Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Proteinase-Activated Receptor-2 Exerts Protective and Pathogenic Cell Type-Specific Effects in Alzheimer's Disease This information is current as of June 16, 2017. Amir Afkhami-Goli, Farshid Noorbakhsh, Avril J. Keller, Nathalie Vergnolle, David Westaway, Jack H. Jhamandas, Patricia Andrade-Gordon, Morley D. Hollenberg, Hosseinali Arab, Richard H. Dyck and Christopher Power References Subscription Permissions Email Alerts This article cites 80 articles, 27 of which you can access for free at: http://www.jimmunol.org/content/179/8/5493.full#ref-list-1 Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017 J Immunol 2007; 179:5493-5503; ; doi: 10.4049/jimmunol.179.8.5493 http://www.jimmunol.org/content/179/8/5493 The Journal of Immunology Proteinase-Activated Receptor-2 Exerts Protective and Pathogenic Cell Type-Specific Effects in Alzheimer’s Disease1 Amir Afkhami-Goli,*†**†† Farshid Noorbakhsh,*† Avril J. Keller,‡ Nathalie Vergnolle,§ David Westaway,¶储# Jack H. Jhamandas,* Patricia Andrade-Gordon,§§ Morley D. Hollenberg,§ Hosseinali Arab,** Richard H. Dyck,‡ and Christopher Power2*† P roteinases comprise 2% of the human genome and exert a wide variety of biological effects (1). Several serine proteases are signaling molecules acting through proteolytic cleavage at specific sites within the extracellular N terminus of seven transmembrane G protein-coupled receptors, proteinase-activated receptors (PAR),3 to unmask a tethered ligand domain (2). These ligands bind to conserved domains in extracellular loop II of *Department of Medicine, University of Alberta, Edmonton, Alberta, Canada; †Departments of Clinical Neurosciences, ‡Psychology, and §Pharmacology and Therapeutics, University of Calgary, Calgary, Alberta, Canada; ¶Centre for Research in Neurodegenerative Diseases, 储Department of Laboratory Medicine and Pathobiology, and #Department of Medical Biophysics, University of Toronto, Toronto, Ontario, Canada; **Department of Pharmacology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran; ††Department of Pharmacology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran; and §§Johnson & Johnson Pharmaceutical Research and Development, Spring House, PA 19477 Received for publication April 12, 2007. Accepted for publication July 25, 2007. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 These studies were supported by the Canadian Institutes of Health Research (to C.P., N.V., M.D.H., and R.H.D.) and the Strafford Foundation for Alzheimer’s Research (to R.H.D. and C.P.). N.V. is an Alberta Heritage Foundation for Medical Research (AHFMR) Scholar and a Canadian Institute of Health Research New Investigator, and C.P. holds a Canada Research Chair (T1) in Neurological Infection and Immunity and is an AHFMR Senior Scholar. 2 Address correspondence and reprint requests to Dr. C. Power, Department of Medicine (Neurology), 611 Heritage Medical Research Centre, University of Alberta, Edmonton, Alberta, Canada. E-mail address: [email protected] 3 Abbreviations used in this paper: AD, Alzheimer’s disease; A1– 42, fibrillar 42-aa form of -amyloid peptide; APP, amyloid precursor protein; ER, endoplasmic reticulum; FPRL1, formyl peptide receptor-like-1; FPR2, formyl peptide receptor-2; GRP58, glucose-regulated protein 58; KO, knockout; WT, wild type; MDM, monocyte-derived macrophage; PAR, proteinase-activated receptor; RFN, rat fetal neuron; Tg, transgenic; UPR, unfolded protein response; NeuN, neuronal nuclear Ag; GFAP, glial fibrillary acidic protein. Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 www.jimmunol.org the receptor to initiate signaling. Among the four identified PARs, PAR1, PAR3, and PAR4 are targeted by thrombin whereas trypsin and mast cell tryptase activate PAR2 (3– 6). In the absence of proteolytic cleavage, various PARs can also be directly activated by synthetic hexapeptides corresponding to the tethered ligands (7, 8). All four PARs are expressed widely on neurons and glial cells in the nervous system and regulate diverse cellular functions including gene transcription, neuronal cell proliferation, differentiation, and survival (2, 4, 9). In particular, PAR2 has been shown to have widespread effects in the peripheral nervous system, where it plays important roles in inflammation, neuronal signaling, and nociception (3, 10 –12). PAR2 is also expressed on neurons and glial cells in the CNS and is associated with the pathogenesis of ischemia, neurodegeneration, and neuroinflammation, depending on the specific disease and experimental paradigm (13–16). As well, PAR2 can exert neuroprotective effects (17–19). Nevertheless, the precise roles that PAR2 plays in different inflammatory and degenerative brain diseases remain uncertain. Alzheimer’s disease (AD) is a progressive and fatal neurodegenerative disease characterized by irreversible cognitive decline, memory impairment, and behavioral changes. These clinical features are accompanied by specific pathological changes in the brain, defined by extracellular deposition of a fibrillar 42-aa form of -amyloid (A1– 42) peptide surrounded by dystrophic neurites, which constitute senile plaques. A1– 42 is one of the enzymatic cleavage fragments of the amyloid precursor protein (APP), which exerts direct neurotoxic effects while also inducing endoplasmic reticulum (ER) stress response in neurons (20 –24). Nevertheless, the notion that A deposition is the direct cause of neurodegeneration associated with AD does not appear to be supported by pathological examination of postmortem human brain tissues; neurons, and their processes can appear intact despite diffuse A deposits, which might represent early stages of the A deposition Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017 The proteinase-activated receptors (PARs) are a novel family of G protein-coupled receptors, and their effects in neurodegenerative diseases remain uncertain. Alzheimer’s disease (AD) is a neurodegenerative disorder defined by misfolded protein accumulation with concurrent neuroinflammation and neuronal death. We report suppression of proteinase-activated receptor-2 (PAR2) expression in neurons of brains from AD patients, whereas PAR2 expression was increased in proximate glial cells, together with up-regulation of proinflammatory cytokines and chemokines and reduced IL-4 expression (p < 0.05). Glial PAR2 activation increased expression of formyl peptide receptor-2 (p < 0.01), a cognate receptor for a fibrillar 42-aa form of -amyloid (A1– 42), enhanced microglia-mediated proinflammatory responses, and suppressed astrocytic IL-4 expression, resulting in neuronal death (p < 0.05). Conversely, neuronal PAR2 activation protected human neurons against the toxic effects of A1– 42 (p < 0.05), a key component of AD neuropathogenesis. Amyloid precursor protein-transgenic mice, displayed glial fibrillary acidic protein and IL-4 induction (p < 0.05) in the absence of proinflammatory gene up-regulation and neuronal injury, whereas PAR2 was up-regulated at this early stage of disease progression. PAR2-deficient mice, after hippocampal A1– 42 implantation, exhibited enhanced IL-4 induction and less neuroinflammation (p < 0.05), together with improved neurobehavioral outcomes (p < 0.05). Thus, PAR2 exerted protective properties in neurons, but its activation in glia was pathogenic with secretion of neurotoxic factors and suppression of astrocytic anti-inflammatory mechanisms contributing to A1– 42-mediated neurodegeneration. The Journal of Immunology, 2007, 179: 5493–5503. 5494 DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS Table I. Real-time RT-PCR primer list Gene Species Sense Antisense PAR2 Trypsinogen FPRL1 TNF-a IL-10 IL-8 IL-4 GRP58 GRP78 PAR2 Trypsinogen FPR2 Mip-2 IL-4 F4/80 GFAP Human Human Human Human Human Human Human Human, mouse Human, mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse CTGGCCATTGGGGTCTTTCTGTTC TCAGCGAACAGTGGGTGGTATCAG TTGGTTTCCCTTTCAACTGG ATTCAGGAATGTGTGGCCTGC CCTCTCACCGTCTTGCTTTC CACCGGAAGGAACCATCTCAC GGCTGACTTAGGAGCTGGTG TCAAGGGTTTTCCTACCATCTACTTC TCATCGGACGCACTTGGAA TGGCCATTGGAGTCTTCCTGTT ATCTCTGGCTGGGGCAACACTC CCTTATAGTCTTGAGAGAGCCCTGA TGAGTGTGACGCCCCCAGGAC CGGCATTTTGAACGAGGTC GCCACCTGCACTGACACC GGACATCGAGATCGCCACCTACAG GGCCCTCTTCCTTTTCTTCTCTGA GAGGGGCGGTGGGCAGAG ACTTAAAGCATGGGGTTGAG GTTTGAATTCTTAGTGGTTGCCAG GCAGAGGTTGCTTGTTCTCC TGGTCCACTCTCAATCACTCTCAG GTGTTCCCTGCCATACTCGT TTAATTCACGGCCACCTTCAT CAACCACCTTGAATGGCAAGA TAGCCCTCTGCCTTTTCTTCTC CTAGGAAGCCAGCACAGACCAT TGCAGGAGGTGAAGTAGAACTGG TCAGACAGCGAGGCACATCAGGTA CGAAAAGCCCGAAAGAGTC GCTGCACTTGGCTCTCC CTCACCATCCCGCATCTCCACAGT Materials and Methods Human brain tissues Brain samples were obtained from the Laboratory for Neurological Infection and Immunity Brain Bank, University of Alberta (Edmonton, Alberta, Canada). Frontal lobe tissues from Alzheimer’s (n ⫽ 6; mean age, 73 ⫾ 5 years) and non-Alzheimer’s (non-AD; n ⫽ 6; mean age, 68 ⫾ 6 years; stroke, multiple sclerosis, sepsis, leukemia) patients were collected at autopsy with consent and stored at ⫺80°C, as previously described (37, 38). Cell cultures and experimental treatments Primary rat basal forebrain neurons were cultured from 16- to 17-day-old embryos of pregnant rats, as previously described (39) and in accordance with the protocol approved by the local Health Sciences Laboratory of Animal Policy and Welfare Committee of the University of Alberta. Briefly, septal regions containing the basal forebrain neurons were dissected in HBSS (Invitrogen Life Technologies) supplemented with 15 mM HEPES, 10 U/ml penicillin. and 10 mg/ml streptomycin, dissociated using 0.05% trypsin, triturated, and then plated on poly-D-lysine-coated wells. Cultures were grown at 37°C with 5% CO2 in a humidified atmosphere in Neurobasal medium supplemented with N2 supplement (Invitrogen Life Technologies). Experiments were performed 7 days after cell plating for 36 h using the fibrillar aggregated form of the -amyloid peptide (A1– 42) prepared according to a modified protocol of Haughey et al. (40). Briefly, a 1 mM solution of A1– 42 (Bachem; H-1368) peptide was incubated in PBS at 37°C for 2–3 days before the experiment. For neuronal PAR2 activation, primary rat neurons were incubated for 36 h with 100 M SLIGRL-NH2 as PAR2-activating peptide or mutant inactive peptide LSIGRL-NH2 (Peptide Synthesis Facility, University of Calgary, Calgary, Canada) in AIM-V serum-free medium (Invitrogen Life Technologies). Mouse primary astrocyte cultures were established from CNS tissue from 2-day-old C57BL/6 PAR2 homozygous knockout (KO) (41) mice and littermate homozygous wild-type (WT) mice as described previously (42). Cells were cultured in MEM (Invitrogen Life Technologies) containing 10% FBS, 1 mM sodium pyruvate, and 2 mM L-glutamine. Mouse bone marrow-derived macrophages were isolated from the pelvic and femoral bone marrow of adult PAR2 WT and KO mice as described previously (38). Bone marrow cells were cultured in DMEM containing 10% FBS, 10% L929 cell-conditioned medium, and 2 mM L-glutamine (Invitrogen Life Technologies). Cells were incubated in 10% CO2 for 5 days before additional treatments. Macrophages or astrocytes were treated with 100 M SLIGRL-NH2 or LSIGRL-NH2 for 4 h. For TNF-␣ treatments, macrophages or astrocytes were treated with TNF-␣ for 8 h before RNA extraction. Human monocyte-derived-macrophage (MDM) cultures were prepared from healthy individuals as previously described (37). Macrophages and astrocytic U373 cells were incubated with fibrillar A1– 42, SLIGRL or LSIGRL prepared as described above in AIM-V serum-free medium for 4 h. Media were then changed for fresh AIM-V medium without peptides, and supernatants were harvested 36 h later and stored at ⫺80°C for subsequent neuronal toxicity experiment on human fetal neurons. Human fetal neurons were cultured in MEM containing 10% FBS, 1% sodium pyruvate, 1% L-glutamine, 1% MEM nonessential amino acid solution, 1% dextrose, and 1% N2 supplement (Invitrogen Life Technologies) as described previously (43). Selection for nondifferentiated neurons was performed by a treatment with arabinofuranosylcytosine (25 M; SigmaAldrich) for 2 wk. Twenty-four hours after being seeded, cells were incubated in MDM and U373 supernatants for 36 h. The neurotoxicity of these supernatants was assessed as described below. Quantitative cellular immunoreactivity The quantification of PAR2 and also GRP58 immunoreactivity was performed using In-cell Western analysis (ODYSSEY Infrared Imaging System; LI-COR Biosciences) according to the manufacturer’s guidelines. We also used immunoreactivity of -tubulin, a cell structural protein, for assessment of neurotoxicity, as well as normalyzing GRP58 and PAR2 immunoreactivity to the number of the cells. Briefly, treated cells (in quadruplicate) were fixed with 3.7% formaldehyde followed by washing with PBS. For tubulin and Grp58 immunoreactivity cells were washed with PBS containing 0.1% Triton X-100 to permeabilize the cell membranes. Cells were incubated with LI-COR Odyssey Blocking Buffer for 1.5 h before the addition of a mouse monoclonal anti--tubulin isotype III (1/800; SigmaAldrich), a rabbit polyclonal Ab (B5) raised against rat PAR2 (1/500; 30 GPNSKGR2SLIGRLDT46P-YGGC, coupled to keyhole limpet hemocyanin; 2 ⫽ trypsin cleavage site, YGGC for conjugation) (8) or goat polyclonal anti-GRP58 (1/50; Santa Cruz Biotechnology) Ab in blocking buffer overnight at 4°C. After extensive washes in 0.1% Tween, cells were incubated for 1 h with fluorescent-labeled secondary Abs goat anti-mouse Alexa Fluor-680 (1/200; Molecular Probes), goat anti-rabbit IRDye Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017 (25). Dystrophic neurites in senile plaques associated with activated glia point to the relevance of inflammatory responses as determinants of neuronal degeneration observed in AD. Moreover, the concept of neurodegeneration caused by A-induced inflammatory responses has received further impetus from the epidemiological and experimental studies, highlighting the effects of nonsteroidal anti-inflammatory drugs in preventing or retarding the age of onset of AD (26 –28). There is substantial evidence that sustained neuroinflammation is present in senile plaques with aggregation of activated microglia in the center and reactive astrocytes that marginate the A deposits and extend their processes toward the center of plaques (25, 29 –32). Both activated microglia and astrocytes are known to secrete a wide variety of molecules involved in neuroinflammation and are potential sources of proinflammatory and neurotoxic agents in the brain (25, 33–36). Considering the overall proinflammatory profile and deficient protective mechanisms in AD brains, and the consistent observation that PAR2 is widely expressed on neurons and glial cells in the brain, we proposed that PAR2 might contribute to AD pathogenesis. We therefore investigated the effects of PAR2 on A1– 42-mediated neurotoxicity in both neurons and glia including expression of the putative A1– 42 receptor formyl peptide receptor-2 (FPR2). The Journal of Immunology 5495 800CW (1/800; Rockland), or donkey anti-goat IRDye 800 (1/100; Rockland) Ab diluted in blocking buffer supplemented with 0.2% Tween 20 to lower the background. After a washing, plates were scanned simultaneously at 700 and 800 nm using the Odyssey Infrared Imaging System. Western blot analysis Protein extracts were prepared from brain tissues samples with cell lysis buffer (20 mM Tris, 1% Triton X-100, 0.05% SDS, 5 mg of sodium deoxycholate, 150 mM NaCl, and 1 mM PMSF), and concentrations were determined by bicinchoninic acid assay (Pierce). Fifty micrograms of protein were separated by 10% SDS-polyacrylamide and transferred onto nitrocellulose membranes followed by blocking with 10% skimmed milk (38). Membranes were then probed with monoclonal antisera to MAP-2 (1/500; Sigma-Aldrich), synaptophysin (/1000; Santa Cruz Biotechnology) or HRP-conjugated -actin (1/200; Chemicon International) overnight at 4°C followed by washing with TBS-Tween 20. Goat anti-mouse secondary Ab conjugated to HRP (1/2500; Chemicon International) was used to detect the primary Abs. After several washes, peroxidase activity on the membrane was detected by chemiluminescence (Roche Diagnostics, Laval, Quebec, Canada). APP-transgenic mice Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017 Transgenic (TgCRND8) mice encoding a double-mutated allele of the human APP genes implicated in AD (Swedish, KM670/671NL; Indiana, V717F) under the control of hamster PrP gene promoter (44) were maintained on a hybrid background (C57BL/6/C3H). To obtain mice for the experiments, TgCRND8 males were crossed with C57BL/6 WT female mice. Twenty-four-week-old gender- and weight-matched heterozygous TgCRND8 mice (n ⫽ 4) and non-Tg littermates (n ⫽ 3), were used in the present studies. -Amyloid implantation Twelve-week-old male PAR2 homozygous KO mice and littermate homozygous WT controls were anesthetized under isoflurane. Bilateral infusions of 1 mM fibrillar A1– 42 (40) (n ⫽ 14) or PBS (n ⫽ 12) were made stereotaxically into the dorsal hippocampus (2.5 mm posterior; ⫾2 mm lateral; 1.4 mm ventral), using 31-gauage cannulae connected by PE tubing to 5-l Hamilton syringes mounted on a Hamilton syringe drive. Fibrillar A1– 42 or PBS was infused at a rate of 0.4 l/min over a period of 5 min. The cannulae were left in place for 10 min before being slowly withdrawn. Animals were allowed to recover for 1 wk before behavioral testing. Implantation of oligomeric A1– 42 (45) did not cause neurobehavioral abnormalities. All experiments followed Calgary Animal Care Committee guidelines and were approved by the University of Calgary Animal Care Committee. Behavioral Testing Acquisition of spatial learning and memory after drug infusion were assessed using the Morris water maze task (46). The apparatus was a circular tank 123 cm in diameter, 35 cm deep, raised 60 cm from the floor, and filled to a height of ⬃21.5 cm with 22°C water made opaque by the addition of skim milk powder. A 10- ⫻ 10-cm escape platform was submerged 1.5 cm below the surface of the water, positioned in the middle of the northeast quadrant. All mice received two blocks of four swimming trials each day, for 4 consecutive days. For each trial block, animals were released from each of the four cardinal compass points (morth, east, south, and west) and allowed to swim freely until they climbed onto the platform, or after 60 s had elapsed. If the mouse found the platform, it was allowed to remain there for 10 s; if it failed to find the platform, it was placed on the platform for 10 s. On the fifth day, the animals were subjected to a single probe trial during which the platform was removed, and each animal was allowed to swim freely for 60 s. Swim paths were recorded and analyzed using the 2020 Plus tracking system for the Morris water maze (HVS Image). Data were analyzed on a Power Mac G5 (Apple) using a repeated measures ANOVA (Statview 5; SAS Institute). Real-time RT-PCR Total RNAs from cultured cells and from human and mouse brain tissues were prepared using Trizol (Invitrogen Life Technologies) according to the manufacturer’s guidelines. One microgram of total RNA was used for cDNA synthesis and subsequent PCR. Primer sequences are listed in Table I. Semiquantitative analysis was performed by monitoring in real time the increase of fluorescence of the SYBR Green dye on a Bio-Rad-i-Cycler as described previously (47). All data were normalized against the GAPDH expression and reported relative to controls ⫾ SEM. FIGURE 1. Neuroinflammation and PAR2 expression in AD brains. PAR2 transcript abundance (a) was decreased in brains from AD (n ⫽ 6) compared with non-AD (n ⫽ 6) patients. TNF-␣ (b), IL-8 (c), and IL-10 (data not shown) mRNA levels were up-regulated, whereas IL-4 transcript levels (d) were suppressed in AD brains. There was a downregulation of the ER chaperone, GRP58, mRNA levels in AD brains (e). In contrast, FPRL1, a potential receptor for A1– 42 in glial cells, was up-regulated in AD brains compared with non-AD brains (f). In non-AD patients, preactivated (g) and total (i) PAR2 immunoreactivity was chiefly present in cortical neurons (i, inset shows the staining with Ab absorbed with immunogen peptide), whereas in AD brains, preactivated (h) and total (j) PAR2 immunoreactivity was colocalized with CD45 demonstrating its expression predominantly in monocytoid cells in the cortex. Original magnification, ⫻200 for main panels; ⫻1000 for h and j insets. Data are mean ⫾ SEM by Student’s t test; ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01; ⴱⴱⴱ, p ⬍ 0.001; RFC, relative fold change. 5496 DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS Immunohistochemistry Immunohistochemical labeling was performed using 5-m paraffin-embedded serial human brain sections prepared as previously described (38). Sections were incubated overnight at 4°C with rabbit polyclonal Ab raised to a peptide corresponding to two noncontiguous epitopes (SLAWLLG; PNSKGR)intheratPAR2N-terminalsequence 5SLAWLLG12G-31PNSKGR/ GGYGGC to detect a preactivated form of PAR2 (SLAW-A; 1/200; Ref. 48), or rabbit polyclonal anti-PAR2 (B5) Ab (1/500; Ref. 8), in PBS containing 5% normal goat serum and 0.2% Triton X-100. Secondary alkaline phosphatase-conjugated goat anti-rabbit Ab (1/500; Jackson ImmunoResearch Laboratories) followed by NBT-5-bromo-4-chloro-3-indolyl phosphate substrate (Vector Laboratories) were used to detect subsequent immunoreactivity. Mouse monoclonal anti-CD45 (1/200; Zymed Laboratories) and biotinylated goat anti-mouse Ab followed by avidin-biotin-peroxidase amplification (Vector Laboratories) and 3,3⬘-diaminobenzidine tetrachloride staining (Vector Laboratories) were used for double labeling. Immunofluorescence and confocal laser scanning microscopy Paraffin-embedded mouse brain serial sections (5 m) were double-immunolabeled for neuronal nuclear Ag (NeuN; 1/200; Chemicon International) and either glial fibrillary acidic protein (GFAP; 1/200; DAKO), ionized calcium binding adaptor molecule (Iba-1; 1/400; Wako) or cleaved caspase-3 (Asp175, 1/100; Cell Signaling Technology) (38). Brain sections were also double-immunolabeled with antisera recognizing IL-4 (1/100; BD Pharmingen) and NeuN, GFAP, or Iba-1. Cy3-conjugated goat anti- mouse or Alexa 488-conjugated goat anti-rabbit and goat anti-rat secondary Abs (Molecular Probes) were used to detect Ag-specific binding. Images were captured on a LSM510 META (Carl Zeiss MicroImaging) confocal laser scanning microscope and analyzed using LSM 5 Image Browser software (Carl Zeiss MicroImaging). Statistical analysis Statistical analyses were performed by ANOVA and Tukey-Kramer or Dunnet as post hoc tests using GraphPad Instat version 3.0 (GraphPad Software). p values of ⬍0.05 were considered significant. Results PAR2 expression is selectively decreased in AD brains The neuropathology of AD is defined by neuronal injury and loss together with -amyloid and tangle accumulation, in conjunction with neuroimmune activation (22, 25, 29 –32). To investigate whether PAR2 participated in these pathological aspects associated with AD, we examined PAR2 transcript levels in frontocortical brain regions from AD and non-AD patients. This analysis revealed a significant decrease in PAR2 mRNA levels in AD compared with non-AD patient brains (Fig. 1a), whereas expression of trypsinogen was not changed (data not shown). TNF-␣ (Fig. 1b), IL-8 (Fig. 1c), and IL-10 (data not shown) transcript levels were Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017 FIGURE 2. Neuronal PAR2 activation protects neurons against A1– 42 toxicity. a, Human cholinergic (LAN-2) and RFN cells expressed PAR2. Background represents the same conditions without primary Ab. b, Fibrillar A1– 42 incubation for 36 h decreased the cytoskeletal isotype III -tubulin immunoreactivity as a neuronal viability marker in RFNs; c, decreased PAR2 expression (normalized against -tubulin immunoreactivity) on LAN-2 cells in concentration-dependent manners; d, PAR2 activation with SLIGRL increased the neuronal viability and protected RFNs against A1– 42 toxicity, whereas the control peptide LSIGRL had no effect; e, A1– 42 also induced the expression of ER stress protein, GRP58 (normalized against -tubulin immunoreactivity) in RFNs; f, activation of PAR2 with SLIGRL reversed A1– 42induced GRP58 expression. Data are mean ⫾ SEM by Student’s t test (a), Dunnet (b, c, and e) and Tukey-Kramer multiple comparisons (d and f) tests; ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01; ⴱⴱⴱ, p ⬍ 0.001. All experiments were performed in quadruplicate and background subtracted average intensities of fluorescence units (arbitrary) are used for quantification of immunoreactivity (IR). The Journal of Immunology up-regulated in AD brains, in contrast to the anti-inflammatory cytokine IL-4, which was significantly suppressed in AD compared with non-AD brains (Fig. 1d). There was no change in the mRNA levels of ER stress gene, GRP78 (also known as BiP), between AD and non-AD brains (data not shown), whereas GRP58 was significantly down-regulated in AD brains (Fig. 1e). It has been shown that A1– 42 serves as a high affinity and specific agonist for formyl peptide receptor-like 1 (FPRL1) and its murine counterpart FPR2, thereby activating microglia to produce a wide variety of proinflammatory cytokines and neurotoxins (49 –52). There was a significant increase in mRNA levels of FPRL1 in AD brains (Fig. 1f). Using previously reported antisera to PAR2, immunohistochemical staining showed that preactivated PAR2 (Fig. 1g) and also total PAR2 (Fig. 1i) immunoreactivity was chiefly present in cortical neurons of non-AD brains. In contrast, in AD brains, glial cells were the principal cells exhibiting preactivated (Fig. 1h) and total (Fig. 1j) PAR2 immunoreactivity, as there was a profound neuronal loss in cortical regions. Indeed, each form of PAR2 was colocalized with the microglial marker, CD45, in AD brains (Fig. 1, h and j, inset). Although these data suggested that total PAR2 levels were reduced in AD brains, its immunoreactivity and activation were more prominent in glial cells of AD brains together with an up-regulation of several proinflammatory genes and suppression of the prototype anti-inflammatory gene, IL-4. Neuronal PAR2 activation protects neurons against A1– 42 toxicity PAR2 has been shown to be expressed on neurons in CNS and play important roles in neuronal excitation and proliferation (2– 4). To assess the role of PAR2 on neurons, we investigated its expression and effects in different neuronal cell lines. Both human cholinergic neuronal (LAN-2) cells and rat fetal neurons (RFN) displayed PAR2 immunoreactivity (Fig. 2a). Treatment of RFN with fibrillar A1– 42 induced neurotoxicity as shown by a concentration-dependent decrease in the immunoreactivity of neuron-specific cytoskeletal protein, class III -tubulin (Refs. 53 and 54 and Fig. 2b). Indeed, A1– 42 also suppressed neuronal PAR2 immunoreactivity FIGURE 4. Macrophage and astrocytic (Astro) PAR2 activation increases A1– 42-induced neuroimmune activation and neurotoxicity. a, IL-8 expression in human macrophages was increased during A1– 42 treatment, whereas PAR2 activation exerted an additive effect with A1– 42. b, In human astrocytes, IL-8 expression is unchanged whereas PAR2 activation suppressed IL-4 expression. c, Supernatants (S/N) from A1– 42-treated macrophages were toxic to human fetal neurons, whereas macrophage PAR2 activation augmented the toxicity. Astrocyte-derived supernatant had no toxic effects on human fetal neurons. Data are mean ⫾ SEM; Dunnett’s test; ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01; ⴱⴱⴱ, p ⬍ 0.001. Experiments performed in quadruplicate. (SLI, SLIGRL-NH2; LSI, LSIGRL-NH2). (Fig. 2c). Incubation of neurons with the PAR2 activating peptide, SLIGRL or the missense receptor-inactive peptide LSIGRL (55) indicated that PAR2 activation alone did not affect the -tubulin reactivity, but it enhanced neuronal viability during A1– 42 neurotoxic treatments (Fig. 2d). Protein levels of the ER stress chaperone protein GRP58 (normalized against -tubulin immunoreactivity) showed a robust up-regulation with A1– 42 treatment, indicating that A1– 42 can enhance ER stress (Fig. 2e). Moreover, lower levels of GRP58 expression (normalized against -tubulin) were observed after PAR2 activation in A1– 42-treated RFNs, supporting the notion of a protective role for PAR2 in neurons concomitant with a reduction in neuronal ER stress (Fig. 2f). Macrophage and astrocytic PAR2 activation increases FPR-2 expression In addition to its direct neurotoxicity, A1– 42 is a potent activator of microglia and induces multiple proinflammatory cytokines and neurotoxins through its cognate receptor, FPR2, in murine macrophages (49 –52). A1– 42 can also stimulate astrocytes to release inflammatory cytokines and chemokines (25, 56). Given that PAR2 is expressed on brain monocytoid cells (perivascular macrophages/microglia) and astrocytes, we investigated the potential role of PAR2 on indirect A1– 42 neurotoxicity. Murine macrophages and astrocytes were treated with SLIGRL, disclosing significant up-regulation of FPR2 transcripts in macrophages (Fig. 3a) and also astrocytes (Fig. 3b), compared with untreated or LSIGRL treated cells. It is also known that proinflammatory stimuli Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017 FIGURE 3. PAR2 activation increases FPR2 expression on mouse glia. Activation of PAR2 with SLIGRL enhanced the expression of FPR2 in mouse primary macrophage (M; a) and astrocytes (Astro; b). Induction of FPR2 expression by TNF-␣ was significantly reduced in PAR2 KO macrophages (c) and astrocytes (d) compare with WT cells. Data are mean ⫾ SEM; Tukey-Kramer multiple comparisons test; ⴱⴱ, p ⬍ 0.01; ⴱⴱⴱ, p ⬍ 0.001; n ⫽ 5; RFC, relative fold change. 5497 5498 such as LPS and TNF-␣ can enhance the functional expression of FPR2 in microglia (57, 58). To assess the potential effects of PAR2 in TNF-␣ signaling leading to FPR2 induction, we treated macrophages and astrocytes from PAR2 null (KO) (41) and WT littermates with this cytokine. In macrophages and astrocytes from WT mice, TNF-␣ caused a marked increase in the FPR2 mRNA levels, with a markedly lower response observed in macrophages (Fig. 3c) and astrocytes (Fig. 3d) from the KO animals. These results suggest that PAR2 is involved in AD neuropathogenesis by modulating FPR2 expression in glial cells and also TNF-␣ inducing effect in terms of FPR2 expression. Macrophage and astrocytic PAR2 activation increases proinflammatory gene expression and enhances the neurotoxic effects of A1– 42 Earlier studies have shown that A1– 42 induces the expression of a range of proinflammatory cytokines and chemokines in human microglia, notably IL-8, which by itself potentiates A1– 42 induc- FIGURE 6. PAR2-deficient mice showed reduced neuroimmune responses after A1– 42 implantation. a, Decreased transcript levels of PAR2 were evident in A1– 42-implanted mice. b, There was no significant change in trypsinogen transcript levels. Up-regulation of F4/80 (c) and GFAP (d) was evident in A1– 42-implanted WT animals but not in implanted PAR2 KO littermates or in PBS-implanted animals. MIP-2 (e) mRNA levels were increased in A1– 42-implanted WT animals, in contrast to IL-4 transcript levels, which were up-regulated in PAR2 KO animals receiving A1– 42 implants (f). mRNA levels of ER stress gene GRP58 were also increased in A1– 42-implanted PAR2 KO animals (g). PAR2 KO animals, regardless of whether they were A1– 42 implanted or not, showed lower levels of FPR2 (h). Data are mean ⫾ SEM; Tukey-Kramer multiple comparisons test; ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01; ⴱⴱⴱ, p ⬍ 0.001. n ⫽ 6 in all four groups. RFC, relative fold change. tion of other inflammatory cytokines and chemokines (59 – 61). In contrast, IL-4 suppresses the expression and activity of microglial FPR2/FPRL1 (62, 63) and down-modulates the proinflammatory responses induced by A1– 42 (64). Several studies have also reported neuroprotective effects for IL-4 in different settings (65– 67), including protection against -amyloid-induced hippocampal injury (68). In view of the ability of PAR2 activation to up-regulate a potential receptor for A1– 42 on microglia and astrocytes, we next examined the impact of PAR2 activation on the inflammatory profile induced by A1– 42. The ability of fibrillar A1– 42 to induce IL-8 expression in human macrophages (MDM) was enhanced by the concurrent activation of PAR2 (Fig. 4a). In contrast, in human astrocytic (U373) cells, fibrillar A1– 42 did not induce an increase in IL-8 or IL-4 mRNA levels in either the absence or presence of Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017 FIGURE 5. APP-Tg mice display early stages of neurodegenerative disease. a, Western blot analysis showed no difference in the neuronal protein, MAP-2, or synaptophysin immunoreactivity between WT (n ⫽ 3) and APP-Tg (n ⫽ 4) groups. Brain PAR2 (b) mRNA levels were up-regulated in APP-Tg mice, without any change in trypsinogen (c) expression compared with WT controls. Transcript levels of the activated macrophage/ microglial gene, F4/80 (d), in brain was unchanged, in contrast to astrocytic gene, GFAP (e), which was up-regulated in APP-Tg mice. MIP-2 (f), the murine homolog of human IL-8, remained unchanged, whereas IL-4 (g) was induced in the brains of the APP-Tg group. There were no differences in FPR2 expression between groups (h). Data are mean ⫾ SEM; Student’s t test; ⴱ, p ⬍ 0.05; RFC, relative fold change. DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS The Journal of Immunology 5499 PAR2 activation. Instead, PAR2 activation by SLIGRL (but not LSIGRL) selectively suppressed the expression of IL-4 in astrocytes in the presence or absence of A1– 42 (Fig. 4b). IL-4 transcripts were not detectable in macrophages (data not shown). To investigate the neurotoxic properties of macrophage and astrocytic PAR2 activation, human fetal neurons were treated with supernatants from the above macrophage and astrocytic cells after PAR2 activation and/or A1– 42 treatment (Fig. 4c). Neurons incubated with supernatants from A-treated macrophages revealed that neuronal viability was diminished in an A1– 42 concentrationdependent manner. Moreover, activation of PAR2 on macrophages with SLIGRL significantly reduced neuronal viability in an additive manner, whereas LSIGRL had no effect. In contrast, supernatants from astrocytes, regardless of the treatment protocol, exerted no neurotoxic effects (Fig. 4c). Thus, activation of PAR2 on macrophages with or without A1– 42 cotreatment, caused the release of soluble neurotoxins. PAR2 is up-regulated in APP-Tg mice Because postmortem AD brains principally show late stage pathology, we examined the early pathogenic features of AD using a transgenic model that represented the similar levels of A (mg equivalent) to sporadic AD brains and also displays many of the neuropathological and clinical aspects of AD, except for neuronal death (44). Supporting the absence of neuronal death in this model, human mutant APP-Yg (TgCRND8) mice showed no significant changes in the neuronal marker MAP-2 or the synaptic marker, synaptophysin, compared with nontransgenic (non-Tg) littermate controls (Fig. 5a). However, a significant increase in PAR2 mRNA levels was observed in TgCRND8 mice (Fig. 5b) compared with non-Tg littermates, without significant changes in trypsinogen expression (Fig. 5c). Given the role of inflammatory mediators in progression of AD, we investigated the activation of different cell types at this stage of the disease, revealing no significant changes in mRNA levels of the macrophage/microglia activation marker F4/80 (Fig. 5d), while the astrocytic marker, GFAP, was up-regulated in TgCRND8 mice (Fig. 5e). MIP-2, the murine homolog of human IL-8 did not differ in transcript levels between groups (Fig. 5f). In contrast, IL-4 was significantly up-regulated in TgCRND8 mice (Fig. 5g), whereas there were no significant differences in transcript levels of FPR2 (Fig. 5h), GRP78 or GRP58 (data not shown) between groups. Although neuronal loss was not a feature Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017 FIGURE 7. PAR2 deficiency is neuroprotective against A1– 42 implantation. Immunolabeling of PBS-implanted PAR2 WT (a and d), PBS-implanted PAR2 KO (data not shown), A1– 42-implanted PAR2 KO (b and e), and A1– 42-implanted PAR2 WT (c and f) mouse brains with anti-NeuN (green) and anti-Iba-1 (red) (a– c) or anti-GFAP (red; d–f) Abs revealed more severe microglial and actrocytic activation in dorsal hippocampi of WT (c and f) animals implanted with A1– 42, as compared with A1– 42-implanted PAR2 KO (b and e) and PBS-implanted WT (a and d) animals. Colocalization of IL-4 with GFAP immunoreactivity was evident (e, inset). Immunolabeling for cleaved caspase-3 showed higher immunoreactivity in A1– 42-implanted WT animals (i) compared with A1– 42-implanted PAR2 KO animals (h). Immunoreactivity for cleaved-caspase-3 was absent in PBS-implanted WT animals (g). Insets in g, h, and i show colocaliztion with the neuronal marker, NeuN. Original magnification, 630; 2 ⫻ 630 magnification for e, inset; j, A1– 42-implanted PAR2 WT animals exhibited consistently delayed neurobehavioral responses during the Morris water maze. Data are mean ⫾ SEM, Tukey-Kramer multiple comparisons test; ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01. n ⫽ 6. 5500 DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS of this AD model as is also the case for other Tg-APP695 mice (69) at this stage of the disease, PAR2 up-regulation in the Tg mice indicated that it might be an early marker of the disease process. PAR2 deficiency affects the A-induced inflammatory profile in mouse brains To determine the direct in vivo effects of A1– 42, the fibrillar form of the peptide (40) was implanted into the dorsal hippocampus of PAR2 WT and KO mice, and gene expression was subsequently examined at 1 wk postimplantation. Recapitulating our findings in human AD brains (Fig. 1), PAR2 expression was significantly suppressed in WT mpise brains receiving A1– 42 (Fig. 6a). There was no significant change in trypsinogen transcript levels (Fig. 6b), but microphage/microglial F4/80 (Fig. 6c) and astrocytic GFAP (Fig. 6d) transcripts were up-regulated in WT animals receiving A1– 42 implants. In the A1– 42-implanted PAR2 KO or in PBS-implanted animals, F4/80 and GFAP transcript levels were lower than in the A1– 42-treated WT animals, indicating a differential activation of neuroglial cells in A1– 42-implanted PAR2 WT vs KO brains. MIP-2 transcript levels also were increased in A1– 42-implanted WT mice (Fig. 6e). In contrast, IL-4 was significantly up-regulated in PAR2 KO compared with WT animals receiving A1– 42 implants and PBS-implanted animals (Fig. 6f). Unlike human AD brains and WT mice receiving A1– 42, a robust GRP58 induction was also detectable in KO mice receiving A1– 42 (Fig. 6g), whereas GRP78 expression was unchanged (data not shown). Complementing these findings, PAR2 KO groups showed lower levels of FPR2 compared with the WT groups (Fig. 6h), underlining the direct interactions between PAR2 and fibrillar A1– 42mediated toxicity. PAR2 deficiency is protective during A toxicity Consistent with the present differences in inflammatory and protective gene expression, immunofluorescence studies revealed that Iba-1 (Fig. 7, a– c) and GFAP (Fig. 8, d–f) immunoreactivity were markedly enhanced in macrophage and astrocytes, respectively, in the dorsal hippocampus of PAR2 WT (Fig. 7, c and f, respectively) compared with KO animals (Fig. 7, b and e, respectively) receiving A1– 42 implants. IL-4 immunoreactivity was colocalized with GFAP (Fig. 7e, inset) but not with Iba-1 (data not shown), demonstrating the cell specificity for IL-4 expression in the brain. To investigate A1– 42-induced activation of cell death pathways in neurons, we performed immunolabeling studies for the detection of activated form of caspase-3. As expected, cleaved caspase-3 immunoreactivity was absent in the dorsal hippocampus of animals implanted with PBS (Fig. 7g). However, cleaved caspase-3 immunoreactivity was evident in the hippocampus of A1– 42-implanted animals and WT animals (Fig. 7i) showed greater immunoreactivities than did PAR2 KO littermates (Fig. 7h). Indeed, cleaved caspase-3 immunolabeling was colocalized with NeuN immunoreactivity (Fig. 7, h and i, insets), underlying the relative vulnerability of neurons in this system. Moreover, we observed a more severe neurobehavioral phenotype in PAR2 WT animals after fibrillar A1– 42 implantation compared with PAR2 KO littermates receiving A1– 42 and the PBS-implanted animals, as evidenced by A1– 42-implanted WT animals showing a significantly longer latency to find the submerged escape platform during Morris water maze testing (Fig. 7j). Hence, our findings revealed that intact PAR2 expression contributed to glial cell neuroimmune activation and worsened neurobehavioral outcomes after exposure to fibrillar A1– 42 with ensuing neuronal apoptosis (Fig. 8). Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017 FIGURE 8. Divergent effects of PAR2 on AD pathogenesis. In addition to the protective properties of neuronal PAR2 in the context of A1– 42 neurotoxicity, A1– 42-induced microglial activation, mediated by FPR2/FPRL1, was amplified by PAR2 coactivation, leading to the release of neurotoxins, inflammatory cytokines, and chemokines such as IL-8, and subsequently induces neuronal death. Although PAR2 mediated these proinflammatory effects, it also suppressed an important inhibitor of this cascade, astrocyte-derived IL-4. The overall consequence of PAR2 activation was to augment the neuroinflammatory response, which overwhelmed the direct protective effects of neuronal PAR2. The Journal of Immunology Discussion shown that fibrillar form of A1– 42 induces ER stress characterized by induction of neuronal GRP58 expression in vitro and simultaneous decreases in neuronal viability. This observation is consistent with earlier reports describing the activation of UPR during AD, usually with increased levels of GRP78 as another stress marker (23, 24). Importantly, GRP58 appears to wield neuroprotective properties in other neurodegenerative diseases (73). In our model, down-regulation of neuronal PAR2 by A1– 42 was important in that PAR2 activation can decrease the neuronal susceptibility to A1– 42 and ER stress, all pointing out to a protective role for neuronal PAR2. This result is in agreement with the previous studies, which have shown the protective effects of PAR2 on neurons in the context of cerebral ischemia (17) and HIV-associated dementia (18). The pathogenic significance of inflammatory responses elicited by brain glial cells during AD has drawn considerable attention in recent years (29 –32). A striking neuropathological feature of AD is the consistent appearance of activated microglia and astrocytes in proximity to amyloid plaques/deposition, indicating a process of focal recruitment and activation of these cells. Several in vitro studies have shown that A1– 42 can directly activate macrophages and astrocytes with the ensuing secretion of proinflammatory cytokines and chemokines through engagement of murine FPR2 or its human counterpart FPRL1 (49 –52). We have extended these studies by demonstrating that PAR2 activation regulates the expression of FPR2 in microglia and astrocytes, either directly or through interfering with TNF-␣ signaling. This last observation might be reinforced by the fact that TNF-␣ and PAR2 share some common signaling pathways such as NF-B activation (57, 58, 74). It has been shown that IL-8 overexpression is a potentially important inflammatory response during A1– 42 toxicity (59, 61) which can play an important role in chemoattraction and potentiates A1– 42-induced production of other inflammatory cytokines and chemokines (60). Indeed, our present studies implied that activation of PAR2 on monocytoid cells with A1– 42 application synergistically augmented IL-8 expression (Fig. 8). Lymphocyte activation and infiltration does not appear to participate in this pathogenic cascade, likely because PAR2 is not expressed on lymphocytes (16). Taken together, these latter results are in accordance with the overexpression of TNF-␣, IL-8, and FPRL1 in autopsied AD brains coupled with microglial activation and overexpression of MIP-2 in A1– 42-implanted WT mice. Although overall PAR2 transcript abundance was suppressed in autopsied AD brains, the residual expression was limited to glial cells. These data support the notion that PAR2 can play an important role in inflammatory aspects of AD, thereby exacerbating the neuropathogenic process through concurrent mechanisms. Activation of PARs requires specific proteases and, for PAR2, trypsin and mast cell tryptase are established cognate proteases (2, 4). Trypsinogen is expressed in the nervous system (16, 18), although its contribution to AD neuropathogenesis remains unclear. Herein, trypsinogen expression did not differ between AD and non-AD brains; likewise, its expression was not altered in both animal models of AD used in the present study although it was expressed by both neurons and glia (data not shown). It is plausible that other proteases may activate individual PARs; indeed several proteases implicated in neurodegenerative diseases, such as kallikreins and matrix metalloproteinases, have recently been shown to activate different PARs (75– 80). Aside from the broad range of effects that PAR2 exercises in neurons during development and disease, a pivotal question to pursue will be to identify its putative cognate protease(s). Nonetheless, cell type-specific mechanisms by which PAR2 affects neuronal viability and fate lend themselves Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017 PAR2, which is widely expressed on different cell types in the nervous system, appears to exert both protective and pathogenic effects depending on the specific neurological disorder (13–18). Although PAR2 can promote inflammation within the nervous system (10 –16), it can also mediate protective neuronal responses (17–19). Herein, we investigated the direct contributions of PAR2 to neuronal viability together with its indirect effects on neurons through activation of proximate immune cells involved in the pathogenesis of AD (Fig. 8). Although fibrillar A1– 42 was directly toxic to neurons and induced ER stress, concurrent activation of PAR2 suppressed A1– 42 neurotoxicity, pointing to a protective role for neuronally expressed PAR2 (Fig. 8). Of possible mechanistic importance for AD, PAR2 activation on monocytoid cells (macrophages/microglia) and astrocytes was associated with up-regulation of FPR2, a putative receptor for A1– 42 and modulated TNF-␣ effects on FPR2 induction. Moreover, PAR2 activation on macrophages exacerbated A1– 42-induced inflammatory responses, indirectly reducing neuronal viability through the release of putative neurotoxins in variable amounts depending on the experimental model (Fig. 8). In astrocytes, PAR2 activation resulted in the suppression of anti-inflammatory cytokine, IL-4, underscoring the pathogenic roles for PAR2 in immune cells. To glean insight into the temporal aspects of PAR2 expression and function in different stages of AD pathogenesis, APP-Tg mice were used as an early stage model of AD, revealing elevated IL-4 expression and astrocytic activation without evidence of proinflammatory responses or neuronal injury. Of interest, induction of PAR2 in this model seemed to be an early cellular response before later inflammation and neuronal death. Conversely, brain samples from autopsied AD patients disclosed that in conjunction with profound neuronal loss in cortex, PAR2 immunoreactivity on neurons and transcript abundance were diminished with concurrent proinflammatory responses. Similarly, after fibrillar A1– 42 implantation into the hippocampus, PAR2 expression was reduced in PAR2 WT mice. This was associated with a proinflammatory response and a neurobehavioral phenotype in conjunction with neuronal apoptosis. In matched littermate KO animals, there were no A1– 42induced proinflammatory effects although both IL-4 and GRP58 expression were enhanced, together with reduced FPR2 expression, emphasizing the complex roles of PAR2 in inducing neuroinflammation and suppression of neuronal and astrocytic-mediated neuroprotective signals. Interestingly, neurobehavioral and neuropathological outcomes were also less severe in PAR2 KO animals compared with the WT littermates. Although astrocytes are not considered a major source of IL-4, several studies have shown that IL-4 expression is detectable and can be induced by proinflammatory cytokines in astrocytes (70 –72). Considering the suppressive effects of PAR2 activation on astrocytic IL-4 expression, it is conceivable that fibrillar A1– 42 implantation in the absence of PAR2 signaling drives the expression of IL-4 by these cells, leading to a more neuroprotective phenotype. Increased production and/or impaired clearance of aggregated forms of -amyloid peptides represent an established hallmark of AD neuropathogenesis. Several lines of evidence indicate that A peptides, most notably A1– 42, are toxic to neurons (20 –22). Moreover, A accumulation triggers an unfolded protein response (UPR) in affected cells following the accumulation of misfolded proteins (23, 24) in the ER. Activation of the UPR results in an overall decrease in translation, enhanced protein degradation, and increased expression levels of ER chaperones such as GRP78 and GRP58, which subsequently increases the protein-folding capacity of the ER to protect cells against further injury. Here, we have 5501 5502 to pharmacological manipulation in future studies of therapeutic interventions for neurodegenerative diseases. Acknowledgments We thank Dr. Arthur W. Clark for helpful discussions, Neda Shariat and David MacTavish for technical assistance, and Stephanie Skinner for assistance with manuscript preparation. DIVERGENT ROLES OF PAR2 IN AD PATHOGENESIS 23. 24. 25. Disclosures The authors have no financial conflict of interest. 26. References 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017 1. Southan, C. 2001. A genomic perspective on human proteases. FEBS Lett. 498: 214 –218. 2. Noorbakhsh, F., N. Vergnolle, M. D. Hollenberg, and C. Power. 2003. Proteinase-activated receptors in the nervous system. Nat. Rev. Neurosci. 4: 981–990. 3. Cottrell, G. S., S. Amadesi, F. Schmidlin, and N. Bunnett. 2003. Protease-activated receptor 2: activation, signalling and function. Biochem. Soc. Trans. 31: 1191–1197. 4. Ossovskaya, V. S., and N. W. Bunnett. 2004. Protease-activated receptors: contribution to physiology and disease. Physiol. Rev. 84: 579 – 621. 5. Wang, Y., W. Luo, T. Wartmann, W. Halangk, M. Sahin-Toth, and G. Reiser. 2006. Mesotrypsin, a brain trypsin, activates selectively proteinase-activated receptor-1, but not proteinase-activated receptor-2, in rat astrocytes. J. Neurochem. 99: 759 –769. 6. Cottrell, G. S., S. Amadesi, E. F. Grady, and N. W. Bunnett. 2004. Trypsin IV, a novel agonist of protease-activated receptors 2 and 4. J. Biol. Chem. 279: 13532–13539. 7. Hollenberg, M. D., M. Saifeddine, B. al-Ani, and A. Kawabata. 1997. Proteinaseactivated receptors: structural requirements for activity, receptor cross-reactivity, and receptor selectivity of receptor-activating peptides. Can. J. Physiol. Pharmacol. 75: 832– 841. 8. Al-Ani, B., M. Saifeddine, A. Kawabata, B. Renaux, S. Mokashi, and M. D. Hollenberg. 1999. Proteinase-activated receptor 2 (PAR2): development of a ligand-binding assay correlating with activation of PAR2 by PAR1- and PAR2derived peptide ligands. J. Pharmacol. Exp. Ther. 290: 753–760. 9. Macfarlane, S. R., M. J. Seatter, T. Kanke, G. D. Hunter, and R. Plevin. 2001. Proteinase-activated receptors. Pharmacol. Rev. 53: 245–282. 10. Steinhoff, M., N. Vergnolle, S. H. Young, M. Tognetto, S. Amadesi, H. S. Ennes, M. Trevisani, M. D. Hollenberg, J. L. Wallace, G. H. Caughey, et al. 2000. Agonists of proteinase-activated receptor 2 induce inflammation by a neurogenic mechanism. Nat. Med. 6: 151–158. 11. Vergnolle, N., J. L. Wallace, N. W. Bunnett, and M. D. Hollenberg. 2001. Protease-activated receptors in inflammation, neuronal signaling and pain. Trends Pharmacol. Sci. 22: 146 –152. 12. Vergnolle, N., M. Ferazzini, M. R. D’Andrea, J. Buddenkotte, and M. Steinhoff. 2003. Proteinase-activated receptors: novel signals for peripheral nerves. Trends Neurosci. 26: 496 –500. 13. Smith-Swintosky, V. L., C. T. Cheo-Isaacs, M. R. D’Andrea, R. J. Santulli, A. L. Darrow, and P. Andrade-Gordon. 1997. Protease-activated receptor-2 (PAR-2) is present in the rat hippocampus and is associated with neurodegeneration. J. Neurochem. 69: 1890 –1896. 14. Olejar, T., R. Matej, M. Zadinova, and P. Pouckova. 2002. Proteinase-activated receptor-2 expression on cerebral neurones after radiation damage: immunohistochemical observation in Wistar rats. Int. J. Tissue React. 24: 81– 88. 15. Rohatgi, T., P. Henrich-Noack, F. Sedehizade, M. Goertler, C. W. Wallesch, K. G. Reymann, and G. Reiser. 2004. Transient focal ischemia in rat brain differentially regulates mRNA expression of protease-activated receptors 1 to 4. J. Neurosci. Res. 75: 273–279. 16. Noorbakhsh, F., S. Tsutsui, N. Vergnolle, L. A. Boven, N. Shariat, M. Vodjgani, K. G. Warren, P. Andrade-Gordon, M. D. Hollenberg, and C. Power. 2006. Proteinase-activated receptor 2 modulates neuroinflammation in experimental autoimmune encephalomyelitis and multiple sclerosis. J. Exp. Med. 203: 425– 435. 17. Jin, G., T. Hayashi, J. Kawagoe, T. Takizawa, T. Nagata, I. Nagano, M. Syoji, and K. Abe. 2005. Deficiency of PAR-2 gene increases acute focal ischemic brain injury. J. Cereb. Blood Flow Metab. 25: 302–313. 18. Noorbakhsh, F., N. Vergnolle, J. C. McArthur, C. Silva, M. Vodjgani, P. Andrade-Gordon, M. D. Hollenberg, and C. Power. 2005. Proteinase-activated receptor-2 induction by neuroinflammation prevents neuronal death during HIV infection. J. Immunol. 174: 7320 –7329. 19. Wang, Y., W. Luo, and G. Reiser. 2006. Proteinase-activated receptor-1-and proteinase-activated receptor-2 induce the release of chemokine GRO/CINC-1 from rat astrocytes via differential activation of JNK isoforms, evoking multiple protective pathways in brain. Biochem. J. 401: 65–78. 20. Fogarty, M. P., E. J. Downer, and V. Campbell. 2003. A role for c-Jun N-terminal kinase 1 (JNK1), but not JNK2, in the -amyloid-mediated stabilization of protein p53 and induction of the apoptotic cascade in cultured cortical neurons. Biochem. J. 371: 789 –798. 21. Awasthi, A., Y. Matsunaga, and T. Yamada. 2005. Amyloid- causes apoptosis of neuronal cells via caspase cascade, which can be prevented by amyloid-derived short peptides. Exp. Neurol. 196: 282–289. 22. Kadowaki, H., H. Nishitoh, F. Urano, C. Sadamitsu, A. Matsuzawa, K. Takeda, H. Masutani, J. Yodoi, Y. Urano, T. Nagano, and H. Ichijo. 2005. Amyloid  induces neuronal cell death through ROS-mediated ASK1 activation. Cell Death Differ. 12: 19 –24. Hoozemans, J. J., R. Veerhuis, E. S. Van Haastert, J. M. Rozemuller, F. Baas, P. Eikelenboom, and W. Scheper. 2005. The unfolded protein response is activated in Alzheimer’s disease. Acta Neuropathol. 110: 165–172. Hoozemans, J. J., J. Stieler, E. S. van Haastert, R. Veerhuis, A. J. Rozemuller, F. Baas, P. Eikelenboom, T. Arendt, and W. Scheper. 2006. The unfolded protein response affects neuronal cell cycle protein expression: implications for Alzheimer’s disease pathogenesis. Exp. Gerontol. 41: 380 –386. Akiyama, H., T. Arai, H. Kondo, E. Tanno, C. Haga, and K. Ikeda. 2000. Cell mediators of inflammation in the Alzheimer disease brain. Alzheimer Dis. Assoc. Disord. 14 (Suppl. 1): S47–S53. Hirohata, M., K. Ono, H. Naiki, and M. Yamada. 2005. Non-steroidal antiinflammatory drugs have anti-amyloidogenic effects for Alzheimer’s -amyloid fibrils in vitro. Neuropharmacology 49: 1088 –1099. Townsend, K. P., and D. Pratico. 2005. Novel therapeutic opportunities for Alzheimer’s disease: focus on nonsteroidal anti-inflammatory drugs. FASEB J. 19: 1592–1601. McGeer, P. L., and E. G. McGeer. 2006. NSAIDs and Alzheimer disease: epidemiological, animal model and clinical studies. Neurobiol. Aging 28: 629 – 647. McGeer, P. L., and E. G. McGeer. 2002. Local neuroinflammation and the progression of Alzheimer’s disease. J. Neurovirol. 8: 529 –538. Rosenberg, P. B. 2005. Clinical aspects of inflammation in Alzheimer’s disease. Int. Rev. Psychiatry 17: 503–514. Tuppo, E. E., and H. R. Arias. 2005. The role of inflammation in Alzheimer’s disease. Int. J. Biochem. Cell Biol. 37: 289 –305. Sastre, M., T. Klockgether, and M. T. Heneka. 2006. Contribution of inflammatory processes to Alzheimer’s disease: molecular mechanisms. Int. J. Dev. Neurosci. 24: 167–176. Minagar, A., P. Shapshak, R. Fujimura, R. Ownby, M. Heyes, and C. Eisdorfer. 2002. The role of macrophage/microglia and astrocytes in the pathogenesis of three neurologic disorders: HIV-associated dementia, Alzheimer disease, and multiple sclerosis. J. Neurol. Sci. 202: 13–23. Streit, W. J., R. E. Mrak, and W. S. Griffin. 2004. Microglia and neuroinflammation: a pathological perspective. J. Neuroinflamm. 1: 14. Streit, W. J. 2004. Microglia and Alzheimer’s disease pathogenesis. J. Neurosci. Res. 77: 1– 8. Ralay Ranaivo, H., J. M. Craft, W. Hu, L. Guo, L. K. Wing, L. J. Van Eldik, and D. M. Watterson. 2006. Glia as a therapeutic target: selective suppression of human amyloid--induced upregulation of brain proinflammatory cytokine production attenuates neurodegeneration. J. Neurosci. 26: 662– 670. Johnston, J. B., C. Silva, J. Holden, K. G. Warren, A. W. Clark, and C. Power. 2001. Monocyte activation and differentiation augment human endogenous retrovirus expression: implications for inflammatory brain diseases. Ann. Neurol. 50: 434 – 442. Tsutsui, S., J. Schnermann, F. Noorbakhsh, S. Henry, V. W. Yong, B. W. Winston, K. Warren, and C. Power. 2004. A1 adenosine receptor upregulation and activation attenuates neuroinflammation and demyelination in a model of multiple sclerosis. J. Neurosci. 24: 1521–1529. Mennicken, F., and R. Quirion. 1997. Interleukin-2 increases choline acetyltransferase activity in septal-cell cultures. Synapse 26: 175–183. Haughey, N. J., A. Nath, S. L. Chan, A. C. Borchard, M. S. Rao, and M. P. Mattson. 2002. Disruption of neurogenesis by amyloid -peptide, and perturbed neural progenitor cell homeostasis, in models of Alzheimer’s disease. J. Neurochem. 83: 1509 –1524. Damiano, B. P., W. M. Cheung, R. J. Santulli, W. P. Fung-Leung, K. Ngo, R. D. Ye, A. L. Darrow, C. K. Derian, L. de Garavilla, and P. Andrade-Gordon. 1999. Cardiovascular responses mediated by protease-activated receptor-2 (PAR-2) and thrombin receptor (PAR-1) are distinguished in mice deficient in PAR-2 or PAR-1. J. Pharmacol. Exp. Ther. 288: 671– 678. Corley, S. M., U. Ladiwala, A. Besson, and V. W. Yong. 2001. Astrocytes attenuate oligodendrocyte death in vitro through an ␣6 integrin-laminin-dependent mechanism. Glia 36: 281–294. Power, C., J. C. McArthur, A. Nath, K. Wehrly, M. Mayne, J. Nishio, T. Langelier, R. T. Johnson, and B. Chesebro. 1998. Neuronal death induced by brain-derived human immunodeficiency virus type 1 envelope genes differs between demented and nondemented AIDS patients. J. Virol. 72: 9045–9053. Chishti, M. A., D. S. Yang, C. Janus, A. L. Phinney, P. Horne, J. Pearson, R. Strome, N. Zuker, J. Loukides, J. French, et al. 2001. Early-onset amyloid deposition and cognitive deficits in transgenic mice expressing a double mutant form of amyloid precursor protein 695. J. Biol. Chem. 276: 21562–21570. Dahlgren, K. N., A. M. Manelli, W. B. Stine, Jr., L. K. Baker, G. A. Krafft, and M. J. LaDu. 2002. Oligomeric and fibrillar species of amyloid- peptides differentially affect neuronal viability. J. Biol. Chem. 277: 32046 –32053. Morris, R. 1984. Developments of a water-maze procedure for studying spatial learning in the rat. J. Neurosci. Methods 11: 47– 60. Power, C., S. Henry, M. R. Del Bigio, P. H. Larsen, D. Corbett, Y. Imai, V. W. Yong, and J. Peeling. 2003. Intracerebral hemorrhage induces macrophage activation and matrix metalloproteinases. Ann. Neurol. 53: 731–742. Wang, J., H. Zheng, M. D. Hollenberg, S. J. Wijesuriya, X. Ou, and M. Hauer-Jensen. 2003. Up-regulation and activation of proteinase-activated receptor 2 in early and delayed radiation injury in the rat intestine: influence of biological activators of proteinase-activated receptor 2. Radiat. Res. 160: 524 –535. Le, Y., W. Gong, H. L. Tiffany, A. Tumanov, S. Nedospasov, W. Shen, N. M. Dunlop, J. L. Gao, P. M. Murphy, J. J. Oppenheim, and J. M. Wang. 2001. The Journal of Immunology 50. 51. 52. 53. 54. 55. 56. 57. 59. 60. 61. 62. 63. 64. 65. Chao, C. C., T. W. Molitor, and S. Hu. 1993. Neuroprotective role of IL-4 against activated microglia. J. Immunol. 151: 1473–1481. 66. Park, K. W., D. Y. Lee, E. H. Joe, S. U. Kim, and B. K. Jin. 2005. Neuroprotective role of microglia expressing interleukin-4. J. Neurosci. Res. 81: 397– 402. 67. Zhao, W., W. Xie, Q. Xiao, D. R. Beers, and S. H. Appel. 2006. Protective effects of an anti-inflammatory cytokine, interleukin-4, on motoneuron toxicity induced by activated microglia. J. Neurochem. 99: 1176 –1187. 68. Lynch, A. M., D. J. Loane, A. M. Minogue, R. M. Clarke, D. Kilroy, R. E. Nally, O. J. Roche, F. O’Connell, and M. A. Lynch. 2007. Eicosapentaenoic acid confers neuroprotection in the amyloid- challenged aged hippocampus. Neurobiol. Aging 28: 845– 855. 69. Phinney, A. L., P. Horne, J. Yang, C. Janus, C. Bergeron, and D. Westaway. 2003. Mouse models of Alzheimer’s disease: the long and filamentous road. Neurol. Res. 25: 590 – 600. 70. Hulshof, S., L. Montagne, C. J. De Groot, and P. Van Der Valk. 2002. Cellular localization and expression patterns of interleukin-10, interleukin-4, and their receptors in multiple sclerosis lesions. Glia 38: 24 –35. 71. Meeuwsen, S., C. Persoon-Deen, M. Bsibsi, R. Ravid, and J. M. van Noort. 2003. Cytokine, chemokine and growth factor gene profiling of cultured human astrocytes after exposure to proinflammatory stimuli. Glia 43: 243–253. 72. Abbas, N., I. Bednar, E. Mix, S. Marie, D. Paterson, A. Ljungberg, C. Morris, B. Winblad, A. Nordberg, and J. Zhu. 2002. Up-regulation of the inflammatory cytokines IFN-␥ and IL-12 and down-regulation of IL-4 in cerebral cortex regions of APPSWE transgenic mice. J. Neuroimmunol. 126: 50 –57. 73. Hetz, C., M. Russelakis-Carneiro, S. Walchli, S. Carboni, E. Vial-Knecht, K. Maundrell, J. Castilla, and C. Soto. 2005. The disulfide isomerase Grp58 is a protective factor against prion neurotoxicity. J. Neurosci. 25: 2793–2802. 74. Macfarlane, S. R., C. M. Sloss, P. Cameron, T. Kanke, R. C. McKenzie, and R. Plevin. 2005. The role of intracellular Ca2⫹ in the regulation of proteinaseactivated receptor-2 mediated nuclear factor B signalling in keratinocytes. Br. J. Pharmacol. 145: 535–544. 75. Rosenberg, G. A. 2002. Matrix metalloproteinases in neuroinflammation. Glia 39: 279 –291. 76. Oka, Y., A. Uchida, M. Aoyama, M. Fujita, N. Hotta, T. Tada, H. Katano, M. Mase, K. Asai, and K. Yamada. 2005. Expression of myelencephalon-specific protease after cryogenic lesioning of the rat parietal cortex. J. Neurotrauma 22: 501–510. 77. Angelo, P. F., A. R. Lima, F. M. Alves, S. I. Blaber, I. A. Scarisbrick, M. Blaber, L. Juliano, and M. A. Juliano. 2006. Substrate specificity of human kallikrein 6: salt and glycosaminoglycan activation effects. J. Biol. Chem. 281: 3116 –3126. 78. Oikonomopoulou, K., K. K. Hansen, M. Saifeddine, I. Tea, M. Blaber, S. I. Blaber, I. Scarisbrick, P. Andrade-Gordon, G. S. Cottrell, N. W. Bunnett, E. P. Diamandis, and M. D. Hollenberg. 2006. Proteinase-activated receptors, targets for kallikrein signaling. J. Biol. Chem. 281: 32095–32112. 79. Oikonomopoulou, K., K. K. Hansen, M. Saifeddine, N. Vergnolle, I. Tea, M. Blaber, S. I. Blaber, I. Scarisbrick, E. P. Diamandis, and M. D. Hollenberg. 2006. Kallikrein-mediated cell signalling: targeting proteinase-activated receptors (PARs). Biol. Chem. 387: 817– 824. 80. Oikonomopoulou, K., K. K. Hansen, M. Saifeddine, N. Vergnolle, I. Tea, E. P. Diamandis, and M. D. Hollenberg. 2006. Proteinase-mediated cell signalling: targeting proteinase-activated receptors (PARs) by kallikreins and more. Biol. Chem. 387: 677– 685. Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017 58. Amyloid 42 activates a G-protein-coupled chemoattractant receptor, FPR-like-1. J. Neurosci. 21: RC123. Tiffany, H. L., M. C. Lavigne, Y. H. Cui, J. M. Wang, T. L. Leto, J. L. Gao, and P. M. Murphy. 2001. Amyloid- induces chemotaxis and oxidant stress by acting at formylpeptide receptor 2, a G protein-coupled receptor expressed in phagocytes and brain. J. Biol. Chem. 276: 23645–23652. Cui, Y., Y. Le, H. Yazawa, W. Gong, and J. M. Wang. 2002. Potential role of the formyl peptide receptor-like 1 (FPRL1) in inflammatory aspects of Alzheimer’s disease. J. Leukocyte Biol. 72: 628 – 635. Iribarren, P., Y. Zhou, J. Hu, Y. Le, and J. M. Wang. 2005. Role of formyl peptide receptor-like 1 (FPRL1/FPR2) in mononuclear phagocyte responses in Alzheimer disease. Immunol. Res. 31: 165–176. Jover, T., H. Tanaka, A. Calderone, K. Oguro, M. V. Bennett, A. M. Etgen, and R. S. Zukin. 2002. Estrogen protects against global ischemia-induced neuronal death and prevents activation of apoptotic signaling cascades in the hippocampal CA1. J. Neurosci. 22: 2115–2124. Abrous, D. N., M. Koehl, and M. Le Moal. 2005. Adult neurogenesis: from precursors to network and physiology. Physiol. Rev. 85: 523–569. Al-Ani, B., S. J. Wijesuriya, and M. D. Hollenberg. 2002. Proteinase-activated receptor 2: differential activation of the receptor by tethered ligand and soluble peptide analogs. J. Pharmacol. Exp. Ther. 302: 1046 –1054. Smits, H. A., A. Rijsmus, J. H. van Loon, J. W. Wat, J. Verhoef, L. A. Boven, and H. S. Nottet. 2002. Amyloid--induced chemokine production in primary human macrophages and astrocytes. J. Neuroimmunol. 127: 160 –168. Cui, Y. H., Y. Le, W. Gong, P. Proost, J. Van Damme, W. J. Murphy, and J. M. Wang. 2002. Bacterial lipopolysaccharide selectively up-regulates the function of the chemotactic peptide receptor formyl peptide receptor 2 in murine microglial cells. J. Immunol. 168: 434 – 442. Cui, Y. H., Y. Le, X. Zhang, W. Gong, K. Abe, R. Sun, J. Van Damme, P. Proost, and J. M. Wang. 2002. Up-regulation of FPR2, a chemotactic receptor for amyloid 1– 42 (A1– 42), in murine microglial cells by TNF ␣. Neurobiol. Dis. 10: 366 –377. Walker, D. G., L. F. Lue, and T. G. Beach. 2001. Gene expression profiling of amyloid  peptide-stimulated human post-mortem brain microglia. Neurobiol. Aging 22: 957–966. Franciosi, S., H. B. Choi, S. U. Kim, and J. G. McLarnon. 2005. IL-8 enhancement of amyloid- (A1– 42)-induced expression and production of pro-inflammatory cytokines and COX-2 in cultured human microglia. J. Neuroimmunol. 159: 66 –74. Walker, D. G., J. Link, L. F. Lue, J. E. Dalsing-Hernandez, and B. E. Boyes. 2006. Gene expression changes by amyloid  peptide-stimulated human postmortem brain microglia identify activation of multiple inflammatory processes. J. Leukocyte Biol. 79: 596 – 610. Iribarren, P., Y. H. Cui, Y. Le, G. Ying, X. Zhang, W. Gong, and J. M. Wang. 2003. IL-4 down-regulates lipopolysaccharide-induced formyl peptide receptor 2 in murine microglial cells by inhibiting the activation of mitogen-activated protein kinases. J. Immunol. 171: 5482–5488. Iribarren, P., K. Chen, J. Hu, X. Zhang, W. Gong, and J. M. Wang. 2005. IL-4 inhibits the expression of mouse formyl peptide receptor 2, a receptor for amyloid 1– 42, in TNF-␣-activated microglia. J. Immunol. 175: 6100 – 6106. Szczepanik, A. M., S. Funes, W. Petko, and G. E. Ringheim. 2001. IL-4, IL-10 and IL-13 modulate A 1– 42-induced cytokine and chemokine production in primary murine microglia and a human monocyte cell line. J. Neuroimmunol. 113: 49 – 62. 5503