Download SciFed Virology Research Journal

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Molecular mimicry wikipedia , lookup

Psychoneuroimmunology wikipedia , lookup

Sociality and disease transmission wikipedia , lookup

Infection control wikipedia , lookup

Hygiene hypothesis wikipedia , lookup

Vaccination wikipedia , lookup

Childhood immunizations in the United States wikipedia , lookup

Eradication of infectious diseases wikipedia , lookup

Chickenpox wikipedia , lookup

Ebola virus disease wikipedia , lookup

West Nile fever wikipedia , lookup

Transmission (medicine) wikipedia , lookup

Germ theory of disease wikipedia , lookup

Hepatitis B wikipedia , lookup

Marburg virus disease wikipedia , lookup

Infection wikipedia , lookup

Globalization and disease wikipedia , lookup

Transcript
Chimeno Zoth et al, SF J Virol, 2017, 1:1
Research Article
SciFed Virology Research Journal
Open Access
IBDV Challenge with an Intermediate Strain for Evaluation of Immunogens
in Chickens: Seeking for Better Animal Welfare Conditions
Silvina Chimeno Zoth, 1,2,3Juan M Carballeda, 1María J Gravisaco, 1,2Evangelina Gómez, 1María S Lucero,
Matías Richetta and *1,2Analía Berinstein
1,2
1,2
Instituto de Biotecnología, CICVyA, INTA, Castelar, Cc 25, B1712WAA, Buenos Aires, Argentina
Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Rivadavia 10 1917, C1033AAJ, CABA, Argentina
*3
Present address: Fundación Instituto Leloir- Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Buenos Aires, Argentina
*1
*2
Abstract
Gumboro is a highly contagious, worldwide spread immunosuppressive chicken disease caused
by the Infectious Bursal Disease Virus (IBDV). The severity of the disease depends on characteristics
of the infected bird and the virulence of the infecting virus. The disease causes very severe signs and
long-lasting immunosuppression, letting the animals more susceptible to other diseases, including those
that do not normally affect healthy chickens. To avoid the use of extremely virulent IBDV, and the
consequences suffered by the birds, we present here an alternative method to perform a first evaluation of
immunogens against IBDV. We inoculated White Leghorn chickens with 2500, 10000 and 25000 EID50
of an intermediate virus and studied cellular and histopathological lesions in bursa. We analyzed different
cytokine profiles by qRT-PCR, bursal lesions by classic histopathology methods, and T cells infiltration
by flow cytometry at 3 and days post inoculation. Taken all together, the results obtained allowed us to
determine that 25000 EID50 of the IBDV strain used is the adequate dose to use in order to reproduce
typical aspects of infection in Bursa of Fabricius, without very virulent virus manipulation, avoiding the
exposure of birds to very virulent IBDV.
Keywords
Infectious bursal disease virus; avian immune response;
T lymphocytes; cytokines; qRT-PCR; flow cytometry
Abbreviations
IBD: Infectious Bursitis Disease, IBDV: Infectious
Bursitis Disease Virus, qRT-PCR: quantitative Reverse
Transcription-Polymerase Chain Reaction, SPF: Specific
Pathogen Free, d.p.i.: days post inoculation, IFNg: gamma
Interferon, IFNa: alpha Interferon, IL-6: Interleukin 6, GAPDH:
Glyceraldehyde-3-Phosphate Dehydrogenase, PBS: Phosphate
Buffered Saline, FBS: Fetal Bovine Serum, EID: Embryo
Infectious Dose.
Introduction
Infectious Bursal Disesase (IBD), also known
as Gumboro, is a highly contagious, worldwide spread
immunosuppressive chicken disease caused by the Infectious
Bursal Disease Virus (IBDV). IBDV is a non-enveloped,
two segmented double- stranded RNA virus, member of the
Birnaviridae Family [1-3]. Two serotypes of IBDV [1 and 2] have
already been described. Only serotype 1 viruses cause clinical
SF J Virol
ISSN:xxxx-xxxx SFJV , an open access journal
signs and they are classified in increasing order of virulence as
mild, intermediate, classical virulent and very virulent strains
[4]. Mild and intermediate viruses are used as live virus vaccines
[4]. On the other hand, serotype 2 viruses may infect chickens
and turkeys but they are non-pathogenic for both species [5-7].
The severity of the disease depends on the age and breed of the
bird infected and the virulence of the infecting virus. The clinical
form of IBD usually occurs in chickens from 3 to 6
*Corresponding author: Silvina Chimeno Zoth, Instituto de Biotecnología,
CICVyA, INTA, Castelar, Cc 25, B1712WAA, Buenos Aires, Argentina. E-mail:
[email protected]
Received January 09, 2017; Accepted March 16, 2017; Published March 31,
2017
Citation: Chimeno Zoth et al (2017) IBDV Challenge with an Intermediate
Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal
Welfare Conditions. SF J Virol 1:1.
Copyright: © 2017 Silvina Chimeno Zoth. This is an open-access article
distributed under the terms of the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided
the original author and source are credited.
Volume 1 · Issue 1 · 1000004
page 1 of 5
Citation: Chimeno Zoth et al (2017) IBDV Challenge with an Intermediate Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal
Welfare Conditions. SF J Virol 1:1.
weeks of age. The disease has a sudden onset, and the mortality
rate in the flock increases rapidly. Clinical signs of disease
include dehydration, trembling, ruffled feathers, vent pecking,
and depression. Also, the disease can cause severe, long-lasting
suppression of the immune system. Chickens that are immune
suppressed by early IBD infections do not respond well to
vaccination and are more susceptible to other diseases, including
those that do not normally affect healthy chickens. On necropsy,
the main lesions are found in the Bursa of Fabricius. This organ
is exclusive of birds and it is a specialized and essential organ
for the amplification and differentiation of B cells. Despite
different assays like ELISA are believed to correlate with the
level of protection elicited by vaccination [8], sometimes
it is desirable to test the effectiveness of a given vaccine by
performing a challenge experiment. However, during challenge,
animals are exposed to tissue damage and pain produced by
infection and, depending on the disease working with, special
challenge conditions are requested, like the use of isolated cages
or to work in BSL 3 laboratories, conditions that are not always
available. We present here an alternative method to first evaluate
immunogens against IBDV.
Materials and Methods
Animals and virus
Specific-pathogen-free (SPF) White Leghorn chickens
(eggs from Rosenbusch S.A., CABA, Argentina) were used
all through the research work. All procedures involving the
use of animals were performed in agreement with institutional
guidelines and approved by the Institutional Committee for the
care and use of experimental animals (CICUAE – CICVyA –
INTA. Authorization reference number: 4/2011). Animals were
maintained in individual cages, with water and food provided
ad libitum. IBDV intermediate virus LZD was obtained from
Laboratorios Inmuner S.A., Entre Ríos, Argentina.
RNA Isolation and cDNA synthesis
RNA was obtained from each sample utilizing
RNAeasy kit (Qiagen) following manufacturer’s instructions.
The purity and concentration of each RNA obtained was
determined using the absorbance 260/280nm relation. After
treatment with DNAseI, reverse transcription was done using
SSIII kit (Invitrogen) and random hexamers.
Quantitative RT PCR
Primers used for amplification of interferon gamma
(IFNg), alpha (IFNa), interleukin 6 (IL-6) and GAPDH
(glyceraldehyde 3-phosphate dehydrogenase, internal control)
genes were designed based on available reported sequences
(Table 1, 9). To quantify mRNA of the mentioned genes,
recombinant plasmids containing a ~200bp fragment of each
codifying region were constructed to create standard curves
[9]. Quantification was carried out with the SYBR®Green
Master Mix Kit (Applied Biosystems, Warrington, UK). Cycle
Threshold (CT) values were used to plot a standard curve in
which the CT values decreases in linear proportion with the log of
the template concentration. Sample CT values were extrapolated
in the standard curve in order to determine the initial amount of
each particular transcript.
Histopathological observation of bursa
Experimental design
randomly divided into four groups. Three groups received 50,
200 and 500 µl of the mentioned virus (5 x 104 EID50/ml) and the
control group received the highest volume of vaccine diluent.
Three animals of each group were sacrificed at 3 and 5 days post
inoculation. (d.p.i.) and the bursas were removed. A fragment
of 30 mg of bursa was submerged in RNA stabilizing solution
(RNAlater, Qiagen). The rest of the organ was divided into
two similar fragments. One of them was submerged in RPMI
media for subsequent lymphocytes isolation, and the other was
submerged in fixing solution for histological processing.
Twenty four SPF chickens of 21 days of age were
A fragment of each bursa was processed for
histopathological observation following standard procedures.
Name
Sequence (5' - 3')
Access number
(Gene bank)
Size of PCR
product (bp)
IFNa Fw
CTCACGCTCCTTCTGAAA
NM_205427.1
174
Y07922
259
AJ309540
254
K01458
264
IFNa Rv
CAGGATGGTGTCGTTGAA
IFNg Fw
CAAAGCCGCACATCAAACA
IFNg Rv
TTTCACCTTCTTCACGCCATC
IL-6 Fw
CAAGGTGACGGAGGAGGAC
IL-6 Rv
TGGCGAGGAGGGATTTCT
GAPDH Fw
AGAACATCATCCCAGCGTCC
GAPDH Rv
CGGCAGGTCAGGTCAACA
Table 1 Oligonucleotides used to amplify cytokine and control coding regions.
SF J Virol
ISSN:xxxx-xxxx SFJV , an open access journal
Volume 1 · Issue 1 · 1000004
page 2 of 5
Citation: Chimeno Zoth et al (2017) IBDV Challenge with an Intermediate Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal
Welfare Conditions. SF J Virol 1:1.
Briefly, samples were submerged in fixing solution, transferred
to successive solutions with increasing concentrations of
ethanol, incubated with xylene and embedded in paraffin.
Histopathological analysis was performed by staining bursa
sections with the hematoxylin/eosin method.
Lymphocyte Isolation and flow cytometry analysis
Another fraction of the organ was processed for
mononuclear cells isolation by ficoll gradient centrifugation
and subsequent staining with specific monoclonal antibodies
for lymphocyte markers conjugated to different fluorochromes
and flow cytometry analysis as described before [9,11]. Briefly,
bursas were cut in very small pieces and mechanically disrupted
by pressing with a syringe plunger. Cellular suspensions were
passed through a mesh (Cell Strainer, BD) and mononuclear
cells were isolated by centrifugation over Histopaque density
gradient (1.077 g/ml; Sigma, St. Louis, MO). Cells obtained
were resuspended in Staining Buffer (PBS 1x, 10 % FBS, 0.1
% Sodium Azide) and 1x106 cells per well were seeded on
96 well-plates. Staining was performed by resuspending the
cellular pellet of each well in 100 µl of staining buffer including
different combinations of antibodies, or as single-color staining
for compensation. Monoclonal antibodies (CD3-SPRD, CD4PE, CD8α-FITC, CD8β-PE, KUL01- PE) were obtained from
Southern Biotech (Birmingham, AL). Positive cells were
analyzed with a FACS Calibur flow cytometer (BD Biosciences,
San Jose, CA) and CellQuest software. Both lymphocyte and
monocyte gates were defined by the forward/side scatter
characteristics of the cells and 30,000 and 50,000 events were
analyzed respectively for each sample.
Results and Discussion
To determine the optimal IBDV dose capable of
producing alterations at cellular and histopathological levels in
the bursa, we inoculated different amounts of an intermediate
virus and studied different parameters in the chicken. First, we
evaluated the expression of IFNg, IFNa, IL-6 and GAPDH by
real time-PCR. A very strong over expression of inflammatory
cytokines (IFNg, IL-6) and IFNa was observed (Figure 1).
This effect was found to be dose dependent, being stronger
when animals were inoculated with 500 µl (2.5 x 104 EID50)
of IBDV on day 3 (Figure 1). Previous studies using virulent
and very virulent strains showed the up regulation of IL-6 and
IFNg in bursa of IBDV treated chickens. However, the authors
observed that type 1 IFNs were not up regulated or were even
down regulated when infecting chickens with very virulent
IBDV strains [10]. In this way, the absence or presence of IFNa
in infected chicken samples could give a clue on the degree of
virulence of the infecting virus. The microscopic observation of
the bursas showed a gradual increase of histological damage
in relation with the dose of IBDV received, being the effect
observed for the lowest dose used (50 µl, 2.5 x 103 EID50)
undistinguishable from the negative control (Figure 2). Higher
doses produced, in increasing degree, alterations compatible
with IBDV infection. Animals which received 200 µl (1 x
104 EID50) of IBDV showed diffused apoptosis spots. These
observations were more pronounced in animals that received
500 µl of IBDV at 5 d.p.i., when more histological damage was
observed, i.e. lymphoid depletion, presence of dense apoptotic
bodies regions, modification of the cortico-medullar epithelia
and follicular stromal thickening, infiltration of inflammatory
Figure 1: Total RNA was extracted from bursa of Fabricius of experimental and control inoculated chickens, and cDNA was synthesized. mRNA levels were
determined by Quantitative Real Time PCR. Data are expressed as normalized mRNA levels of duplicate determinations to GAPDH mRNA with pooled
samples from three chickens. Ratios between IBDV: PBS treated chickens are shown. Results were analyzed using Student´s test (GraphPad QuickCalcs) www.
graphpad.com/quickcalcs/ttest1.cfm (*): p<0.05. Times over expressed are exposed between brackets.
SF J Virol
ISSN:xxxx-xxxx SFJV , an open access journal
Volume 1 · Issue 1 · 1000004
page 3 of 5
Citation: Chimeno Zoth et al (2017) IBDV Challenge with an Intermediate Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal
Welfare Conditions. SF J Virol 1:1.
Figure 2: Bursal tissue sections stained with hematoxylin and eosin. A: normal bursa; B, C and D: Bursa of animals infected with 50, 200 and 500 µl of an
intermediate strain of IBDV strain, respectively.
Table 2 Evaluation of cellular populations by flow cytometry
Cell
subpopulation
IBDV dose
CD3+
CD3+CD8α+
CD3+CD4+
CD8α+CD8β+
KUL01+
-
3.25
0.66
0.72
0.51
24.1
50µl
2.49
0.44
0.5
0.26
25.47
200µl
3.11
0.87
0.42
0.67
20.92
500µl
6.58
3.37
1.85
3.15
25.59
Lymphocytes isolated at 5 dpi from pools of bursae of IBDV-infected and PBS-treated chickens were stained with different combinations of antibodies and
analyzed by flow cytometry. For CD3+, CD4+, CD8α+ and CD8β+ the gating strategy was location of the lymphocytes in a forward/side scatter-defined gate.
KULO1+ cells were studied in the monocytes/macrophages gate defined in a forward/side scatter graph. Results are expressed as the percentage of stained cells
in the gate.
cells and edema, among others (Figure 2). Finally, results of the
cytometry analysis of bursal lymphocytes are shown in table 2.
The presence of T cells was only detected in bursae from chickens
inoculated with 500 µl of IBDV (Table 2). It is already known
that in virulent and very virulent IBDV infected chickens, there
is an increase in the number of intrabursal T cells, compared
to the bursas of uninfected chickens [12-14]. In the same way,
we found intrabursal T cells augmented when chickens were
infected with the highest dose of classical IBDV. Practically,
none T cells were found in the bursae of the rest of the animals.
In nature, affected birds shed large amounts of virus for about
2 weeks after infection. IBDV is shed in faeces and spreads
SF J Virol
ISSN:xxxx-xxxx SFJV , an open access journal
between birds or by contact with a contaminated environment.
IBDV is very stable and difficult to eradicate. Mealworms
and litter mites may harbor the virus for 8 weeks. In this
context, avoidance of the use of virulent virus for experimental
challenge is interesting, as it reduces the risk of virulent virus
dissemination. In a recent study on vaccination approaches
against IBDV, Arnold and coworkers used the classical IBDV
strain. Edgar for challenge experiments and subsequent bursal
lesion score analysis [15]. In their case they had to use 100 EID50
to produce a significant disease. Each challenge virus may have
to be evaluated to determine the optimal dose to be used, but
the approach is being incorporated in different laboratories.
Volume 1 · Issue 1 · 1000004
page 4 of 5
Citation: Chimeno Zoth et al (2017) IBDV Challenge with an Intermediate Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal
Welfare Conditions. SF J Virol 1:1.
Taken all together, our results allowed us to determine that 2.5
x 104 EID50 of an intermediate strain of IBDV is the adequate
dose to use to reproduce typical aspects of infection in Bursa
of Fabricius, without very virulent virus manipulation, avoiding
the exposure of birds to very virulent IBDV. We could reproduce
infection without disease manifestation using a high dose of the
virus. This method brings a safer and less traumatic option for
first evaluating IBDV vaccines.
Acknowledgements
The authors are grateful to Mr. Daniel Funes for his
technical assistance in the histopathological studies and to Mr.
Silvio Díaz for the animal care. This work was supported by
grants PIP 11420090100034 from CONICET and PE 232152
from INTA. JMC and MSL are recipients of CONICET
fellowships.
References
1. Dobos P, Hill BJ, Hallett R, et al. (1979) Biophysical and
biochemical characterization of five animal viruses with
bisegmented double-stranded RNA genomes. Journal of
Virology 32: 593-605.
2. Kibenge FS, Dhillon AS, Russell R.G (1988) Biochemistry
and immunology of infectious bursal disease virus. Journal of
General Virology 69: 1757-1775.
3. Sharma JM, Kim IJ, Rautenschiein S, et al. (2000)
Infectious bursal disease virus of chickens: pathogenesis
and immunosuppression. Developmental and Comparative
Immunology 24: 223-235.
4. Berg TP (2000) Acute infectious bursal disease in poultry: a
review. Avian Pathology 29: 175-194.
5. Mcferran JB, Mcnulty MS, Mckillop E.R, et al. (1980)
Isolation and serological studies with infectious bursal disease
viruses from fowl, turkeys and ducks: demonstration of a second
serotype. Avian Pathology 9: 395-404.
9. Carballeda JM, Zoth SC, Gomez E, et al. (2011) Activation
of the immune response against Infectious Bursal Disease
Virus after intramuscular inoculation of an intermediate strain.
Immunobiology 216: 1028-1033.
10. Eldaghayes I, Rothwell L, Williams A, et al. (2006) Infectious
bursal disease virus: strains that differ in virulence differentially
modulate the innate immune response to infection in the chicken
bursa. Viral Immunology 19: 83-91.
11. Chimeno Zoth S, Carballeda JM, Gomez E, et al. (2012)
Modulation of innate immunity in chickens induced by in vivo
administration of baculovirus. Veterinary Immunology and
Immunopathology 145: 241-247.
12. Khan MZ, Hashimoto Y (1996) An immunohistochemical
analysis of T-cell subsets in the chicken bursa of Fabricius
during postnatal stages of development. Journal of Veterinary
Medical Science 58: 1231-1234.
13. Tanimura N, Sharma JM (1997) Appearance of T cells in
the bursa of Fabricius and cecal tonsils during the acute phase
of infectious bursal disease virus infection in chickens. Avian
Diseases 41: 638-645.
14. Kim IJ, Gagic M, Sharma JM (1999) Recovery of antibodyproducing ability and lymphocyte repopulation of bursal
follicles in chickens exposed to infectious bursal disease virus.
Avian Diseases 43: 401-413.
15. Arnold M, Duraira Iuraira V, Mundt E, et al. (2012) Protective
vaccination against Infectious Bursal Disease Virus with whole
recombinant Kluyveromyces lactis yeast expressing the viral
VP2 subunit. Plos One 7: e42870.
Citation: Chimeno Zoth et al (2017) IBDV Challenge with an Intermediate
Strain for Evaluation of Immunogens in Chickens: Seeking for Better Animal
Welfare Conditions. SF J Virol 1:1.
6. Jackwood DJ, Saif YM, Hughes JH (1982) Characteristics and
serologic studies of two serotypes of infectious bursal disease
virus in turkeys. Avian Diseases 26: 871-882.
7. Mcnulty MS, Saif Y (1988) Antigenic relationship of nonserotype 1 turkey infectious bursal disease viruses from the
United States and United Kingdom. Avian Diseases 32: 374-375.
8. Jackwood DJ, Sommer SE, Odor E (1999) Correlation of
enzyme- linked immunosorbent assay titers with protection
against infectious bursal disease virus. Avian Diseases 43: 189197.
SF J Virol
ISSN:xxxx-xxxx SFJV , an open access journal
Volume 1 · Issue 1 · 1000004
page 5 of 5