* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download SciFed Virology Research Journal
Molecular mimicry wikipedia , lookup
Psychoneuroimmunology wikipedia , lookup
Sociality and disease transmission wikipedia , lookup
Infection control wikipedia , lookup
Hygiene hypothesis wikipedia , lookup
Vaccination wikipedia , lookup
Childhood immunizations in the United States wikipedia , lookup
Eradication of infectious diseases wikipedia , lookup
Ebola virus disease wikipedia , lookup
West Nile fever wikipedia , lookup
Transmission (medicine) wikipedia , lookup
Germ theory of disease wikipedia , lookup
Hepatitis B wikipedia , lookup
Chimeno Zoth et al, SF J Virol, 2017, 1:1 Research Article SciFed Virology Research Journal Open Access IBDV Challenge with an Intermediate Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal Welfare Conditions Silvina Chimeno Zoth, 1,2,3Juan M Carballeda, 1María J Gravisaco, 1,2Evangelina Gómez, 1María S Lucero, Matías Richetta and *1,2Analía Berinstein 1,2 1,2 Instituto de Biotecnología, CICVyA, INTA, Castelar, Cc 25, B1712WAA, Buenos Aires, Argentina Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Rivadavia 10 1917, C1033AAJ, CABA, Argentina *3 Present address: Fundación Instituto Leloir- Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Buenos Aires, Argentina *1 *2 Abstract Gumboro is a highly contagious, worldwide spread immunosuppressive chicken disease caused by the Infectious Bursal Disease Virus (IBDV). The severity of the disease depends on characteristics of the infected bird and the virulence of the infecting virus. The disease causes very severe signs and long-lasting immunosuppression, letting the animals more susceptible to other diseases, including those that do not normally affect healthy chickens. To avoid the use of extremely virulent IBDV, and the consequences suffered by the birds, we present here an alternative method to perform a first evaluation of immunogens against IBDV. We inoculated White Leghorn chickens with 2500, 10000 and 25000 EID50 of an intermediate virus and studied cellular and histopathological lesions in bursa. We analyzed different cytokine profiles by qRT-PCR, bursal lesions by classic histopathology methods, and T cells infiltration by flow cytometry at 3 and days post inoculation. Taken all together, the results obtained allowed us to determine that 25000 EID50 of the IBDV strain used is the adequate dose to use in order to reproduce typical aspects of infection in Bursa of Fabricius, without very virulent virus manipulation, avoiding the exposure of birds to very virulent IBDV. Keywords Infectious bursal disease virus; avian immune response; T lymphocytes; cytokines; qRT-PCR; flow cytometry Abbreviations IBD: Infectious Bursitis Disease, IBDV: Infectious Bursitis Disease Virus, qRT-PCR: quantitative Reverse Transcription-Polymerase Chain Reaction, SPF: Specific Pathogen Free, d.p.i.: days post inoculation, IFNg: gamma Interferon, IFNa: alpha Interferon, IL-6: Interleukin 6, GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase, PBS: Phosphate Buffered Saline, FBS: Fetal Bovine Serum, EID: Embryo Infectious Dose. Introduction Infectious Bursal Disesase (IBD), also known as Gumboro, is a highly contagious, worldwide spread immunosuppressive chicken disease caused by the Infectious Bursal Disease Virus (IBDV). IBDV is a non-enveloped, two segmented double- stranded RNA virus, member of the Birnaviridae Family [1-3]. Two serotypes of IBDV [1 and 2] have already been described. Only serotype 1 viruses cause clinical SF J Virol ISSN:xxxx-xxxx SFJV , an open access journal signs and they are classified in increasing order of virulence as mild, intermediate, classical virulent and very virulent strains [4]. Mild and intermediate viruses are used as live virus vaccines [4]. On the other hand, serotype 2 viruses may infect chickens and turkeys but they are non-pathogenic for both species [5-7]. The severity of the disease depends on the age and breed of the bird infected and the virulence of the infecting virus. The clinical form of IBD usually occurs in chickens from 3 to 6 *Corresponding author: Silvina Chimeno Zoth, Instituto de Biotecnología, CICVyA, INTA, Castelar, Cc 25, B1712WAA, Buenos Aires, Argentina. E-mail: [email protected] Received January 09, 2017; Accepted March 16, 2017; Published March 31, 2017 Citation: Chimeno Zoth et al (2017) IBDV Challenge with an Intermediate Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal Welfare Conditions. SF J Virol 1:1. Copyright: © 2017 Silvina Chimeno Zoth. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Volume 1 · Issue 1 · 1000004 page 1 of 5 Citation: Chimeno Zoth et al (2017) IBDV Challenge with an Intermediate Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal Welfare Conditions. SF J Virol 1:1. weeks of age. The disease has a sudden onset, and the mortality rate in the flock increases rapidly. Clinical signs of disease include dehydration, trembling, ruffled feathers, vent pecking, and depression. Also, the disease can cause severe, long-lasting suppression of the immune system. Chickens that are immune suppressed by early IBD infections do not respond well to vaccination and are more susceptible to other diseases, including those that do not normally affect healthy chickens. On necropsy, the main lesions are found in the Bursa of Fabricius. This organ is exclusive of birds and it is a specialized and essential organ for the amplification and differentiation of B cells. Despite different assays like ELISA are believed to correlate with the level of protection elicited by vaccination [8], sometimes it is desirable to test the effectiveness of a given vaccine by performing a challenge experiment. However, during challenge, animals are exposed to tissue damage and pain produced by infection and, depending on the disease working with, special challenge conditions are requested, like the use of isolated cages or to work in BSL 3 laboratories, conditions that are not always available. We present here an alternative method to first evaluate immunogens against IBDV. Materials and Methods Animals and virus Specific-pathogen-free (SPF) White Leghorn chickens (eggs from Rosenbusch S.A., CABA, Argentina) were used all through the research work. All procedures involving the use of animals were performed in agreement with institutional guidelines and approved by the Institutional Committee for the care and use of experimental animals (CICUAE – CICVyA – INTA. Authorization reference number: 4/2011). Animals were maintained in individual cages, with water and food provided ad libitum. IBDV intermediate virus LZD was obtained from Laboratorios Inmuner S.A., Entre Ríos, Argentina. RNA Isolation and cDNA synthesis RNA was obtained from each sample utilizing RNAeasy kit (Qiagen) following manufacturer’s instructions. The purity and concentration of each RNA obtained was determined using the absorbance 260/280nm relation. After treatment with DNAseI, reverse transcription was done using SSIII kit (Invitrogen) and random hexamers. Quantitative RT PCR Primers used for amplification of interferon gamma (IFNg), alpha (IFNa), interleukin 6 (IL-6) and GAPDH (glyceraldehyde 3-phosphate dehydrogenase, internal control) genes were designed based on available reported sequences (Table 1, 9). To quantify mRNA of the mentioned genes, recombinant plasmids containing a ~200bp fragment of each codifying region were constructed to create standard curves [9]. Quantification was carried out with the SYBR®Green Master Mix Kit (Applied Biosystems, Warrington, UK). Cycle Threshold (CT) values were used to plot a standard curve in which the CT values decreases in linear proportion with the log of the template concentration. Sample CT values were extrapolated in the standard curve in order to determine the initial amount of each particular transcript. Histopathological observation of bursa Experimental design randomly divided into four groups. Three groups received 50, 200 and 500 µl of the mentioned virus (5 x 104 EID50/ml) and the control group received the highest volume of vaccine diluent. Three animals of each group were sacrificed at 3 and 5 days post inoculation. (d.p.i.) and the bursas were removed. A fragment of 30 mg of bursa was submerged in RNA stabilizing solution (RNAlater, Qiagen). The rest of the organ was divided into two similar fragments. One of them was submerged in RPMI media for subsequent lymphocytes isolation, and the other was submerged in fixing solution for histological processing. Twenty four SPF chickens of 21 days of age were A fragment of each bursa was processed for histopathological observation following standard procedures. Name Sequence (5' - 3') Access number (Gene bank) Size of PCR product (bp) IFNa Fw CTCACGCTCCTTCTGAAA NM_205427.1 174 Y07922 259 AJ309540 254 K01458 264 IFNa Rv CAGGATGGTGTCGTTGAA IFNg Fw CAAAGCCGCACATCAAACA IFNg Rv TTTCACCTTCTTCACGCCATC IL-6 Fw CAAGGTGACGGAGGAGGAC IL-6 Rv TGGCGAGGAGGGATTTCT GAPDH Fw AGAACATCATCCCAGCGTCC GAPDH Rv CGGCAGGTCAGGTCAACA Table 1 Oligonucleotides used to amplify cytokine and control coding regions. SF J Virol ISSN:xxxx-xxxx SFJV , an open access journal Volume 1 · Issue 1 · 1000004 page 2 of 5 Citation: Chimeno Zoth et al (2017) IBDV Challenge with an Intermediate Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal Welfare Conditions. SF J Virol 1:1. Briefly, samples were submerged in fixing solution, transferred to successive solutions with increasing concentrations of ethanol, incubated with xylene and embedded in paraffin. Histopathological analysis was performed by staining bursa sections with the hematoxylin/eosin method. Lymphocyte Isolation and flow cytometry analysis Another fraction of the organ was processed for mononuclear cells isolation by ficoll gradient centrifugation and subsequent staining with specific monoclonal antibodies for lymphocyte markers conjugated to different fluorochromes and flow cytometry analysis as described before [9,11]. Briefly, bursas were cut in very small pieces and mechanically disrupted by pressing with a syringe plunger. Cellular suspensions were passed through a mesh (Cell Strainer, BD) and mononuclear cells were isolated by centrifugation over Histopaque density gradient (1.077 g/ml; Sigma, St. Louis, MO). Cells obtained were resuspended in Staining Buffer (PBS 1x, 10 % FBS, 0.1 % Sodium Azide) and 1x106 cells per well were seeded on 96 well-plates. Staining was performed by resuspending the cellular pellet of each well in 100 µl of staining buffer including different combinations of antibodies, or as single-color staining for compensation. Monoclonal antibodies (CD3-SPRD, CD4PE, CD8α-FITC, CD8β-PE, KUL01- PE) were obtained from Southern Biotech (Birmingham, AL). Positive cells were analyzed with a FACS Calibur flow cytometer (BD Biosciences, San Jose, CA) and CellQuest software. Both lymphocyte and monocyte gates were defined by the forward/side scatter characteristics of the cells and 30,000 and 50,000 events were analyzed respectively for each sample. Results and Discussion To determine the optimal IBDV dose capable of producing alterations at cellular and histopathological levels in the bursa, we inoculated different amounts of an intermediate virus and studied different parameters in the chicken. First, we evaluated the expression of IFNg, IFNa, IL-6 and GAPDH by real time-PCR. A very strong over expression of inflammatory cytokines (IFNg, IL-6) and IFNa was observed (Figure 1). This effect was found to be dose dependent, being stronger when animals were inoculated with 500 µl (2.5 x 104 EID50) of IBDV on day 3 (Figure 1). Previous studies using virulent and very virulent strains showed the up regulation of IL-6 and IFNg in bursa of IBDV treated chickens. However, the authors observed that type 1 IFNs were not up regulated or were even down regulated when infecting chickens with very virulent IBDV strains [10]. In this way, the absence or presence of IFNa in infected chicken samples could give a clue on the degree of virulence of the infecting virus. The microscopic observation of the bursas showed a gradual increase of histological damage in relation with the dose of IBDV received, being the effect observed for the lowest dose used (50 µl, 2.5 x 103 EID50) undistinguishable from the negative control (Figure 2). Higher doses produced, in increasing degree, alterations compatible with IBDV infection. Animals which received 200 µl (1 x 104 EID50) of IBDV showed diffused apoptosis spots. These observations were more pronounced in animals that received 500 µl of IBDV at 5 d.p.i., when more histological damage was observed, i.e. lymphoid depletion, presence of dense apoptotic bodies regions, modification of the cortico-medullar epithelia and follicular stromal thickening, infiltration of inflammatory Figure 1: Total RNA was extracted from bursa of Fabricius of experimental and control inoculated chickens, and cDNA was synthesized. mRNA levels were determined by Quantitative Real Time PCR. Data are expressed as normalized mRNA levels of duplicate determinations to GAPDH mRNA with pooled samples from three chickens. Ratios between IBDV: PBS treated chickens are shown. Results were analyzed using Student´s test (GraphPad QuickCalcs) www. graphpad.com/quickcalcs/ttest1.cfm (*): p<0.05. Times over expressed are exposed between brackets. SF J Virol ISSN:xxxx-xxxx SFJV , an open access journal Volume 1 · Issue 1 · 1000004 page 3 of 5 Citation: Chimeno Zoth et al (2017) IBDV Challenge with an Intermediate Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal Welfare Conditions. SF J Virol 1:1. Figure 2: Bursal tissue sections stained with hematoxylin and eosin. A: normal bursa; B, C and D: Bursa of animals infected with 50, 200 and 500 µl of an intermediate strain of IBDV strain, respectively. Table 2 Evaluation of cellular populations by flow cytometry Cell subpopulation IBDV dose CD3+ CD3+CD8α+ CD3+CD4+ CD8α+CD8β+ KUL01+ - 3.25 0.66 0.72 0.51 24.1 50µl 2.49 0.44 0.5 0.26 25.47 200µl 3.11 0.87 0.42 0.67 20.92 500µl 6.58 3.37 1.85 3.15 25.59 Lymphocytes isolated at 5 dpi from pools of bursae of IBDV-infected and PBS-treated chickens were stained with different combinations of antibodies and analyzed by flow cytometry. For CD3+, CD4+, CD8α+ and CD8β+ the gating strategy was location of the lymphocytes in a forward/side scatter-defined gate. KULO1+ cells were studied in the monocytes/macrophages gate defined in a forward/side scatter graph. Results are expressed as the percentage of stained cells in the gate. cells and edema, among others (Figure 2). Finally, results of the cytometry analysis of bursal lymphocytes are shown in table 2. The presence of T cells was only detected in bursae from chickens inoculated with 500 µl of IBDV (Table 2). It is already known that in virulent and very virulent IBDV infected chickens, there is an increase in the number of intrabursal T cells, compared to the bursas of uninfected chickens [12-14]. In the same way, we found intrabursal T cells augmented when chickens were infected with the highest dose of classical IBDV. Practically, none T cells were found in the bursae of the rest of the animals. In nature, affected birds shed large amounts of virus for about 2 weeks after infection. IBDV is shed in faeces and spreads SF J Virol ISSN:xxxx-xxxx SFJV , an open access journal between birds or by contact with a contaminated environment. IBDV is very stable and difficult to eradicate. Mealworms and litter mites may harbor the virus for 8 weeks. In this context, avoidance of the use of virulent virus for experimental challenge is interesting, as it reduces the risk of virulent virus dissemination. In a recent study on vaccination approaches against IBDV, Arnold and coworkers used the classical IBDV strain. Edgar for challenge experiments and subsequent bursal lesion score analysis [15]. In their case they had to use 100 EID50 to produce a significant disease. Each challenge virus may have to be evaluated to determine the optimal dose to be used, but the approach is being incorporated in different laboratories. Volume 1 · Issue 1 · 1000004 page 4 of 5 Citation: Chimeno Zoth et al (2017) IBDV Challenge with an Intermediate Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal Welfare Conditions. SF J Virol 1:1. Taken all together, our results allowed us to determine that 2.5 x 104 EID50 of an intermediate strain of IBDV is the adequate dose to use to reproduce typical aspects of infection in Bursa of Fabricius, without very virulent virus manipulation, avoiding the exposure of birds to very virulent IBDV. We could reproduce infection without disease manifestation using a high dose of the virus. This method brings a safer and less traumatic option for first evaluating IBDV vaccines. Acknowledgements The authors are grateful to Mr. Daniel Funes for his technical assistance in the histopathological studies and to Mr. Silvio Díaz for the animal care. This work was supported by grants PIP 11420090100034 from CONICET and PE 232152 from INTA. JMC and MSL are recipients of CONICET fellowships. References 1. Dobos P, Hill BJ, Hallett R, et al. (1979) Biophysical and biochemical characterization of five animal viruses with bisegmented double-stranded RNA genomes. Journal of Virology 32: 593-605. 2. Kibenge FS, Dhillon AS, Russell R.G (1988) Biochemistry and immunology of infectious bursal disease virus. Journal of General Virology 69: 1757-1775. 3. Sharma JM, Kim IJ, Rautenschiein S, et al. (2000) Infectious bursal disease virus of chickens: pathogenesis and immunosuppression. Developmental and Comparative Immunology 24: 223-235. 4. Berg TP (2000) Acute infectious bursal disease in poultry: a review. Avian Pathology 29: 175-194. 5. Mcferran JB, Mcnulty MS, Mckillop E.R, et al. (1980) Isolation and serological studies with infectious bursal disease viruses from fowl, turkeys and ducks: demonstration of a second serotype. Avian Pathology 9: 395-404. 9. Carballeda JM, Zoth SC, Gomez E, et al. (2011) Activation of the immune response against Infectious Bursal Disease Virus after intramuscular inoculation of an intermediate strain. Immunobiology 216: 1028-1033. 10. Eldaghayes I, Rothwell L, Williams A, et al. (2006) Infectious bursal disease virus: strains that differ in virulence differentially modulate the innate immune response to infection in the chicken bursa. Viral Immunology 19: 83-91. 11. Chimeno Zoth S, Carballeda JM, Gomez E, et al. (2012) Modulation of innate immunity in chickens induced by in vivo administration of baculovirus. Veterinary Immunology and Immunopathology 145: 241-247. 12. Khan MZ, Hashimoto Y (1996) An immunohistochemical analysis of T-cell subsets in the chicken bursa of Fabricius during postnatal stages of development. Journal of Veterinary Medical Science 58: 1231-1234. 13. Tanimura N, Sharma JM (1997) Appearance of T cells in the bursa of Fabricius and cecal tonsils during the acute phase of infectious bursal disease virus infection in chickens. Avian Diseases 41: 638-645. 14. Kim IJ, Gagic M, Sharma JM (1999) Recovery of antibodyproducing ability and lymphocyte repopulation of bursal follicles in chickens exposed to infectious bursal disease virus. Avian Diseases 43: 401-413. 15. Arnold M, Duraira Iuraira V, Mundt E, et al. (2012) Protective vaccination against Infectious Bursal Disease Virus with whole recombinant Kluyveromyces lactis yeast expressing the viral VP2 subunit. Plos One 7: e42870. Citation: Chimeno Zoth et al (2017) IBDV Challenge with an Intermediate Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal Welfare Conditions. SF J Virol 1:1. 6. Jackwood DJ, Saif YM, Hughes JH (1982) Characteristics and serologic studies of two serotypes of infectious bursal disease virus in turkeys. Avian Diseases 26: 871-882. 7. Mcnulty MS, Saif Y (1988) Antigenic relationship of nonserotype 1 turkey infectious bursal disease viruses from the United States and United Kingdom. Avian Diseases 32: 374-375. 8. Jackwood DJ, Sommer SE, Odor E (1999) Correlation of enzyme- linked immunosorbent assay titers with protection against infectious bursal disease virus. Avian Diseases 43: 189197. SF J Virol ISSN:xxxx-xxxx SFJV , an open access journal Volume 1 · Issue 1 · 1000004 page 5 of 5