Download Effects in Alzheimer`s Disease Protective and Pathogenic Cell Type

Proteinase-Activated Receptor-2 Exerts
Protective and Pathogenic Cell Type-Specific
Effects in Alzheimer's Disease
This information is current as
of June 16, 2017.
Amir Afkhami-Goli, Farshid Noorbakhsh, Avril J. Keller,
Nathalie Vergnolle, David Westaway, Jack H. Jhamandas,
Patricia Andrade-Gordon, Morley D. Hollenberg, Hosseinali
Arab, Richard H. Dyck and Christopher Power
References
Subscription
Permissions
Email Alerts
This article cites 80 articles, 27 of which you can access for free at:
http://www.jimmunol.org/content/179/8/5493.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2007 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
J Immunol 2007; 179:5493-5503; ;
doi: 10.4049/jimmunol.179.8.5493
http://www.jimmunol.org/content/179/8/5493
The Journal of Immunology
Proteinase-Activated Receptor-2 Exerts Protective and
Pathogenic Cell Type-Specific Effects in Alzheimer’s Disease1
Amir Afkhami-Goli,*†**†† Farshid Noorbakhsh,*† Avril J. Keller,‡ Nathalie Vergnolle,§
David Westaway,¶储# Jack H. Jhamandas,* Patricia Andrade-Gordon,§§ Morley D. Hollenberg,§
Hosseinali Arab,** Richard H. Dyck,‡ and Christopher Power2*†
P
roteinases comprise 2% of the human genome and exert a
wide variety of biological effects (1). Several serine proteases are signaling molecules acting through proteolytic
cleavage at specific sites within the extracellular N terminus of
seven transmembrane G protein-coupled receptors, proteinase-activated receptors (PAR),3 to unmask a tethered ligand domain (2).
These ligands bind to conserved domains in extracellular loop II of
*Department of Medicine, University of Alberta, Edmonton, Alberta, Canada; †Departments of Clinical Neurosciences, ‡Psychology, and §Pharmacology and Therapeutics, University of Calgary, Calgary, Alberta, Canada; ¶Centre for Research in
Neurodegenerative Diseases, 储Department of Laboratory Medicine and Pathobiology,
and #Department of Medical Biophysics, University of Toronto, Toronto, Ontario,
Canada; **Department of Pharmacology, Faculty of Veterinary Medicine, University
of Tehran, Tehran, Iran; ††Department of Pharmacology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran; and §§Johnson & Johnson
Pharmaceutical Research and Development, Spring House, PA 19477
Received for publication April 12, 2007. Accepted for publication July 25, 2007.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
These studies were supported by the Canadian Institutes of Health Research (to C.P.,
N.V., M.D.H., and R.H.D.) and the Strafford Foundation for Alzheimer’s Research (to
R.H.D. and C.P.). N.V. is an Alberta Heritage Foundation for Medical Research
(AHFMR) Scholar and a Canadian Institute of Health Research New Investigator, and
C.P. holds a Canada Research Chair (T1) in Neurological Infection and Immunity and
is an AHFMR Senior Scholar.
2
Address correspondence and reprint requests to Dr. C. Power, Department of Medicine (Neurology), 611 Heritage Medical Research Centre, University of Alberta,
Edmonton, Alberta, Canada. E-mail address: [email protected]
3
Abbreviations used in this paper: AD, Alzheimer’s disease; A␤1– 42, fibrillar 42-aa
form of ␤-amyloid peptide; APP, amyloid precursor protein; ER, endoplasmic reticulum; FPRL1, formyl peptide receptor-like-1; FPR2, formyl peptide receptor-2;
GRP58, glucose-regulated protein 58; KO, knockout; WT, wild type; MDM, monocyte-derived macrophage; PAR, proteinase-activated receptor; RFN, rat fetal neuron;
Tg, transgenic; UPR, unfolded protein response; NeuN, neuronal nuclear Ag; GFAP,
glial fibrillary acidic protein.
Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00
www.jimmunol.org
the receptor to initiate signaling. Among the four identified PARs,
PAR1, PAR3, and PAR4 are targeted by thrombin whereas trypsin
and mast cell tryptase activate PAR2 (3– 6). In the absence of
proteolytic cleavage, various PARs can also be directly activated
by synthetic hexapeptides corresponding to the tethered ligands (7,
8). All four PARs are expressed widely on neurons and glial cells
in the nervous system and regulate diverse cellular functions including gene transcription, neuronal cell proliferation, differentiation, and survival (2, 4, 9). In particular, PAR2 has been shown
to have widespread effects in the peripheral nervous system, where
it plays important roles in inflammation, neuronal signaling, and
nociception (3, 10 –12). PAR2 is also expressed on neurons and
glial cells in the CNS and is associated with the pathogenesis of
ischemia, neurodegeneration, and neuroinflammation, depending
on the specific disease and experimental paradigm (13–16). As
well, PAR2 can exert neuroprotective effects (17–19). Nevertheless, the precise roles that PAR2 plays in different inflammatory
and degenerative brain diseases remain uncertain.
Alzheimer’s disease (AD) is a progressive and fatal neurodegenerative disease characterized by irreversible cognitive decline,
memory impairment, and behavioral changes. These clinical features are accompanied by specific pathological changes in the
brain, defined by extracellular deposition of a fibrillar 42-aa form
of ␤-amyloid (A␤1– 42) peptide surrounded by dystrophic neurites,
which constitute senile plaques. A␤1– 42 is one of the enzymatic
cleavage fragments of the amyloid precursor protein (APP), which
exerts direct neurotoxic effects while also inducing endoplasmic
reticulum (ER) stress response in neurons (20 –24). Nevertheless,
the notion that A␤ deposition is the direct cause of neurodegeneration associated with AD does not appear to be supported by
pathological examination of postmortem human brain tissues; neurons, and their processes can appear intact despite diffuse A␤ deposits, which might represent early stages of the A␤ deposition
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
The proteinase-activated receptors (PARs) are a novel family of G protein-coupled receptors, and their effects in neurodegenerative
diseases remain uncertain. Alzheimer’s disease (AD) is a neurodegenerative disorder defined by misfolded protein accumulation with
concurrent neuroinflammation and neuronal death. We report suppression of proteinase-activated receptor-2 (PAR2) expression in
neurons of brains from AD patients, whereas PAR2 expression was increased in proximate glial cells, together with up-regulation of
proinflammatory cytokines and chemokines and reduced IL-4 expression (p < 0.05). Glial PAR2 activation increased expression of
formyl peptide receptor-2 (p < 0.01), a cognate receptor for a fibrillar 42-aa form of ␤-amyloid (A␤1– 42), enhanced microglia-mediated
proinflammatory responses, and suppressed astrocytic IL-4 expression, resulting in neuronal death (p < 0.05). Conversely, neuronal
PAR2 activation protected human neurons against the toxic effects of A␤1– 42 (p < 0.05), a key component of AD neuropathogenesis.
Amyloid precursor protein-transgenic mice, displayed glial fibrillary acidic protein and IL-4 induction (p < 0.05) in the absence of
proinflammatory gene up-regulation and neuronal injury, whereas PAR2 was up-regulated at this early stage of disease progression.
PAR2-deficient mice, after hippocampal A␤1– 42 implantation, exhibited enhanced IL-4 induction and less neuroinflammation (p < 0.05),
together with improved neurobehavioral outcomes (p < 0.05). Thus, PAR2 exerted protective properties in neurons, but its activation
in glia was pathogenic with secretion of neurotoxic factors and suppression of astrocytic anti-inflammatory mechanisms contributing to
A␤1– 42-mediated neurodegeneration. The Journal of Immunology, 2007, 179: 5493–5503.
5494
DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS
Table I. Real-time RT-PCR primer list
Gene
Species
Sense
Antisense
PAR2
Trypsinogen
FPRL1
TNF-a
IL-10
IL-8
IL-4
GRP58
GRP78
PAR2
Trypsinogen
FPR2
Mip-2
IL-4
F4/80
GFAP
Human
Human
Human
Human
Human
Human
Human
Human, mouse
Human, mouse
Mouse
Mouse
Mouse
Mouse
Mouse
Mouse
Mouse
CTGGCCATTGGGGTCTTTCTGTTC
TCAGCGAACAGTGGGTGGTATCAG
TTGGTTTCCCTTTCAACTGG
ATTCAGGAATGTGTGGCCTGC
CCTCTCACCGTCTTGCTTTC
CACCGGAAGGAACCATCTCAC
GGCTGACTTAGGAGCTGGTG
TCAAGGGTTTTCCTACCATCTACTTC
TCATCGGACGCACTTGGAA
TGGCCATTGGAGTCTTCCTGTT
ATCTCTGGCTGGGGCAACACTC
CCTTATAGTCTTGAGAGAGCCCTGA
TGAGTGTGACGCCCCCAGGAC
CGGCATTTTGAACGAGGTC
GCCACCTGCACTGACACC
GGACATCGAGATCGCCACCTACAG
GGCCCTCTTCCTTTTCTTCTCTGA
GAGGGGCGGTGGGCAGAG
ACTTAAAGCATGGGGTTGAG
GTTTGAATTCTTAGTGGTTGCCAG
GCAGAGGTTGCTTGTTCTCC
TGGTCCACTCTCAATCACTCTCAG
GTGTTCCCTGCCATACTCGT
TTAATTCACGGCCACCTTCAT
CAACCACCTTGAATGGCAAGA
TAGCCCTCTGCCTTTTCTTCTC
CTAGGAAGCCAGCACAGACCAT
TGCAGGAGGTGAAGTAGAACTGG
TCAGACAGCGAGGCACATCAGGTA
CGAAAAGCCCGAAAGAGTC
GCTGCACTTGGCTCTCC
CTCACCATCCCGCATCTCCACAGT
Materials and Methods
Human brain tissues
Brain samples were obtained from the Laboratory for Neurological Infection and Immunity Brain Bank, University of Alberta (Edmonton, Alberta,
Canada). Frontal lobe tissues from Alzheimer’s (n ⫽ 6; mean age, 73 ⫾ 5
years) and non-Alzheimer’s (non-AD; n ⫽ 6; mean age, 68 ⫾ 6 years;
stroke, multiple sclerosis, sepsis, leukemia) patients were collected at autopsy with consent and stored at ⫺80°C, as previously described (37, 38).
Cell cultures and experimental treatments
Primary rat basal forebrain neurons were cultured from 16- to 17-day-old
embryos of pregnant rats, as previously described (39) and in accordance
with the protocol approved by the local Health Sciences Laboratory of
Animal Policy and Welfare Committee of the University of Alberta.
Briefly, septal regions containing the basal forebrain neurons were dissected in HBSS (Invitrogen Life Technologies) supplemented with 15 mM
HEPES, 10 U/ml penicillin. and 10 mg/ml streptomycin, dissociated using
0.05% trypsin, triturated, and then plated on poly-D-lysine-coated wells.
Cultures were grown at 37°C with 5% CO2 in a humidified atmosphere in
Neurobasal medium supplemented with N2 supplement (Invitrogen Life
Technologies). Experiments were performed 7 days after cell plating for
36 h using the fibrillar aggregated form of the ␤-amyloid peptide (A␤1– 42)
prepared according to a modified protocol of Haughey et al. (40). Briefly,
a 1 mM solution of A␤1– 42 (Bachem; H-1368) peptide was incubated in
PBS at 37°C for 2–3 days before the experiment. For neuronal PAR2
activation, primary rat neurons were incubated for 36 h with 100 ␮M
SLIGRL-NH2 as PAR2-activating peptide or mutant inactive peptide
LSIGRL-NH2 (Peptide Synthesis Facility, University of Calgary, Calgary,
Canada) in AIM-V serum-free medium (Invitrogen Life Technologies).
Mouse primary astrocyte cultures were established from CNS tissue
from 2-day-old C57BL/6 PAR2 homozygous knockout (KO) (41) mice and
littermate homozygous wild-type (WT) mice as described previously (42).
Cells were cultured in MEM (Invitrogen Life Technologies) containing
10% FBS, 1 mM sodium pyruvate, and 2 mM L-glutamine. Mouse bone
marrow-derived macrophages were isolated from the pelvic and femoral
bone marrow of adult PAR2 WT and KO mice as described previously
(38). Bone marrow cells were cultured in DMEM containing 10% FBS,
10% L929 cell-conditioned medium, and 2 mM L-glutamine (Invitrogen
Life Technologies). Cells were incubated in 10% CO2 for 5 days before
additional treatments. Macrophages or astrocytes were treated with 100
␮M SLIGRL-NH2 or LSIGRL-NH2 for 4 h. For TNF-␣ treatments, macrophages or astrocytes were treated with TNF-␣ for 8 h before RNA
extraction.
Human monocyte-derived-macrophage (MDM) cultures were prepared
from healthy individuals as previously described (37). Macrophages and
astrocytic U373 cells were incubated with fibrillar A␤1– 42, SLIGRL or
LSIGRL prepared as described above in AIM-V serum-free medium for
4 h. Media were then changed for fresh AIM-V medium without peptides,
and supernatants were harvested 36 h later and stored at ⫺80°C for subsequent neuronal toxicity experiment on human fetal neurons.
Human fetal neurons were cultured in MEM containing 10% FBS, 1%
sodium pyruvate, 1% L-glutamine, 1% MEM nonessential amino acid solution, 1% dextrose, and 1% N2 supplement (Invitrogen Life Technologies)
as described previously (43). Selection for nondifferentiated neurons was
performed by a treatment with arabinofuranosylcytosine (25 ␮M; SigmaAldrich) for 2 wk. Twenty-four hours after being seeded, cells were incubated in MDM and U373 supernatants for 36 h. The neurotoxicity of these
supernatants was assessed as described below.
Quantitative cellular immunoreactivity
The quantification of PAR2 and also GRP58 immunoreactivity was performed using In-cell Western analysis (ODYSSEY Infrared Imaging System; LI-COR Biosciences) according to the manufacturer’s guidelines. We
also used immunoreactivity of ␤-tubulin, a cell structural protein, for assessment of neurotoxicity, as well as normalyzing GRP58 and PAR2 immunoreactivity to the number of the cells. Briefly, treated cells (in quadruplicate) were fixed with 3.7% formaldehyde followed by washing with
PBS. For tubulin and Grp58 immunoreactivity cells were washed with PBS
containing 0.1% Triton X-100 to permeabilize the cell membranes. Cells
were incubated with LI-COR Odyssey Blocking Buffer for 1.5 h before the
addition of a mouse monoclonal anti-␤-tubulin isotype III (1/800; SigmaAldrich), a rabbit polyclonal Ab (B5) raised against rat PAR2 (1/500;
30
GPNSKGR2SLIGRLDT46P-YGGC, coupled to keyhole limpet hemocyanin; 2 ⫽ trypsin cleavage site, YGGC for conjugation) (8) or goat
polyclonal anti-GRP58 (1/50; Santa Cruz Biotechnology) Ab in blocking
buffer overnight at 4°C. After extensive washes in 0.1% Tween, cells were
incubated for 1 h with fluorescent-labeled secondary Abs goat anti-mouse
Alexa Fluor-680 (1/200; Molecular Probes), goat anti-rabbit IRDye
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
(25). Dystrophic neurites in senile plaques associated with activated glia point to the relevance of inflammatory responses as
determinants of neuronal degeneration observed in AD. Moreover,
the concept of neurodegeneration caused by A␤-induced inflammatory responses has received further impetus from the epidemiological and experimental studies, highlighting the effects of nonsteroidal anti-inflammatory drugs in preventing or retarding the
age of onset of AD (26 –28). There is substantial evidence that
sustained neuroinflammation is present in senile plaques with aggregation of activated microglia in the center and reactive astrocytes that marginate the A␤ deposits and extend their processes
toward the center of plaques (25, 29 –32). Both activated microglia
and astrocytes are known to secrete a wide variety of molecules
involved in neuroinflammation and are potential sources of proinflammatory and neurotoxic agents in the brain (25, 33–36).
Considering the overall proinflammatory profile and deficient
protective mechanisms in AD brains, and the consistent observation that PAR2 is widely expressed on neurons and glial cells in
the brain, we proposed that PAR2 might contribute to AD
pathogenesis. We therefore investigated the effects of PAR2 on
A␤1– 42-mediated neurotoxicity in both neurons and glia including expression of the putative A␤1– 42 receptor formyl peptide
receptor-2 (FPR2).
The Journal of Immunology
5495
800CW (1/800; Rockland), or donkey anti-goat IRDye 800 (1/100; Rockland) Ab diluted in blocking buffer supplemented with 0.2% Tween 20 to
lower the background. After a washing, plates were scanned simultaneously at 700 and 800 nm using the Odyssey Infrared Imaging System.
Western blot analysis
Protein extracts were prepared from brain tissues samples with cell lysis
buffer (20 mM Tris, 1% Triton X-100, 0.05% SDS, 5 mg of sodium deoxycholate, 150 mM NaCl, and 1 mM PMSF), and concentrations were
determined by bicinchoninic acid assay (Pierce). Fifty micrograms of protein were separated by 10% SDS-polyacrylamide and transferred onto nitrocellulose membranes followed by blocking with 10% skimmed milk
(38). Membranes were then probed with monoclonal antisera to MAP-2
(1/500; Sigma-Aldrich), synaptophysin (/1000; Santa Cruz Biotechnology)
or HRP-conjugated ␤-actin (1/200; Chemicon International) overnight at
4°C followed by washing with TBS-Tween 20. Goat anti-mouse secondary
Ab conjugated to HRP (1/2500; Chemicon International) was used to detect the primary Abs. After several washes, peroxidase activity on the
membrane was detected by chemiluminescence (Roche Diagnostics, Laval,
Quebec, Canada).
APP-transgenic mice
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
Transgenic (TgCRND8) mice encoding a double-mutated allele of the human APP genes implicated in AD (Swedish, KM670/671NL; Indiana,
V717F) under the control of hamster PrP gene promoter (44) were maintained on a hybrid background (C57BL/6/C3H). To obtain mice for the
experiments, TgCRND8 males were crossed with C57BL/6 WT female
mice. Twenty-four-week-old gender- and weight-matched heterozygous
TgCRND8 mice (n ⫽ 4) and non-Tg littermates (n ⫽ 3), were used in the
present studies.
␤-Amyloid implantation
Twelve-week-old male PAR2 homozygous KO mice and littermate homozygous WT controls were anesthetized under isoflurane. Bilateral infusions of 1 mM fibrillar A␤1– 42 (40) (n ⫽ 14) or PBS (n ⫽ 12) were made
stereotaxically into the dorsal hippocampus (2.5 mm posterior; ⫾2 mm
lateral; 1.4 mm ventral), using 31-gauage cannulae connected by PE tubing
to 5-␮l Hamilton syringes mounted on a Hamilton syringe drive. Fibrillar
A␤1– 42 or PBS was infused at a rate of 0.4 ␮l/min over a period of 5 min.
The cannulae were left in place for 10 min before being slowly withdrawn.
Animals were allowed to recover for 1 wk before behavioral testing. Implantation of oligomeric A␤1– 42 (45) did not cause neurobehavioral abnormalities. All experiments followed Calgary Animal Care Committee guidelines and were approved by the University of Calgary Animal Care
Committee.
Behavioral Testing
Acquisition of spatial learning and memory after drug infusion were assessed using the Morris water maze task (46). The apparatus was a circular
tank 123 cm in diameter, 35 cm deep, raised 60 cm from the floor, and
filled to a height of ⬃21.5 cm with 22°C water made opaque by the addition of skim milk powder. A 10- ⫻ 10-cm escape platform was submerged 1.5 cm below the surface of the water, positioned in the middle of
the northeast quadrant. All mice received two blocks of four swimming
trials each day, for 4 consecutive days. For each trial block, animals were
released from each of the four cardinal compass points (morth, east, south,
and west) and allowed to swim freely until they climbed onto the platform,
or after 60 s had elapsed. If the mouse found the platform, it was allowed
to remain there for 10 s; if it failed to find the platform, it was placed on
the platform for 10 s. On the fifth day, the animals were subjected to a
single probe trial during which the platform was removed, and each animal
was allowed to swim freely for 60 s. Swim paths were recorded and analyzed using the 2020 Plus tracking system for the Morris water maze (HVS
Image). Data were analyzed on a Power Mac G5 (Apple) using a repeated
measures ANOVA (Statview 5; SAS Institute).
Real-time RT-PCR
Total RNAs from cultured cells and from human and mouse brain tissues
were prepared using Trizol (Invitrogen Life Technologies) according to the
manufacturer’s guidelines. One microgram of total RNA was used for
cDNA synthesis and subsequent PCR. Primer sequences are listed in Table
I. Semiquantitative analysis was performed by monitoring in real time the
increase of fluorescence of the SYBR Green dye on a Bio-Rad-i-Cycler as
described previously (47). All data were normalized against the GAPDH
expression and reported relative to controls ⫾ SEM.
FIGURE 1. Neuroinflammation and PAR2 expression in AD brains.
PAR2 transcript abundance (a) was decreased in brains from AD (n ⫽
6) compared with non-AD (n ⫽ 6) patients. TNF-␣ (b), IL-8 (c), and
IL-10 (data not shown) mRNA levels were up-regulated, whereas IL-4
transcript levels (d) were suppressed in AD brains. There was a downregulation of the ER chaperone, GRP58, mRNA levels in AD brains (e).
In contrast, FPRL1, a potential receptor for A␤1– 42 in glial cells, was
up-regulated in AD brains compared with non-AD brains (f). In non-AD
patients, preactivated (g) and total (i) PAR2 immunoreactivity was
chiefly present in cortical neurons (i, inset shows the staining with Ab
absorbed with immunogen peptide), whereas in AD brains, preactivated
(h) and total (j) PAR2 immunoreactivity was colocalized with CD45
demonstrating its expression predominantly in monocytoid cells in the
cortex. Original magnification, ⫻200 for main panels; ⫻1000 for h and
j insets. Data are mean ⫾ SEM by Student’s t test; ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍
0.01; ⴱⴱⴱ, p ⬍ 0.001; RFC, relative fold change.
5496
DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS
Immunohistochemistry
Immunohistochemical labeling was performed using 5-␮m paraffin-embedded serial human brain sections prepared as previously described (38).
Sections were incubated overnight at 4°C with rabbit polyclonal Ab raised
to a peptide corresponding to two noncontiguous epitopes (SLAWLLG;
PNSKGR)intheratPAR2N-terminalsequence 5SLAWLLG12G-31PNSKGR/
GGYGGC to detect a preactivated form of PAR2 (SLAW-A; 1/200; Ref.
48), or rabbit polyclonal anti-PAR2 (B5) Ab (1/500; Ref. 8), in PBS containing
5% normal goat serum and 0.2% Triton X-100. Secondary alkaline phosphatase-conjugated goat anti-rabbit Ab (1/500; Jackson ImmunoResearch Laboratories) followed by NBT-5-bromo-4-chloro-3-indolyl phosphate substrate
(Vector Laboratories) were used to detect subsequent immunoreactivity.
Mouse monoclonal anti-CD45 (1/200; Zymed Laboratories) and biotinylated
goat anti-mouse Ab followed by avidin-biotin-peroxidase amplification (Vector Laboratories) and 3,3⬘-diaminobenzidine tetrachloride staining (Vector
Laboratories) were used for double labeling.
Immunofluorescence and confocal laser scanning microscopy
Paraffin-embedded mouse brain serial sections (5 ␮m) were double-immunolabeled for neuronal nuclear Ag (NeuN; 1/200; Chemicon International)
and either glial fibrillary acidic protein (GFAP; 1/200; DAKO), ionized
calcium binding adaptor molecule (Iba-1; 1/400; Wako) or cleaved
caspase-3 (Asp175, 1/100; Cell Signaling Technology) (38). Brain sections
were also double-immunolabeled with antisera recognizing IL-4 (1/100;
BD Pharmingen) and NeuN, GFAP, or Iba-1. Cy3-conjugated goat anti-
mouse or Alexa 488-conjugated goat anti-rabbit and goat anti-rat secondary Abs (Molecular Probes) were used to detect Ag-specific binding. Images were captured on a LSM510 META (Carl Zeiss MicroImaging)
confocal laser scanning microscope and analyzed using LSM 5 Image
Browser software (Carl Zeiss MicroImaging).
Statistical analysis
Statistical analyses were performed by ANOVA and Tukey-Kramer or
Dunnet as post hoc tests using GraphPad Instat version 3.0 (GraphPad
Software). p values of ⬍0.05 were considered significant.
Results
PAR2 expression is selectively decreased in AD brains
The neuropathology of AD is defined by neuronal injury and loss
together with ␤-amyloid and tangle accumulation, in conjunction
with neuroimmune activation (22, 25, 29 –32). To investigate
whether PAR2 participated in these pathological aspects associated with AD, we examined PAR2 transcript levels in frontocortical brain regions from AD and non-AD patients. This analysis
revealed a significant decrease in PAR2 mRNA levels in AD compared with non-AD patient brains (Fig. 1a), whereas expression of
trypsinogen was not changed (data not shown). TNF-␣ (Fig. 1b),
IL-8 (Fig. 1c), and IL-10 (data not shown) transcript levels were
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 2. Neuronal PAR2 activation protects neurons against A␤1– 42 toxicity. a, Human
cholinergic (LAN-2) and RFN cells expressed
PAR2. Background represents the same conditions without primary Ab. b, Fibrillar A␤1– 42 incubation for 36 h decreased the cytoskeletal isotype III ␤-tubulin immunoreactivity as a
neuronal viability marker in RFNs; c, decreased
PAR2 expression (normalized against ␤-tubulin
immunoreactivity) on LAN-2 cells in concentration-dependent manners; d, PAR2 activation
with SLIGRL increased the neuronal viability
and protected RFNs against A␤1– 42 toxicity,
whereas the control peptide LSIGRL had no effect; e, A␤1– 42 also induced the expression of
ER stress protein, GRP58 (normalized against
␤-tubulin immunoreactivity) in RFNs; f, activation of PAR2 with SLIGRL reversed A␤1– 42induced GRP58 expression. Data are mean ⫾
SEM by Student’s t test (a), Dunnet (b, c, and e)
and Tukey-Kramer multiple comparisons (d and
f) tests; ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01; ⴱⴱⴱ, p ⬍
0.001. All experiments were performed in quadruplicate and background subtracted average
intensities of fluorescence units (arbitrary) are
used for quantification of immunoreactivity
(IR).
The Journal of Immunology
up-regulated in AD brains, in contrast to the anti-inflammatory
cytokine IL-4, which was significantly suppressed in AD compared with non-AD brains (Fig. 1d). There was no change in the
mRNA levels of ER stress gene, GRP78 (also known as BiP),
between AD and non-AD brains (data not shown), whereas GRP58
was significantly down-regulated in AD brains (Fig. 1e). It has
been shown that A␤1– 42 serves as a high affinity and specific agonist for formyl peptide receptor-like 1 (FPRL1) and its murine
counterpart FPR2, thereby activating microglia to produce a wide
variety of proinflammatory cytokines and neurotoxins (49 –52).
There was a significant increase in mRNA levels of FPRL1 in AD
brains (Fig. 1f). Using previously reported antisera to PAR2, immunohistochemical staining showed that preactivated PAR2 (Fig.
1g) and also total PAR2 (Fig. 1i) immunoreactivity was chiefly
present in cortical neurons of non-AD brains. In contrast, in AD
brains, glial cells were the principal cells exhibiting preactivated
(Fig. 1h) and total (Fig. 1j) PAR2 immunoreactivity, as there was
a profound neuronal loss in cortical regions. Indeed, each form of
PAR2 was colocalized with the microglial marker, CD45, in AD
brains (Fig. 1, h and j, inset). Although these data suggested that
total PAR2 levels were reduced in AD brains, its immunoreactivity
and activation were more prominent in glial cells of AD brains
together with an up-regulation of several proinflammatory genes
and suppression of the prototype anti-inflammatory gene, IL-4.
Neuronal PAR2 activation protects neurons against
A␤1– 42 toxicity
PAR2 has been shown to be expressed on neurons in CNS and play
important roles in neuronal excitation and proliferation (2– 4). To
assess the role of PAR2 on neurons, we investigated its expression
and effects in different neuronal cell lines. Both human cholinergic
neuronal (LAN-2) cells and rat fetal neurons (RFN) displayed
PAR2 immunoreactivity (Fig. 2a). Treatment of RFN with fibrillar
A␤1– 42 induced neurotoxicity as shown by a concentration-dependent decrease in the immunoreactivity of neuron-specific cytoskeletal protein, class III ␤-tubulin (Refs. 53 and 54 and Fig. 2b).
Indeed, A␤1– 42 also suppressed neuronal PAR2 immunoreactivity
FIGURE 4. Macrophage and astrocytic (Astro) PAR2 activation increases A␤1– 42-induced neuroimmune activation and neurotoxicity. a, IL-8
expression in human macrophages was increased during A␤1– 42 treatment,
whereas PAR2 activation exerted an additive effect with A␤1– 42. b, In
human astrocytes, IL-8 expression is unchanged whereas PAR2 activation
suppressed IL-4 expression. c, Supernatants (S/N) from A␤1– 42-treated
macrophages were toxic to human fetal neurons, whereas macrophage
PAR2 activation augmented the toxicity. Astrocyte-derived supernatant
had no toxic effects on human fetal neurons. Data are mean ⫾ SEM; Dunnett’s test; ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01; ⴱⴱⴱ, p ⬍ 0.001. Experiments performed in quadruplicate. (SLI, SLIGRL-NH2; LSI, LSIGRL-NH2).
(Fig. 2c). Incubation of neurons with the PAR2 activating peptide,
SLIGRL or the missense receptor-inactive peptide LSIGRL (55)
indicated that PAR2 activation alone did not affect the ␤-tubulin
reactivity, but it enhanced neuronal viability during A␤1– 42 neurotoxic treatments (Fig. 2d). Protein levels of the ER stress chaperone protein GRP58 (normalized against ␤-tubulin immunoreactivity) showed a robust up-regulation with A␤1– 42 treatment,
indicating that A␤1– 42 can enhance ER stress (Fig. 2e). Moreover,
lower levels of GRP58 expression (normalized against ␤-tubulin)
were observed after PAR2 activation in A␤1– 42-treated RFNs, supporting the notion of a protective role for PAR2 in neurons concomitant with a reduction in neuronal ER stress (Fig. 2f).
Macrophage and astrocytic PAR2 activation increases
FPR-2 expression
In addition to its direct neurotoxicity, A␤1– 42 is a potent activator
of microglia and induces multiple proinflammatory cytokines and
neurotoxins through its cognate receptor, FPR2, in murine macrophages (49 –52). A␤1– 42 can also stimulate astrocytes to release
inflammatory cytokines and chemokines (25, 56). Given that
PAR2 is expressed on brain monocytoid cells (perivascular macrophages/microglia) and astrocytes, we investigated the potential
role of PAR2 on indirect A␤1– 42 neurotoxicity. Murine macrophages and astrocytes were treated with SLIGRL, disclosing significant up-regulation of FPR2 transcripts in macrophages (Fig.
3a) and also astrocytes (Fig. 3b), compared with untreated or
LSIGRL treated cells. It is also known that proinflammatory stimuli
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 3. PAR2 activation increases FPR2 expression on mouse glia.
Activation of PAR2 with SLIGRL enhanced the expression of FPR2 in
mouse primary macrophage (M␾; a) and astrocytes (Astro; b). Induction of
FPR2 expression by TNF-␣ was significantly reduced in PAR2 KO macrophages (c) and astrocytes (d) compare with WT cells. Data are mean ⫾
SEM; Tukey-Kramer multiple comparisons test; ⴱⴱ, p ⬍ 0.01; ⴱⴱⴱ, p ⬍
0.001; n ⫽ 5; RFC, relative fold change.
5497
5498
such as LPS and TNF-␣ can enhance the functional expression of
FPR2 in microglia (57, 58). To assess the potential effects of PAR2
in TNF-␣ signaling leading to FPR2 induction, we treated macrophages and astrocytes from PAR2 null (KO) (41) and WT littermates with this cytokine. In macrophages and astrocytes from WT
mice, TNF-␣ caused a marked increase in the FPR2 mRNA levels,
with a markedly lower response observed in macrophages (Fig. 3c)
and astrocytes (Fig. 3d) from the KO animals. These results suggest that PAR2 is involved in AD neuropathogenesis by modulating FPR2 expression in glial cells and also TNF-␣ inducing effect
in terms of FPR2 expression.
Macrophage and astrocytic PAR2 activation increases
proinflammatory gene expression and enhances the neurotoxic
effects of A␤1– 42
Earlier studies have shown that A␤1– 42 induces the expression of
a range of proinflammatory cytokines and chemokines in human
microglia, notably IL-8, which by itself potentiates A␤1– 42 induc-
FIGURE 6. PAR2-deficient mice showed reduced neuroimmune responses after A␤1– 42 implantation. a, Decreased transcript levels of PAR2
were evident in A␤1– 42-implanted mice. b, There was no significant change
in trypsinogen transcript levels. Up-regulation of F4/80 (c) and GFAP (d)
was evident in A␤1– 42-implanted WT animals but not in implanted PAR2
KO littermates or in PBS-implanted animals. MIP-2 (e) mRNA levels were
increased in A␤1– 42-implanted WT animals, in contrast to IL-4 transcript
levels, which were up-regulated in PAR2 KO animals receiving A␤1– 42
implants (f). mRNA levels of ER stress gene GRP58 were also increased
in A␤1– 42-implanted PAR2 KO animals (g). PAR2 KO animals, regardless
of whether they were A␤1– 42 implanted or not, showed lower levels of
FPR2 (h). Data are mean ⫾ SEM; Tukey-Kramer multiple comparisons
test; ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01; ⴱⴱⴱ, p ⬍ 0.001. n ⫽ 6 in all four groups.
RFC, relative fold change.
tion of other inflammatory cytokines and chemokines (59 – 61). In
contrast, IL-4 suppresses the expression and activity of microglial
FPR2/FPRL1 (62, 63) and down-modulates the proinflammatory
responses induced by A␤1– 42 (64). Several studies have also reported neuroprotective effects for IL-4 in different settings (65–
67), including protection against ␤-amyloid-induced hippocampal
injury (68). In view of the ability of PAR2 activation to up-regulate
a potential receptor for A␤1– 42 on microglia and astrocytes, we
next examined the impact of PAR2 activation on the inflammatory
profile induced by A␤1– 42. The ability of fibrillar A␤1– 42 to induce
IL-8 expression in human macrophages (MDM) was enhanced by
the concurrent activation of PAR2 (Fig. 4a). In contrast, in human
astrocytic (U373) cells, fibrillar A␤1– 42 did not induce an increase
in IL-8 or IL-4 mRNA levels in either the absence or presence of
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 5. APP-Tg mice display early stages of neurodegenerative disease. a, Western blot analysis showed no difference in the neuronal protein,
MAP-2, or synaptophysin immunoreactivity between WT (n ⫽ 3) and
APP-Tg (n ⫽ 4) groups. Brain PAR2 (b) mRNA levels were up-regulated
in APP-Tg mice, without any change in trypsinogen (c) expression compared with WT controls. Transcript levels of the activated macrophage/
microglial gene, F4/80 (d), in brain was unchanged, in contrast to astrocytic
gene, GFAP (e), which was up-regulated in APP-Tg mice. MIP-2 (f), the
murine homolog of human IL-8, remained unchanged, whereas IL-4 (g)
was induced in the brains of the APP-Tg group. There were no differences
in FPR2 expression between groups (h). Data are mean ⫾ SEM; Student’s
t test; ⴱ, p ⬍ 0.05; RFC, relative fold change.
DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS
The Journal of Immunology
5499
PAR2 activation. Instead, PAR2 activation by SLIGRL (but not
LSIGRL) selectively suppressed the expression of IL-4 in astrocytes in the presence or absence of A␤1– 42 (Fig. 4b). IL-4 transcripts were not detectable in macrophages (data not shown).
To investigate the neurotoxic properties of macrophage and astrocytic PAR2 activation, human fetal neurons were treated with
supernatants from the above macrophage and astrocytic cells after
PAR2 activation and/or A␤1– 42 treatment (Fig. 4c). Neurons incubated with supernatants from A␤-treated macrophages revealed
that neuronal viability was diminished in an A␤1– 42 concentrationdependent manner. Moreover, activation of PAR2 on macrophages
with SLIGRL significantly reduced neuronal viability in an additive manner, whereas LSIGRL had no effect. In contrast, supernatants from astrocytes, regardless of the treatment protocol, exerted
no neurotoxic effects (Fig. 4c). Thus, activation of PAR2 on macrophages with or without A␤1– 42 cotreatment, caused the release
of soluble neurotoxins.
PAR2 is up-regulated in APP-Tg mice
Because postmortem AD brains principally show late stage pathology, we examined the early pathogenic features of AD using a
transgenic model that represented the similar levels of A␤ (mg
equivalent) to sporadic AD brains and also displays many of the
neuropathological and clinical aspects of AD, except for neuronal
death (44). Supporting the absence of neuronal death in this model,
human mutant APP-Yg (TgCRND8) mice showed no significant
changes in the neuronal marker MAP-2 or the synaptic marker,
synaptophysin, compared with nontransgenic (non-Tg) littermate
controls (Fig. 5a). However, a significant increase in PAR2 mRNA
levels was observed in TgCRND8 mice (Fig. 5b) compared with
non-Tg littermates, without significant changes in trypsinogen expression (Fig. 5c). Given the role of inflammatory mediators in
progression of AD, we investigated the activation of different cell
types at this stage of the disease, revealing no significant changes
in mRNA levels of the macrophage/microglia activation marker
F4/80 (Fig. 5d), while the astrocytic marker, GFAP, was up-regulated in TgCRND8 mice (Fig. 5e). MIP-2, the murine homolog of
human IL-8 did not differ in transcript levels between groups (Fig.
5f). In contrast, IL-4 was significantly up-regulated in TgCRND8
mice (Fig. 5g), whereas there were no significant differences in
transcript levels of FPR2 (Fig. 5h), GRP78 or GRP58 (data not
shown) between groups. Although neuronal loss was not a feature
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 7. PAR2 deficiency is neuroprotective against A␤1– 42 implantation. Immunolabeling of PBS-implanted PAR2 WT (a and d),
PBS-implanted PAR2 KO (data not shown),
A␤1– 42-implanted PAR2 KO (b and e), and
A␤1– 42-implanted PAR2 WT (c and f) mouse
brains with anti-NeuN (green) and anti-Iba-1
(red) (a– c) or anti-GFAP (red; d–f) Abs revealed more severe microglial and actrocytic activation in dorsal hippocampi of WT (c and f)
animals implanted with A␤1– 42, as compared
with A␤1– 42-implanted PAR2 KO (b and e) and
PBS-implanted WT (a and d) animals. Colocalization of IL-4 with GFAP immunoreactivity
was evident (e, inset). Immunolabeling for
cleaved caspase-3 showed higher immunoreactivity in A␤1– 42-implanted WT animals (i) compared with A␤1– 42-implanted PAR2 KO animals
(h). Immunoreactivity for cleaved-caspase-3
was absent in PBS-implanted WT animals (g).
Insets in g, h, and i show colocaliztion with the
neuronal marker, NeuN. Original magnification,
630; 2 ⫻ 630 magnification for e, inset; j,
A␤1– 42-implanted PAR2 WT animals exhibited
consistently delayed neurobehavioral responses
during the Morris water maze. Data are mean ⫾
SEM, Tukey-Kramer multiple comparisons test;
ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01. n ⫽ 6.
5500
DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS
of this AD model as is also the case for other Tg-APP695 mice
(69) at this stage of the disease, PAR2 up-regulation in the Tg mice
indicated that it might be an early marker of the disease process.
PAR2 deficiency affects the A␤-induced inflammatory profile in
mouse brains
To determine the direct in vivo effects of A␤1– 42, the fibrillar form
of the peptide (40) was implanted into the dorsal hippocampus of
PAR2 WT and KO mice, and gene expression was subsequently
examined at 1 wk postimplantation. Recapitulating our findings in
human AD brains (Fig. 1), PAR2 expression was significantly suppressed in WT mpise brains receiving A␤1– 42 (Fig. 6a). There was
no significant change in trypsinogen transcript levels (Fig. 6b), but
microphage/microglial F4/80 (Fig. 6c) and astrocytic GFAP (Fig.
6d) transcripts were up-regulated in WT animals receiving A␤1– 42
implants. In the A␤1– 42-implanted PAR2 KO or in PBS-implanted
animals, F4/80 and GFAP transcript levels were lower than in the
A␤1– 42-treated WT animals, indicating a differential activation of
neuroglial cells in A␤1– 42-implanted PAR2 WT vs KO brains.
MIP-2 transcript levels also were increased in A␤1– 42-implanted
WT mice (Fig. 6e). In contrast, IL-4 was significantly up-regulated
in PAR2 KO compared with WT animals receiving A␤1– 42 implants and PBS-implanted animals (Fig. 6f). Unlike human AD
brains and WT mice receiving A␤1– 42, a robust GRP58 induction
was also detectable in KO mice receiving A␤1– 42 (Fig. 6g),
whereas GRP78 expression was unchanged (data not shown).
Complementing these findings, PAR2 KO groups showed lower
levels of FPR2 compared with the WT groups (Fig. 6h), underlining the direct interactions between PAR2 and fibrillar A␤1– 42mediated toxicity.
PAR2 deficiency is protective during A␤ toxicity
Consistent with the present differences in inflammatory and protective gene expression, immunofluorescence studies revealed that
Iba-1 (Fig. 7, a– c) and GFAP (Fig. 8, d–f) immunoreactivity were
markedly enhanced in macrophage and astrocytes, respectively, in
the dorsal hippocampus of PAR2 WT (Fig. 7, c and f, respectively)
compared with KO animals (Fig. 7, b and e, respectively) receiving
A␤1– 42 implants. IL-4 immunoreactivity was colocalized with
GFAP (Fig. 7e, inset) but not with Iba-1 (data not shown), demonstrating the cell specificity for IL-4 expression in the brain. To
investigate A␤1– 42-induced activation of cell death pathways in
neurons, we performed immunolabeling studies for the detection
of activated form of caspase-3. As expected, cleaved caspase-3
immunoreactivity was absent in the dorsal hippocampus of animals implanted with PBS (Fig. 7g). However, cleaved caspase-3
immunoreactivity was evident in the hippocampus of A␤1– 42-implanted animals and WT animals (Fig. 7i) showed greater immunoreactivities than did PAR2 KO littermates (Fig. 7h). Indeed,
cleaved caspase-3 immunolabeling was colocalized with NeuN
immunoreactivity (Fig. 7, h and i, insets), underlying the relative
vulnerability of neurons in this system. Moreover, we observed a
more severe neurobehavioral phenotype in PAR2 WT animals after fibrillar A␤1– 42 implantation compared with PAR2 KO littermates receiving A␤1– 42 and the PBS-implanted animals, as evidenced by A␤1– 42-implanted WT animals showing a significantly
longer latency to find the submerged escape platform during Morris water maze testing (Fig. 7j). Hence, our findings revealed that
intact PAR2 expression contributed to glial cell neuroimmune activation and worsened neurobehavioral outcomes after exposure to
fibrillar A␤1– 42 with ensuing neuronal apoptosis (Fig. 8).
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 8. Divergent effects of PAR2 on AD pathogenesis. In addition to the protective properties of neuronal PAR2 in the context of A␤1– 42 neurotoxicity,
A␤1– 42-induced microglial activation, mediated by
FPR2/FPRL1, was amplified by PAR2 coactivation,
leading to the release of neurotoxins, inflammatory cytokines, and chemokines such as IL-8, and subsequently
induces neuronal death. Although PAR2 mediated these
proinflammatory effects, it also suppressed an important
inhibitor of this cascade, astrocyte-derived IL-4. The
overall consequence of PAR2 activation was to augment the neuroinflammatory response, which overwhelmed the direct protective effects of neuronal PAR2.
The Journal of Immunology
Discussion
shown that fibrillar form of A␤1– 42 induces ER stress characterized by induction of neuronal GRP58 expression in vitro and simultaneous decreases in neuronal viability. This observation is
consistent with earlier reports describing the activation of UPR
during AD, usually with increased levels of GRP78 as another
stress marker (23, 24). Importantly, GRP58 appears to wield neuroprotective properties in other neurodegenerative diseases (73). In
our model, down-regulation of neuronal PAR2 by A␤1– 42 was
important in that PAR2 activation can decrease the neuronal susceptibility to A␤1– 42 and ER stress, all pointing out to a protective
role for neuronal PAR2. This result is in agreement with the previous studies, which have shown the protective effects of PAR2 on
neurons in the context of cerebral ischemia (17) and HIV-associated dementia (18).
The pathogenic significance of inflammatory responses elicited
by brain glial cells during AD has drawn considerable attention in
recent years (29 –32). A striking neuropathological feature of AD
is the consistent appearance of activated microglia and astrocytes
in proximity to amyloid plaques/deposition, indicating a process of
focal recruitment and activation of these cells. Several in vitro
studies have shown that A␤1– 42 can directly activate macrophages
and astrocytes with the ensuing secretion of proinflammatory cytokines and chemokines through engagement of murine FPR2 or
its human counterpart FPRL1 (49 –52). We have extended these
studies by demonstrating that PAR2 activation regulates the expression of FPR2 in microglia and astrocytes, either directly or
through interfering with TNF-␣ signaling. This last observation
might be reinforced by the fact that TNF-␣ and PAR2 share some
common signaling pathways such as NF-␬B activation (57, 58,
74). It has been shown that IL-8 overexpression is a potentially
important inflammatory response during A␤1– 42 toxicity (59, 61)
which can play an important role in chemoattraction and potentiates A␤1– 42-induced production of other inflammatory cytokines
and chemokines (60). Indeed, our present studies implied that activation of PAR2 on monocytoid cells with A␤1– 42 application
synergistically augmented IL-8 expression (Fig. 8). Lymphocyte
activation and infiltration does not appear to participate in this
pathogenic cascade, likely because PAR2 is not expressed on lymphocytes (16). Taken together, these latter results are in accordance with the overexpression of TNF-␣, IL-8, and FPRL1 in autopsied AD brains coupled with microglial activation and
overexpression of MIP-2 in A␤1– 42-implanted WT mice. Although
overall PAR2 transcript abundance was suppressed in autopsied
AD brains, the residual expression was limited to glial cells. These
data support the notion that PAR2 can play an important role in
inflammatory aspects of AD, thereby exacerbating the neuropathogenic process through concurrent mechanisms.
Activation of PARs requires specific proteases and, for PAR2,
trypsin and mast cell tryptase are established cognate proteases (2,
4). Trypsinogen is expressed in the nervous system (16, 18), although its contribution to AD neuropathogenesis remains unclear.
Herein, trypsinogen expression did not differ between AD and
non-AD brains; likewise, its expression was not altered in both
animal models of AD used in the present study although it was
expressed by both neurons and glia (data not shown). It is plausible
that other proteases may activate individual PARs; indeed several
proteases implicated in neurodegenerative diseases, such as kallikreins and matrix metalloproteinases, have recently been shown
to activate different PARs (75– 80). Aside from the broad range of
effects that PAR2 exercises in neurons during development and
disease, a pivotal question to pursue will be to identify its putative
cognate protease(s). Nonetheless, cell type-specific mechanisms
by which PAR2 affects neuronal viability and fate lend themselves
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
PAR2, which is widely expressed on different cell types in the
nervous system, appears to exert both protective and pathogenic
effects depending on the specific neurological disorder (13–18).
Although PAR2 can promote inflammation within the nervous system (10 –16), it can also mediate protective neuronal responses
(17–19). Herein, we investigated the direct contributions of PAR2
to neuronal viability together with its indirect effects on neurons
through activation of proximate immune cells involved in the
pathogenesis of AD (Fig. 8). Although fibrillar A␤1– 42 was directly toxic to neurons and induced ER stress, concurrent activation of PAR2 suppressed A␤1– 42 neurotoxicity, pointing to a protective role for neuronally expressed PAR2 (Fig. 8). Of possible
mechanistic importance for AD, PAR2 activation on monocytoid
cells (macrophages/microglia) and astrocytes was associated with
up-regulation of FPR2, a putative receptor for A␤1– 42 and modulated TNF-␣ effects on FPR2 induction. Moreover, PAR2 activation on macrophages exacerbated A␤1– 42-induced inflammatory
responses, indirectly reducing neuronal viability through the release of putative neurotoxins in variable amounts depending on the
experimental model (Fig. 8). In astrocytes, PAR2 activation resulted in the suppression of anti-inflammatory cytokine, IL-4, underscoring the pathogenic roles for PAR2 in immune cells. To
glean insight into the temporal aspects of PAR2 expression and
function in different stages of AD pathogenesis, APP-Tg mice
were used as an early stage model of AD, revealing elevated IL-4
expression and astrocytic activation without evidence of proinflammatory responses or neuronal injury. Of interest, induction of
PAR2 in this model seemed to be an early cellular response before
later inflammation and neuronal death. Conversely, brain samples
from autopsied AD patients disclosed that in conjunction with profound neuronal loss in cortex, PAR2 immunoreactivity on neurons
and transcript abundance were diminished with concurrent proinflammatory responses. Similarly, after fibrillar A␤1– 42 implantation into the hippocampus, PAR2 expression was reduced in PAR2
WT mice. This was associated with a proinflammatory response
and a neurobehavioral phenotype in conjunction with neuronal apoptosis. In matched littermate KO animals, there were no A␤1– 42induced proinflammatory effects although both IL-4 and GRP58
expression were enhanced, together with reduced FPR2 expression, emphasizing the complex roles of PAR2 in inducing neuroinflammation and suppression of neuronal and astrocytic-mediated neuroprotective signals. Interestingly, neurobehavioral and
neuropathological outcomes were also less severe in PAR2 KO
animals compared with the WT littermates. Although astrocytes
are not considered a major source of IL-4, several studies have
shown that IL-4 expression is detectable and can be induced by
proinflammatory cytokines in astrocytes (70 –72). Considering the
suppressive effects of PAR2 activation on astrocytic IL-4 expression, it is conceivable that fibrillar A␤1– 42 implantation in the absence of PAR2 signaling drives the expression of IL-4 by these
cells, leading to a more neuroprotective phenotype.
Increased production and/or impaired clearance of aggregated
forms of ␤-amyloid peptides represent an established hallmark of
AD neuropathogenesis. Several lines of evidence indicate that A␤
peptides, most notably A␤1– 42, are toxic to neurons (20 –22).
Moreover, A␤ accumulation triggers an unfolded protein response
(UPR) in affected cells following the accumulation of misfolded
proteins (23, 24) in the ER. Activation of the UPR results in an
overall decrease in translation, enhanced protein degradation, and
increased expression levels of ER chaperones such as GRP78 and
GRP58, which subsequently increases the protein-folding capacity
of the ER to protect cells against further injury. Here, we have
5501
5502
to pharmacological manipulation in future studies of therapeutic
interventions for neurodegenerative diseases.
Acknowledgments
We thank Dr. Arthur W. Clark for helpful discussions, Neda Shariat and
David MacTavish for technical assistance, and Stephanie Skinner for assistance with manuscript preparation.
DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS
23.
24.
25.
Disclosures
The authors have no financial conflict of interest.
26.
References
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
1. Southan, C. 2001. A genomic perspective on human proteases. FEBS Lett. 498:
214 –218.
2. Noorbakhsh, F., N. Vergnolle, M. D. Hollenberg, and C. Power. 2003. Proteinase-activated receptors in the nervous system. Nat. Rev. Neurosci. 4: 981–990.
3. Cottrell, G. S., S. Amadesi, F. Schmidlin, and N. Bunnett. 2003. Protease-activated receptor 2: activation, signalling and function. Biochem. Soc. Trans. 31:
1191–1197.
4. Ossovskaya, V. S., and N. W. Bunnett. 2004. Protease-activated receptors: contribution to physiology and disease. Physiol. Rev. 84: 579 – 621.
5. Wang, Y., W. Luo, T. Wartmann, W. Halangk, M. Sahin-Toth, and G. Reiser.
2006. Mesotrypsin, a brain trypsin, activates selectively proteinase-activated receptor-1, but not proteinase-activated receptor-2, in rat astrocytes. J. Neurochem.
99: 759 –769.
6. Cottrell, G. S., S. Amadesi, E. F. Grady, and N. W. Bunnett. 2004. Trypsin IV,
a novel agonist of protease-activated receptors 2 and 4. J. Biol. Chem. 279:
13532–13539.
7. Hollenberg, M. D., M. Saifeddine, B. al-Ani, and A. Kawabata. 1997. Proteinaseactivated receptors: structural requirements for activity, receptor cross-reactivity,
and receptor selectivity of receptor-activating peptides. Can. J. Physiol. Pharmacol. 75: 832– 841.
8. Al-Ani, B., M. Saifeddine, A. Kawabata, B. Renaux, S. Mokashi, and
M. D. Hollenberg. 1999. Proteinase-activated receptor 2 (PAR2): development of
a ligand-binding assay correlating with activation of PAR2 by PAR1- and PAR2derived peptide ligands. J. Pharmacol. Exp. Ther. 290: 753–760.
9. Macfarlane, S. R., M. J. Seatter, T. Kanke, G. D. Hunter, and R. Plevin. 2001.
Proteinase-activated receptors. Pharmacol. Rev. 53: 245–282.
10. Steinhoff, M., N. Vergnolle, S. H. Young, M. Tognetto, S. Amadesi, H. S. Ennes,
M. Trevisani, M. D. Hollenberg, J. L. Wallace, G. H. Caughey, et al. 2000.
Agonists of proteinase-activated receptor 2 induce inflammation by a neurogenic
mechanism. Nat. Med. 6: 151–158.
11. Vergnolle, N., J. L. Wallace, N. W. Bunnett, and M. D. Hollenberg. 2001. Protease-activated receptors in inflammation, neuronal signaling and pain. Trends
Pharmacol. Sci. 22: 146 –152.
12. Vergnolle, N., M. Ferazzini, M. R. D’Andrea, J. Buddenkotte, and M. Steinhoff.
2003. Proteinase-activated receptors: novel signals for peripheral nerves. Trends
Neurosci. 26: 496 –500.
13. Smith-Swintosky, V. L., C. T. Cheo-Isaacs, M. R. D’Andrea, R. J. Santulli,
A. L. Darrow, and P. Andrade-Gordon. 1997. Protease-activated receptor-2
(PAR-2) is present in the rat hippocampus and is associated with neurodegeneration. J. Neurochem. 69: 1890 –1896.
14. Olejar, T., R. Matej, M. Zadinova, and P. Pouckova. 2002. Proteinase-activated
receptor-2 expression on cerebral neurones after radiation damage: immunohistochemical observation in Wistar rats. Int. J. Tissue React. 24: 81– 88.
15. Rohatgi, T., P. Henrich-Noack, F. Sedehizade, M. Goertler, C. W. Wallesch,
K. G. Reymann, and G. Reiser. 2004. Transient focal ischemia in rat brain differentially regulates mRNA expression of protease-activated receptors 1 to 4.
J. Neurosci. Res. 75: 273–279.
16. Noorbakhsh, F., S. Tsutsui, N. Vergnolle, L. A. Boven, N. Shariat, M. Vodjgani,
K. G. Warren, P. Andrade-Gordon, M. D. Hollenberg, and C. Power. 2006. Proteinase-activated receptor 2 modulates neuroinflammation in experimental autoimmune encephalomyelitis and multiple sclerosis. J. Exp. Med. 203: 425– 435.
17. Jin, G., T. Hayashi, J. Kawagoe, T. Takizawa, T. Nagata, I. Nagano, M. Syoji,
and K. Abe. 2005. Deficiency of PAR-2 gene increases acute focal ischemic brain
injury. J. Cereb. Blood Flow Metab. 25: 302–313.
18. Noorbakhsh, F., N. Vergnolle, J. C. McArthur, C. Silva, M. Vodjgani,
P. Andrade-Gordon, M. D. Hollenberg, and C. Power. 2005. Proteinase-activated
receptor-2 induction by neuroinflammation prevents neuronal death during HIV
infection. J. Immunol. 174: 7320 –7329.
19. Wang, Y., W. Luo, and G. Reiser. 2006. Proteinase-activated receptor-1-and
proteinase-activated receptor-2 induce the release of chemokine GRO/CINC-1
from rat astrocytes via differential activation of JNK isoforms, evoking multiple
protective pathways in brain. Biochem. J. 401: 65–78.
20. Fogarty, M. P., E. J. Downer, and V. Campbell. 2003. A role for c-Jun N-terminal
kinase 1 (JNK1), but not JNK2, in the ␤-amyloid-mediated stabilization of protein p53 and induction of the apoptotic cascade in cultured cortical neurons.
Biochem. J. 371: 789 –798.
21. Awasthi, A., Y. Matsunaga, and T. Yamada. 2005. Amyloid-␤ causes apoptosis
of neuronal cells via caspase cascade, which can be prevented by amyloid-␤derived short peptides. Exp. Neurol. 196: 282–289.
22. Kadowaki, H., H. Nishitoh, F. Urano, C. Sadamitsu, A. Matsuzawa, K. Takeda,
H. Masutani, J. Yodoi, Y. Urano, T. Nagano, and H. Ichijo. 2005. Amyloid ␤
induces neuronal cell death through ROS-mediated ASK1 activation. Cell Death
Differ. 12: 19 –24.
Hoozemans, J. J., R. Veerhuis, E. S. Van Haastert, J. M. Rozemuller, F. Baas,
P. Eikelenboom, and W. Scheper. 2005. The unfolded protein response is activated in Alzheimer’s disease. Acta Neuropathol. 110: 165–172.
Hoozemans, J. J., J. Stieler, E. S. van Haastert, R. Veerhuis, A. J. Rozemuller,
F. Baas, P. Eikelenboom, T. Arendt, and W. Scheper. 2006. The unfolded protein
response affects neuronal cell cycle protein expression: implications for Alzheimer’s disease pathogenesis. Exp. Gerontol. 41: 380 –386.
Akiyama, H., T. Arai, H. Kondo, E. Tanno, C. Haga, and K. Ikeda. 2000. Cell
mediators of inflammation in the Alzheimer disease brain. Alzheimer Dis. Assoc.
Disord. 14 (Suppl. 1): S47–S53.
Hirohata, M., K. Ono, H. Naiki, and M. Yamada. 2005. Non-steroidal antiinflammatory drugs have anti-amyloidogenic effects for Alzheimer’s ␤-amyloid
fibrils in vitro. Neuropharmacology 49: 1088 –1099.
Townsend, K. P., and D. Pratico. 2005. Novel therapeutic opportunities for Alzheimer’s disease: focus on nonsteroidal anti-inflammatory drugs. FASEB J. 19:
1592–1601.
McGeer, P. L., and E. G. McGeer. 2006. NSAIDs and Alzheimer disease: epidemiological, animal model and clinical studies. Neurobiol. Aging 28: 629 – 647.
McGeer, P. L., and E. G. McGeer. 2002. Local neuroinflammation and the progression of Alzheimer’s disease. J. Neurovirol. 8: 529 –538.
Rosenberg, P. B. 2005. Clinical aspects of inflammation in Alzheimer’s disease.
Int. Rev. Psychiatry 17: 503–514.
Tuppo, E. E., and H. R. Arias. 2005. The role of inflammation in Alzheimer’s
disease. Int. J. Biochem. Cell Biol. 37: 289 –305.
Sastre, M., T. Klockgether, and M. T. Heneka. 2006. Contribution of inflammatory processes to Alzheimer’s disease: molecular mechanisms. Int. J. Dev. Neurosci. 24: 167–176.
Minagar, A., P. Shapshak, R. Fujimura, R. Ownby, M. Heyes, and C. Eisdorfer.
2002. The role of macrophage/microglia and astrocytes in the pathogenesis of
three neurologic disorders: HIV-associated dementia, Alzheimer disease, and
multiple sclerosis. J. Neurol. Sci. 202: 13–23.
Streit, W. J., R. E. Mrak, and W. S. Griffin. 2004. Microglia and neuroinflammation: a pathological perspective. J. Neuroinflamm. 1: 14.
Streit, W. J. 2004. Microglia and Alzheimer’s disease pathogenesis. J. Neurosci.
Res. 77: 1– 8.
Ralay Ranaivo, H., J. M. Craft, W. Hu, L. Guo, L. K. Wing, L. J. Van Eldik, and
D. M. Watterson. 2006. Glia as a therapeutic target: selective suppression of
human amyloid-␤-induced upregulation of brain proinflammatory cytokine production attenuates neurodegeneration. J. Neurosci. 26: 662– 670.
Johnston, J. B., C. Silva, J. Holden, K. G. Warren, A. W. Clark, and C. Power.
2001. Monocyte activation and differentiation augment human endogenous retrovirus expression: implications for inflammatory brain diseases. Ann. Neurol.
50: 434 – 442.
Tsutsui, S., J. Schnermann, F. Noorbakhsh, S. Henry, V. W. Yong,
B. W. Winston, K. Warren, and C. Power. 2004. A1 adenosine receptor upregulation and activation attenuates neuroinflammation and demyelination in a model
of multiple sclerosis. J. Neurosci. 24: 1521–1529.
Mennicken, F., and R. Quirion. 1997. Interleukin-2 increases choline acetyltransferase activity in septal-cell cultures. Synapse 26: 175–183.
Haughey, N. J., A. Nath, S. L. Chan, A. C. Borchard, M. S. Rao, and
M. P. Mattson. 2002. Disruption of neurogenesis by amyloid ␤-peptide, and
perturbed neural progenitor cell homeostasis, in models of Alzheimer’s disease.
J. Neurochem. 83: 1509 –1524.
Damiano, B. P., W. M. Cheung, R. J. Santulli, W. P. Fung-Leung, K. Ngo,
R. D. Ye, A. L. Darrow, C. K. Derian, L. de Garavilla, and P. Andrade-Gordon.
1999. Cardiovascular responses mediated by protease-activated receptor-2
(PAR-2) and thrombin receptor (PAR-1) are distinguished in mice deficient in
PAR-2 or PAR-1. J. Pharmacol. Exp. Ther. 288: 671– 678.
Corley, S. M., U. Ladiwala, A. Besson, and V. W. Yong. 2001. Astrocytes attenuate oligodendrocyte death in vitro through an ␣6 integrin-laminin-dependent
mechanism. Glia 36: 281–294.
Power, C., J. C. McArthur, A. Nath, K. Wehrly, M. Mayne, J. Nishio,
T. Langelier, R. T. Johnson, and B. Chesebro. 1998. Neuronal death induced by
brain-derived human immunodeficiency virus type 1 envelope genes differs between demented and nondemented AIDS patients. J. Virol. 72: 9045–9053.
Chishti, M. A., D. S. Yang, C. Janus, A. L. Phinney, P. Horne, J. Pearson,
R. Strome, N. Zuker, J. Loukides, J. French, et al. 2001. Early-onset amyloid
deposition and cognitive deficits in transgenic mice expressing a double mutant
form of amyloid precursor protein 695. J. Biol. Chem. 276: 21562–21570.
Dahlgren, K. N., A. M. Manelli, W. B. Stine, Jr., L. K. Baker, G. A. Krafft, and
M. J. LaDu. 2002. Oligomeric and fibrillar species of amyloid-␤ peptides differentially affect neuronal viability. J. Biol. Chem. 277: 32046 –32053.
Morris, R. 1984. Developments of a water-maze procedure for studying spatial
learning in the rat. J. Neurosci. Methods 11: 47– 60.
Power, C., S. Henry, M. R. Del Bigio, P. H. Larsen, D. Corbett, Y. Imai,
V. W. Yong, and J. Peeling. 2003. Intracerebral hemorrhage induces macrophage
activation and matrix metalloproteinases. Ann. Neurol. 53: 731–742.
Wang, J., H. Zheng, M. D. Hollenberg, S. J. Wijesuriya, X. Ou, and
M. Hauer-Jensen. 2003. Up-regulation and activation of proteinase-activated receptor 2 in early and delayed radiation injury in the rat intestine: influence of
biological activators of proteinase-activated receptor 2. Radiat. Res. 160:
524 –535.
Le, Y., W. Gong, H. L. Tiffany, A. Tumanov, S. Nedospasov, W. Shen,
N. M. Dunlop, J. L. Gao, P. M. Murphy, J. J. Oppenheim, and J. M. Wang. 2001.
The Journal of Immunology
50.
51.
52.
53.
54.
55.
56.
57.
59.
60.
61.
62.
63.
64.
65. Chao, C. C., T. W. Molitor, and S. Hu. 1993. Neuroprotective role of IL-4 against
activated microglia. J. Immunol. 151: 1473–1481.
66. Park, K. W., D. Y. Lee, E. H. Joe, S. U. Kim, and B. K. Jin. 2005. Neuroprotective role of microglia expressing interleukin-4. J. Neurosci. Res. 81: 397– 402.
67. Zhao, W., W. Xie, Q. Xiao, D. R. Beers, and S. H. Appel. 2006. Protective effects
of an anti-inflammatory cytokine, interleukin-4, on motoneuron toxicity induced
by activated microglia. J. Neurochem. 99: 1176 –1187.
68. Lynch, A. M., D. J. Loane, A. M. Minogue, R. M. Clarke, D. Kilroy, R. E. Nally,
O. J. Roche, F. O’Connell, and M. A. Lynch. 2007. Eicosapentaenoic acid confers neuroprotection in the amyloid-␤ challenged aged hippocampus. Neurobiol.
Aging 28: 845– 855.
69. Phinney, A. L., P. Horne, J. Yang, C. Janus, C. Bergeron, and D. Westaway.
2003. Mouse models of Alzheimer’s disease: the long and filamentous road.
Neurol. Res. 25: 590 – 600.
70. Hulshof, S., L. Montagne, C. J. De Groot, and P. Van Der Valk. 2002. Cellular
localization and expression patterns of interleukin-10, interleukin-4, and their
receptors in multiple sclerosis lesions. Glia 38: 24 –35.
71. Meeuwsen, S., C. Persoon-Deen, M. Bsibsi, R. Ravid, and J. M. van Noort. 2003.
Cytokine, chemokine and growth factor gene profiling of cultured human astrocytes after exposure to proinflammatory stimuli. Glia 43: 243–253.
72. Abbas, N., I. Bednar, E. Mix, S. Marie, D. Paterson, A. Ljungberg, C. Morris,
B. Winblad, A. Nordberg, and J. Zhu. 2002. Up-regulation of the inflammatory
cytokines IFN-␥ and IL-12 and down-regulation of IL-4 in cerebral cortex regions of APPSWE transgenic mice. J. Neuroimmunol. 126: 50 –57.
73. Hetz, C., M. Russelakis-Carneiro, S. Walchli, S. Carboni, E. Vial-Knecht,
K. Maundrell, J. Castilla, and C. Soto. 2005. The disulfide isomerase Grp58 is a
protective factor against prion neurotoxicity. J. Neurosci. 25: 2793–2802.
74. Macfarlane, S. R., C. M. Sloss, P. Cameron, T. Kanke, R. C. McKenzie, and
R. Plevin. 2005. The role of intracellular Ca2⫹ in the regulation of proteinaseactivated receptor-2 mediated nuclear factor ␬B signalling in keratinocytes.
Br. J. Pharmacol. 145: 535–544.
75. Rosenberg, G. A. 2002. Matrix metalloproteinases in neuroinflammation. Glia
39: 279 –291.
76. Oka, Y., A. Uchida, M. Aoyama, M. Fujita, N. Hotta, T. Tada, H. Katano,
M. Mase, K. Asai, and K. Yamada. 2005. Expression of myelencephalon-specific
protease after cryogenic lesioning of the rat parietal cortex. J. Neurotrauma 22:
501–510.
77. Angelo, P. F., A. R. Lima, F. M. Alves, S. I. Blaber, I. A. Scarisbrick, M. Blaber,
L. Juliano, and M. A. Juliano. 2006. Substrate specificity of human kallikrein 6:
salt and glycosaminoglycan activation effects. J. Biol. Chem. 281: 3116 –3126.
78. Oikonomopoulou, K., K. K. Hansen, M. Saifeddine, I. Tea, M. Blaber,
S. I. Blaber, I. Scarisbrick, P. Andrade-Gordon, G. S. Cottrell, N. W. Bunnett,
E. P. Diamandis, and M. D. Hollenberg. 2006. Proteinase-activated receptors,
targets for kallikrein signaling. J. Biol. Chem. 281: 32095–32112.
79. Oikonomopoulou, K., K. K. Hansen, M. Saifeddine, N. Vergnolle, I. Tea,
M. Blaber, S. I. Blaber, I. Scarisbrick, E. P. Diamandis, and M. D. Hollenberg.
2006. Kallikrein-mediated cell signalling: targeting proteinase-activated receptors (PARs). Biol. Chem. 387: 817– 824.
80. Oikonomopoulou, K., K. K. Hansen, M. Saifeddine, N. Vergnolle, I. Tea,
E. P. Diamandis, and M. D. Hollenberg. 2006. Proteinase-mediated cell signalling: targeting proteinase-activated receptors (PARs) by kallikreins and more.
Biol. Chem. 387: 677– 685.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
58.
Amyloid ␤42 activates a G-protein-coupled chemoattractant receptor, FPR-like-1.
J. Neurosci. 21: RC123.
Tiffany, H. L., M. C. Lavigne, Y. H. Cui, J. M. Wang, T. L. Leto, J. L. Gao, and
P. M. Murphy. 2001. Amyloid-␤ induces chemotaxis and oxidant stress by acting
at formylpeptide receptor 2, a G protein-coupled receptor expressed in phagocytes and brain. J. Biol. Chem. 276: 23645–23652.
Cui, Y., Y. Le, H. Yazawa, W. Gong, and J. M. Wang. 2002. Potential role of the
formyl peptide receptor-like 1 (FPRL1) in inflammatory aspects of Alzheimer’s
disease. J. Leukocyte Biol. 72: 628 – 635.
Iribarren, P., Y. Zhou, J. Hu, Y. Le, and J. M. Wang. 2005. Role of formyl peptide
receptor-like 1 (FPRL1/FPR2) in mononuclear phagocyte responses in Alzheimer
disease. Immunol. Res. 31: 165–176.
Jover, T., H. Tanaka, A. Calderone, K. Oguro, M. V. Bennett, A. M. Etgen, and
R. S. Zukin. 2002. Estrogen protects against global ischemia-induced neuronal
death and prevents activation of apoptotic signaling cascades in the hippocampal
CA1. J. Neurosci. 22: 2115–2124.
Abrous, D. N., M. Koehl, and M. Le Moal. 2005. Adult neurogenesis: from
precursors to network and physiology. Physiol. Rev. 85: 523–569.
Al-Ani, B., S. J. Wijesuriya, and M. D. Hollenberg. 2002. Proteinase-activated
receptor 2: differential activation of the receptor by tethered ligand and soluble
peptide analogs. J. Pharmacol. Exp. Ther. 302: 1046 –1054.
Smits, H. A., A. Rijsmus, J. H. van Loon, J. W. Wat, J. Verhoef, L. A. Boven,
and H. S. Nottet. 2002. Amyloid-␤-induced chemokine production in primary
human macrophages and astrocytes. J. Neuroimmunol. 127: 160 –168.
Cui, Y. H., Y. Le, W. Gong, P. Proost, J. Van Damme, W. J. Murphy, and
J. M. Wang. 2002. Bacterial lipopolysaccharide selectively up-regulates the function of the chemotactic peptide receptor formyl peptide receptor 2 in murine
microglial cells. J. Immunol. 168: 434 – 442.
Cui, Y. H., Y. Le, X. Zhang, W. Gong, K. Abe, R. Sun, J. Van Damme, P. Proost,
and J. M. Wang. 2002. Up-regulation of FPR2, a chemotactic receptor for amyloid ␤1– 42 (A␤1– 42), in murine microglial cells by TNF ␣. Neurobiol. Dis. 10:
366 –377.
Walker, D. G., L. F. Lue, and T. G. Beach. 2001. Gene expression profiling of
amyloid ␤ peptide-stimulated human post-mortem brain microglia. Neurobiol.
Aging 22: 957–966.
Franciosi, S., H. B. Choi, S. U. Kim, and J. G. McLarnon. 2005. IL-8 enhancement of amyloid-␤ (A␤1– 42)-induced expression and production of pro-inflammatory cytokines and COX-2 in cultured human microglia. J. Neuroimmunol.
159: 66 –74.
Walker, D. G., J. Link, L. F. Lue, J. E. Dalsing-Hernandez, and B. E. Boyes.
2006. Gene expression changes by amyloid ␤ peptide-stimulated human postmortem brain microglia identify activation of multiple inflammatory processes.
J. Leukocyte Biol. 79: 596 – 610.
Iribarren, P., Y. H. Cui, Y. Le, G. Ying, X. Zhang, W. Gong, and J. M. Wang.
2003. IL-4 down-regulates lipopolysaccharide-induced formyl peptide receptor 2
in murine microglial cells by inhibiting the activation of mitogen-activated protein kinases. J. Immunol. 171: 5482–5488.
Iribarren, P., K. Chen, J. Hu, X. Zhang, W. Gong, and J. M. Wang. 2005. IL-4
inhibits the expression of mouse formyl peptide receptor 2, a receptor for amyloid
␤1– 42, in TNF-␣-activated microglia. J. Immunol. 175: 6100 – 6106.
Szczepanik, A. M., S. Funes, W. Petko, and G. E. Ringheim. 2001. IL-4, IL-10
and IL-13 modulate A ␤1– 42-induced cytokine and chemokine production in primary murine microglia and a human monocyte cell line. J. Neuroimmunol. 113:
49 – 62.
5503