Download Clinical Investigation and Reports

Clinical Investigation and Reports
Missense Mutations and Gene Interruption in PROSIT240, a
Novel TRAP240-Like Gene, in Patients With Congenital
Heart Defect (Transposition of the Great Arteries)
Nadja Muncke, PhD; Christine Jung, MD; Heinz Rüdiger, MD; Herbert Ulmer, MD;
Ralph Roeth; Annette Hubert; Elizabeth Goldmuntz, MD; Deborah Driscoll, MD;
Judith Goodship, MD; Karin Schön; Gudrun Rappold, PhD
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Background—Congenital heart disease represents the most common severe birth defect, affecting 0.7% to 1% of all
neonates, among whom 5% to 7% display transposition of the great arteries (TGA). TGA represents a septation defect
of the common outflow tract of the heart, manifesting around the fifth week during embryonic development. Despite its
high prevalence, very little is known about the pathogenesis of this disease.
Methods and Results—Using a positional cloning approach, we isolated a novel gene, PROSIT240 (also termed THRAP2),
that is interrupted in a patient with a chromosomal translocation and who displays TGA and mental retardation. High
expression of PROSIT240 within the heart (aorta) and brain (cerebellum) was well correlated with the malformations
observed in the patient and prompted further analyses. PROSIT240 shows significant homology to the nuclear receptor
coactivator TRAP240, suggesting it to be a new component of the thyroid hormone receptor–associated protein (TRAP)
complex. Interestingly, several TRAP components have been previously shown to be important in early embryonic
development in various organisms, making PROSIT240 an excellent candidate gene to be correlated to the patient’s
phenotype. Subsequent mutational screening of 97 patients with isolated dextro-looped TGA revealed 3 missense
mutations in PROSIT240, which were not detected in 400 control chromosomes.
Conclusions—Together, these genetic data suggest that PROSIT240 is involved in early heart and brain development.
(Circulation. 2003;108:2843-2850.)
Key Words: transposition of great vessels 䡲 heart defects, congenital 䡲 heart diseases
W
tal factors has been discussed controversially.6,7 However,
because historically only a few TGA patients survived to
reproductive age, very little is known about the recurrence
risk in offspring. Until now, mutations in 2 genes were
thought to be associated with the pathogenesis of TGA in
humans: ZIC38 and CFC1 (human CRYPTIC gene).9 Both
genes were originally characterized in patients with heterotaxic phenotypes (randomized organ positioning)10,11 and
subsequently screened for mutations in patients with TGA. A
contribution of the chromosomal region 22q11 to the pathogenesis of TGA, as suggested by Melchionda et al,12 could
not be verified in subsequent studies.13,14 The low mutational
frequency of ZIC3 and CFC1 in TGA patients cannot explain
the high incidence of the disease, underlining the strong
heterogeneity that we expect for dTGA.
In this study, we used positional cloning as a direct strategy
to isolate genes involved in the pathogenesis of TGA. We
report on a novel gene on 12q24 similar to the human thyroid
ith a prevalence rate of 0.7% to 1% of live births,1– 4
congenital heart disease represents the most common
severe birth defect. Despite this high prevalence, very little is
known about the underlying mechanisms. Transposition of
the great arteries (TGA) accounts for 5% to 7% of all
congenital heart disease, affecting 0.2 per 1000 live
births,1,2,4,5 thereby representing the most frequent cyanotic
heart defect diagnosed in the neonatal period. TGA occurs as
a defect of the partition of the common outflow tract into the
aorta and pulmonary arteries. The majority of patients show
dextro-looped TGA (dTGA), which is characterized by atrioventricular concordance and ventriculoarterial discordance
(Figure 1). As a result, the systemic and pulmonary circulations are completely separated, which is not compatible with
life. The less common levo-looped TGA presents with both
atrioventricular and ventriculoarterial discordance.
The pathogenesis of TGA is largely unknown. The genetic
contribution to the pathogenesis of TGA versus environmen-
Received August 8, 2003; de novo received September 17, 2003; accepted October 9, 2003.
From the Institut für Humangenetik (N.M., C.G., R.R., A.H., K.S., G.R.), Universität Heidelberg, and the Abteilung für Kardiologie (H.R., H.U.),
Kinderklinik Heidelberg, Heidelberg, Germany; the Division of Cardiology (E.G., D.D.), Department of Pediatrics, University of Pennsylvania School
of Medicine, Philadelphia, Pa; and the Institute of Human Genetics (J.G.), International Center for Life, Newcastle upon Tyne, Great Britain.
This article originally appeared Online on November 24, 2003 (Circulation. 2003;108:r136 –r143).
Correspondence to Gudrun Rappold, PhD, Institute of Human Genetics, Im Neuenheimer Feld 328, 69120 Heidelberg, Germany. E-mail
[email protected]
© 2003 American Heart Association, Inc.
Circulation is available at http://www.circulationaha.org
DOI: 10.1161/01.CIR.0000103684.77636.CD
2843
2844
Circulation
December 9, 2003
(CATCH22) was excluded by fluorescence in situ hybridization
(FISH).
Human Subjects and Genomic DNA
Peripheral blood samples were taken from individuals after informed
consent was obtained, after approval by the review board of ethics of
the respective institutions (Medical Department, University of Heidelberg, Germany; Newcastle and North Tyneside Health Authority
Joint Ethics Committee, England; and Children’s Hospital of Philadelphia, Pa).
Genomic Clones and Breakpoint Mapping
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 1. Scheme of normal heart (left) and dTGA (right). Atrial
septal defect allows restricted mixing of oxygenated (red) and
nonoxygenated (blue) blood. AO indicates aorta; LA, left atrium;
LV, left ventricle; PA, pulmonary artery; RA, right atrium; and
RV, right ventricle. Reprinted with permission from Randy
Attwood, Director of University Relations, University of Kansas
Medical Center, Kansas City.
hormone receptor–associated protein (TRAP) 240,15 which is
disrupted by a translocation breakpoint in a patient with
dTGA and mental retardation. The gene was therefore termed
PROSIT240 (protein similar to TRAP240). Defects in TRAP
function have been previously shown to affect nuclear receptor signaling, resulting in severe defects during embryonic
development. Ablation of murine TRAP220, for example, has
been shown to result in impaired heart and nervous system
development.16 Drosophila homologues of TRAP240 and
TRAP230 are required for proper eye-antennal disc development.17 Thus, TRAP family members do interfere with
important processes in early embryonic patterning, making
the PROSIT240 gene a good candidate to be involved in the
phenotype of the patient. Mutational screening of 97 patients
with dTGA revealed several sequence variants, including 3
missense mutations, which were not detected in controls.
Methods
Case Report
The proband was a 7-year-old girl born as the first child to a healthy,
30-year-old mother and a healthy, 31-year-old father. The parents
were not related, and the family history was unremarkable. The
patient had a healthy, 4-year-old brother. The uneventful pregnancy
ended in a spontaneous delivery in the 38th week of pregnancy
(Apgar score 9/10/10). Birth length was 52 cm (75th percentile),
birth weight was 2650 g (10th percentile), and head circumference
was 32 cm (10th percentile). Echocardiography revealed dTGA, a
perimembranous ventricular septal defect, and an open foramen
ovale, as well as mild coarctation of the aorta. The TGA was
operated on at the age of 14 months, and the remaining ventricular
septal defect was corrected at the age of 4 years.
Postnatal microcephaly developed, and at the age of 2 months, a
magnetic resonance imaging scan of the brain was performed. It
showed no structural abnormalities, and myelinization was rather
advanced. Motor development was mildly delayed. Discrete ataxia
was present, and the sense of balance was impaired. Mental
retardation became more obvious with age. Speech is nearly absent.
The result of routine blood and urine examinations did not indicate
metabolic disturbances. A deletion of chromosomal region 22q11
Yeast artificial chromosome (YAC) clones were purchased from the
German Resource Center (RZPD), Berlin. P1-derived artificial
chromosome (PAC) and bacterial artificial chromosome (BAC)
clones were obtained from BACPAC Resources, Oakland, Calif
(RPCI-1,4 and RPCI-11) or from Research Genetics, Huntsville, Ala
(HCIT, CTD). Isolation of metaphase chromosomes and FISH were
performed as described elsewhere.18
Expression Studies
Human multiple-tissue Northern blots were purchased from Clontech
Laboratories. Fragment Ex1/2, covering exons 1 and 2 (bp 91 to 283;
FG33289 reverse, gacatcacgacgccatacac; FG493822 forward, gagcctggaggattgtcact), was used as a gene-specific probe, and a ␤-actin or
a glyceraldehyde 3-phosphate dehydrogenase (GAPDH) probe was
used as a control. Labeling was performed with ␣-[32P]dCTP
(Amersham Bioscience). Probes were purified by using a purification kit (Qiaquick, Qiagen) and hybridized to the filter overnight at
65°C, as recommended by the manufacturer. The membranes were
washed with 2⫻ sodium chloride sodium citrate at room temperature
and with 0.2⫻ sodium chloride sodium citrate at 50°C and exposed
at ⫺80°C for 2 hours to 4 days, depending on signal intensity. Fetal
cDNA panels were purchased from Clontech Laboratories.
Mutation Screening
Mutation screening was performed by denaturing high-performance
liquid chromatography (DHPLC). A WAVE DNA fragment analysis
system (Transgenomic Inc) was used. Untranslated regions were not
analyzed; exons 10 and 17 had to be subdivided because the
fragments were too large. (Primer sequences and polymerase chain
reaction [PCR] conditions are available on request.)
Sequencing
Sequencing was performed on a MegaBACE sequencer (Amersham
Bioscience) and with use of a DYEnamic ET terminator cycle
sequencing kit, following the manufacturer’s protocol. Sequencing
reactions were performed on both DNA strands. Sequences were
analyzed with the CLUSTAL program (German Cancer Research
Center, Biocomputing Facility HUSAR).
Accession Numbers
During preparation of this manuscript, our sequence (accession No.
AF515599) was confirmed on April 28, 2003, by an update of clone
KIAA1025 (XM_034056), now also including exons 4 and 3 and
part of exon 2.
Results
Physical Mapping and Characterization of
Translocation Breakpoints
Routine cytogenetic analysis had revealed a de novo balanced
chromosomal translocation 46,XX,t(12,17) (q24.1;q21). To
map the breakpoints, FISH of YACs and PACs was used for
gross mapping (data not shown). By using BAC and cosmid
clones, we could isolate clones spanning the breakpoints, thus
narrowing the critical interval (Figure 2A and 2B). Subsequent Southern blot analysis showed aberrant products in the
Muncke et al
PROSIT240 Mutations in Patients With dTGA
2845
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 2. Physical mapping of chromosomal breakpoint region. A, BAC/cosmid
map spanning 12q24 and 17q21 breakpoint region. Horizontal dotted lines indicate clones spanning breakpoint. Overlap
of clones was verified by PCR or was
based on sequence comparison.
PROSIT240 is shown; arrowhead indicates
gene orientation. B, FISH analysis of
metaphase chromosomes of affected
individual. Biotinylated BACs spanning
breakpoint were hybridized on patient’s
metaphase chromosomes, together with
reference probe mapping to 17p. Arrows
indicate split signal of BACs. C, Genomic
Southern blot analysis of patient’s and
control DNAs derived from whole blood
and digested with PstI and StuI. Only in
patient’s DNA was additional shifted band
detected. Cen indicates centromere; Tel,
telomere; and der, derivative.
patient’s DNA but not in controls (Figure 2C). Cloning and
sequencing of the junction fragments confirmed the location
of the breakpoint and revealed a microdeletion of 16 nucleotides (data not shown).
On chromosome 17, no known gene was interrupted by the
breakpoint, and no novel transcript could be isolated within this
interval. The breakpoint on chromosome 12 resided in the
overlapping region of RP11-101P14 and RP11-973J6. Using
computer-based gene prediction (Nix at http://www.hgmp.mrc.
ac.uk), a novel partial transcript of 192 bp could be amplified by
reverse transcription (RT)–PCR in multiple tissues.
Isolation of a Novel Gene in 12q24 Interrupted by
the Breakpoint
By RT-PCR (of heart, brain, and kidney mRNA; Clontech),
subsequent cloning, and sequencing, we could show that the
newly identified fragment forms a transcriptional unit with
the partial cDNA clone KIAA1025, isolating 5 new exons 5⬘
to the already known sequence. In total, the novel gene
encodes 31 exons with a transcript size of 9377 bp and spans
a genomic locus of ⬇317 kb. Exon 1, harboring the start
codon at position 56, is embedded into a CpG island. A stop
codon in exon 31 defines an open reading frame of 6633 bp,
which encodes a putative protein of 2210 amino acids. A
polyadenylation signal is predicted at position 9357. Figure 3
shows the genomic structure of the gene and gives the exon
and intron sizes. The breakpoint resides between exon 1
(harboring the start codon ATG) and exon 2, therefore
interrupting the genomic sequence of the gene.
Sequence Comparison
Alignment of the cDNA sequence with the databases revealed
a significant homology with TRAP240.15 The 2 large genes
showed 55% homology on the nucleotide level over the total
gene length according to the CLUSTAL program and 63%
according to the BESTFIT program (German Cancer Research
Center, Biocomputing Facility HUSAR). On the protein
level, a total of 1138 amino acids are identical (51%)
according to the CLUSTAL program, with 5 subregions showing identity of ⬎70% (Figure 4). TRAP240 is evolutionarily
conserved up to yeast19 and represents a component of the
human TRAP complex, a large multisubunit coactivator.20 –22
Approximately 20 different TRAP subunits have been identified so far, among which are several that have been shown
to be involved in embryonic development.16 TRAP240, 230,
170, and 100 were shown to possess at least 2 copies of the
2846
Circulation
December 9, 2003
Figure 3. Scheme of genomic structure
of PROSIT240, with black and white
boxes representing exons. Exon 1 contains start, and exon 31 contains stop
codon. Black portions indicate newly
defined exons, and white portions indicate cDNA designated by KIAA1025.
Breakpoint, residing between exons
1 and 2, is indicated. Exon and intron
sizes and 5⬘ and 3⬘ borders within coding region of PROSIT240 are given. Cen
indicates centromere; Tel, telomere.
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
LXXLL domain, responsible for nuclear hormone receptor
binding.23 Two LXXLL motifs are also present in the novel
gene at amino acids 668 and 1224 (Figure 4). Because of the
structural (and possible functional) homology to TRAP240,
we termed the novel gene PROSIT240. Alternatively, the
name THRAP2 also has been assigned by the nomenclature
committee.
Expression Analysis
To examine the expression pattern of PROSIT240, we performed Northern blot analysis on human multiple tissues.
Figure 5A shows that PROSIT240 is expressed in multiple
tissues, with high expression in the brain, heart, skeletal
muscle, kidney, placenta, and peripheral blood leukocytes.
Among the fetal tissues tested, the transcript showed strongest expression in fetal brain, but it was also expressed in all
other tissues tested (Figure 5B). In addition, expression in
fetal skeletal muscle, fetal spleen, and fetal thymus was
shown by RT-PCR on a normalized cDNA panel (data not
shown).
Because PROSIT240 was identified in a patient with a
severe heart defect and mental retardation, we also investigated the expression pattern in different subregions of the
heart and brain. Figure 5C shows that within heart structures,
the highest expression was detectable in the aorta. Among the
tested brain regions, the cerebellum showed the strongest
expression; however, the novel gene is expressed in all brain
subregions (Figure 5D). Hence, PROSIT240 is expressed at
the right place during embryonic development to be involved
in the pathogenesis of the patient’s condition.
Using zoo blot analysis, we could show that PROSIT240 is
conserved within humans, mice, cattle, and chickens (data not
shown). Database searches across species revealed a possible
partially cloned mouse orthologue (XM_132318) residing in
the syntenic region, with 88% homology on the nucleotide
level and 92% homology on the protein level.
Mutational Analysis of Patients With dTGA
On the basis of the fact that the novel gene is interrupted in
a patient with heart and neuronal defects, the correlating
expression patterns of PROSIT240, and the high impact of
related TRAP components in early embryonic development,
we consider it an excellent candidate gene to be associated
with the pathogenesis of the patient’s phenotype. To prove
the involvement of PROSIT240, additional patients with
similar phenotypes were screened for mutations. Because the
patient with the chromosomal translocation is also suffering
from mental retardation, a mutation screen in patients with
mental retardation would be formally possible. However,
because such a patient pool is both clinically and genetically
highly heterogeneous, this approach is not very promising. To
test its involvement in the clinically more specifically defined
defect of heart formation, we screened 97 patients with dTGA
for mutations in PROSIT240 by means of DHPLC and
sequencing. In cases for which metaphase chromosomes were
available (22 cases), FISH analysis was also performed to
exclude large deletions. With the use of BACs RP11-973J6,
RP11-392B15, and RP11-493P1 as hybridization probes, no
gross deletion could be detected. The Table summarizes the
results of mutation screening by DHPLC. In total, 6 intronic
polymorphisms, 6 silent mutations, and 4 missense mutations
were found, which were named according to the scheme of
Antonarakis.24 In cases for which a polymorphism or mutation was not found in 6 control individuals, the number of
controls was increased. In the case of 2 intronic polymorphisms (IVS5⫹41C3 T and IVS19⫹22T3 C) and 1
silent mutation (1563C3 T), the variation could not be
detected in the control cohort of 100 and 68 individuals,
Muncke et al
PROSIT240 Mutations in Patients With dTGA
2847
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 4. Sequence comparison between PROSIT240 (top) and TRAP240 (lower) based on CLUSTAL program (HUSAR). Blue color indicates identical amino acids, red color indicates amino acids with strong similarity, and orange indicates amino acids with weak similarities. Boxed areas represent regions with identities ⬎70%. Two LXXLL domains are indicated by horizontal pink lines at positions 683
and 1249. Green circles below amino acid indicate missense mutations found in conserved amino acids; turquoise circle indicates missense mutation in nonconserved amino acid.
respectively. Therefore, these cases cannot be excluded to be
functionally important without further analysis. One of the
missense mutations (2056A3 C, Lys686Gln) was found once
in a control cohort of 200 individuals, representing an allelic
frequency of 0.25%. Because the mutation did not affect a
conserved amino acid and we could not obtain further
information about the person showing the mutation, we did
not pursue further analysis on this case at the moment, despite
the fact that it also could not be excluded to be of functional
significance.
Most notably, we found 3 missense mutations (752A3 G
[Glu251Gly], 5615G3 A [Arg1872His], and 6068A3 G
[Asp2023Gly]) that could be detected only in patients and not
in any of the 200 ethnically matched control persons. Parental
DNA was available for 3 of the 6 respective parents. The
mutation Glu251Gly could also be detected in the patient’s
mother, who does not have a clinically defined TGA. All 3
mutations affect amino acids, which are conserved between
PROSIT240 and TRAP240 (Figure 4), and 2 mutations
(Arg1872His and Asp2023Gly), which reside within the
available mouse sequence, affect amino acids conserved
between the human and murine PROSIT240 sequence. Two
of the variations (Glu251Gly and Asp2023Gly) furthermore
significantly change the biochemical properties of the amino
acids.
Discussion
Early embryonic development and organogenesis require
spatially and temporally tight coordination of gene expression. Transcriptional regulation in such complex processes
therefore involves not only basic activators or repressors but
also additional modifiers. The TRAP complex, composed of
several TRAP components, represents such a global coactivator, influencing transcriptional regulation of nuclear hormone receptors20 –22 and other activators like p53 or VP16.25
TRAPs have been shown to be essential for early embryonic
development. TRAP220⫺/⫺ mouse embryos, for example, die
at ⬇11 days after conception because of severe heart prob-
2848
Circulation
December 9, 2003
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 5. Expression studies of
PROSIT240 by Northern blot analysis.
Multiple-tissue Northern blots (Clontech)
were hybridized with probe spanning
part of exon 1 and exon 2 (bp 33 to bp
228 of coding region). Expression was
checked in human adult tissues (A),
human fetal tissues (B), and various subregions of heart (C) and brain (D). ␤-Actin
cDNA (A, B, and D) or GAPDH probe (C)
was used as control. Per indicates
peripheral.
lems and impaired neuronal development.16 Also, some of the
interacting partners of TRAPs have long been known to be
involved in developmental processes. Thyroid hormone and
its receptor TR, for example, play key roles in the development of the central nervous system.26,27 Patients with point
mutations in the TR␤ gene, for example, show mental
retardation and emotional disturbance.27 The influence of
nuclear receptors in heart formation has been strikingly
demonstrated for RXR␣ and RAR␣. RXR/RAR double
mutants display outflow tract malformations and abnormalities of the great arteries.26,28 Using a positional cloning approach,
we could show that PROSIT240/THRAP2, a novel TRAP240like gene, is interrupted in a patient with a severe heart defect
(dTGA) and mental retardation.
The PROSIT240/THRAP2 gene comprises 31 exons encoding a putative protein of 2210 amino acids. On the protein
level, 1138 amino acids (51%) are identical between
PROSIT240 and TRAP240, with 5 subregions showing
identity of ⬎70%. PROSIT240 contains 2 LXXLL domains,
which have been shown to be responsible for receptor
binding. Both TRAP240 and PROSIT240 are ubiquitously
expressed, with the highest expression in skeletal muscle. In
contrast to TRAP240, however, PROSIT240 is also strongly
expressed in the heart (aorta) and brain (cerebellum), where it
could possibly substitute for TRAP240 function. The expression pattern correlates well with a possible role for
PROSIT240 in the pathogenesis of the patient’s phenotype.
Because of the high sequence homology to TRAP240 and the
overlapping expression pattern, we suggest that the novel
gene is functionally related to TRAP240. Future studies will
have to show whether PROSIT240 is indeed a functional
relative of TRAP240. It will be interesting to see whether and
with what kind of activators (or repressors) the putative
protein will interact, defining its biologic role during development. Considering the phenotype, RAR/RXR and TR
would be particularly interesting candidates to check for
interaction with PROSIT240.
For the pathogenesis of dTGA, the involvement of 2 genes
has already been discussed. A nonsense mutation in the gene
ZIC3, originally characterized in patients with laterality
defects,10 was shown to segregate with dTGA in a Lebanese
family. Surprisingly, a healthy, maternal uncle also showed
the same mutation, pointing toward incomplete penetrance.8
Besides ZIC3, the EGF-CFC gene CFC1 represents an
interesting candidate because of gene-targeting studies in
mice. CFC1⫺/⫺ mice develop laterality defects and complex
Muncke et al
PROSIT240 Mutations in Patients With dTGA
2849
Summary of PROSIT240 Sequence Variations in dTGA Study Cohort
Patients
(n⫽97)
Controls
Variant
Frequency, n
(%)
No. of
Controls
Intron 5
1 (1.03)
100
IVS5–27A⬎C
Intron 5
19 (19.59)
100
IVS19⫹22T⬎C
Intron 19
1 (1.03)
100
IVS21–40A⬎G
Intron 21
24 (24.74)
6
2 (33.3)
IVS26–42G⬎C
Intron 26
1 (1.03)
68
3 (4.41)
IVS27–8C⬎T
Intron 27
1 (1.03)
100
6 (6.00)
948G⬎A (Lys316Lys)
Exon 7
1 (1.03)
6
1563C⬎T (Ser521Ser)
Exon 10-1
1 (1.03)
68
1773G⬎A (Gln591Gln)
Exon 10-2
25 (25.77)
6
3070T⬎C (Leu1024Leu)
Exon 17-1
25 (25.77)
6
2 (33.33)
5928T⬎C (Thr1976Thr)
Exon 27
23 (23.71)
68
20 (28.99)
6354C⬎T (Pro2118Pro)
Exon 29
10 (10.31)
6
1 (16.66)
Type of Variation/Specific Variation
Frequency, n
(%)
Intronic variations
IVS5⫹41C⬎T
0 (0)
22 (22.00)
0 (0)
Silent mutations
1 (16.66)
0 (0)
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
2 (33.33)
Missense mutations
2056A⬎C (Lys686Gln)
Exon 11
1 (1.03)
200
1 (0.50)
752A⬎G (Glu251Gly)
Exon 6
1 (1.03)
200
0 (0)
5615G⬎A (Arg1872His)
Exon 25
1 (1.03)
200
0 (0)
6068A⬎G (Asp2023Gly)
Exon 28
1 (1.03)
200
0 (0)
cardiac malformations reminiscent of human heterotaxy syndrome.29,30 Most interestingly, 82% of the homozygous mutant mice have malconnection of the great arteries, including
TGA, as well as other cardiac malformations.29 Bamford et
al11 identified 2 distinct mutations within the gene CFC1 in 3
independent patients with laterality defects and dTGA. Both
the deletion and the missense mutation, however, were also
found in normal controls or in a healthy parent of the
patient.11 An additional splice-donor mutation was detected in
the same gene, creating an alternative splice site, which is
predicted to cause a frameshift.9 However, functional studies
could not be performed. The influence of the chromosomal
region 22q11 (CATCH22) in dTGA was also discussed
controversially. Whereas 2 studies provided evidence that a
deletion of 22q11 is causative for dTGA in 12% of patients,12,31 2 other studies found no correlation between the
deletion and the disease.13,14 These controversial data and the
low mutation frequency of ZIC3 and CFC1 in dTGA patients
underline the heterogeneity of this disease and demonstrate
that only initial steps have been made so far toward an
understanding of the pathogenesis of dTGA.
To clarify the involvement of PROSIT240 in heart formation, we screened 97 patients with dTGA for mutations. In
total, we found 6 intronic polymorphisms, 6 silent mutations,
and 4 missense mutations. Although intronic and silent
mutations generally cannot be excluded to be functionally
relevant,32,33 especially when not found in controls, we
focused on the missense mutations at this stage. Three
missense mutations (Glu251Gly, Arg1872His, and
Asp2023Gly) found in the patient cohort could not be
identified in 400 control chromosomes. These mutations all
affect amino acids that are conserved between PROSIT240
and TRAP240 (Figure 4) and could therefore be important for
protein function. Glu251Gly and Asp2023Gly represent exchanges that significantly change biochemical properties of
the respective amino acid. One of the mutations (Glu251Gly)
is also carried by the patient’s mother, who did not present
with dTGA. Unfortunately, this mother was not available for
further clinical testing to check for previously undiagnosed
(subtle) heart defects. The mutation could represent a rare
polymorphism, yet finding the mutation in a healthy parent
can also be explained by incomplete penetrance, which has
been previously reported in congenital heart disease (eg, in
ZIC3; see above).
Detecting 3 missense mutations and 1 gene interruption
(leading to haploinsufficiency) in dTGA patients strongly
suggests a contribution of PROSIT240 to heart development.
The putative relatedness of PROSIT240 to TRAP240 could
point to an involvement of the TRAP complex. The Drosophila homologues of TRAP240 and TRAP230 were shown to act
together to control cell affinity to establish cell boundaries, a
process that might also be relevant to our observation relating
PROSIT240 malfunction to dTGA.34 Amino acid exchanges
caused by missense mutations could alter the ability of
PROSIT240 to interact with target activators or repressors.
Understanding more about the mechanisms leading to dTGA
might also help to determine whether dTGA could be
considered a manifestation of a left-right laterality defect
2850
Circulation
December 9, 2003
concerning the heart, a point that has been raised based on
data from animal models35,36 and the fact that ZIC3 and CFC1
mutations are detected both in patients with dTGA and in
heterotaxy problems.8,11 In animal models, most interestingly,
Pitx2⫺/⫺ and Dvl⫺/⫺ mice present with outflow tract abnormalities, including TGA and laterality defects. Both genes are
part of the Wnt/Dvl/␤-catenin 3 Pitx2 pathway, which was
shown to recruit TRAP components.36 It will be interesting to
see whether there will be a common pathogenetic mechanism
involved in causing dTGA and laterality defects. With
PROSIT240, we were able to bring a novel, exciting player
into the game, leading the way toward new questions that can
be raised concerning the complexity of heart formation.
Acknowledgments
N.M. was supported by the Landesgraduiertenförderung BadenWürttemberg, Germany. We thank Dr Rüdiger Blaschke for critically reading the manuscript and Maike Boerger, Dr Beate Niesler,
and Dr Bernd Frank for helpful support.
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
References
1. Hoffman JI. Incidence of congenital heart disease, I: postnatal incidence.
Pediatr Cardiol. 1995;16:103–113.
2. Hoffman JI. Incidence of congenital heart disease, II: prenatal incidence.
Pediatr Cardiol. 1995;16:155–165.
3. Schoetzau A, van Santen F, Sauer U, et al. Kardiovaskuläre Fehlbildungen in Bayern 1984 –1991. Z Kardiol. 1997;86:496 –505.
4. Samanek M. Congenital heart malformations: prevalence, severity,
survival, and quality of life. Cardiol Young. 2000;10:179 –185.
5. Fyler DC, Buckley LP, Hellenbrand WE, et al. Report of the New
England regional infant cardiac program. Pediatrics. 1980;65(suppl):
375– 461.
6. Burn J, Brennan P, Little J, et al. Recurrence risks in offspring of adults
with major heart defects: results from first cohort of British collaborative
study. Lancet. 1998;351:311–316.
7. Digilio MC, Casey B, Toscano A, et al. Complete transposition of the
great arteries: patterns of congenital heart disease in familial precurrence.
Circulation. 2001;104:2809 –2814.
8. Megarbane A, Salem N, Stephan E, et al. X-linked transposition of the
great arteries and incomplete penetrance among males with a nonsense
mutation in ZIC3. Eur J Hum Genet. 2000;8:704 –708.
9. Goldmuntz E, Bamford R, Karkera JD, et al. CFC1 mutations in patients
with transposition of the great arteries and double-outlet right ventricle.
Am J Hum Genet. 2002;70:776 –780.
10. Gebbia M, Ferrero GB, Pilia G, et al. X-linked situs abnormalities result
from mutations in ZIC3. Nat Genet. 1997;17:305–308.
11. Bamford RN, Roessler E, Burdine RD, et al. Loss-of-function mutations
in the EGF-CFC gene CFC1 are associated with human left-right laterality defects. Nat Genet. 2000;26:365–369.
12. Melchionda S, Digilio MC, Mingarelli R, et al. Transposition of the great
arteries associated with deletion of chromosome 22q11. Am J Cardiol.
1995;75:95–98.
13. Takahashi K, Kido S, Hoshino K, et al. Frequency of a 22q11 deletion in
patients with conotruncal cardiac malformations: a prospective study. Eur
J Pediatr. 1995;154:878 – 881.
14. Goldmuntz E, Clark BJ, Mitchell LE, et al. Frequency of 22q11 deletions
in patients with conotruncal defects. J Am Coll Cardiol. 1998;32:
492– 498.
15. Ito M, Yuan CX, Malik S, et al. Identity between TRAP and SMCC
complexes indicates novel pathways for the function of nuclear receptors
and diverse mammalian activators. Mol Cell. 1999;3:361–370.
16. Ito M, Yuan CX, Okano HJ, et al. Involvement of the TRAP220 component of the TRAP/SMCC coactivator complex in embryonic development and thyroid hormone action. Mol Cell. 2000;5:683– 693.
17. Treisman JE. Drosophila homologues of the transcriptional coactivation
complex subunits TRAP240 and TRAP230 are required for identical
processes in eye-antennal disc development. Development. 2001;128:
603– 615.
18. Lichter P, Cremer T. Human Cytogenetics: A Practical Approach.
Oxford/New York/Tokyo: IRL Press/Oxford University Press; 1992.
19. Samuelsen CO, Baraznenok V, Khorosjutina O, et al. TRAP230/ARC240
and TRAP240/ARC250 mediator subunits are functionally conserved
through evolution. Proc Natl Acad Sci U S A. 2003;100:6422– 6427.
20. Fondell JD, Ge H, Roeder RG. Ligand induction of a transcriptionally
active thyroid hormone receptor coactivator complex. Proc Natl Acad Sci
U S A. 1996;93:8329 – 8333.
21. Fondell JD, Guermah M, Malik S, et al. Thyroid hormone receptorassociated proteins and general positive cofactors mediate thyroid
hormone receptor function in the absence of the TATA box-binding
protein-associated factors of TFIID. Proc Natl Acad Sci U S A. 1999;96:
1959 –1964.
22. Yuan CX, Ito M, Fondell JD, et al. The TRAP220 component of a thyroid
hormone receptor-associated protein (TRAP) coactivator complex
interacts directly with nuclear receptors in a ligand-dependent fashion.
Proc Natl Acad Sci U S A. 1998;95:7939 –7944.
23. Ren Y, Behre E, Ren Z, et al. Specific structural motifs determine
TRAP220 interactions with nuclear hormone receptors. Mol Cell Biol.
2000;20:5433–5446.
24. Antonarakis SE. Recommendations for a nomenclature system for human
gene mutations: Nomenclature Working Group. Hum Mutat. 1998;
11:1–3.
25. Malik S, Roeder RG. Transcriptional regulation through mediator-like
coactivators in yeast and metazoan cells. Trends Biochem Sci. 2000;25:
277–283.
26. Kastner P, Mark M, Chambon P. Nonsteroid nuclear receptors: what are
genetic studies telling us about their role in real life? Cell. 1995;83:
859 – 869.
27. Forrest D, Reh RA, Rusch A. Neurodevelopmental control by thyroid
hormone receptors. Curr Opin Neurobiol. 2002;12:49 –56.
28. Kastner P, Grondona JM, Mark M, et al. Genetic analysis of RXR␣
developmental function: convergence of RXR and RAR signaling
pathways in heart and eye morphogenesis. Cell. 1994;78:987–1003.
29. Gaio U, Schweickert A, Fischer A, et al. A role of the cryptic gene in the
correct establishment of the left-right axis. Curr Biol. 1999;9:1339 –1342.
30. Yan YT, Gritsman K, Ding J, et al. Conserved requirement for EGF-CFC
genes in vertebrate left-right axis formation. Genes Dev. 1999;13:
2527–2537.
31. Marble M, Morava E, Lopez R, et al. Report of a new patient with
transposition of the great arteries with deletion of 22q11.2. Am J Med
Genet. 1998;78:317–318.
32. Krawczak M, Reiss J, Cooper DN. The mutational spectrum of single
base-pair substitutions in mRNA splice junctions of human genes: causes
and consequences. Hum Genet. 1992;90:41–54.
33. Cartegni L, Chew SL, Krainer AR. Listening to silence and understanding
nonsense: exonic mutations that affect splicing. Nat Rev Genet. 2002;3:
285–298.
34. Janody F, Martirosyan Z, Benlali A, et al. Two subunits of the Drosophila
mediator complex act together to control cell affinity. Development.
2003;130:3691–3701.
35. Yasui H, Morishima M, Nakazawa M, et al. Anomalous looping, atrioventricular cushion dysplasia, and unilateral ventricular hypoplasia in the
mouse embryos with right isomerism induced by retinoic acid. Anat Rec.
1998;250:210 –219.
36. Kioussi C, Briata P, Baek SH, et al. Identification of a Wnt/Dvl/␤catenin3 Pitx2 pathway mediating cell-type-specific proliferation during
development. Cell. 2002;111:673– 685.
Missense Mutations and Gene Interruption in PROSIT240, a Novel TRAP240-Like Gene,
in Patients With Congenital Heart Defect (Transposition of the Great Arteries)
Nadja Muncke, Christine Jung, Heinz Rüdiger, Herbert Ulmer, Ralph Roeth, Annette Hubert,
Elizabeth Goldmuntz, Deborah Driscoll, Judith Goodship, Karin Schön and Gudrun Rappold
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Circulation. 2003;108:2843-2850; originally published online November 24, 2003;
doi: 10.1161/01.CIR.0000103684.77636.CD
Circulation is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2003 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7322. Online ISSN: 1524-4539
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circ.ahajournals.org/content/108/23/2843
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation is online at:
http://circ.ahajournals.org//subscriptions/