heyworth PG, Rae J, Curnutte JT. A
variant X-linked chronic granulomatous disease
patient (X911) with partially functional cytochrome b. J Biol Chem. 1995;170:8194-8200.
31. Cross AR, Curnutte JT, Heyworth PG. Hematologically important mutations: the autosomal recessive forms of chronic granulomatous disease.
Blood Cells Mol Dis. 1996;22:268-270.
32. Ariga T, Furuta H, Cho K, Sakiyama Y. Genetic
analysis of 13 families with X-linked chronic
granulomatous disease reveals a low proportion
of sporadic patients and a high proportion of sporadic carriers. Pediatr Res. 1998;44:85-92.
33. Patino PJ, Rae J, Noack D, Erickson R, et al. Molecular characterization of autosomal recessive
chronic granulomatous disease caused by a defect of the nicotinamide adenine dinucleotide
phosphate (reduced form) oxidase component
p67-phox. Blood. 1999;94:2505-2514.
34. Noack D, Rae J, Cross AR, et al. Autosomal recessive chronic granulomatous disease caused
by novel mutations in NCF-2, the gene encoding
the p67-phox component of phagocyte NADPH
oxidase. Hum Genet. 1999;105:460-467.
26. Segal AW, Cross AR, Garcia R, et al. Absence of
cytochrome b-245 in CGD: a multicentre European
evaluation of its incidence and relevance. N Engl
J Med. 1983;308:245-251.
35. Casimir CM, Bu-Ghanim HN, Rodaway ARF,
Bentley DL, Rowe P, Segal AW. Autosomal recessive chronic granulomatous disease caused by
deletion at a dinucleotide repeat. Proc Natl Acad
Sci U S A. 1991;88:2753-2757.
27. Heyworth PG, Bohl BP, Bokoch GM, Curnutte JT.
Rac translocates independently of the neutrophil
NADPH oxidase components p47phox and
p67phox. J Biol Chem. 1994;269:30749-30752.
36. Görlach A, Lee PL, Roesler J, et al. A p47phox
pseudogene carries the most common mutation
causing p47phox-deficient chronic granulomatous
disease. J Clin Invest. 1997;100:1907-1918.
28. DeLeo FR, Renee J, McCormick S, et al. Neutrophils exposed to bacterial lipopolysaccharide upregulate NADPH oxidase assembly. J Clin Invest.
1998;101:455-463.
29. Nakamura M, Murakami M, Koga T, Tanaka Y,
Minakami S. Monoclonal antibody 7D5 raised to
cytochrome b558 of human neutrophils: immunocytochemical detection of the antigen in the peripheral phagocytes of normal subjects, patients
37. Leusen JHW, Bolscher BGJM, Hilarius PM, et al.
156Pro=Gln substitution in the light chain of cytochrome b558 of human neutrophil NADPH oxidase (p22phox) leads to defective translocation of
the cytosolic proteins p47phox and p67phox. J Exp
Med. 1994;180:2329-2334.
38. Cross AR, Jones OTG. Enzymic mechanisms of
superoxide production. Biochim Biophys Acta.
1991;1057:281-298.