Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Analysis of isoform specific functions of atypical PKCɩ and PKCζ Sebastian Seidl The Biotechnology Centre of Oslo University of Oslo April 2013 © Sebastian Seidl, 2013 Series of dissertations submitted to the Faculty of Mathematics and Natural Sciences, University of Oslo No. 1335 ISSN 1501-7710 All rights reserved. No part of this publication may be reproduced or transmitted, in any form or by any means, without permission. Cover: Inger Sandved Anfinsen. Printed in Norway: AIT Oslo AS. Produced in co-operation with Akademika publishing. The thesis is produced by Akademika publishing merely in connection with the thesis defence. Kindly direct all inquiries regarding the thesis to the copyright holder or the unit which grants the doctorate. “Far more interesting than problem solving is problem creation.” Chuck Close Table of content Acknowledgements Abbreviations List of papers included Introduction 4 5 6 7 Principles of signal transduction 7 Three large classes of the cell surface receptors 8 Ligand-gated ion channels 8 Enzyme coupled-receptors 9 G-protein receptors Protein kinases in signal transduction 10 12 The family of Protein Kinases C 13 Domains and their roles in PKC 14 The C1 and C2 domains 14 The pseudosubstrate motif 16 The PB1 domain 16 The Hinge region 17 The kinase domain 18 Activation of PKC 21 A-loop phosphorylation 22 Phosphorylation of the turn-motif 24 The atypical PKCs 26 The role of aPKC in polarization and maintenance of cellular polarity 27 Maintenance of cellular polarization through active exclusion 32 Atypical PKCs in embryology 34 The role of aPKC in very early embryogenesis 36 2 2 Present Investigations 39 Aims of the study 39 Synopsis of the papers 40 Discussion 42 The HINGE domain and its role in sub-cellular localization of aPKCs. 42 The nuclear shuttling of aPKCs is not exclusively regulated by the NLS 44 Nuclear functions of aPKCs 48 The role of atypical PKCs in early mouse development 50 Embryoid bodies as a model system for cavity formation 51 Further insights from alternative model systems for cavity formation53 aPKCɩ deficient embryos show impaired TJ proteins Expression of aPKCζ partially rescues the aPKCɩ phenotype Summary and future perspectives References Papers 3 3 54 57 59 60 87 Acknowledgements The present work was conducted at the Biotechnology Centre of Oslo, University of Oslo, 2008 - 2012 supported by the University of Oslo, Molecular Life Science (MLS) under the supervision of Michael Leitges. First and foremost a want to thank my supervisor Dr. Michael Leitges. During my time as a Ph.D student at The Biotechnology Centre of Oslo he has been more than my superior. He was a co-worker, a bouncing wall for ideas and most important, a motivator. I am very grateful for the time and the energy he spent on my project. His understanding of the field and his attitude towards science will always be an example for me As a researcher you can only be as good as the lab you are a part of. So if I am anything but excellent, thats my fault, since I had the pleasure of working with an exceptional technician, Uschi. Thank you for everything, Iwill miss the time we had in the lab. To Catherine, Sergio, Julian, Sandra and Philip: All of you made the work in the group interesting. Your stories and your personalities are outstanding. I am not sure whether I going to miss all of it, but I will for sure treasure you for the rest of my life. To my BiO colleagues: thank you for all the discussions, the retreats, christmas parties and tuesday seminars. You were my scientific community for all those years and you influenced my way of thinking whether you like it or not. I wish all of you the very best. To Ola, Jorunn, Gladys, Carlos, Ragni, Melaku, George, Jean and especially Liv. Thank you for keeping the Biotek running. You are very much appreciated. To Catherine and Judith Staerk. Thank you for your work on the manuscript an your much appreciated feedback. To my family. Words cannot describe what you mean to me. Thank you to my brothers Christian and Florian for endless support when needed and distractions when necessary. Mama and Papa, you have always been examples and cared more about your children than about yourselves. This thesis is as much yours as it is mine (but I understand it better). I love you all. To Victoria: thank you, for everything you were, you are and will be. 4 4 Abbreviations A-loop = activation loop NES = nuclear export sequence ADH = antidiuretic hormone NLS = nuclear localisation sequence AJ = adherens junction nPKC = novel Protein kinase C AJC = apical junctiona complex NRTK = non receptor tyrosine kinase AL = activation loop Par3/6 = partitioning defective 3/6 AMP=adenosin monophosphate PB1 = Phox and Bem1p AMPK = AMP activated kinase PIP2 = Phosphatidylinositol 4,5-bisphosphate AP = apico basal PKA = protein kinase A aPKC = atypical Protein Kinase C PKC = protein kinase C AR = androgen receptor PKD = protein kinase D BTC = Betacellulin protein PKG = protein kinase G C1 = cystein rich domain 1 PLC = phospho lipase C CAMK = Ca2+ dependent protein kinase PP1ɑ = protein phosphatase 1 alpha CHO = Chinese hamster ovary PTB = phosphotyrosine-binding domain CKI = cyclin dependent kinase RasGRP = RAS guanyl nucleotide-releasing protein cPKC = conventional Protein kinase C RGS = regulator of G-protein signaling DAG = diacylglycerol ROCK = Rho-associated protein kinase EGF = epidermal growth factor RTK = receptor tyrosine kinase EGFR = epidermal growth factor receptor SH2 = src homolog FRET = Fluorescence Resonance Energy Transfer TE = tropho-ectoderm GAP = GTPase Activating Protein TGFɑ = tumor growth factor alpha GDP = Guanosyl di-phosphate TJ = tight junction GPCR = G-protein coupled receptor TM = transmembrane GTP = Guanosyl tri-phosphate TNF = tumor necrosis factor HB = haemoglobin UFE = unfertilized egg hBVR = human biliverdin reductase V3 = variable region 3 HM = hydrophobic motif ZA = zonula adherens ICM = inner cell mass ZO = zonula occludens IP3 = inositol-tri-phosphate JAM = junctional adhesion molecule LGL = Lethal giant larvea LIP = lambda interacting protein mTOR = mammalian target of rapamycin mTORC = mTOR-complex 5 5 List of papers included Paper I Functional comparison of protein domains within aPKCs involved in nucleocytoplasmic shuttling Sebastian Seidl, Ursula B. Braun and Michael Leitges* May 15, 2012 Biology Open 1, 436-445. doi: 10.1242/ bio.2012505 Paper II Manuscript (under review) Phenotypical analysis of atypical PKCs in vivo function display a compensatory system at embryonic stage 7.5 p.c. Sebastian Seidl, Ursula Braun, Norbert Roos, Shaohua Li, Andreas Kispert* and Michael Leitges* 6 6 Introduction Principles of signal transduction Communication and interaction between cells is probably older than any multicellular organism, since already yeast as a single cell organism have been shown to influence another cell by secreting a signaling molecule. Mating yeast secret a ‘mating factor’ that causes other yeast to stop proliferating and instead to prepare for mating (Marsh, Neiman, & Herskowitz, 1991), showing that communication between cells is crucial to control critical cellular responses. In multi-cellular organisms, cells developed many different mechanisms to specifically interact and/or manipulate each other. The more complex an organism the more crucial it becomes to restrict and specify signals to prevent unwanted crosstalk between cells. The easiest and simplest way of communication is through direct interaction of two or more cells. In case of contact dependent signaling, the molecule, also called ligand, is presented on the cell membrane by the neighboring cell. The receiving cell presents a receptor on the membrane that specifically recognizes and binds one or more signaling molecule. Contact-dependent ligand-receptor binding is the main form of communication between cells during development and in immune response and represents an extremely specific and local event that requires physical contact between the effector and the receiving cell. In higher organisms signals often have to be sent over long distances. Cells therefore started to secret soluble signaling molecule instead of presenting the signaling molecules on the membrane. The advantage of this system is that numerous distant cells can be reached by the secreted molecules but the effect can also be a local event and can be limited to a single organ or to events such as infection or injury. The secretion of a signaling molecule by a single cell or a group of cells to activate, modulate or recruit the same cell is called autocrine signaling, whereas secretion of a molecule by a single cell to regulate different adjacent cells is called paracrine signaling. During autocrine signaling the hormone produced by one cell binds to receptors on the same cell and modulates its cell response. During paracrine signaling the signaling molecule is secreted by one cell and affects a different cell nearby. To regulate cell responses further away higher organisms have developed endocrine signaling which is mediated by hormones that are released into the blood stream and can affect the whole body or control certain tissues and organs. The endocrine system ensures that an organism can react to an event with a systemic response, such as hormone release into 7 7 the blood, which in turn can have different local effects. A signaling molecule involved in paracrine and endocrine signaling is for example vasopressin. Vasopressin, also known as ADH, is mainly synthesized in a region of the brain called hypothalamus where it acts as a neurotransmitter and seems to play an important role in memory and diseases such as Schizophrenia and Autism (Frank & Landgraf, 2008). Moreover, when secreted into the blood, e.g. after osmotic stress, it acts as a peptide hormone and mediates diverse biological effects depending on the interacting receptor. The vasopressin receptors V1a, b (V1R) and V2 (V2R) are found on the surface a variety of tissue including vascular smooth muscle, kidney, liver and spleen. In the kidney vasopressin acts by the V2R and regulates the water balance of the organism (Zingg, 1996). The V2R is exclusively expressed in the collecting ducts of the organ (Mutig et al., 2007) and this signaling cascade is a good example illustrating how a systemic signal can control local biological processes. In summary, all types of communication are based on the same principle: a specific ligandreceptor interaction. Most receptors are membrane bound and highly specific for one group of ligand or even for one kind of signaling molecule. Whether a cell is affected by a certain hormone or molecule is therefore dependent on the cell-surface receptors presented on the membrane. Three large classes of the cell surface receptors As mentioned above, all signaling molecules bind to specific receptors presented on the surface of the target cell. The binding of the ligand to its corresponding receptor induces a process that is called signal transduction. Signal transduction describes the translation of an extracellular event into an intracellular signal or signaling cascade, which further influences cellular processes such as proliferation, migration and apoptosis. Nearly all cellsurface receptors belong to one of the main three classes, which are classified by their mode of signal transduction after activation of the receptor and explained in more detail below. Ligand-gated ion channels The ligand-gated ion channel superfamily contains numerous homologous receptor proteins that consist of an extracellular binding domain and transmembrane domains. Each receptor exists as a multi-subunit structure such as trimeric complexes (P2X receptors), tetrameric complexes (NMDA, AMPA receptors) and pentameric complexes (nicotinic acetylcholine receptor (nAChR)). The nAChR is a particularly well studied example. nAChR belongs to the group of pentameric receptors and is most abundant on 8 8 the surface of neural cells. Upon binding of nicotine the internal receptor conformation changes from closed to open. Each subunit binds two nicotine molecules to fully open the pore, which subsequently allows Na+ ions to travel along their electrochemical gradient. As a consequence, the cell membrane depolarizes and an action potential is initiated (Brejc et al., 2001). Besides the family of nACh receptors there are several others, such as glutamate receptors, ATP-gated channels and cAMP-gated channels. All ligand gated ion channels share the same mechanism. Binding of the ligand induces a conformational switch from either ‘open to close’ or ‘close to open’ and changes the permeability of the membrane to the corresponding molecule or ion triggering intracellular process (reviewed in Collingridge, Olsen, Peters, & Spedding, 2009). Enzyme coupled-receptors The second main group of cell-surface receptors is the superfamily of enzyme-coupled receptors, also referred to as catalytic receptors. These receptors are transmembrane proteins that consist of an extracellular domain that recognizes and binds the signaling molecule, an intracellular domain that activates downstream signaling and a transmembrane helix that anchors the receptor in the membrane. Three groups of enzymatic coupled-receptors are known: i) Receptor serine-threonine kinases, ii)Receptor tyrosine kinases (RTK), and iii)Tyrosine-kinase associated receptors (cytokine receptors) RTK exist as heterodimers when bound with a signaling molecule and perform tyrosine phosphorylation on themselves (autophosphorylation) and each other (crossphosphorylation). Every subfamily of enzyme-coupled receptors contains several isoforms that form a homo- and heterodimer with specific ligand-binding properties. For example, the family of EGFR/ErbB receptors consists of four protein isoforms: EGFR (ErbB1, Her1), ErbB2 (Her2, Neu), ErbB3 (Her3) and ErbB4 (Her4). It has been shown that all isoforms can form homo- or heterodimers with each other and that each combination has a specific ligand affinity with multiple possible ligands (reviewed in Harris, Chung, & Coffey, 2003). Dimerization of the receptor occurs in the endoplasmic reticulum (ER) and not as earlier expected on the cell membrane (Tao & Maruyama, 2008). Depending on the cell type the heterodimer composition is different and not necessarily influenced by extrinsic factors (Zaczek, Brandt, & Bielawski, 2005). Depending on the heterodimer composition the 9 9 receptors are able to bind several ligands including EGF, TGFɑ, AR, HB-EGF, BTC, EPR and EPIGEN. Upon ligand binding tyrosine residues in the C-terminal tail become phosphorylated. These so-called Src-Homology 2 (SH2) domains and Phosphotyrosinebinding domains (PTBs), act as docking sites for other signaling proteins. Receptor activation ultimately leads to activation of downstream signaling pathways including mitogen activated protein kinase (MAPK), phospholipase Cɣ (PLCɣ) and phosphatidylinositol-3 kinase (PI3K), which then further modulates cellular functions. Once a receptor is activated and active the cell has to deal with the problem of restricting and regulating the receptor and its effects. Enzyme-coupled receptor activity is regulated by internalization and subsequently undergoes degradation and/or recycling, depending on the ligand. For example, the binding of EGF to the corresponding receptor is very strong and remains even in the endosome. Even after internalization of the receptor ligand complex the persisting binding of EGF causes continuous ubiquitination of the EGFR in the endosome and the ubiquinated protein is then further transported to the lysosomes where it undergoes degradation (Madshus & Stang,2009). In contrast, binding of TGFɑ to the receptor is much weaker and pH dependent. The changed pH in the endosome causes disassociation of the ligand from the receptor and prevents prolonged ubiquitination of the EGFR which in turn is recycled and not degraded. The specific effects of the several different ligands on the regulation of EGFR have been investigated in detailed by Roepstorff and colleagues (Roepstorff et al., 2009). G-protein receptors G-protein coupled receptors (GPCRs) represent the largest family of membrane proteins in the human genome. As indicated by the name, these receptors interact with or are coupled to trimeric G-proteins on the cytoplasmic side of the membrane. Despite their classification it has recently been shown in plants that these receptor types can signal through G-protein independent pathways (J. G. Chen, 2004). All GPCRs share a common structure of seven transmembrane (TM) segments with an extracellular amino terminus and an intracellular carboxyl terminus. The greatest homology among the family members is found in the TM segments, while the greatest diversity is found in the amino terminus and varies depending on the corresponding interacting signaling molecule. In spite of the diversity of ligands there seems to be a general mechanism of activation. All GPCR family members transduce external signaling information into an intracellular event by interacting and activating members of the family of heterotrimeric G-proteins. 10 10 Heterotrimeric G-proteins are crucial for regulation of signaling events within the cell. These proteins turn on intracellular signaling cascades in response to extracellular stimuli and are key components in the regulation of several cellular responses including cell proliferation, migration and survival. Heterotrimeric G-proteins are composed of three different subunits ɑ, β and ɣ. Due to their ability to switch between a GTP-bound conformation and a GDP-bound conformation they are often called ‘molecular switches’. In the GDP-bound conformation G-proteins are primed to bind the receptor while the GTPbound conformation modulates downstream effectors. In humans, 21 Gɑ subunits (encoded by 16 genes), 6 Gβ subunits (encoded by 5 genes) and 12 Gɣ subunits have been identified so far. The heterotrimers are classified into four main groups based on their sequence homology of the Gɑ subunits: Gɑs, Gɑi, Gɑq and Gɑ12. The interaction between G-proteins and GPCRs involves several regions that contribute to the interaction surface of the complex. Even though GPCRs are able to activate several G-proteins they do not interact with all G-proteins. Furthermore, each member of the G-protein family interacts with many different receptors. The exact mechanism of how specificity of those interactions is achieved remains unknown. Upon activation of the heterotrimeric G-proteins by a stimulated receptor, the ɑ-subunit releases the bound GDP and exchanges it for the energetically higher GTP. Subsequent conformational changes of the ɑ-subunit lead to disassociation of the βɣ-complex, resulting in two active signaling components. The separation of the complex activates downstream effectors, such as adenylyl cyclase, guanylyl cyclase, phospholipase C and others. The activity and target specificity are usually regulated by special proteins, also known as regulator of G-protein signaling (RGSs). The RGS-protein family consists of at least 25 members in humans of which all contain the RGS-domain that binds to the ɑsubunit. There are three main mechanisms by which RGS-proteins regulate the activity of the ɑ-subunit: 1. RGS-proteins act as a GTPase activating protein (GAP) accelerating the hydrolysis of GTP to GDP and therefore the reassembling of the trimeric complex. 2. RGS-proteins act as effector-antagonists that prevent binding of the G-protein to its actual effector. 3. RGS-proteins accelerate the reformation of the trimeric complex by increasing the affinity of the ɑ-subunit to the βɣ-complex. The spatial and temporal regulation of G-proteins is crucial for a coordinated signaling cascade. While the temporal regulation is mainly mediated by RGS-proteins, spatial 11 11 regulation is achieved by covalently attached lipid molecules that bind and thereby restrict the protein to the plasma membrane. Activation of G proteins then lead to activation and release of second messengers and activation of protein kinases. Protein kinases often work as signaling hubs getting input from different sources and regulating important cellular processes through a complex network. Protein kinases in signal transduction The human kinome includes a total of 518 kinases organized in eight superfamilies. Six superfamilies belong to the class of serine/threonine kinases, including STE-, CKI-, AGC-, CAMK-, CMGC- and RGC protein family. There are two classes of tyrosine kinases including a total of 133 proteins (Manning, Whyte, Martinez, Hunter, & Sudarsanam, 2002). Receptor tyrosine kinases (RTKs) are transmembrane proteins with an extracellular substrate binding domain and an intracellular kinase domain that phosphorylates the target protein. Receptor tyrosine kinases do not act as second messenger and possess enzymatic activity that is induced upon ligand binding. The second group is the class of non-receptor tyrosine kinases (NRTKs). These proteins are cytoplasmic molecules that are not directly activated by extracellular signals. Instead, activation of NRTKs is mediated by RTKs or other cell surface receptors such as G protein-coupled receptors. The family of NRTKs is divided in subfamilies based on sequence homology and includes Src-, Abl- and Jak kinases. The largest subfamily of NRTKs, with nine members, is the Src kinase family. Src proteins are involved in signaling processes including mitogenesis, T- and B-cell activation and cell structure. Src kinase has originally been isolated from cancer cells and has been implicated in several human carcinomas, including breast, lung and colon cancer (Biscardi, Tice, & Parsons, 1999).The remainder of human kinases is specific for the phosphorylation of serine/threonine residues and consists of at least 385 proteins organized in six major groups, 82 families and 135 subfamilies (Manning et al., 2002). Serine/threonine kinases are involved in the regulation of every aspect of cellular life and proteins and are often essential for survival of the organism. In the following the focus lies on the family of protein kinase C (PKCs). PKCs are a group of diverse kinases activated by the second messengers DAG and Ca2+. In general, DAG is thought to be responsible for membrane recruitment of the protein kinase, where it binds to Ca2+ and phosphatidylserine. Activated PKCs interact with numerous targets and are involved in many cellular processes. 12 12 The family of Protein Kinases C The Protein kinase C (PKC) multigene family consists of 11 serine/threonine kinases that play a crucial role in growth factor signal transduction and are involved in various cellular events including cell proliferation, differentiation and cell death. As members of the so called AGC family ( named after PKA, PKG and PKC families) they share common features. All PKCs contain a catalytic domain that is highly conserved among serine/ threonine kinases and a variable N-terminal regulatory domain that maintains the enzyme in an inactive conformation and regulates protein-protein interactions. The PKC family is further divided into three subfamilies depending on their modus of activation, which in part is a consequence of the domain composition of the regulatory domain. The conventional PKCs (ɑ, γ, and the alternatively spliced βΙ and βII) require diacylglycerol (DAG), phosphatidylserine (PS), and calcium for activation. Novel PKCs (δ, ε, η/λ, θ) are activated by DAG and PS but are insensitive to calcium. The atypical protein kinase C (aPKC) subfamily is composed of two members (ζ and ι/λ) with PKCɩ being the human homolog of mouse PKCƛ. The two atypical isoforms are highly related with an amino acid sequence homology of 72%. The two isoforms share an almost identical kinase domain with all members of the PKC family. In contrast, the regulatory domain lacks some features compared to the other subfamilies and contains only one cysteine rich C1 domain, a pseudo-substrate motif and a PB1 domain. Thus, aPKCs only require PS but neither DAG nor calcium to acquire full activity. PKC activation is mediated by G-protein coupled receptors and therefore connected to a variety of signaling molecules. The lipid-sensitive enzymes are activated through growth factor induced activation of phospholipase C (PLC). Activated PLC hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2) to generate diacylglycerol (DAG) and inositol triphosphate (IP3), which induces an increase of intracellular calcium (CA2+). DAG and increased calcium levels then activate most PKC isoforms. In the inactive conformation the pseudosubstrate (PS) occupies the ATP-binding site and prevents substrate-binding of the enzyme. Interaction and binding of cofactors change the conformation and release the PS from the ATP-binding site, making it available for catalysis. Even though PKCs are ubiquitously expressed, the expression pattern of the different PKC isoforms is tissue specific, e.g. PKCθ is expressed primarily in skeletal muscle, lymphoid organs and hematopoietic cells, while PKC gamma is expressed in neurons. Generally, multiple members of the PKC family are found in the same cell. 13 13 Domains and their roles in PKC The domain composition of the N-terminus is very heterogenous among different members of the PKC family. When first discovered by coworkers of Nishizuka at the Kobe University in 1977 it was thought to be a new type of an unregulated kinase. It turned out that they isolated only the catalytic domain, since the isolation procedure fragmented the protein (Inoue, Kishimoto, Takai, & Nishizuka, 1977; Takai, Kishimoto, Inoue, & Nishizuka, 1977). It was obvious from the time of its discovery, that any kind of regulation and specificity is modulated by the N-terminal regulatory domain. To understand the mechanism behind the regulation of PKC it is important to know the function of the components of the system, or in this particular case, the individual domains. Each domain has an intrinsic function that is under certain circumstances executed or inhibited. The sheer existence of the same domain in two different proteins does not necessarily mean that they have exactly the same function. The C1 and C2 domains The C1 domains are cysteine-rich, 50-51 amino acids long motifs. They were originally identified as binding sites for DAG and phorbol esters in PKC, but have been found in multiple signaling families, including PKDs, chimaerins, RasGRPs, diacylglycerol kinases (DGKs) and others. All domains contain a conserved motif: H-x12-C-x2-C-x13/14- C-X2-C-X4H-x2- C-x7-C (H-histidine; C=cystidine; x=any AA). In cPKCs and nPKCs the C1 domain exists as a tandem motif, C1A and C1B. This motif is responsible for DAG binding through 14 14 2 zinc ions controlled by the C1 domain. Due to the ability to bind DAG as an important second messenger or its analog phorbol esters it is also known as phorbol esters/DAG binding domain. In aPKCs only one C1 domain is present and PKCɩ/ƛ and ζ are DAG and phorbol ester insensitive. Whether this insensitivity is due to the lack of one motif or caused by intrinsic differences is still debated. Although all DAG/phorbol esters responsive PKC contain a twin cysteine-rich motif it has been show that single C1 domains possess all the requirements for binding of phorbol esters (Quest & Bell, 1994). Interestingly, despite their different affinities to DAG under normal conditions c/nPKCs display the same affinity for the ligand when forced into a 2D structure (Kazanietz et al., 1993). This indicates that the C1 domains have either unique intrinsic structural characteristics or are regulated by the overall conformation of the PKCs. However, it is clear that aPKCs are DAG and phorbol ester insensitive no matter whether this is due to the ‘atypical C1’ (Colón-González & Kazanietz, 2006) domain or not. The C2 domain consists of 130 amino acid residues and was first identified in activated PKCs. The fact that cPKCs, in contrast to nPKCs, are regulated by calcium suggests that the C2 domain acts as a calcium-binding motif (Kikkawa, Kishimoto, & Nishizuka, 1989). Further studies confirmed that the C2 domain binds anionic phospholipids in a calcium dependent manner. The binding of calcium is thought to be the initiating step in cPKC activation. Upon calcium binding PKCs transiently translocate to the membrane. DAG, the membrane bound co-activator of PKCs is then able to interact with the C1 domain. Subsequent binding of PIP2 and PS facilitates the release of the autoinhibitory pseudosubstrate sequence allowing substrate phosphorylation (Evans, Murray, Leslie, & Falke, 2006; Sánchez-Bautista, Marín-Vicente, Gómez-Fernández, & Corbalán-García, 2006). Novel PKCs also contain a C2 domain, although the order of those two is switched relative to the cPKCs. Novel PKCs were originally thought to lack the C2 domain, but phylogenetic studies identified a conserved C2 domain (Sossin & Schwartz, 1993). Defining nPKC, the C2 domain lacks the ability to bind calcium, resulting in a DAG dependent, but calcium independent protein activation. The atypical PKCs lack a C2 domain and are Ca2+ insensitive. 15 15 The pseudosubstrate motif The pseudosubstrate domain is a conserved motif present in the regulatory domain of all PKC isoforms but is differently located within the protein. Originally identified by Kemp and coworkers, the sequence resembles that of a PKC substrate except that an alanine occupies the phospho-acceptor position (House & Kemp, 1987). When PKC is inactivated, the pseudosubstrate domain covers the ATP binding pocket of the otherwise active catalytic domain. This theory was supported by the fact that an antibody against the pseudosubstrate sequence is able to fully activate the enzyme in the absence of cofactors (MAKOWSKE & ROSEN, 1989) The PB1 domain An exclusive feature of the atypical PKCs are the N-terminal PB1 (Phox and Bem1) domains. The PB1 domains consist of about 80 amino acid residues, mediate highly specific protein-protein interactions and are conserved in a variety of species ranging from plants to mammals. The PB1 domains are grouped into three types, type I, type II and typeI/II. Type I, also known as PC-motif (Phox and Cdc42) (Nakamura et al., 1998) is 28 amino acids long with four highly conserved acidic residues with the sequence Asp-X(Asp/Glu)-Gly-Asp-X8-(Glu/Asp). This motif is also known as OPR (octicosapeptide repat) or AID (atypical PKC interaction domain) and is therefore generally named OPCA (OPR, PC, AID).The type II variant of the PB1 domains is characterized by an invariant lysine residue on the first beta strand. PB1 domains are highly specific for PB1-PB1 interaction and by now at least 13 PB1 containing proteins have been identified in humans, containing either type I, type II or both motifs. The protein-protein interactions are a result of heterodimeric assembly between type I and type II PB1 domains in a front-to-back manner. In this also called canonical PB1 dimerization the acidic residues on the OPCA motif form salt bridges with basic residues of the type II domain. The aPKC PB1 domain is a typeI/II domain and has been shown to mediate interaction with several proteins, such as p62, par6 and Mek5 (Hirano, 2004a). In the case of the interaction between PKCɩ/ƛ and Par6ɑ, two residues of the Par6ɑ, Arg28 and Arg89 (on strand β2, respectively β5) assist the salt bridge formation. In addition a conserved acidic residue, Glu76, forms another salt bridge with Arg27 on strand β2 of Par6ɑ. The specificity of the hetero-dimerization is increased by an interaction of the ɑ2 helix of PKCɩ/ƛ with the Par6ɑ PB1 domain (Hirano, 2004b; Wilson, Gill, Perisic, Quinn, & Williams, 2003). Generally, type II domains are able 16 16 to interact with all types of PB1 domains and have the potential to mediate homooligomerization. Even though this has not yet been reported for aPKCs, p62 another typeI/ II containing protein is also capable of homologous binding (Bjorkoy, 2005). p62, also known as sequestosome1 (SQSTM1) has also been shown to interact with both aPKCs (S. Ohno, 2001; Puls, Schmidt, Grawe, & Stabel, 1997). However, p62 is not a substrate and has no significant effect on the kinase activity of the protein. Therefore it is likely that p62 acts as a scaffold protein to restrict and direct the actions of aPKCs. Taking the nature of PB1-Pb1 interaction it is likely that over time more interactions will be identified and in the case of aPKCs more studies are necessary to fully understand the function and regulation of the different PB1 interactions. The Hinge region The Hinge domain, also called variable region 3 (V3), is approx. 60 amino acid residues long and is located between the regulatory domain and the catalytic domain. This structure shows very little homology among the PKCs and was originally thought to have no particular function at all. Anyhow, some PKC isoforms including PKCδ, -ε, -θ and -ζ have been shown to be a target of proteolytic cleavage with a primary cleavage-site exclusively in the hinge region. PKCε possess in total 3 cleavages sites of which the primary site for function is located in the hinge region. TNF-induced Caspase 7 mediated cleavage of PKCε results in an active kinase fragment with an anti-apoptotic function (Basu, 2002). PKCζ on the other hand contains two cleavage-sites, both within the hinge region. In contrast to PKCε, the cleavage of PKCζ is mediated by several caspases, including caspase-8, -3, -6, and-7 (L. Smith, 2000). The product of the cleavage, an active kinase fragment, is linked to the apoptosis pathway and as with PKCε, is linked to an antiapoptotic function (Berra et al., 1997; Frutos, Moscat, & Diaz-Meco, 1999). In nitric oxideinduced apoptosis the catalytic activity of the separated kinase domain is inhibited before the cleavage of the protein occurs. It has been shown that nitric oxide induces interaction of aPKCζ with the p38 kinase. This interaction leads to an inhibition of autophosphorylation at T560 and inactivation of the kinase domain (J.-S. Kim, Park, Yoo, Yu, & Chun, 2005). This was discovered because earlier inhibition of caspase-3 in articular chondrocytes did not rescue the inhibition of aPKCζ, although cleavage of the protein was significantly reduced (S.-J. Kim et al., 2002). Interestingly, treatment of chondrocytes with nitric oxide caused an enrichment of certain phospo-peptides identified through MS/MS analysis. The MS/MS spectra showed two phospho peptides which are located in the Hinge region of 17 17 aPKCζ, indicating that phosphorylation of serine residues in the aPKCζ Hinge region might play a role in p38 mediated inhibition of aPKCζ (J.-S. Kim et al., 2005). However, the cleavage of PKCs does not always result in fragment with anti-apoptotic properties. It has been shown, that the cleavage of PKCδ and PKCθ induces or promotes apoptosis in the corresponding tissue (R. Datta, 1997; Kato et al., 2009). In summary, an high number of publications described unique properties of the hinge region and given its location in the center of the protein and the vast heterogeneity of the sequence it is likely that more functions will be identified in the future. One theory is that PKCs with a cleavage site become most vulnerable not having co-activators. The inactive conformation could leave the Hinge region exposed and therefor more accessible to caspase-mediated cleavage. To completely understand the role of the Hinge region in PKC more studies are necessary and most definitely require the full solution structure of the full-length proteins. The kinase domain The C-terminal catalytic domain of PKCs consists of approx. 350 amino acid residues and is highly conserved in all three subfamilies of PKC. The overall structure of this domain shows high homology with members of the PKA, PKB/AKT families and PDK1. The tertiary structure of the domain consists of a small N-terminal lobe, a large C-terminal lobe and a hinge linker region. Considering the relative position of the lobes, the conformation of the catalytic domain can be classified as either ‘open’ or ‘closed’. Recruitment of ATP happens during the ‘open’ conformation, while transferring the y-phosphate onto its substrate happens in ‘closed’ conformation (Johnson, Akamine, Radzio-Andzelm, Madhusudan, & Taylor, 2001). The switch between those two states is tightly regulated and involves phosphorylation of a specific motif of the catalytic domain. The catalytic domain has several conserved motifs, present in all members of the AGC kinase family: 1. The ATPbinding site is located at the interface of both lobes. ATP is usually bound by its nontransferable phosphate by a motif that contains 3 glycine residues and acts as a kind of clamp. This motif is highly conserved among 95% of all kinases (Hanks & Hunter, 1995). However, in aPKCs the phosphate-binding site differs from that of other family members. The N-terminal lobe of cPKCs and nPKCs contains the ATP binding loop with the conserved consensus sequence GXGXXG, whereas in aPKC the last glycine residue is substituted by an alanine. Thus, it adapts an open conformation and implies a different binding mechanism compared to other PKCs. 2. The activation loop (AL) stretches from residue 387 to 414. It is usually in a phosphorylated state and interacts with two residues, 18 18 Lys392 and Arg368. This interaction is necessary for catalytic activity. 3. The hydrophobic motif (HM) of the C-terminus is conserved and interacts with the hydrophobic groove of the N-lobe. The C-terminal tail of the catalytic domain is less conserved among the AGC kinases and therefore shows a high sequence variation. However, in PKCi the C-terminal tail, also called V5 domain, contains a clearly defined phosphorylation site (Thr555) of the turn motif (Messerschmidt et al., 2005). Both, the activation loop and the V5 region play a crucial role in the structure of the catalytic pocket and are common targets for phosphorylation. Phosphorylation is thought to be crucial for activation of PKC, even though this theory has been partly challenged by recent publications (Graybill, Wee, Atwood, & Prehoda, 2012). However, to achieve full kinase activity all three phosphorylation sites need to be modified. This maturation of the protein happens per se post-translational in cells and is mediated by other kinases such as PDK1 (Le Good, 1998), Src (Rybin, Guo, Gertsberg, Elouardighi, & Steinberg, 2007) and mTORC2 (Ikenoue, Inoki, Yang, Zhou, & Guan, 2008). Many of the phosphorylation events activate the kinase and are also important for interactions with other proteins. PKCδ, PKCɩ/ƛ and PKCζ contain a Nuclear Export Sequence (NES; L-x1/2-L-x2-F-x-L/I) in the beginning of the catalytic domain. This motif has been shown to interact with CRM1/exportin1 to facilitate nuclear export of PKCɩ (Perander, 2000). Interestingly, the corresponding NLS in PKCɩ requires phosphorylation by Src at T256 in PC12 cells to become exposed and is relevant for the localization of the protein (White, Seibenhener, & Wooten, 2002). Another well-established binding partner, Par3, binds through a 28 amino acid motif to the catalytic domain of aPKC, called the aPKC binding motif. Two serine residues within the motif act as substrates and phosphorylation of these residues leads to disassociation of the complex (Wang, Shang, Yu, & Zhang, 2012). Kibra (kidney and brain protein), a WW domain containing protein and human ribunucleoprotein 1 (hnRNP A1) exclusively interact with activated aPKCs or with truncated proteins containing only the catalytic domain. This indicates that the tertiary structure of the protein strongly regulates the interactions of the catalytic domain. Noteworthy: The sequence connecting the two lobes contains a so-called “gatekeeper” residue that controls ATP binding and access to the binding pocket. This gatekeeper residue is usually a large hydrophobic residue and is often mutated to create a kinase that is able to facilitate unnatural ATP analogs (Allen et al., 2007). This mutation is a highly specific tool for identification of substrates in vivo. Conveniently, the mutated kinase is able 19 19 to facilitate normal ATP besides the unnatural analog. If applied to aPKCs this would be an excellent tool to identify common and specific substrates of both aPKCs in comparison. 20 20 Activation of PKC Traditionally PKCs were seen as generic enzymes that are anchored to the membrane during their activated state and that achieve target specificity by close localization to their substrates. However, the notion that PKCs become activated mainly through translocation events has recently been challenged. It appears that the phosphorylation status of the serine/threonine residues of the enzymes affect stability, function, activity and proteinprotein interactions. Cleavage of PKC releases a free kinase domain that either can act as an inhibitory molecule or as an activator of the full-length protein. PKC can also be activated by more traditional lipid cofactors, such as ceramide or arachidonic acid enabling PKC to signal throughout the cell, not limited to DAG containing membranes. These alternative regulation mechanisms were only recently published and additional studies are necessary to fully understand these mechanisms. As a rule of thumb inactive PKC is localized in the cytoplasma. Upon activation, PKC translocates to the membrane, where it phosphorylates target proteins. In order to activate PKC a series of phosphorylation events are necessary, which lead to a conformational change and allow the protein to interact with the cell membrane. Further release of the pseudosubstrate results in a fully activated protein. Studies involving mutational analysis of predicted phosphorylation sites and mass spectrometry revealed three key phosphorylation sites for the activity of the protein within the C-terminus of PKC. These sites are known as the activation loop (AL), the turn-motif (TM) and the hydrophobic-motif (HM). Interestingly, while all three sites are conserved in the cPKC and nPKC, the atypical PKC lack the hydrophobic motif and harbor a negatively charged glutamic acid (Freeley, Kelleher, & Long, 2011). Whether this site mimics a constitutively phosphorylated state or not, remains unknown. 21 21 A-loop phosphorylation For most of the PKC isoforms, a phosphorylated A-loop is crucial for catalysis, since mutation of the residue to a non-phophorylatable residue abolishes activity. Furthermore, in some PKC the A-loop seems to contribute to the stabilization of the active conformation by forming ionic contacts with positively charged residues of the kinase domain (Grodsky et al., 2006; Messerschmidt et al., 2005). Some PKC possess a cleavage site in the HINGE region of the protein. When cleaved, an isolated but functional catalytic domain is released. As known so far, only PKCδ, PKCθ, PKCε, and PKCζ undergo caspasedependent cleavage in response to a range of apoptogenic stimuli. In this context the Aloop is generally required for catalytic activity (L. Smith, 2002). The main role in A-loop phosphorylation is played by the enzyme PhosphoinositideDependent Protein Kinase-1 (PDK-1). PDK-1 has been known to phosphorylates the Aloop of many protein kinase families besides PKC, such as PKB/Akt. PDK-1 has been shown to phosphorylate cPKC, nPKC and aPKCs in vitro and in cell lines when overexpressed (Le Good, 1998). Cells that lack PDK-1 have significantly reduced levels of PKC ɑ, ΒII, ɣ and ε (McManus, Balendran). In contrast, the PKC ζ isoform was reported to be stable in PDK-1 negative ES cells (McManus, Balendran). Very little is known about the interaction modi of PDK-1 and PKCs. Initially it was thought, that the PH domain of PDK-1 is a key player in mediating that interaction, however, it has been shown, that in cells overexpressing a PH deficient PKD-1 mutant instead of the wild-type protein, A-loop phosphorylation of PKCs appears to be normal, indicating another mechanism (McManus et al., 2004; Waugh, Sinclair, Finlay, Bayascas, & Cantrell, 2009). Besides the evidence that PDK-1 is the A-loop kinase of PKC in various cell types, there is proof of PKD-1 independent A-loop phosphorylation. PKC δ A-loop phosphorylation was detected in ES cells and thymocytes lacking PDK-1(Balendran et al., 2000; McManus et 22 22 al., 2004). In cardiomyocytes, PKC δ triggers autophosphorylation on the A-loop after being phosphorylated by Src kinases at the hinge domain (Rybin et al., 2007; Sumandea et al., 2008). Together these studies imply a PKD-1 independent A-loop phosphorylation or autophosphorylation of the protein. Other kinases than PDK-1 have been implicated to play a role in A-loop phosphorylation of PKCs. Human biliverdin reductase (hBVR) may be involved in A-loop phosphorylation of PKCβII (Maines, Miralem, Lerner-Marmarosh, Shen, & Gibbs, 2007) and 5’-AMP-activated protein kinase (AMPK) has been shown to directly phosphorylate the A-loop of PKCζ during hypoxia (Gusarova et al., 2009). 23 23 Phosphorylation of the turn-motif The turn motif (TM) is highly conserved among all PKCs. The TM is located in the C4 domain on the so-called C-terminal tail of the enzyme. The role of the TM is diverse and incompletely understood. Phosphorylation of the TM enables interaction between the motif and residues in the enzyme to help stabilizing the enzyme (Grodsky et al., 2006; Hauge et al., 2007; Messerschmidt et al., 2005). In the two PKCβI and βII isoforms this phosphorylation is required for catalytic activity (Edwards, Faux, Scott, & Newton, 1999), while for PKCɑ, θ and ɩ it is dispensable (Bornancin & Parker, 1997; Hauge et al., 2007; Liu, Graham, Li, Fisher, & Shaw, 2002). In the case of PKCδ and ζ the results have been conflicting. After all it seems that the conformational and structural differences of the PKCs are in fact the cause for their different requirements for TM phosphorylation (Edwards et al., 1999). Anyhow, the differences reported for PKC δ and ζ indicate a more complex activation mechanism in which the phosphorylation requirement depends not only on interactions but also on the expressing tissue and environment. In PKCα, mutation of the TM site has no effect on its catalytic function, but the mutant was more sensitive to thermal instability, oxidation, proteolysis and overall dephosphorylation (Bornancin & Parker, 1997). In addition, the TM site seems to play a role in other aspects of PKCs. For example, the catalytic activity of PKCϴ is independent of the TM site. Since the TM mutant demonstrates an enhanced ability to activate the NF𝜅B pathway in T lymphocytes (Liu et al., 2002). Initially the TM site was described as autophosphorylation site, but recent data demonstrated that the mammalian target of Rapamycin (mTOR) is involved in the regulation TM phosphorylation. mTOR is a serine/threonine protein kinase and belongs to the phosphatydil-inositol 3-kinase-related kinase protein family. The protein forms multiprotein complexes, mTORC1 and mTORC2, and is involved in the regulation of cell growth, -proliferation, -motility and -survival. mTORC2 is in contrast to mTORC1 insensitive to rapid rapamycin treatment and has been implicated in TM phosphorylation of the PKC isoforms α, βI, βII, ɣ and ε (Facchinetti et al., 2008; Ikenoue et al., 2008). The effect of mTORC2 on these PKCs appears to be indirect and needs further investigation.Hydrophobic-motif phosphorylation The hydrophobic-motif (HM) is a conserved motif present in cPKC and nPKC, but is absent in aPKCs. In the case of aPKCɩ, the negatively charged glutamic acid residue positioned within the motif seems to perform similar functions (Messerschmidt et al., 2005). It has been shown that similar to the TM phosphorylation, HM phosphorylation 24 24 regulates catalytic activity of the enzyme as well as stability and function. In PKCɑ, phosphorylation of the HM protects the protein from phosphatasesand prevents its inactivation. Studies on its influence on the catalytic activity seem however highly dependent on the isoform. Mutation of the HM has no effect on PKCβII activity (Edwards & Newton, 1997), but induces a 5-fold reduction of PKC ϴ activity (Liu et al., 2002), whereas in PKC δ it increases activity (Karmacharya, Jang, Lee, Lee, & Soh, 2010). The present studies highlight the varying roles of these phosphorylation sites on the functions of PKCs and it is difficult to explain how one isoform is affected while another is not. Contradicting results may be explained by the use of different cell-lines. Depending on the cellular context the set of binding partners might vary and thereby change the behavior of the proteins. 25 25 The atypical PKCs Atypical protein kinase C isoforms PKCiota and aPKCζ define a subclass of the PKC family and are functionally and structurally distinct from other PKCs. In contrast to other PKCs the catalytic activity of atypical PKC is not dependent on calcium or phosphatidylserine. This is due to a unique composition of the N-terminal regulatory domain that lacks the corresponding binding motifs. Instead, aPKC activity can be regulated by 3-phosphoinositides, phosphorylation by PDK1 and through protein-protein interactions with Par-6 (Graybill et al., 2012). As a result of a screening to identify PKC isoforms in the rat brain aPKCζ was the first isoform to be identified, cloned and analyzed (Ono et al., 1989). Due to the insensitivity of the protein to Ca2+ and phorbol esters it became the first member of the atypical PKC family. The mouse ortholog of aPKCζ shows a 99% amino acid homology and is located on chromosome 4 (Goodnight, Kazanietz, Blumberg, Mushinski, & Mischak, 1992).The second member of atypical PKCs was identified during an attempt to identify the aPKCζ isoform in a mouse P19 embryonal carcinoma cell line (Akimoto et al., 1994). The murine protein was named PKClambda, based on its 72% sequence homology to aPKCζ. Around the same time a group around Lisa Selbie isolated another atypical PKC from human insulin secreting cells. It later turned out to be the human homolog of PKClambda, leading to the consensus PKCiota/lambda (aPKCɩ/ƛ). Both genes consist of 18 exons and the corresponding proteins have a size of approx. 67 kDA, although the protein size on a SDS gel can vary between 72 and 80 kDA. Expression analysis of both isoforms showed a much broader, almost universal expression of PKCiota (Selbie, Schmitz-Peiffer, Sheng, & Biden, 1993), while the expression of aPKCζ is restricted to a few organs including lung, kidney, testicles and the intestine (Goodnight et al., 1992). Initial studies failed to assign cellular functions to aPKCs, however, over the last 20 years researchers were able to link these proteins to various cellular processes including the regulation of cell proliferation (Berra et al., 1993), DNA synthesis (Akimoto et al., 1998; Berra et al., 1995), induction of apoptosis and NFκB signaling (Sanz, 1999; 2000), cartilage destruction (Litherland et al., 2010) and cell differentiation (Kampfer, 2001). The high homology of the proteins in combination with the fact that most commercially available biochemical tools could not reliably distinguish the two isoforms produced a number of ambiguous studies. More recently, however, tools and methods have significantly improved and both isoforms have now been assigned to distinct, nonoverlapping roles. 26 26 The role of aPKC in polarization and maintenance of cellular polarity All multicellular organisms, including simple metazoans and highly complex mammals share acommon feature: Polarity. Macroscopic (from the outside), polarity often presents itself as a front and back or head and tail. However, on a cellular level it describes the asymmetric distribution of intracellular components and functional asymmetry within the cell. The establishment and maintenance of ‘cell polarity’ is an essential feature of all eukaryotes. It appears that the same complexes are conserved in at least C. elagans, D. melanogaster and mammals. As expected such an important feature is tightly regulated and involves many signaling pathways and molecules. The aPKCs are crucial components at the crossroad of polarization and their kinase activity is highly regulated through interaction partners. This kinase activity is required for polarization, as overexpression of kinase-dead aPKC mutants blocks the formation of important cell junctions and leads to mislocalization of polarity proteins (Suzuki et al., 2001). The aPKC themselves interact only with few polarity proteins, such as Par-6, Par-3 and LGLs. In the following paragraph we will discuss the mechanisms behind polarization of epithelial cells, the key components of this process and how aPKC is involved in polarization, regulation and maintenance of cellular polarity. By default cells are isotropic, meaning that the cell content is equally distributed within the cell. In this state, cells can be referred to as ‘unpolar’. Certain stimuli, external and internal, are able to stimulate the cell to redistribute the cellular contents, thereby become ‘polar’. For example, during cell division the cytoskeleton reorganizes and the DNA aligns perfectly in the center, thereby the cell forms two equal daughter cells in a so called symmetric cell division. However, in multi-cellular organisms the challenge is not only to keep the cell-division symmetric, but also in plane with the surrounding tissue. Even the simplest multi-cellular organisms such as Spirogyra must tightly regulate the orientation of cell division to survive. Spirogyra is an algae growing as a single string of aligned cells with one basal cell responsible for attachment of the organism. Already in this context (1D) impaired orientation of cell division would affect growth and have severe consequences for Spyrogyra. In culture, adherent cells grow in a monolayer (2D) with cells next to each other. When the cells reach confluency they stop to proliferate and establish tight connections with each other. This process is called contact inhibition. Cancer cells often lack this control mechanism and therefore uncontrolled proliferation is one of the six hallmarks of cancer (Hanahan & Weinberg, 2011). In a monolayer, cells are no longer isotropic. At that stage the cell can be divided into three distinct functional domains. The 27 27 apical domain, which is the surface of the cell and in contact with the extracellular space and responsible for receiving signals and nutritions from ‘outside’. The basal domain, which is in contact with the surface and responsible for attachment and cell movement and, third, the lateral domain, which is in contact with neighboring cells, maintains the cellcell communication and is important for the integrity of the cytoskeleton and the monolayer. However, depending on the cell line, the monolayer can be so compact that it is impermeable for molecules and thereby it may function as a barrier between ‘outside’ and ‘inside’. To achieve this level of interaction between cells they are connected by socalled cell-junctions. There are four major types of cell-junctions. Tight Junctions (TJs) form the closest contact between cells and are localized in the apical region around the cell's circumference. Desmosomes (DS) serve localized adhesive function and connect the plasma membrane to intermediate filaments in the cytoplasm. Adherens junctions (AJs) play an important role in intracellular adhesion and the interaction of the actomyosin cytoskeleton with the plasma membrane, and Gap junctions (GJs) that consist of intercellular channels in the plasma membrane of adjacent cells. Small molecules can diffuse across the channel and into the cytoplasm of the other cell. Their contribution to the tightness of the cell-cell contact is minimal. All four types of junctions are localized in the lateral surface of the cell and together they are grouped into the term apical junctional complexes (AJCs). Since TJ are the most important AJCs to establish polarity, the following paragraphs focus on TJs Tight junctions are the most apical components of the intercellular junctional complexes and a major player in the regulation of the degree of tightness of the cell layer. These multi-protein complexes mediate the strongest cell-cell contact to be found in nature and are almost unique to epithelial and endothelial cells. By the tight attachment of cell to their neighbors and the formation of a belt encircling the cell, this complex is preventing molecules from diffusing from the apical domain into the sheet between to cells, the lateral domain. This barrier function is a major mechanism in maintaining the apico-basal (AP) polarity by restricting macromolecules to their distinct domains. Although the complete mechanism of TJ formation remains unknown, three protein families have been identified to be involved. The three main transmembrane protein families found in TJs are members of the occludin, claudins and junctional adhesion molecules (JAMs) families. Occludin was the first tight junction integral membrane protein to be discovered and was originally isolated from chick liver (Furuse et al., 1993). Depending on the tissue the expression levels of occludin vary dependent on the required “tightness” of the TJ. For example, occludins are highly expressed in brain endothelium which forms a very tight 28 28 barrier, but are expressed at much lower levels in endothelial cells of non-neuronal tissue that are characterized by much lower barrier properties (Hirase et al., 1997). Besides the role in regulating the quality of the barrier function, occludin is either not required for maintenance of the integrity of TJs or other proteins can compensate for the loss of occludin, since its absence has no effect on the structure of TJs (Saitou et al., 1998). Moreover, occludin interacts with a number of regulatory proteins at tight junction, including aPKCζ, c-Yes, PI3K (Nusrat et al., 2000) and ZO-1 (Furuse et al., 1994). The ZO family members (ZO-1, -2 and -3) interact with a wide variety of cellular proteins through multiple interaction domains and play a central role in organizing TJs. Besides many other interaction partners ZO-1 binds in vitro to F-actin and thus might serve as a linker for occludin to the cytoskeleton (Fanning, Jameson, Jesaitis, & Anderson, 1998) and to JAM (Ebnet, 2000). JAMs, another family of important structural proteins, are single pass transmembrane proteins found in epithelial and endothelial tight junctions. Overexpression of JAM reduces paracellular permeability in CHO (Chinese hamster ovary) cells in a calcium-dependent manner (Aurrand-Lions, Duncan, Ballestrem, & Imhof, 2001), showing that that it is an important component of tight junctions. JAM physically interacts with several tight junction proteins besides ZO-1, such as AF-6 and ASIP (Par3) (Ebnet, Schulz, Meyer Zu Brickwedde, Pendl, & Vestweber, 2000; Ebnet et al., 2001). The third large family of transmembrane proteins are claudins. Claudins have been shown to be important for TJ formation andwere discovered in occludin expressing chicken livers (Furuse, Fujita, Hiiragi, Fujimoto, & Tsukita, 1998), and later studies showed that claudins are expressed in many other tissues. Moreover, expression of claudin family members is specific for certain tissues. The properties of the barrier function mediated by TJs correlates with the claudin composition (Furuse, Sasaki, & Tsukita, 1999). Not surprisingly, claudins interact with ZO-1 through a conserved binding motif in the C-terminus of the protein (Itoh et al., 1999). In summary, all TJs are composed of members of one of the main transmembrane protein families, providing the basis for polarity by actively regulating the distribution of macromolecules along the cell membrane. In contrast to the AJCs, which is embedded into the apical and sub-apical membrane, the trimeric polarity complex is located in the cytosol and thereby able to translocate to different compartments in the cell. The three proteins that form the polarity complex, aPKC, Par6 and Par-3 are considered as the core compounds of cellular polarity and have been shown to regulate multiple cellular processes via protein-protein interaction and modification of substrates. When par-6 was initially discovered in a screen for mutants with partitioning-defective phenotype in C. elegans it was immediately linked to cellular 29 29 asymmetry and Par-3 (Watts et al., 1996). This early study showed that mutations in par-6 result in disruption of asymmetry in the early embryo causing disrupted spindle orientation at the second cell division (Watts et al., 1996). Furthermore Par-6 plays a role in Par-3 localization. Under normal first cell division of the C. elegans embryo, Par-3 is localized to the anterior periphery of the embryo. Mutations in Par-6 lead to mislocalization of Par-3 in the embryo (Watts et al., 1996). Par-3 itself was identified as an important player in establishing polarity through interaction with PKC-3, the homolog of the human aPKCs, in C. elegans. The expression pattern of PKC-3 has just been published earlier in the same year. (S. L. Wu, 1998). Knockdown of PKC-3 resulted in a Par-3 like phenotype, indicating a functional relationship. Subsequent immunoprecipitation analysis confirmed the direct interaction of both protein in C. elegans (Tabuse et al., 1998). Only two month later the same group published data showing that the same interaction happens in mammalian cells (Izumi et al., 1998). It didn’t take long until a direct link between PKC-3, Par-6 and Par-3 was discovered, leading to the establishment of the trimeric polarity complex (Hung & Kemphues, 1999) also in human and mouse (Etienne-Manneville & Hall, 2003; Joberty, Petersen, Gao, & Macara, 2000). Today, the polarity complex is established as a crucial polarity component and the mechanism by which the three proteins interact are well understood. The Par-6 and aPKCs proteins interact with each other through their PB1 domains present in the N-terminal regions of the proteins (Hirano, 2004a). The Par-6/Par-3 interaction is mediated through PDZ domains present in both proteins (Hung & Kemphues, 1999). While Par-6 contains only one PDZ domain Par-3 has three (PDZ1-3). Finally, Par-3 is interacting with the catalytic domain of aPKC through an ‘aPKC binding motif’. The mechanism behind complex formation and how the different proteins modify each other and possible substrates is not completely understood and still a focus for many researchers. There is however little doubt about the function of the complex. Work from several laboratories have demonstrated a role of the polarity complex in establishing AP polarity and in regulating asymmetric cell division in C. elegans (Pellettieri & Seydoux, 2002) as well as mammals (D. Lin et al., 2000). The present data suggest that the inactive Par-6/aPKC complex is stable and constitutively formed under normal conditions, while Par-3 is transiently interacting with the complex. In this complex the Par-6 protein is considered to be the regulator of aPKC activity, since studies have shown that overexpression of a truncated Par-6 protein, N-terminus alone, is able to increase aPKC kinase activity (Joberty et al., 2000), but overexpression of the full-length Par-6 failed to do so (Yamanaka et al., 2001). The current model puts the repression of aPKC by Par-6 in 30 30 the center, with transient interaction partner that regulates localization and target specificity. The first evidence for a role of aPKC in TJ formation was published in 2001 by Suzuki and coworkers. The introduction of a dominant negative mutant of aPKC into MDCK II cells blocks the completion of the two-step TJ formation and impairs cell surface polarity, causing inter-domain diffusion of a marker molecule (Suzuki et al., 2001). One year later the same group showed that aPKC is recruited to the spot-like AJ complex where it colocalizes with other ZO-1, Jam, occludin and claudin to promote the formation of TJs (Suzuki et al., 2002). In C. elegans the recruitment of the Par-6/aPKC complex is mediated by Par-3. In the one-cell embryo, Par-3 translocates to the cell periphery in the absence of PKC-3 (aPKC) or Par-6, while both absolutely require Par-3 (Hung & Kemphues, 1999; Tabuse et al., 1998; Watts et al., 1996). Similar observations have been made in MDCK cells where Par-3 is transiently localized at the spot-like AJ before the Par-6/aPKC complex translocates (Suzuki et al., 2002).This theory is supported by the most recent study showing that JAM, a Par-3 interaction partner, is phosphorylated at Ser285 in vitro and in epithelial cells (Iden et al., 2012). Non-phosphorylated JAM localizes to pAJ and most likely recruits Par-3. Once the trimeric polarity complex has formed at the pAJ Par6 becomes activated by through binding of Rho family small GTPases (Joberty et al., 2000; D. Lin et al., 2000), aPKC is activated and phosphorylates JAM. JAM phosphorylation subsequently promotes the maturation of pAJ into TJ by recruiting other proteins such as ZO-1 to the site (Iden et al., 2012). In addition, there are numerous other proteins that might be involved in recruitment, interaction and/or regulation of aPKCs or that might be targets of phosphorylation. Two members of the FERM (protein4.1, ezrin, radixin, moesin)domain family of proteins, Willin and ezrin have been directly linked to aPKC. Willin, together with Par-3, plays a role in the recruitment of aPKC and in the phosphorylation of the Rho-associated protein kinase (ROCK) by aPKC in epithelial apical morphogenesis (Ishiuchi & Takeichi, 2011). Ezrin seems to be a target of aPKCs and its phosphorylation leads to activation and localization to tight junction in mammalian cells (Wald et al., 2008). In summary, the Par-3/Par-6/aPKC complex is located at the apical domain of polarized cells through Par-3 mediated translocation, where it is involved in maturation of TJs by interacting with network of membrane bound proteins and thereby orchestrates the formation of the AJCs. The regulation of the polarity complex is not fully understood, but it seems that the catalytic activity of aPKC is essential for TJ maturation and is regulated by Par-6 binding. 31 31 As mentioned earlier, the interaction between the Par-6/aPKC complex and Par-3 is transient and other interaction partners have been identified. Several studies suggest that Lethal giant larvea (LGL) competes with Par-3 for Par-6/aPKC interaction and that the Par-6/aPKC/Lgl complex plays a role in earlier processes of polarity formation. LGL has first been identified as an interaction partner of Par-6/aPKC in Drosophila using immunoprecipitation experiments, which becomes phosphorylated by aPKC (Betschinger, Mechtler, & Knoblich, 2003). The same complex was identified in mammalian cells showing mammalian Lgl (mLgl) phosphorylation in fibroblasts after applying scratch wounds (Plant et al., 2003). Finally, mLgl1 and mLgl2 were identified to compete with Par-3 at an early stage of MDCK polarization during calcium switch and is segregated from the complex to the baso-lateral domain after phosphorylation by aPKC (YAMANAKA et al., 2003). This observation is supported by the fact that overexpression of aPKCkn induces abnormal co-distribution of Par-6 and Lgl (YAMANAKA et al., 2003). Additional studies confirmed this model and postulated that mLgl functions as a mediator of cell adhesion stimuli to create a corresponding apical membrane domain and lumen during epithelial tissue morphogenesis by inhibiting the Par-3Par-6/aPKC-complex formation and Cdc42 binding to Par-6 (YAMANAKA et al., 2006). Maintenance of cellular polarization through active exclusion The mechanism described above occurs in a tightly regulated spacial context which is mostly regulated by aPKC localization and activity. As part of the polarity complex, aPKC is involved in maintaining cellular polarity through active exclusion of important protein from distinct domains. The polarity complex is often localized in a complementary pattern to that of Par-1. This pattern seems to be facilitated through mutual phosphorylation of the two kinases, aPKC and Par-1. By phosphorylation they exclude each other from the complementary region of the cell. Par-1 phosphorylates directly Baz/Par-3 at several residues including S1085 (Benton & St Johnston, 2003). Phosphorylation of the S1085 residue creates at Par-5 (which is a 14-3-3 protein) binding site and this binding effectively inhibits interaction with aPKC (Benton & St Johnston, 2003). The 14-3-3 binding to the Par-3 protein can be reversed by protein phosphatase 1ɑ (PP1ɑ) (Traweger et al., 2008), allowing the relocalization of Par-3 to the anterior cortex and reformation of the polarity complex. Conversely, Par-1 phosphorylation by aPKC inhibits both, the localization of the kinase at the membrane domain and the activity of the Par-1 kinase domain. Apparently, Par-1 gets phosphorylated at two residues and both of them have the same consequences. Direct phosphorylation through aPKC at T595 (Hurov, Watkins, & Piwnica32 32 Worms, 2004) and aPKC dependent PKD mediated phosphorylation at S400 (Watkins et al., 2008). Furthermore, aPKCs are involved in the cellular distribution of many more cell fate determinants such as Numb (C. A. Smith et al., 2007), Miranda (Atwood & Prehoda, 2009) and the polarity protein LgL (Betschinger et al., 2003). In all cases phosphorylation by aPKC removes the target protein from the corresponding cellular cortex. 33 33 Atypical PKCs in embryology During development of the pre-implantation embryo two major mechanisms are involved in generating cell diversity: asymmetric cell division, leading to the formation of two daughter cells with different protein composition, and cellular interaction, leading to cells to adopt a distinct fate based on the environment. Thus, two distinguishable cell-lines first appear at the 16-cell stage, recognizable by position and phenotype (polarized and unpolar). The outer cells (polarized, trophoectoderm) are epithelial cells surrounding a cavity and a group of undifferentiated (unpolar) cells, the inner cell mass (ICM). This so-called ‘insideoutside’-model is based on the theory that the position of the cell determines the fate (Tarkowski & Wróblewska, 1967). The apico-basal (AP) axis is first formed at the compacted 8-cell stage (also E2.5). Each cell (blastomer) polarizes its cytoplasm along the AP-axis, which enables the cells to undergo asymmetric cell division leading to the two cell-lines at the 16-cell stage (also E3.0). These morphological events (asymmetrical contacts and polarity) are essential processes that contribute to the generation of trophectoderm (TE) and inner cell mass (ICM) through asymmetric divisions. The formation of these two cell types is a crucial process for the development of the mouse embryo since the ICM will mainly contribute to the formation of the embryo while the TE will participate to extra-embryonic structures. Early studies investigating the establishment of polarity showed that in C. elegans embryos the anterior-posterior-axis occurs as early as during the first cell cycle and is dependent on the functions of Par proteins (Kemphues, Priess, Morton, & Cheng, 1988) and PKC-3 (Tabuse et al., 1998), the ortholog of mammalian aPKCs. Without normal function of these proteins the asymmetric distribution of proteins is altered and especially PKC-3 is required for viability in C. elegans (S. L. Wu, 1998). The fact that PKC-3 does not localize to the periphery without PAR-3 (Tabuse et al., 1998) suggested that PAR-3 recruits PKC-3. Interestingly, in C. elegans fertilization induces polarized localization of PKC-3, Par-3 and Par-6 to the apical pole (Hung & Kemphues, 1999; Tabuse et al., 1998) with Par-1 localized to the basal pole (Boyd, Guo, Levitan, Stinchcomb, & Kemphues, 1996; S. Guo & Kemphues, 1995). The characterization of Par-3 and Par-6 proteins present in the early mouse embryo revealed that the proteins are expressed from the 2-cell stage onwards. Interestingly, asymmetric distribution of Par proteins occurs at the 8-cell compaction stage with mPar1 localized at the basal domain (Vinot et al., 2005). However, aPKCζ protein expression levels are very low until the 8-cell stage but increases at 16-cell 34 34 stage and onwards (Vinot et al., 2005). In contrast to the relatively late onset of aPKCζ expression, aPKCɩ is already detectable at the 4-cell stage with increasing expression onwards (Dard, Le, Maro, & Louvet-Vallée, 2009; Eckert & Fleming, 2008). These differences in expression made aPKCɩ a more likely player in polarity formation, since aPKCζ is either absent or expressed at very low amounts. Expression analysis of both aPKC isoforms at later stages of mouse embryogenesis using in situ hybridization (ISH) showed ubiquitous expression of both isoform at E7.5 (Kovac, Oster, & Leitges, 2007). Further analysis showed consistently lower expression of aPKCζ compared to aPKCɩ in all tested stages (E7.5 - E14.5) and highly specific expression patterns, especially for aPKCζ at later time-points (Kovac et al., 2007). In summary, very little is known about isoform specific functions of the proteins in pre-implantation embryo and during embryogenesis. As mentioned before experimental approaches to adequately investigate this question were limited due to the lack of specific biochemical tools. The first data about isoform specificity came from gene targeting approaches against aPKCζ. Leitges et al. showed that the disruption of aPKCζ protein expression has no effect on embryonic development but causes an impairment of the NFkB pathway in adult animals (Leitges et al., 2001). This study also shows that aPKCζ associates with, and directly phosphorylates p65 and that aPKCζ is required for the cytokine-induced p65 phosphorylation in mouse embryonic fibroblasts (MEFs). Since aPKCɩ is present in the same tissues this data exclude possible redundancy between the two aPKCs and, for the first time assigns a specific in vivo function to the aPKCζ protein. In contrast, disruption of aPKCɩ expression causes a severe phenotype. The aPKCɩΔ/Δ embryos display structural abnormalities as early as E6.5 and by E9.5 the embryos are shrunken with no recognizable structures (Soloff, Katayama, Lin, Feramisco, & Hedrick, 2004). Further analysis of the phenotype were performed in aPKCɩΔ/Δ cell.line and showed an alteration in actin stress fibers in MEFs but no impairment of the NFkB pathway (Soloff et al., 2004), supporting the specific aPKCζ function. However, the gene targeting studies were based on knockdown studies in very early stages of mouse embryogenesis that repeatedly failed to assign specific functions to an aPKC isoform. This was likely due to the lack of adequate biochemical tools and not due to a lack of scientific effort. Despite these problems the scientific field continued to investigate the role of aPKCs in early embryogenesis. In the following years aPKCs were linked to important functions in polarity formation in the preimplantation embryo. As mentioned above, between the 16-cell and 32-cell (blastocyst) stage, the outer cells progressively differentiate into epithelial cells. During this phase cell junctions start to mature, characterized by a step-by-step accumulation of tight junction proteins at the 35 35 border of the apical and the basolateral domains. During 8-cell stage compaction adhesive E-cadherin recruits ZO-1, rab13 and the Par-3/6/apKC-complex to the site of TJ formation. From the 8-cell stage to the blastocyst stage recruitment of JAM, Cdc42, cingulin and ZO-2 results in a functional TJ and a basolateral Zonula adherens (ZA) as reviewed in Eckert and Fleming (Eckert & Fleming, 2008). It also has been shown that both proteins show lineage-distinct staining patterns in blastocysts. While PKCiota is distributed to the TE membrane and cytoplasm, aPKCζ is predominantly localized at the apical membrane of TE, showing a similar staining than the ZO-1 protein (Eckert et al., 2004). While it is clear from these data that both proteins have distinct localization patterns, the role of the individual aPKC isoforms remains unclear. Despite the indications that aPKCζ might play the more important role in TJ formation, it is aPKCɩ that has been linked to this process in early mouse development and not aPKCζ. Mutant embryos either expressing a kinase dead dominant mutant or siRNA against endogenous aPKCɩ displayed mislocated ZO-1 and cingulin, indicating a defect in TJ formation, while the setting up of polarity along the radial axis at 8-cell stage by E-cadherin showed no impairment (Dard et al., 2009). The role of aPKC in very early embryogenesis One of the biggest challenges in developmental biology is to understand how asymmetries are elaborated along the main body axis. Remarkably, the origin of this process can in many organisms be traced back to the one-cell stage. The one-cell stage or the egg contains cell axis determinants that localize to opposite ends of the cell, thereby controlling the symmetry or asymmetry of the cell. Genetic screens in Drososphila and C-.elegans have identified several regulators of egg polarity. Soon after the discovery of a group of genes crucial for polarization of cells (par-genes) in C. elegans these genes were investigated in Drosophila. It turned out that these mechanisms were conserved with one exception: In C. elegans Par-3 and par-6 localize together with aPKC at the anterior domain, while par-1 and par-2 occupy the posterior domain. The remaining par-4 and par-5 are equally distributed throughout the cytosol. In Drosophila, the par-2 protein is missing, while otherwise the machinery seems to be fully conserved. Par6 was first identified for its role in polarizing the C. elegans zygote (Watts et al., 1996). PAR-6 and PKC-3 become restricted to an anterior cortical domain of the zygote and regulate the localization of developmental determinants and proteins required for asymmetric cleavage (Pellettieri & Seydoux, 2002). PKC3 was first described to play a role in cell organization in C. elegans. Oocytes lacking PKC3 failed to hatch (S. L. Wu, 1998). Examination by 36 36 interference microscopy revealed that arrested embryos contained highly disorganized cells. Thus, it appears that the atypical PKC3 of C. elegans is essential for the normal progression of early to mid-embryogenesis and the viability of the intact organism. In both organisms D. melanogaster and C. elegans only one atypical PKC is expressed and several studies investigated the role of aPKC in both organisms over the last two centuries: The first description of aPKC in D. melanogaster was published in 1989 as a detailed description including gene description, sequence analysis and protein expression (Schaeffer, Smith, Mardon, Quinn, & Zuker, 1989). Later studies showed Drosophila atypical Protein Kinase C associates with Baz/Par-3 and controls polarity of epithelia and neuroblasts (Wodarz, Ramrath, Grimm, & Knust, 2000). Surprisingly, Baz does not simply function as a scaffold to anchor DaPKC in the apical cytocortex, but is itself dependent on DaPKC for proper localization and stability. The dependency of Par-3 on aPKC for its localization is unique to D. melanogaster and not completely understood. In C. elegans the PKC3 protein was first described by Wu et al. (S. L. Wu, 1998). As part of a bigger study, functional investigations showed that more than 90% (338 of 367) of embryos containing antisense against PKC3 mRNA failed to hatch. More detailed examination by interference microscopy revealed that arrested embryos contain 100–200 highly disorganized cells. Thus, it appears that atypical PKC3 of C. elegans is essential for the normal progression of early to mid-embryogenesis and the viability of the intact organism. In contrast to C. elegans and D. melanogaster, mammalian cells contain two aPKC isoforms, confronting the field with the problem of possible overlapping function and specific role in embryogenesis. Several studies have investigated the PKC expression pattern in the unfertilized mammalian egg (UFE), early stages of egg activation as well as embryogenesis (Dard et al., 2009; Eckert et al., 2004; Eckert & Fleming, 2008; Halet, 2004; Kovac et al., 2007; Pauken, 2000; Pauken & Capco, 1999; Raz, Eliyahu, Yesodi, & Shalgi, 1998; Vinot et al., 2005). When fertilization-competent cells were detergent extracted, which means that all soluble unbound content is removed, aPKCζ remained tightly associated with the meiotic spindle and seemed to be bound to spindle fibers (Baluch, Koeneman, Hatch, McGaughey, & Capco, 2004). The model that aPKCζ stays associated with the spindle apparatus during the complete cell division was confirmed by fluorescence resonance energy transfer (FRET) using tubulin as an acceptor and aPKCζ as a donor (Baluch et al., 2004). After completion of the first cell cycle aPKCζ localizes to the cytoplasm and the nucleus of two daughter cells. Interestingly, aPKCζ expression starts as early (or ‘as late as’ in the context of the previous data) as in the 2-cell stage and increases in the 4- and 8-cell stage (Pauken, 2000). In contrast to the expression data, 37 37 aPKCζ protein is already detected in the UFE, which might be maternal protein and not newly expressed protein. However, the localization in the 2- and 8-cell stage (before compaction) is mainly cytoplasmic with nuclear localization, but exclusion from the nucleoli, while the localization pattern slightly changes during the 4-cell stage. In the 4-cell stage aPKCζ suddenly translocates from the cytoplasm to the cell membrane facing the external milieu and relocates to the cytosol in uncompacted 8-cell embryos. During compaction aPKCζ relocalizes to the membrane and shows no nuclear localization (Pauken, 2000; Vinot et al., 2005). Recent studies on aPKCɩ expression in the preimplantation mouse embryo revealed detectable, increasing protein expression from the 4-cell stage upwards with higher expression relative to aPKCζ (Dard et al., 2009; Kovac et al., 2007), with an important role in allocation of cell lineages (Dard et al., 2009). To further investigate the role of aPKCɩ during early embryogenesis fertilized eggs or embryos in the 2-cell stage were transfected with siRNA against aPKCɩ. Depletion of aPKCɩ has no effect on the development of the stage before 8-cell stage embryos and apico-basal polarity is correctly set up at compaction. At the 16-cell stage embryo the absence of aPKCɩ shows an effect. In aPKCɩ depleted embryos ZO-1 and cingulin were mislocalized, causing impaired junction formation. Because of the impaired polarity the ratio between inside cells (forming ICM) and outside cells (tropho-ectoderm) is changed. The absence of aPKCɩ causes an increase in asymmetric cell division during the 8-16 cell stage resulting in decreased inner cells (Dard et al., 2009). Considering these studies, both atypical PKCs are co-expressed in the mouse embryo at least at the 4-cell stage and later. It has been shown that the aPKCζ protein is present at very high levels in the unfertilized egg without detectable mRNA present. Since the protein is likely from the mother, we cannot exclude the presence of maternal aPKCɩ protein. 38 38 Present Investigations Aims of the study The atypical PKCs represent the third of the superfamily of serine/threonine kinases PKC. Atypical PKCs have been shown to be involved in a number of important cellular mechanisms such as proliferation, migration, differentiation and apoptosis. However, little is known regarding isoform specificity in mammals and PKCɩ and PKCζ are often considered to be functionally redundant. While biochemical studies have problems linking certain functions to the specific isoforms, genetic targeting approaches clearly show different phenotypes in aPKC knockout animals, indicating non-overlapping functions. The main goal of this study is to investigate isoform specificity. Considering published data and available unique tools in our lab we based the study on two approaches. 1. To identify possible isoform-specific functions we designed a number of aPKC GFPfusion proteins and expressed those in MDCK cells, an established model cell-line to study polarity. It is known that kinase specificity is often achieved by (either) interaction and/or localization. Based on that rationale we investigated the role of distinct domains within aPKC in mediating localization in MDCK cells to conclude possible isoform specificity. The proteins investigated include truncated proteins of both isoforms and mutant versions that specifically target known interaction partners to verify their possible role in aPKC regulation. 2. To further investigate possible redundancies between the two atypical PKC we performed a detailed analysis of aPKCɩΔ/Δ mice regarding the role of aPKCɩ during early stages of development and the possible reason for the observed lethal phenotype. As part of that study we also investigate the possible role of aPKCζ in the context of aPKCɩ deficiency. 39 39 Synopsis of the papers Paper I: Functional Comparison of protein domains within aPKCs involved in nucleocytoplasmic shuttling. The regulation of aPKC localization, translocation and interaction was investigated based on functional components and differences in the amino acid sequence. The comparative analysis of atypical PKCɩ/ƛ and PKCζ was performed in MDCK cells, an established model system for proteins involved in either establishing or maintaining cellular polarity. We expressed a series of GFP-fusion proteins including the full-length proteins, truncated proteins and functional mutants to investigate the role of the single domains in localization and nucleocytoplasmic shuttling. For the comparison of nuclear translocation of both aPKCs we were using the nuclear export inhibitor Leptomycin B showed. The analysis of the shuttling properties of both full-length proteins showed different kinetics of the two isoforms. Overexpression of truncated proteins revealed differences in subcellular localization between the two isoforms. Expression of the regulatory domain of aPKCɩ resulted in a protein with predominant nuclear localization. In contrast the regulatory domain of aPKCζ was almost exclusively located at the membrane with little cytoplasmic signal. These results indicated a different regulation of localization between the two aPKC members. A more detailed study of the regulatory domain identified the Hinge region as a possible carrier of a yet unidentified motif that mediates specific localization in MDCK cells. Analysis of the aPKCɩHINGE showed a dominant localization to the nucleus of the cell. The corresponding aPKCζ construct showed a cytoplasmic staining with an obvious absence of nuclear localization. Mutational analysis of the NLS of both PKCs revealed that PKCɩ can translocate to the nucleus independent of its NLS whereas PKCζ’s translocation is mainly regulated by its NLS. In the context of the full-length protein the PB1 domain partly regulates the translocation of aPKCɩ, but not aPKCζ. Together these data argue for a different regulation of aPKC isoforms regarding cellular localization and translocation. 40 40 Paper II: Phenotypical analysis of atypical PKCs in vivo display a compensatory system at embryonic stage 7.5 p.c. (under review in PlosOne) The atypical protein kinases C (PKC) isoforms ι/λ and ζ play crucial roles in many cellular processes including development, cell proliferation, differentiation and cell survival. Possible redundancy between the two isoforms has always been an issue since most biochemical tools do not differentiate between the two proteins. Thus, many efforts have been made during the last decades to characterize the functions of aPKCs using gene targeting approaches and depletion studies. However, little is known about the specific roles of each isoform during mouse development. We show that deletion of PKCι/λ, results in a reduced size of the amniotic cavity at E7.5 and impaired growth of the embryo at E8.5 with subsequent absorption of the embryo. Our data also indicate an impaired localization of ZO-1 and a disorganized structure of the epithelial tissue in the embryo. Importantly, using electron microscopy, embryoid body formation and immunofluorescence analysis, we found, that in the absence of PKCι/λ, tight junctions and apico-basal polarity were still established. Finally, our study indicates a non-redundant PKCι/λ function at E9.5, since expression of aPKCζ is able to rescue the E7.5 phenotype, but resulted in embryonic lethality at a later time-point (E9.5). Our data show for the first time that PKCι/λ is crucial for mouse embryogenesis but is dispensable for the establishment of polarity and tight junction formation. We present a compensatory function of aPKCζ at E7.5, rescuing the phenotype. Furthermore, this study indicates at least one specific, yet unknown, PKCι/λ function that cannot be compensated by aPKCζ overexpression at E9.5. 41 41 Discussion Atypical PKCs represent a subgroup of the PKC family that shows a remarkable homology to each other. Irrespective of the distinguishable mode of activation compared to the rest of the family, very little is known about possible differences between the two atypical PKCs. Several studies using gene targeting or RNA knockdown approaches have indicated the existence of isoform-specific functions. In recent years the view that specific interaction partners restrict the individual isoforms to certain cellular domains to create a specificity of action (Jaken & Parker, 2000). Several interaction partners have been identified to act on aPKCs, including lipid second messengers (e.g. PI-3,4,5-trisphosphate and ceramide) and members of the Par-family (Par3, -4 and -6). Some of the known binding proteins seem to interact with both isoforms, whereas others are specific for one isoform. For example, Zip/p62 has been shown to interact with both isoforms in PC12 cells (Samuels, Seibenhener, Neidigh, & Wooten, 2001) and links aPKCs (in this case) to the regulation of nerve growth factor (NGF)-induced differentiation and Par4 selectively interacts with both aPKCs during apoptosis (Diaz-Meco et al., 1996a). In contrast, lambda interacting protein (LIP) selectively interacts with the zinc finger of aPKCɩ and is a very specific, potent activator of aPKCɩ but not aPKCζ. It has been suggested that LIP activated aPKCɩ might play a role in the transactivation of a κB dependent promotors (Diaz-Meco, Municio, Sanchez, Lozano, & Moscat, 1996b). Isoform specificity is an important issue and a better understanding of the regulation of the specific isoforms is crucial for drug development and targeted studies. Thus, the aim of this thesis was to identify functional differences among aPKCs and to study the role of specific protein domains in mediating isoform specific localization and/or interactions. The HINGE domain and its role in sub-cellular localization of aPKCs. As a starting point of our biochemical study (Paper I) we assumed that isoform specific function is linked to a specific localization in the cell and that localization is mediated by protein domains and their interaction partners. Moreover, we decided to focus on the regulatory domain, since this region contains conserved domains as well as highly variable regions. We hypothesized that conserved domains are either regulated differently in the two isoforms and/or that localization is mediated by the variable regions through interactions with different proteins. We thought that removing the kinase domain would 42 42 simulate an open conformation of the regulatory domain and thereby promote protein interactions. We were indeed able to show that the isolated hinge regions of the aPKC isoforms have distinct cellular localization. Furthermore, we demonstrated that the hinge regions are essential for the localization of the regulatory domain. Switching the hinge regions of the aPKC isoforms changed the localization of the chimeric proteins and confirmed a dominant effect of the hinge region on the localization of the regulatory domain and in the context of the full-length proteins. Our data shows that the hinge region of aPKCiota is involved mediating nuclear localization, while the aPKCzeta hinge region causes membrane and/or cytoplasmic localization. So far the only characterized motif in the hinge region is a caspase cleavage site that has previously been described in the hinge region of aPKCzeta (Frutos et al., 1999). In HeLa cells, longer exposure to UV light was shown to inactivate aPKCzeta that precedes it proteolytic degradation and produces a fragment of approximately 50 kDa (Frutos et al., 1999). In our setup, however, none of the aPKCzeta constructs showed significant increase in caspase cleavage of the GFP-fusion protein and no accumulation of a 50 kDa fragment could be detected. To gain further understanding of the mechanism that influences localization and to possibly identify new motifs that might be relevant for the specific cellular localization we develop a strategy based on random mutagenesis. The idea is to create a fusion protein library containing hinge domains mutants of both isoforms. The number of mutant has to be sufficient to statistically hit all amino-acids in the sequence with at least one mutation. We are aware of studies that have shown that the GFP tag might be suboptimal for this kind of high throughput localization studies (Seibel, Eljouni, Nalaskowski, & Hampe, 2007) and we think that the intrinsic nuclear localization of the GFP protein might interfere with our read-out. We therefore consider an approach using a smaller tag such as Myc or FLAG. To avoid that diffusion of the protein interferes with our experimental setup we also consider a much larger LacZ fusion protein. This approach is currently in process in our laboratory. 43 43 The nuclear shuttling of aPKCs is not exclusively regulated by the NLS When we first observed the nuclear localization of the N-terminal construct without the hinge region we assumed that this is due to the NLS motif present in the C1 domain of both isoforms, functionally described by others (Perander, 2000; Pu et al., 2006). Since the NLS has only been shown to be functional in the context of shorter fragments and not in the full-length protein (Perander, 2000) we decided to investigate the role of the NLS in more detail. Using MDCK cells, we were able to confirm earlier work performed in Cos7 and HeLa cells that showed increased shuttling of aPKCiota compared to aPKCzeta (Perander, 2000). However, when we mutated the NLS in both isoforms, the aPKCɩ mutant did not appear to be affected, whereas aPKCζ protein levels in the nucleus were significantly decreased. Although reduced, the accumulation of aPKCζ in the nucleus of MDCK cells was significant. Together our results strongly indicate the presence of alternative translocation mechanisms in both aPKCs. In contrast to our data, in studies using PC12 cells both aPKCs have been reported to translocate into the nucleus after neural growth factor treatment (NGF) (Neri et al., 1999; M. W. Wooten, Zhou, Wooten, & Seibenhener, 1997; G. Zhou, 1997). In fact Wooten et al. convincingly showed phosphorylation of aPKCiota at Tyr256 by Src after NGF treatment. Sequence alignment of aPKCɩ and aPKCζ shows that the Tyr256 residue is conserved in both isoforms suggesting that it may play a role in the translocation of aPKCζ as well. It seems that phosphorylation of Tyr256 causes a conformational change leading to the exposure of the NLS and subsequent importin-β binding (White et al., 2002). It is likely that importin-β binds directly to aPKCɩ, since arginine-rich NLS motifs do not need importin-ɑ (Palmeri & Malim, 1999). This is supported by other in vitro studies that have shown that human aPKCζ, which has the same NLS sequence then murine aPKCɩ, does not directly bind to importin-ɑ (Maiyar, Leong, & Firestone, 2003). Similar results were observed by Neri and colleagues, who showed a PI3K dependent translocation of aPKCζ into the nucleus of PC12 cells upon NGF stimulation. Unfortunately, none of these studies addressed whether these mechanisms are specific for aPKCɩ or aPKCζ as well. Neri et al. suggested that the two phosphorylation products of PI3K, PtdIns(3,4)P2 and PtdIns(3,4,5)P3, are involved in the nuclear localization of the protein. Both products have been shown to activate aPKCζ in vitro (Nakanishi, Brewer, & Exton, 1993; Toker et al., 1994). In their model aPKCζ shuttles between the cytosol and the nucleus and after NGF 44 44 stimulation PI3K translocates to the nucleus where nuclear PtdIns(3,4,5)P3 activates aPKCζ. Activated aPKCζ then remains in the nucleus. We used Leptomycin B (LMB) to show that both isoforms shuttle between the cytoplasm and the nucleus. LMB has been described to specifically inhibit the export of protein with a leucine rich NES by inactivating CRM1 (Stade, Ford, Guthrie, & Weis, 1997). CRM1 belongs to the superfamily of importin-β and together with four other family members (CAS, exportin1, exportin and importin 13) it mediates nuclear export (Fornerod, Ohno, Yoshida, & Mattaj, 1997). Of these five proteins CRM1 regulates the vast majority of shuttling protein containing a leucine-rich NES, such as aPKCs, while the others are very specific for unique export substrates. Even though the sequence alignment of the two NES in aPKCs do not show a different amount of leucine residues we cannot exclude that the decreased accumulation of aPKCζ is partly a result of using LMB as an inhibitor and that other export proteins might be involved. Regarding the role of the NLS in aPKCiota we can only speculate that other yet unidentified NLS motifs are present or that importin independent mechanisms are involved in the nuclear translocation of this isoform. Despite extensive studies on the sequence of both aPKCs very little is known about novel NLS or other sequences related to nuclear import. However, importin independent mechanisms do exist like for example: 1. β-catenin, which as a part of the Wnt/Wingless pathway, binds to the cytoplasmic tail of cadherin adhesion molecules and has been shown to translocate to the nucleus through importin-independent mechanisms. The protein binds directly to the nuclear pore machinery and translocates into the nucleus in a possibly Ran-dependent manner (Fagotto, Glück, & Gumbiner, 1998). The β-catenin armadillo-repeats are present in a number of proteins including importin-β and present data suggest a role of this motif in nuclear translocation (Fagotto et al., 1998). Interestingly, an interaction between βcatenin and aPKCs also has been shown in various tissues and is believed to be mediated by the armadillo-repeat present in β-catenin and a yet unknown motif in aPKCs (Luna-Ulloa et al., 2011; Seifert et al., n.d.). In addition to the direct interaction of these proteins, aPKCζ kinase activity is important for the nuclear localization of βcatenin in cancer cell lines (Luna-Ulloa et al., 2011). Together these data show that βcatenin shuttles importin-independent and CRM1-dependent between the nucleus and the cytosol. Not only the transcriptional activity of β-catenin is regulated by aPKCζ, it also interacts directly with aPKCζ through its armadillo-repeat. We think that the link between β-catenin nuclear localization and aPKCζ activity might also be relevant for 45 45 other pathways and that β-catenin is a potential regulator of aPKC localization in an importin independent manner. 2. Alternatively, Pollard et al. described a 38 amino acid transport signal, termed M9, which confers bidirectional transport across the nuclear envelope (Pollard et al., 1996). For its nucleocytoplasmic shuttling, M9 serves as a NLS and nuclear export signal (NES) and its transport receptor is transportin (Trn)/karyopherin β2 (Calado, Kutay, Kühn, Wahle, & Carmo-Fonseca, 2000; Rebane, Aab, & Steitz, 2004). Attempts to define the sequence for Trn interaction produced a consensus Trn interaction sequence (Bogerd et al., 1999). This sequence is present in the kinase domain of both aPKCs and has the potential to interact with TRN. Whether the interaction between Trn and aPKC happens in vivo or in vitro and whether this plays a role in translocation needs to be further investigated. In this study we also investigated an involvement of a “hitchhiking” o “Piggyback”mechanism (Fagotto et al., 1998; Fang et al., 2007; Luna-Ulloa, Hernandez-Maqueda, Santoyo-Ramos, Castaneda-Patlan, & Robles-Flores, 2011; Pollard et al., 1996) as possible importin independent mechanism through which aPKCs might translocate into the nucleus. This principle is not completely new and the importin-β mediated translocation follows the same mechanism. Interestingly, importin-β competes with β-catenin for binding the nuclear envelope, suggesting a novel function for β-catenin (Fagotto et al., 1998). Earlier export models of β-catenin included APC as a carrier protein (Fagotto et al., 1998; Henderson, 2000) but a more recent study showed that β-catenin can bind directly to CRM1 independently of APC (Ki, Oh, Chung, & Kim, 2008). Since the aPKC-PB1-domain is a protein-protein interaction domain (Hirano, 2004a; 2004b) that theoretically interacts with at least 12 additional mammalian PB1-containing proteins (Lamark, 2003) we investigated the role of that domain during translocation. Interestingly, Par-6, a protein that has been shown to interact with aPKCs via the PB1 domain is localized in the nucleus of MDCK cells. Therefor Par-6 represents a possible candidate to act as a partner during ‘hitchhiking’. Thus we mutated the PB1 domains in the full-length proteins to observe possible changes in the localization or translocation behaviour. We expected to see decreased nuclear accumulation of the mutant upon LMB 46 46 treatment. Instead, we observed an increased nuclear fraction of aPKCs in untreated cells, indicating an impaired shuttling. One possible interpretation of these data is that under normal conditions aPKCs are predominantly localized in the cytosol of the cell through interaction with Par-6. A fraction of that aPKC pool might translocate to other cell compartments through binding to other protein such as Par-3 and Cdc42. Another fraction of the same aPKC pool shuttles into the nucleus depending on importin-β and yet unknown binding partners.The disruption of the PB1 domain leads to the disruption of the Par6-aPKC interaction (Wilson et al., 2003) and might cause a shift in the distribution of the protein (Noda, 2003). As a result of the Par-6 release the aPKC pseudo-substrate interacts with the kinase domain and causes a conformational change. Thus, more mutant protein is available for other interactions and this might lead to increased nuclear import. We think that Par-6 might act as an anchor and is not actively involved in the nuclear translocation of aPKC even though Par-6 has been described in the nucleus and it shows weak shuttling between the nucleus and the cytosol (Cline & Nelson, 2007). While this study focus on the involvement and alteration of possible import mechanism of aPKCs into the nucleus we cannot fully exclude that our observations are a result of an impaired export of the proteins. Some of the domains that we postulate to be involved in nuclear import have also been shown to play a role in the nuclear export of proteins. A recent publication has shown that another PB1 containing protein, p62, is important for the nuclear export of ALFY (autophagy-linked FYVE) in HeLA cells (Clausen et al., 2010) demonstrating that proteins can also “hitchhike” out of the nucleus. This suggests, as we have mentioned, that the increased amount of nuclear protein might as well be a result of decreased export rather than increased import. The p62 protein, also known as zeta interacting protein (ZIP), has previously been identified as a binding partner of aPKCs (Puls et al., 1997; Sanchez, De Carcer, Sandoval, Moscat, & Diaz-Meco, 1998) and has recently received more attention as a player in starvation induced autophagy (Lamark, Kirkin, Dikic, & Johansen, 2009; Pankiv et al., 2010) Bjørkøy et al. identified p62 as a nuclear protein with shuttling properties similar to aPKC (Pankiv et al., 2010). Thus, we consider p62 as a likely candidate to mediate nuclear shuttling of aPKCs. 47 47 Nuclear functions of aPKCs Very little has been published regarding the nuclear functions of atypical PKCs and none of those publications differentiates between the two isoforms. We were and still are particularly interested in possible nuclear functions since our study is the first to suggest multiple mechanisms of nuclear transport. This could mean that the cellular context plays a major role in the regulation of nuclear translocation and that the physiological conditions for nuclear translocation and activity of both aPKCs are different. However, over the last decade three nuclear processes have been identified which potentially could be linked to aPKC function: 1. Both isoforms have been described as a binding partner of Par-3 and Par-6 (Henrique, 2003; Joberty et al., 2000; Noda, 2003), forming a ternary complex, also known as polarity complex. Recent work has revealed a nuclear localization of both Par proteins. In MDCK cells, Par-6 has been characterized as a constitutive dual-location protein present at the membrane and in the nucleus (Cline & Nelson, 2007). Furthermore the nuclear localization of Par-6 is partially dependent on a putative NLS present in the protein, but independent of aPKC, since deletion of the PB1 in Par-3 has no effect on the nuclear localization (Cline & Nelson, 2007). However, when we overexpressed the aPKC/???PB1 mutant in MDCK cells we noticed an increased nuclear localization of Par-6 (data not published), supporting a possible role of aPKC in regulation of Par-6 localization. Par-3 has also been shown to be located in the nucleus and in contrast to Par-6 it has been associated with a distinct function. Par-3 was shown to interact with Ku70/Ku80 after ɣ-radiation (IR), a potent double strand break inducer in DNA often used in DNA repair studies. Subsequently, the DNA-dependent protein kinase (DNA-PK) associates with this complex (Fang et al., 2007). This study shows an unexpected link of Par-3 to DNA repair and that Par-3 is absolutely required for efficient DNA repair and cell survival following DNA damage.The cellular localization of Par-3 has been shown to be independent of aPKC and Par-6 interaction. During the formation of tight junction, Par-3 is recruiting Par-6 and aPKC. Considering the robustness of the polarity complex in the cytosol it might as well exist in the nucleus with yet undiscovered functions. Furthermore, when we used known online tools to scan the protein sequence of both aPKCs for possible motifs we found a conserved phosphorylation motif for DNA-PK present in both proteins. The presence of a DNA-PK motif might represent a functional link between aPKCs and Par-3 in the nucleus that has not been reported before. More 48 48 detailed studies are necessary and conclusions based on these data are highly speculative so far. However, we do think that aPKCs potentially play a role in DNA damage repair including interaction with Par-3 and Par-6. 2. The role of aPKCζ in colonic epithelial proliferation. After aPKCζ has earlier been implicated in the control of cellular mitogenic signaling and survival (Diaz-Meco et al., 1996a; Gómez et al., 1995; Powell et al., 1996). Recent studies in the murine colon showed a correlation of increased aPKCζ expression and crypt hyperproliferation (Umar, Sellin, & Morris, 2000). Furthermore, the study shows increased nuclear localization of aPKC in hyperproliferating crypt nuclei indicating a role in transmissible murine colonic hyperplysia (TMCH). 3. Lastly it has been shown in 293 cells and embryonic fibroblasts that treatment with TNFɑ leads to the activation of aPKCs which subsequently activates the NFκB signaling pathway thereby causing a translocation of NFκB to the nucleus. Activation and translocation of NFκB requires specific phosphorylation, for example at Ser311 at the RelA subunit, which is a target of aPKCζ (Duran, Diaz-Meco, & Moscat, 2003).Cells deficient for aPKCζ showed a reduced RelA phosphorylation at Ser311 indicating that this process is specific for aPKCζ and aPKCɩ is not involved. Whether the phosphorylation of RelA by aPKCζ takes place in the cytosol or within the nucleus of the cell still remains unknown. 49 49 The role of atypical PKCs in early mouse development Many studies have been performed describing the role of aPKC during embryonic development including various species. Earlier studies on aPKCs were mainly performed in C. elegans, Xenopus and D. melanogaster and showed an important role of aPKC in the establishment and maintenance of the apico-basal polarity and epithelial structures. In contrast to mammals these organisms have only one aPKC isoform and therefore provide a straight forward model system with limited information about possible mechanisms controlled by specific isoforms in mammals. The first evidence that there is functional exclusiveness of aPKC isoforms came from gene targeting approaches for both aPKCs. In 2004, Soloff et al. described an embryonic lethal phenotype when the aPKCɩ gene was knocked out by conventional gene targeting. Nevertheless that study did not investigate details such as the exact time and possible causes of the lethality. In comparison to the viable aPKCζ knock out animals this defines an important role of aPKCɩ during early mouse development. When we generated various aPKCɩ knockout alleles in our lab, mice deficient for aPKCɩ showed a lethal phenotype as well. Further analysis of the mutants discovered first morphological irregularities at E7.5. At this stage mutant embryos showed reduced size and an impaired formation of the amniotic cavity. Only very little is known about the role of aPKCɩ in cavity formation and this is the first time that the protein could be linked to the process of the amniotic cavity formation. Based on what is known about the role of aPKCɩ in polarization of cells we expected that the phenotype is a result of impaired polarity. We therefore compared our phenotype with described phenotypes of other polarity proteins. Surprisingly only a few knockout studies have been performed on proteins involved in polarization events that show comparable phenotypes. 1. Studies on Zonula Occludens-1 (ZO-1) showed that ZO-1 deficiency causes a lethal phenotype between E10.5 and E11.5. Compared to the loss of aPKCɩ this phenotype occurs later and is most likely due to a defected yolk sac angiogenesis and apoptosis (Katsuno et al., 2008). 2. A phenotype that is strikingly similar to the aPKCɩ-deficiency is caused by the loss of afadin. Afadin deficient embryos showed first morphological impairment at E7.5 and degradation of the embryo at E9.5 (Wataru Ikeda, 1999). The loss of afadin causes impaired localization of ZO-1 and E-cadherin leading to disorganized cell-cell junctions of the embryonic ectoderm. Afadin has been shown to regulate aPKC activity through 50 50 Cdc42 (Atwood & Prehoda, 2009; Sato, 2005; Welchman, Mathies, & Ahringer, 2007) and therefore represents a link to the role of aPKCs. 3. Cdc42-deficient mice show a much more dramatic phenotype then ZO-1 and Afadin. The lack of Cdc42 severely impairs the development of the embryo resulting in a reduction in size at E5.5 and absorption of the embryo at E6.5. As the author suggests the onset of the phenotype could even be earlier and that it may be delayed by the maternal Cdc42 (F. Chen et al., 2000). Even though all three proteins have been described to play a role during the formation of tight junctions and adherens junctions (Komura et al., 2007; X. Wu et al., 2007) the various phenotypes all occur at different timepoints of the embryonic development and/or are different from what we see in the aPKCɩ deficient animals. Since our attempt to find a mechanistic explanations or hinds for the phenotype of the aPKCɩ deficiency by comparing existing knockout studies did not succeed, we choose alternative approaches. Embryoid bodies as a model system for cavity formation First we wanted to look at the process of cavity formation and the potential role of aPKCɩ since we observed a severe reduction of the amniotic cavity in aPKCɩ deficient embryos. A commonly used system to investigate the molecular mechanism of cavity formation is the embroid bodie (EB) formation assay. This model system recapitulates early stages of embryonic development in vitro (Keller 1995). Our initial analysis using immunofluorescence showed correct formation of the basal lamina and the apical domain. E-cadherin was found to be at the apical site facing the lumen in both genotypes, indicating the presence of cell junctions (Tunggal et al., 2005). We also used Par-3 as a marker for TJ-formation and established AP, as well as the adapter protein MUPP1, to check for the interaction of JACs with the cytoskeleton (Guillemot, Paschoud, Pulimeno, Foglia, & Citi, 2008). The localization of Par3 and MUPP1 were unaffected by the loss of aPKCɩ in analyzed EBs. The fact that Par3 localization remains unaffected in EB formation using aPKCɩ deficient mammals ES cells confirms earlier results from studies performed in C. elegans(Hung & Kemphues, 1999). Furthermore, our data show that the impaired cavity formation as a result of the loss of aPKCɩ is not caused by the loss of apico-basal polarity. Our study also shows a remaining aPKC signal at the apical domain of aPKCɩ deficient mutants. Western Blot analysis and RNA expression studies confirmed the complete depletion of aPKCiota, thus the aPKC signal in deficient embryos must be aPKCzeta. We think that it is likely that the remaining aPKCζ is compensating for the loss of aPKCɩ. To 51 51 verify this theory we are in the process of making a double knockout of both aPKCs. However, supporting evidence for compensatory effects of aPKCζ come from earlier knockout/knockdown studies on regulators of aPKC activity. Cdc42, as a member of the small Rho-GTPase-family has been shown to interact with the Par6/aPKC-complex (D. Lin et al., 2000; Qi et al., 2011) and plays a role in cell polarity. In contrast to the aPKCɩ KO, EBs derived from Cdc42- deficient ES cells not only fail to produce a single lumen, but also show a total loss of both aPKCs and Par-3 at the apical domain (X. Wu et al., 2007). This phenotype is much stronger than aPKCɩ KO alone and we think this is because Cdc42 interacts with both aPKC isoforms in a non-discriminating way. Thus, depletion of Cdc42 caused reduced activity of both aPKCs and resulted in a more dramatic phenotype. The overexpression of dn-aPKCζ in Cdc42 wild-type EB leads to an identical phenotype compared to the Cdc42 knockout (X. Wu et al., 2007), which supports our theory. Similar to the phenotype of the Cdc42-deficiency, the loss of afadin causes a loss lumen formation and impaired distribution of Par-3, Par-6 and aPKC in EBs (Komura et al., 2007). It is important to note that the formation of a single cavity is a twostep process: first, multiple small lumen form in the periphery of the EB with initiation ofAP at each site (Coucouvanis & Martin, 1995). In a second step the smaller lumen fuse and the inner cells undergo apoptosis to clear the central lumen. Our data suggest that the loss of aPKCɩ does not interfere with the first step, since we see multiple lumen in the periphery of the EB, but disrupt the second step involving apoptosis. Activation of caspase-3 is an important step in apoptosis. Thus the reduced levels of activated caspase-3 in aPKCɩ deficient EBs support the importance of aPKCɩ in the second part of cavity formation. At this point we are not aware of any mechanism that might explain that observation. However, an earlier study using aPKCζ pseudosubstrate to inhibit both aPKCs in MDCK cyst formation showed increased caspase-3 activation with a negative correlation with aPKC activity (M. Kim et al., 2007). These results imply that the loss of aPKCɩ might elaborate aPKCζ activity in EBs, which causes inhibition of apoptosis. Taken together, the loss of aPKCɩ causes impaired lumen formation and reduced apoptosis in embryoid bodies without influencing the AP formation. Whether this phenotype is strictly an effect of the loss of aPKCɩ or is a result of reduced apoptosis by the remaining aPKCζ is unclear. 52 52 Further insights from alternative model systems for cavity formation Data regarding the role of Par-6 and Par-3 in cavity formation comes from another model system using MDCK cells in a three-dimensional (3D) epithelial culture. In this model epithelial cells organize themselves into cyst structures that resemble their in vivo architecture and are an established model for lumen formation. 1. Knockdown of Par-3 in this system results in a reduced lumen size, formation of multiple lumen and complete loss of aPKC at the apical domain (Hao et al., 2010; Horikoshi et al., 2009). Thus, the correct localization of Par-3 in aPKCɩ deficient EBs might explain the remaining aPKC signal of aPKCζ at the apical domain in aPKCɩ deficient EBs. 2. Studies regarding Par-6 have shown that overexpression of the Par-6 N-terminus in MDCK cells results in impaired cyst formation with a smaller central lumen and redistribution of aPKC to the cytosol (M. Kim, Datta, Brakeman, Yu, & Mostov, 2007). Considering the majority of publication, Par-6 binding to aPKC is thought to inhibit aPKC activity in general (Yamanaka et al., 2001). In complex with Par-6, aPKC becomes activated through interaction with other proteins. However, a more recent study has demonstrated that Par-6 binding to aPKC replaces the pseudosubstrate from the kinase domain and activates aPKC (Graybill et al., 2012). It seems difficult to combine both studies to a general mechanism and it is possible that each mechanism applies to one specific aPKC isoform. In fact, Yamanaka et al. presumably investigated aPKCɩ only, while the Graybill et al. study is based entirely on aPKCζ. If this model is true, overexpression of the Par-6 N-terminus would inhibit aPKCɩ and activate aPKCζ at the same time. Thus, it is likely that the remaining aPKC signal at the apical pole in MDCK cysts is activated aPKCζ. Finally, similar to the EB model, overexpression of kinasedead aPKCɩ in MDCK cells results in the formation of multiple-lumen cyst, just like in the Par-3 knockdown studies. We therefore conclude that both aPKC isoforms are necessary for complete formation of a single central lumen in both models and that the deletion of aPKCɩ might be partly compensated by aPKCζ. To verify the results from aPKC inhibition studies it would be crucial to investigate cavity/lumen formation using a system deficient for both aPKC isoforms on which we are currently working. 53 53 aPKCɩ deficient embryos show impaired TJ proteins Others have reported that the absence, inhibition or depletion of aPKCs has an influence on TJ formation and lumen formation in various in vitro model systems (Desclozeaux et al., 2008; Hao et al., 2010; Izumi et al., 1998). The fact that we see a size reduced amniotic cavity in aPKCɩ deficient embryos suggest an underlying mechanism that is similar to the systems using cell-based approaches. Thus we further looked at the localization of marker proteins for polarity and cell-cell junctions in mutants embryos. First we investigated the localization of E-cadherin and occludin using immunofluorescence (IF). The correct localization of E-cadherin showed that the apical domain was established even though the signal was slightly diffuse. The localization of occludin at the intersection of two cells in a spot-like manner is an important marker for TJ formation and was detectable in both genotypes. Similar to the E-cadherin the Occludin signal was more diffuse compared to the wildtype.. Next we looked at the localization of ZO-1, a marker for TJs in aPKCɩ deficient embryos. We found a massive reduction of the ZO-1 protein at the apical domain of mutant embryos which might be due to reduced expression levels. It has been shown that inhibition of aPKCs or expression of a dominant-negative (dn) version of aPKC results in loss of ZO-1 at the TJ and causes reduced tightness of the TJs (Gopalakrishnan et al., 2007). The main different between these studies and the study on aPKCɩ deficiency in embryos is that the knockout approach is specific for one isofrom, while the expression of a dn protein affects both isoforms. Most inhibitors, such as myristolated pseudosubstrate (PS) act on both isoforms, therefore all effects upon PS treatment are a result of a pan-aPKC inhibition. Atypical PKCs play a crucial role in TJ formation, but the existing body of evidence does not proof that the loss of aPKCs directly causes ZO-1 relocation which directly causes TJ disassembly. Besides, if aPKCɩ and ZO-1 would share a common exclusive pathway the phenotypes of the KO mice would be expected to be similar, unless there is a functional redundant substitute. When we compared the two phenotypes we saw that ZO-1 deficient mice die around E9.5, thus later than the aPKCɩ deficient embryos (Katsuno et al., 2008). Likely candidates to compensate the loss of ZO-1 are naturally ZO-2 and ZO-3. The deletion of ZO-2 causes a phenotype with first signs of growth retardation at E6.5. At E8.5 the embryos display impaired gastrulation resulting in complete apoptosis (Xu et al., 2008). In contrast, ZO-3 deficient mice show no apparent phenotype (Xu et al., 2008). However, in ZO-1-/- Eph4 cells it has been shown that ZO-2 gets recruited to the junctional areas during polarization and substitutes ZO-1 (Umeda, 2004). In spite ZO-2 localization at the junctional site ZO-1 deficient cells still show 54 54 retarded recruitment of occludin. This indicates a unique function of ZO-1 in regulating the tightness of the TJs. In the case of occludin we have to rely data from other model systems. In MDCK cells and chick intestinal epithelial cells occludin phosphorylation highly correlates with TJ formation (Sakakibara, Furuse, Saitou, Ando-Akatsuka, & Tsukita, 1997; Wong, 1997). Even though there are no studies showing definitive data that aPKCs might be the kinase that regulates occludin phosphorylation and localization it had been shown in MDCK cells that overexpression of kinase-dead aPKCɩ causes delocalization of various TJ proteins including ZO-1, Par-3, occludin and E-cadherin. A study on the role of aPKC activity in TJ formation showed that treatment with myristolated pseudosubstrate results in decreased levels of phoshorylated occludin and ZO-1 in MDCK cells. In addition, aPKCs have been reported to directly interact with or phosphorylate a number of proteins that colocalize at the TJ including JAM-1 (Iden et al., 2012), Par3 (Gopalakrishnan, Hallett, Atkinson, & Marrs, 2007), Par-6 (Heather E Cunliffe, 2012) and ZO-1 (Fanning, Ma, & Anderson, 2002). Thus, occludin appears to be a likely substrate of aPKCs. Both, the EB data and the immunoflourescence data from the mutant embryos indicates that the loss of aPKCɩ influences the formation of cell-cell junctions. Thus, we used electron microscopy to further support our data from the IF analysis and we found no apparent differences in mutants compared to wild-type animals regarding AJCs. According to our work, neither TJ formation nor AJ and desmosomes were impaired in embryos lacking aPKCɩ. The fact that we still have correct localization in the absence of aPKCɩ indicates a similar role of aPKCζ regarding occludin regulation. Considering the present data the following model would be possible: Deletion of aPKCɩ interferes with the recruitment of ZO-1 and thereby with the establishment of TJs. However, ZO-2 is able to substitute ZO-1 at the apical domain and allows the formation of TJ. The incorporation of ZO-2 influences the recruitment of occludin and causes slight structural impairments. As a result of a feedback loop, the formation of TJs causes a decline in ZO-1 expression by a yet unknown mechanism (Anderson et al., 1989). In later stages of embryogenesis the functionally impaired TJ result in growth retardation and finally reabsorption of the embryo. This model is not entirely conclusive since we still detect ZO-1 expression in wild-type embryos where proper TJ are established and therefore also should suppress ZO-1 expression. The ZO-1 signal might be unaffected, because this mechanism only effects the cells forming the apical domain and therefore 55 55 reflects a small pool of the whole embryo. Regarding the role of aPKCζ in ZO-1 phosphorylation and possible redundancy we assume that expression levels of the protein are too low to compensate the loss of the aPKCɩ function. This is backed-up by our own data from mutant embryos that shows no up-regulation of aPKCζ expression in aPKCɩ deficient embryos. 56 56 Expression of aPKCζ partially rescues the aPKCɩ phenotype The issue of redundancy among aPKCs has probably been discussed since scientists have looked at the first sequence alignment of the two isoforms. With a staggering 72%(Clustal2W) homology those two proteins are very similar to each other. Even more interesting is that most of the differences are found within two regions of the proteins: the very N-terminal part (approximately 14aa) and the hinge region (approximately 60aa) are highly variable. Sequence alignment of these two regions shows a 7% homology (Clustal2W) between the isoforms. In contrast, alignment of the functional domains results in 80% homology. Only little work has been published showing a direct functional comparison of the two aPKCs and both isoforms have been treated as equals in most studies. However, when Kovac et al. compared expression levels in the early stages of embryogenesis and specific tissues in adult mice they were showing ubiquitous expression of aPKCɩ and in comparison a more restricted and lower aPKCζ expression (Kovac, Oster, & Leitges, 2007; Oster, Eichele, & Leitges, 2004). Analysis of aPKCɩ and aPKCζ in zebrafish revealed multiple and redundant functions during vertebrate retinogenesis (Cui, Otten, Rohr, Abdelilah-Seyfried, & Link, 2007). The majority of the early data is either based on unspecific inhibition studies, overexpression of one isoform without considering the other or on the use of ‘specific antibodies’. Thus, most biochemical studies regarding aPKCs are studies on aPKC functions with limited information about isoform-specificity. In recent years an increasing amount of data has been published using deletion models of aPKC isoforms either from conventional knockouts or, in the case of aPKCɩ, conditional knockout material. Many of these publications address the role of aPKC isoforms in various cancer types including among others lung (Regala et al., 2009), breast (Heather E Cunliffe, 2012) and colon cancer (N. R. Murray, Weems, Braun, Leitges, & Fields, 2009) However, we know from earlier studies that aPKCζ expression is lower in most tissues compared to aPKCɩ (Kovac et al., 2007; Oster et al., 2004). Thus, one can argue that the phenotype of the aPKCɩ deficient mice is stronger than of the aPKCζ-deficient mice because aPKCζ is not present in sufficient protein levels. Consequently, the aPKCζ phenotype is milder because of the high expression of aPKCɩ that compensates the loss. To further address this possibility we decided to design a knock-in approach based on the aPKCɩ KO mice. If both isoforms are functionally redundant then overexpression of aPKCζ without aPKCɩ present should rescue the phenotype. Therefore, the knock-in approach was designed to assure comparable expression levels of the introduced aPKCζ compared 57 57 to the native aPKCɩ. This was achieved by using the same regulatory elements that regulate the endogenous aPKCɩ expression. Similar to the aPKCɩ deficiency, no homozygous rescue animals were born, indicating a lethal phenotype. When we analyzed embryos we noticed that: 1. Embryos at E7.5 we were not able to distinguish between wild-type embryos and homozygous carrier of the rescue allele ( all embryos appeared to be normal). Our study indicates that whatever causes the lethality at stage E7.5 in aPKCɩ deficient embryos can be rescued by aPKCζ expression. 2. Embryos at E8.5 appeared to be normal. We detected embryos with reduced size at E9.5 which were proven to be homozygous for the rescue allele exclusively. This clearly shows that the phenotype of the aPKCɩ deficient embryo at E7.5 can be rescued by additional aPKCζ, indicating a redundancy between both proteins at this stage of development. After E7.5 and before E11.5 the deficiency of aPKCɩ is causing a problem that cannot be compensated by aPKCζ and subsequently leads to absorption of the embryos. Our studies did not include further experiments on the rescue animals but further studies on the phenotype will be performed in the future. 58 58 Summary and future perspectives In this thesis we present evidence for distinct functions and specific regulatory mechanisms of the atypical PKC isoforms. Despite the order of publication, the idea of paperI was based on preliminary data from paperII. Since the phenotypes of the aPKC knock-out are so dramatically different we hypothesized that specific function of the aPKCs might be achieved by specific localization and/or regulation of the proteins. Our effort resulted in the first publication “Functional comparison of protein domains within aPKCs involved in nucleocytoplasmic shuttling”. This paper clearly shows that the current perception of atypical PKCs as two proteins with redundant functions needs to be reconsidered and that both isoforms not only have overlapping roles but also might have unique functions not only in cancer but also in other cellular processes. For the first time we were able show the hinge region as a functional domain within aPKCs with distinct properties in each isoform. Subsequentlywe performed the analysis of the aPKCiota deficient embryos which partly was based on data from paper I in order to characterize the underlying mechanism of the observed phenotype. As a result, paperII “Phenotypical analysis of atypical PKCs in vivo functions display a compensatory system at embryonic stage 7.5 p.c.” provides more than a description of a phenotype. In PaperII we show that the phenotype is not due to impaired apico-basal polarization or failure in development of the germlines. It seems that the lethal phenotype of aPKCiota deficiency at 7.5 p.c. is mostly due to the insufficient amounts of aPKCzeta present at this stage. This theory is backed up by overexpression of aPKCzeta, which is able to rescue the early lethality but leads to a lethal phenotype at 10.5 p.c. At the same time we could see an increased expression of aPKCzeta in aPKCiota deficient EBs. To further investigate whether aPKCzeta is indeed upregulated in aPKCiota deficient embryos we are in the process to produce embryos deficient for both aPKS. These animals will allow us to verify the remaining signal and to show whether it really is aPKCzeta or a unspecific background. Even if aPKCzeta is overexpressed in aPKCiota deficient embryos we still do not understand why the rescue animals that expression additional aPKCzeta die around E.9.5. Future work on the role of aPKCzeta in embryogenesis will include the role of caspase cleavage of the protein in the observed rescue phenotype and which specific function of aPKCiota is not compensated by aPKC zeta expression. The latest will include morphological analysis of the rescue animals 59 59 References Akimoto, K., Mizuno, K., Osada, S., Hirai, S., Tanuma, S., Suzuki, K., & Ohno, S. (1994). A new member of the third class in the protein kinase C family, PKC lambda, expressed dominantly in an undifferentiated mouse embryonal carcinoma cell line and also in many tissues and cells. Journal of Biological Chemistry, 269(17), 12677. Akimoto, K., Nakaya, M., Yamanaka, T., Tanaka, J., Matsuda, S., Weng, Q. P., et al. (1998). Atypical protein kinase Clambda binds and regulates p70 S6 kinase. Biochemical Journal, 335(Pt 2), 417. Allen, J. J., Li, M., Brinkworth, C. S., Paulson, J. L., Wang, D., Hübner, A., et al. (2007). A semisynthetic epitope for kinase substrates. Nature Methods, 4(6), 511–516. doi: 10.1038/nmeth1048 Anderson, J. M., Van Itallie, C. M., Peterson, M. D., Stevenson, B. R., Carew, E. A., & Mooseker, M. S. (1989). ZO-1 mRNA and protein expression during tight junction assembly in Caco-2 cells. The Journal of Cell Biology, 109(3), 1047–1056. Atwood, S. X., & Prehoda, K. E. (2009). aPKC phosphorylates Miranda to polarize fate determinants during neuroblast asymmetric cell division. Current Biology : CB, 19(9), 723–729. doi:10.1016/j.cub.2009.03.056 Aurrand-Lions, M., Duncan, L., Ballestrem, C., & Imhof, B. A. (2001). JAM-2, a novel immunoglobulin superfamily molecule, expressed by endothelial and lymphatic cells. The Journal of Biological Chemistry, 276(4), 2733–2741. doi:10.1074/ jbc.M005458200 Balendran, A., Biondi, R. M., Cheung, P. C., Casamayor, A., Deak, M., & Alessi, D. R. (2000). A 3-phosphoinositide-dependent protein kinase-1 (PDK1) docking site is required for the phosphorylation of protein kinase Czeta (PKCzeta ) and PKC- 60 60 related kinase 2 by PDK1. The Journal of Biological Chemistry, 275(27), 20806– 20813. doi:10.1074/jbc.M000421200 Baluch, D. P., Koeneman, B. A., Hatch, K. R., McGaughey, R. W., & Capco, D. G. (2004). PKC isotypes in post-activated and fertilized mouse eggs: association with the meiotic spindle. Developmental Biology, 274(1), 45–55. doi:10.1016/j.ydbio. 2004.05.030 Basu, A. (2002). Proteolytic Activation of Protein Kinase C-epsilon by Caspase-mediated Processing and Transduction of Antiapoptotic Signals. Journal of Biological Chemistry, 277(44), 41850–41856. doi:10.1074/jbc.M205997200 Benton, R., & St Johnston, D. (2003). Drosophila PAR-1 and 14-3-3 inhibit Bazooka/PAR-3 to establish complementary cortical domains in polarized cells. Cell, 115(6), 691– 704. Berra, E., Diaz-Meco, M. T., Dominguez, I., Municio, M. M., Sanz, L., Lozano, J., et al. (1993). Protein kinase C zeta isoform is critical for mitogenic signal transduction. Cell, 74(3), 555–563. Berra, E., Diaz-Meco, M. T., Lozano, J., Frutos, S., Municio, M. M., Sanchez, P., et al. (1995). Evidence for a role of MEK and MAPK during signal transduction by protein kinase C zeta. The EMBO Journal, 14(24), 6157–6163. Berra, E., Municio, M. M., Sanz, L., Frutos, S., Diaz-Meco, M. T., & Moscat, J. (1997). Positioning atypical protein kinase C isoforms in the UV-induced apoptotic signaling cascade. Molecular and Cellular Biology, 17(8), 4346–4354. Betschinger, J., Mechtler, K., & Knoblich, J. A. (2003). The Par complex directs asymmetric cell division by phosphorylating the cytoskeletal protein Lgl. Nature, 422(6929), 326–330. doi:10.1038/nature01486 Biscardi, J. S., Tice, D. A., & Parsons, S. J. (1999). c-Src, receptor tyrosine kinases, and human cancer. Advances in Cancer Research, 76, 61–119. 61 61 Bjorkoy, G. (2005). p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. The Journal of Cell Biology, 171(4), 603–614. doi:10.1083/jcb.200507002 Bogerd, H. P., Benson, R. E., Truant, R., Herold, A., Phingbodhipakkiya, M., & Cullen, B. R. (1999). Definition of a consensus transportin-specific nucleocytoplasmic transport signal. The Journal of Biological Chemistry, 274(14), 9771–9777. Bornancin, F., & Parker, P. J. (1997). Phosphorylation of protein kinase C-alpha on serine 657 controls the accumulation of active enzyme and contributes to its phosphataseresistant state. The Journal of Biological Chemistry, 272(6), 3544–3549. Boyd, L., Guo, S., Levitan, D., Stinchcomb, D. T., & Kemphues, K. J. (1996). PAR-2 is asymmetrically distributed and promotes association of P granules and PAR-1 with the cortex in C. elegans embryos. Development, 122(10), 3075–3084. Brejc, K., van Dijk, W. J., Klaassen, R. V., Schuurmans, M., van der Oost, J., Smit, A. B., & Sixma, T. K. (2001). Crystal structure of an ACh-binding protein reveals the ligandbinding domain of nicotinic receptors. Nature, 411(6835), 269–276. doi: 10.1038/35077011 Calado, A., Kutay, U., Kühn, U., Wahle, E., & Carmo-Fonseca, M. (2000). Deciphering the cellular pathway for transport of poly(A)-binding protein II. RNA (New York, N.Y.), 6(2), 245–256. Chen, F., Ma, L., Parrini, M. C., Mao, X., Lopez, M., Wu, C., et al. (2000). Cdc42 is required for PIP2-induced actin polymerization and early development but not for cell viability. Current Biology, 10(13), 758–765. doi:10.1016/ S0960-9822(00)00571-6 Chen, J. G. (2004). GCR1 Can Act Independently of Heterotrimeric G-Protein in Response to Brassinosteroids and Gibberellins in Arabidopsis Seed Germination. Plant Physiology, 135(2), 907–915. doi:10.1104/pp.104.038992 62 62 Clausen, T. H., Lamark, T., Isakson, P., Finley, K., Larsen, K. B., Brech, A., et al. (2010). p62/SQSTM1 and ALFY interact to facilitate the formation of p62 bodies/ALIS and their degradation by autophagy. Autophagy, 6(3), 330–344. Cline, E. G., & Nelson, W. J. (2007). Characterization of Mammalian Par 6 as a DualLocation Protein. Molecular and Cellular Biology, 27(12), 4431–4443. doi:10.1128/ MCB.02235-06 Collingridge, G. L., Olsen, R. W., Peters, J., & Spedding, M. (2009). A nomenclature for ligand-gated ion channels. Neuropharmacology, 56(1), 2–5. doi:10.1016/ j.neuropharm.2008.06.063 Colón-González, F., & Kazanietz, M. G. (2006). C1 domains exposed: from diacylglycerol binding to protein-protein interactions. Biochimica Et Biophysica Acta, 1761(8), 827–837. doi:10.1016/j.bbalip.2006.05.001 Coucouvanis, E., & Martin, G. R. (1995). Signals for death and survival: a two-step mechanism for cavitation in the vertebrate embryo. Cell, 83(2), 279–287. Cui, S., Otten, C., Rohr, S., Abdelilah-Seyfried, S., & Link, B. A. (2007). Analysis of aPKClambda and aPKCzeta reveals multiple and redundant functions during vertebrate retinogenesis. Molecular and Cellular Neurosciences, 34(3), 431–444. doi:10.1016/j.mcn.2006.11.016 Dard, N., Le, T., Maro, B., & Louvet-Vallée, S. (2009). Inactivation of aPKCλ Reveals a Context Dependent Allocation of Cell Lineages in Preimplantation Mouse Embryos. PLoS ONE, 4(9), e7117. doi:10.1371/journal.pone.0007117 Datta, R. (1997). Caspase-3-mediated Cleavage of Protein Kinase C theta in Induction of Apoptosis. Journal of Biological Chemistry, 272(33), 20317–20320. doi:10.1074/jbc. 272.33.20317 Desclozeaux, M., Venturato, J., Wylie, F. G., Kay, J. G., Joseph, S. R., Le, H. T., & Stow, J. L. (2008). Active Rab11 and functional recycling endosome are required for E63 63 cadherin trafficking and lumen formation during epithelial morphogenesis. American Journal of Physiology-Cell Physiology, 295(2), C545–56. doi:10.1152/ajpcell. 00097.2008 Diaz-Meco, M. T., Municio, M. M., Frutos, S., Sanchez, P., Lozano, J., Sanz, L., & Moscat, J. (1996a). The product of par-4, a gene induced during apoptosis, interacts selectively with the atypical isoforms of protein kinase C. Cell, 86(5), 777–786. Diaz-Meco, M. T., Municio, M. M., Sanchez, P., Lozano, J., & Moscat, J. (1996b). Lambdainteracting protein, a novel protein that specifically interacts with the zinc finger domain of the atypical protein kinase C isotype lambda/iota and stimulates its kinase activity in vitro and in vivo. Molecular and Cellular Biology, 16(1), 105–114. Duran, A., Diaz-Meco, M. T., & Moscat, J. (2003). Essential role of RelA Ser311 phosphorylation by zetaPKC in NF-kappaB transcriptional activation. The EMBO Journal, 22(15), 3910–3918. doi:10.1093/emboj/cdg370 Durgan, J., Kaji, N., Jin, D., & Hall, A. (2011). Par6B and Atypical PKC Regulate Mitotic Spindle Orientation during Epithelial Morphogenesis. Journal of Biological Chemistry, 286(14), 12461–12474. doi:10.1074/jbc.M110.174235 Ebnet, K., Schulz, C. U., Meyer Zu Brickwedde, M. K., Pendl, G. G., & Vestweber, D. (2000). Junctional adhesion molecule interacts with the PDZ domain-containing proteins AF-6 and ZO-1. The Journal of Biological Chemistry, 275(36), 27979– 27988. doi:10.1074/jbc.M002363200 Ebnet, K., Suzuki, A., Horikoshi, Y., Hirose, T., Meyer Zu Brickwedde, M. K., Ohno, S., & Vestweber, D. (2001). The cell polarity protein ASIP/PAR-3 directly associates with junctional adhesion molecule (JAM). The EMBO Journal, 20(14), 3738–3748. doi: 10.1093/emboj/20.14.3738 64 64 Eckert, J. J., & Fleming, T. P. (2008). Tight junction biogenesis during early development. Biochimica Et Biophysica Acta, 1778(3), 717–728. doi:10.1016/j.bbamem. 2007.09.031 Eckert, J. J., McCallum, A., Mears, A., Rumsby, M. G., Cameron, I. T., & Fleming, T. P. (2004). Specific PKC isoforms regulate blastocoel formation during mouse preimplantation development. Developmental Biology, 274(2), 384–401. doi: 10.1016/j.ydbio.2004.07.027 Edwards, A. S., & Newton, A. C. (1997). Phosphorylation at conserved carboxyl-terminal hydrophobic motif regulates the catalytic and regulatory domains of protein kinase C. The Journal of Biological Chemistry, 272(29), 18382–18390. Edwards, A. S., Faux, M. C., Scott, J. D., & Newton, A. C. (1999). Carboxyl-terminal phosphorylation regulates the function and subcellular localization of protein kinase C betaII. The Journal of Biological Chemistry, 274(10), 6461–6468. Etienne-Manneville, S., & Hall, A. (2003). Cell polarity: Par6, aPKC and cytoskeletal crosstalk. Current Opinion in Cell Biology, 15(1), 67–72. Evans, J. H., Murray, D., Leslie, C. C., & Falke, J. J. (2006). Specific translocation of protein kinase Calpha to the plasma membrane requires both Ca2+ and PIP2 recognition by its C2 domain. Molecular Biology of the Cell, 17(1), 56–66. doi: 10.1091/mbc.E05-06-0499 Facchinetti, V., Ouyang, W., Wei, H., Soto, N., Lazorchak, A., Gould, C., et al. (2008). The mammalian target of rapamycin complex 2 controls folding and stability of Akt and protein kinase C. The EMBO Journal, 27(14), 1932–1943. doi:10.1038/emboj. 2008.120 Fagotto, F., Glück, U., & Gumbiner, B. M. (1998). Nuclear localization signal-independent and importin/karyopherin-independent nuclear import of β-catenin. Current Biology, 8(4), 181–190. doi:10.1016/S0960-9822(98)70082-X 65 65 Fang, L., Wang, Y., Du, D., Yang, G., Tak Kwok, T., Kai Kong, S., et al. (2007). Cell polarity protein Par3 complexes with DNA-PK via Ku70 and regulates DNA double-strand break repair. Cell Research, 17(2), 100–116. doi:10.1038/sj.cr.7310145 Fanning, A. S., Jameson, B. J., Jesaitis, L. A., & Anderson, J. M. (1998). The tight junction protein ZO-1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton. The Journal of Biological Chemistry, 273(45), 29745–29753. Fanning, A. S., Ma, T. Y., & Anderson, J. M. (2002). Isolation and functional characterization of the actin binding region in the tight junction protein ZO-1. FASEB Journal : Official Publication of the Federation of American Societies for Experimental Biology, 16(13), 1835–1837. doi:10.1096/fj.02-0121fje Fornerod, M., Ohno, M., Yoshida, M., & Mattaj, I. W. (1997). CRM1 is an export receptor for leucine-rich nuclear export signals. Cell, 90(6), 1051–1060. Frank, E., & Landgraf, R. (2008). The vasopressin system--from antidiuresis to psychopathology. European Journal of Pharmacology, 583(2-3), 226–242. doi: 10.1016/j.ejphar.2007.11.063 Freeley, M., Kelleher, D., & Long, A. (2011). Regulation of Protein Kinase C function by phosphorylation on conserved and non-conserved sites. Cellular Signalling, 23(5), 753–762. doi:10.1016/j.cellsig.2010.10.013 Frutos, S., Moscat, J., & Diaz-Meco, M. T. (1999). Cleavage of ζPKC but not λ/ιPKC by caspase-3 during UV-induced apoptosis. Journal of Biological Chemistry, 274(16), 10765. Furuse, M., Fujita, K., Hiiragi, T., Fujimoto, K., & Tsukita, S. (1998). Claudin-1 and -2: novel integral membrane proteins localizing at tight junctions with no sequence similarity to occludin. The Journal of Cell Biology, 141(7), 1539–1550. 66 66 Furuse, M., Hirase, T., Itoh, M., Nagafuchi, A., Yonemura, S., Tsukita, S., & Tsukita, S. (1993). Occludin: a novel integral membrane protein localizing at tight junctions. The Journal of Cell Biology, 123(6 Pt 2), 1777–1788. Furuse, M., Itoh, M., Hirase, T., Nagafuchi, A., Yonemura, S., Tsukita, S., & Tsukita, S. (1994). Direct association of occludin with ZO-1 and its possible involvement in the localization of occludin at tight junctions. The Journal of Cell Biology, 127(6 Pt 1), 1617–1626. Furuse, M., Sasaki, H., & Tsukita, S. (1999). Manner of interaction of heterogeneous claudin species within and between tight junction strands. The Journal of Cell Biology, 147(4), 891–903. Goodnight, J., Kazanietz, M. G., Blumberg, P. M., Mushinski, J. F., & Mischak, H. (1992). The cDNA sequence, expression pattern and protein characteristics of mouse protein kinase C-zeta. Gene, 122(2), 305–311. Gopalakrishnan, S., Hallett, M. A., Atkinson, S. J., & Marrs, J. A. (2007). aPKC-PAR complex dysfunction and tight junction disassembly in renal epithelial cells during ATP depletion. American Journal of Physiology-Cell Physiology, 292(3), C1094– 102. doi:10.1152/ajpcell.00099.2006 Gómez, J., Pitton, C., García, A., Martinez de Aragón, A., Silva, A., & Rebollo, A. (1995). The zeta isoform of protein kinase C controls interleukin-2-mediated proliferation in a murine T cell line: evidence for an additional role of protein kinase C epsilon and beta. Experimental Cell Research, 218(1), 105–113. doi:10.1006/excr.1995.1136 Graybill, C., Wee, B., Atwood, S. X., & Prehoda, K. E. (2012). Par-6 activates atypical protein kinase C by pseudosubstrate displacement. The Journal of Biological Chemistry. doi:10.1074/jbc.M112.360495 Grodsky, N., Li, Y., Bouzida, D., Love, R., Jensen, J., Nodes, B., et al. (2006). Structure of the catalytic domain of human protein kinase C beta II complexed with a 67 67 bisindolylmaleimide inhibitor. Biochemistry, 45(47), 13970–13981. doi:10.1021/ bi061128h Guillemot, L., Paschoud, S., Pulimeno, P., Foglia, A., & Citi, S. (2008). The cytoplasmic plaque of tight junctions: a scaffolding and signalling center. Biochimica Et Biophysica Acta, 1778(3), 601–613. doi:10.1016/j.bbamem.2007.09.032 Guo, S., & Kemphues, K. J. (1995). par-1, a gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed. Cell, 81(4), 611–620. Gusarova, G. A., Dada, L. A., Kelly, A. M., Brodie, C., Witters, L. A., Chandel, N. S., & Sznajder, J. I. (2009). Alpha1-AMP-activated protein kinase regulates hypoxiainduced Na,K-ATPase endocytosis via direct phosphorylation of protein kinase C zeta. Molecular and Cellular Biology, 29(13), 3455–3464. doi:10.1128/MCB. 00054-09 Halet, G. (2004). PKC signaling at fertilization in mammalian eggs. Biochimica Et Biophysica Acta, 1742(1-3), 185–189. doi:10.1016/j.bbamcr.2004.09.012 Hanahan, D., & Weinberg, R. A. (2011). Hallmarks of cancer: the next generation. Cell, 144(5), 646–674. doi:10.1016/j.cell.2011.02.013 Hanks, S. K., & Hunter, T. (1995). Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB Journal : Official Publication of the Federation of American Societies for Experimental Biology, 9(8), 576–596. Hao, Y., Du, Q., Chen, X., Zheng, Z., Balsbaugh, J. L., Maitra, S., et al. (2010). Par3 controls epithelial spindle orientation by aPKC-mediated phosphorylation of apical Pins. Current Biology : CB, 20(20), 1809–1818. doi:10.1016/j.cub.2010.09.032 Harris, R. C., Chung, E., & Coffey, R. J. (2003). EGF receptor ligands. Experimental Cell Research, 284(1), 2–13. 68 68 Hauge, C., Antal, T. L., Hirschberg, D., Doehn, U., Thorup, K., Idrissova, L., et al. (2007). Mechanism for activation of the growth factor-activated AGC kinases by turn motif phosphorylation. The EMBO Journal, 26(9), 2251–2261. doi:10.1038/sj.emboj. 7601682 Heather E Cunliffe, Y. J. K. M. F. F. Y. P. S. M. (2012). PAR6B is required for tight junction formation and activated PKCζ localization in breast cancer. American Journal of Cancer Research, 2(5), 478. Henderson, B. R. (2000). Nuclear-cytoplasmic shuttling of APC regulates beta-catenin subcellular localization and turnover. Nature Cell Biology, 2(9), 653–660. doi: 10.1038/35023605 Henrique, D. (2003). Cell polarity: the ups and downs of the Par6/aPKC complex. Current Opinion in Genetics & Development, 13(4), 341–350. doi:10.1016/ S0959-437X(03)00077-7 Hirano, Y. (2004a). Solution Structure of Atypical Protein Kinase C PB1 Domain and Its Mode of Interaction with ZIP/p62 and MEK5. Journal of Biological Chemistry, 279(30), 31883–31890. doi:10.1074/jbc.M403092200 Hirano, Y. (2004b). Structure of a Cell Polarity Regulator, a Complex between Atypical PKC and Par6 PB1 Domains. Journal of Biological Chemistry, 280(10), 9653–9661. doi:10.1074/jbc.M409823200 Hirase, T., Staddon, J. M., Saitou, M., Ando-Akatsuka, Y., Itoh, M., Furuse, M., et al. (1997). Occludin as a possible determinant of tight junction permeability in endothelial cells. Journal of Cell Science, 110 ( Pt 14), 1603–1613. Horikoshi, Y., Suzuki, A., Yamanaka, T., Sasaki, K., Mizuno, K., Sawada, H., et al. (2009). Interaction between PAR-3 and the aPKC-PAR-6 complex is indispensable for apical domain development of epithelial cells. Journal of Cell Science, 122(10), 1595–1606. doi:10.1242/jcs.043174 69 69 House, C., & Kemp, B. E. (1987). Protein kinase C contains a pseudosubstrate prototope in its regulatory domain. Science, 238(4834), 1726–1728. Hung, T. J., & Kemphues, K. J. (1999). PAR-6 is a conserved PDZ domain-containing protein that colocalizes with PAR-3 in Caenorhabditis elegans embryos. Development, 126(1), 127–135. Hurov, J. B., Watkins, J. L., & Piwnica-Worms, H. (2004). Atypical PKC phosphorylates PAR-1 kinases to regulate localization and activity. Current Biology : CB, 14(8), 736–741. doi:10.1016/j.cub.2004.04.007 Iden, S., Misselwitz, S., Peddibhotla, S. S. D., Tuncay, H., Rehder, D., Gerke, V., et al. (2012). aPKC phosphorylates JAM-A at Ser285 to promote cell contact maturation and tight junction formation. The Journal of Cell Biology, 196(5), 623–639. doi: 10.1083/jcb.201104143 Ikenoue, T., Inoki, K., Yang, Q., Zhou, X., & Guan, K.-L. (2008). Essential function of TORC2 in PKC and Akt turn motif phosphorylation, maturation and signalling. The EMBO Journal, 27(14), 1919–1931. doi:10.1038/emboj.2008.119 Inoue, M., Kishimoto, A., Takai, Y., & Nishizuka, Y. (1977). Studies on a cyclic nucleotideindependent protein kinase and its proenzyme in mammalian tissues. II. Proenzyme and its activation by calcium-dependent protease from rat brain. The Journal of Biological Chemistry, 252(21), 7610–7616. Ishiuchi, T., & Takeichi, M. (2011). Willin and Par3 cooperatively regulate epithelial apical constriction through aPKC-mediated ROCK phosphorylation. Nature Cell Biology, 13(7), 860–866. doi:10.1038/ncb2274 Itoh, M., Furuse, M., Morita, K., Kubota, K., Saitou, M., & Tsukita, S. (1999). Direct binding of three tight junction-associated MAGUKs, ZO-1, ZO-2, and ZO-3, with the COOH termini of claudins. The Journal of Cell Biology, 147(6), 1351–1363. 70 70 Izumi, Y., Hirose, T., Tamai, Y., Hirai, S., Nagashima, Y., Fujimoto, T., et al. (1998). An atypical PKC directly associates and colocalizes at the epithelial tight junction with ASIP, a mammalian homologue of Caenorhabditis elegans polarity protein PAR-3. The Journal of Cell Biology, 143(1), 95–106. Jaken, S., & Parker, P. J. (2000). Protein kinase C binding partners. BioEssays : News and Reviews in Molecular, Cellular and Developmental Biology, 22(3), 245–254. doi: 10.1002/(SICI)1521-1878(200003)22:3<245::AID-BIES6>3.0.CO;2-X Joberty, G., Petersen, C., Gao, L., & Macara, I. G. (2000). The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Nature Cell Biology, 2(8), 531– 539. Johnson, D. A., Akamine, P., Radzio-Andzelm, E., Madhusudan, M., & Taylor, S. S. (2001). Dynamics of cAMP-dependent protein kinase. Chemical Reviews, 101(8), 2243– 2270. Karmacharya, M. B., Jang, J.-I., Lee, Y.-J., Lee, Y.-S., & Soh, J.-W. (2010). Mutation of the hydrophobic motif in a phosphorylation-deficient mutant renders protein kinase C delta more apoptotically active. Archives of Biochemistry and Biophysics, 493(2), 242–248. doi:10.1016/j.abb.2009.11.007 Kato, K., Yamanouchi, D., Esbona, K., Kamiya, K., Zhang, F., Kent, K. C., & Liu, B. (2009). Caspase-mediated protein kinase C-delta cleavage is necessary for apoptosis of vascular smooth muscle cells. American Journal of Physiology. Heart and Circulatory Physiology, 297(6), H2253–61. doi:10.1152/ajpheart.00274.2009 Katsuno, T., Umeda, K., Matsui, T., Hata, M., Tamura, A., Itoh, M., et al. (2008). Deficiency of zonula occludens-1 causes embryonic lethal phenotype associated with defected yolk sac angiogenesis and apoptosis of embryonic cells. Molecular Biology of the Cell, 19(6), 2465–2475. doi:10.1091/mbc.E07-12-1215 71 71 Kazanietz, M. G., Areces, L. B., Bahador, A., Mischak, H., Goodnight, J., Mushinski, J. F., & Blumberg, P. M. (1993). Characterization of ligand and substrate specificity for the calcium-dependent and calcium-independent protein kinase C isozymes. Molecular Pharmacology, 44(2), 298–307. Kemphues, K. J., Priess, J. R., Morton, D. G., & Cheng, N. S. (1988). Identification of genes required for cytoplasmic localization in early C. elegans embryos. Cell, 52(3), 311–320. Ki, H., Oh, M., Chung, S. W., & Kim, K. (2008). β-Catenin can bind directly to CRM1 independently of adenomatous polyposis coli, which affects its nuclear localization and LEF-1/β-catenin-dependent gene expression. Pharmacological Research, 32(4), 394–400. doi:10.1016/j.cellbi.2007.12.008 Kikkawa, U., Kishimoto, A., & Nishizuka, Y. (1989). The protein kinase C family: heterogeneity and its implications. Annual Review of Biochemistry, 58, 31–44. doi: 10.1146/annurev.bi.58.070189.000335 Kim, J.-S., Park, Z.-Y., Yoo, Y.-J., Yu, S.-S., & Chun, J.-S. (2005). p38 kinase mediates nitric oxide-induced apoptosis of chondrocytes through the inhibition of protein kinase C zeta by blocking autophosphorylation. Cell Death and Differentiation, 12(3), 201–212. doi:10.1038/sj.cdd.4401511 Kim, M., Datta, A., Brakeman, P., Yu, W., & Mostov, K. E. (2007). Polarity proteins PAR6 and aPKC regulate cell death through GSK-3beta in 3D epithelial morphogenesis. Journal of Cell Science, 120(14), 2309–2317. doi:10.1242/jcs.007443 Kim, S.-J., Kim, H.-G., Oh, C.-D., Hwang, S.-G., Song, W.-K., Yoo, Y.-J., et al. (2002). p38 kinase-dependent and -independent Inhibition of protein kinase C zeta and -alpha regulates nitric oxide-induced apoptosis and dedifferentiation of articular chondrocytes. The Journal of Biological Chemistry, 277(33), 30375–30381. doi: 10.1074/jbc.M205193200 72 72 Komura, H., Ogita, H., Ikeda, W., Mizoguchi, A., Miyoshi, J., & Takai, Y. (2007). Establishment of cell polarity by afadin during the formation of embryoid bodies. Genes to Cells, 13(1), 79–90. doi:10.1111/j.1365-2443.2007.01150.x Kovac, J., Oster, H., & Leitges, M. (2007). Expression of the atypical protein kinase C (aPKC) isoforms ι/λ and ζ during mouse embryogenesis. Gene Expression Patterns, 7(1-2), 187–196. doi:10.1016/j.modgep.2006.07.002 Lamark, T. (2003). Interaction Codes within the Family of Mammalian Phox and Bem1p Domain-containing Proteins. Journal of Biological Chemistry, 278(36), 34568– 34581. doi:10.1074/jbc.M303221200 Lamark, T., Kirkin, V., Dikic, I., & Johansen, T. (2009). NBR1 and p62 as cargo receptors for selective autophagy of ubiquitinated targets. Cell Cycle (Georgetown, Tex.), 8(13), 1986–1990. Le Good, J. A. (1998). Protein Kinase C Isotypes Controlled by Phosphoinositide 3-Kinase Through the Protein Kinase PDK1. Science, 281(5385), 2042–2045. doi:10.1126/ science.281.5385.2042 Leitges, M., Sanz, L., Martin, P., Duran, A., Braun, U., Garci'a, J. F., et al. (2001). Targeted disruption of the [zeta] PKC gene results in the impairment of the NF-[kappa] B pathway. Molecular Cell, 8(4), 771–780. Lin, D., Edwards, A. S., Fawcett, J. P., Mbamalu, G., Scott, J. D., & Pawson, T. (2000). A mammalian PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC signalling and cell polarity. Nature Cell Biology, 2(8), 540–547. doi:10.1038/35019582 Litherland, G. J., Elias, M. S., Hui, W., Macdonald, C. D., Catterall, J. B., Barter, M. J., et al. (2010). Protein kinase C isoforms zeta and iota mediate collagenase expression and cartilage destruction via STAT3- and ERK-dependent c-fos induction. The Journal of Biological Chemistry, 285(29), 22414–22425. doi:10.1074/ jbc.M110.120121 73 73 Liu, Y., Graham, C., Li, A., Fisher, R. J., & Shaw, S. (2002). Phosphorylation of the protein kinase C-theta activation loop and hydrophobic motif regulates its kinase activity, but only activation loop phosphorylation is critical to in vivo nuclear-factor-kappaB induction. Biochemical Journal, 361(Pt 2), 255–265. Luna-Ulloa, L. B., Hernandez-Maqueda, J. G., Santoyo-Ramos, P., Castaneda-Patlan, M. C., & Robles-Flores, M. (2011). Protein kinase C is a positive modulator of canonical Wnt signaling pathway in tumoral colon cell lines. Carcinogenesis, 32(11), 1615–1624. doi:10.1093/carcin/bgr190 Madshus, I. H., & Stang, E. (n.d.). Internalization and intracellular sorting of the EGF receptor: a model for understanding the mechanisms of receptor trafficking. Jcs.Biologists.org. Maines, M. D., Miralem, T., Lerner-Marmarosh, N., Shen, J., & Gibbs, P. E. M. (2007). Human biliverdin reductase, a previously unknown activator of protein kinase C betaII. The Journal of Biological Chemistry, 282(11), 8110–8122. doi:10.1074/ jbc.M513427200 Maiyar, A. C., Leong, M. L. L., & Firestone, G. L. (2003). Importin-alpha mediates the regulated nuclear targeting of serum- and glucocorticoid-inducible protein kinase (Sgk) by recognition of a nuclear localization signal in the kinase central domain. Molecular Biology of the Cell, 14(3), 1221–1239. doi:10.1091/mbc.E02-03-0170 MAKOWSKE, M., & ROSEN, O. (1989). Complete Activation of Protein Kinase-C by an Antipeptide Antibody Directed Against the Pseudosubstrate Prototope. The Journal of Biological Chemistry, 264(27), 16155–16159. Manning, G., Whyte, D. B., Martinez, R., Hunter, T., & Sudarsanam, S. (2002). The protein kinase complement of the human genome. Science, 298(5600), 1912–1934. doi: 10.1126/science.1075762 74 74 Marsh, L., Neiman, A. M., & Herskowitz, I. (1991). Signal transduction during pheromone response in yeast. Annual Review of Cell …. McManus, E. J., Collins, B. J., Ashby, P. R., Prescott, A. R., Murray-Tait, V., Armit, L. J., et al. (2004). The in vivo role of PtdIns(3,4,5)P3 binding to PDK1 PH domain defined by knockin mutation. The EMBO Journal, 23(10), 2071–2082. doi:10.1038/sj.emboj. 7600218 Messerschmidt, A., Macieira, S., Velarde, M., Bädeker, M., Benda, C., Jestel, A., et al. (2005). Crystal structure of the catalytic domain of human atypical protein kinase Ciota reveals interaction mode of phosphorylation site in turn motif. Journal of Molecular Biology, 352(4), 918–931. doi:10.1016/j.jmb.2005.07.060 Murray, N. R., Weems, J., Braun, U., Leitges, M., & Fields, A. P. (2009). Protein Kinase C II and PKC/: Collaborating Partners in Colon Cancer Promotion and Progression. Cancer Research, 69(2), 656–662. doi:10.1158/0008-5472.CAN-08-3001 Mutig, K., Paliege, A., Kahl, T., Jöns, T., Müller-Esterl, W., & Bachmann, S. (2007). Vasopressin V2 receptor expression along rat, mouse, and human renal epithelia with focus on TAL. American Journal of Physiology. Renal Physiology, 293(4), F1166–77. doi:10.1152/ajprenal.00196.2007 Nakamura, R., Sumimoto, H., Mizuki, K., Hata, K., Ago, T., Kitajima, S., et al. (1998). The PC motif: a novel and evolutionarily conserved sequence involved in interaction between p40phox and p67phox, SH3 domain-containing cytosolic factors of the phagocyte NADPH oxidase. European Journal of Biochemistry / FEBS, 251(3), 583–589. Nakanishi, H., Brewer, K. A., & Exton, J. H. (1993). Activation of the zeta isozyme of protein kinase C by phosphatidylinositol 3,4,5-trisphosphate. Journal of Biological Chemistry. 75 75 Neri, L. M., Martelli, A. M., Borgatti, P., Colamussi, M. L., Marchisio, M., & Capitani, S. (1999). Increase in nuclear phosphatidylinositol 3-kinase activity and phosphatidylinositol (3,4,5) trisphosphate synthesis precede PKC-zeta translocation to the nucleus of NGF-treated PC12 cells. FASEB Journal : Official Publication of the Federation of American Societies for Experimental Biology, 13(15), 2299–2310. Noda, Y. (2003). Molecular Recognition in Dimerization between PB1 Domains. Journal of Biological Chemistry, 278(44), 43516–43524. doi:10.1074/jbc.M306330200 Nusrat, A., Chen, J. A., Foley, C. S., Liang, T. W., Tom, J., Cromwell, M., et al. (2000). The coiled-coil domain of occludin can act to organize structural and functional elements of the epithelial tight junction. The Journal of Biological Chemistry, 275(38), 29816– 29822. doi:10.1074/jbc.M002450200 Ohno, S. (2001). Intercellular junctions and cellular polarity: the PAR-aPKC complex, a conserved core cassette playing fundamental roles in cell polarity. Current Opinion in Cell Biology, 13(5), 641–648. Ono, Y., Fujii, T., Ogita, K., Kikkawa, U., Igarashi, K., & Nishizuka, Y. (1989). Protein kinase C zeta subspecies from rat brain: its structure, expression, and properties. Proceedings of the National Academy of Sciences, 86(9), 3099–3103. Oster, H., Eichele, G., & Leitges, M. (2004). Differential expression of atypical PKCs in the adult mouse brain. Brain Research. Molecular Brain Research, 127(1-2), 79–88. doi:10.1016/j.molbrainres.2004.05.009 Palmeri, D., & Malim, M. H. (1999). Importin beta can mediate the nuclear import of an arginine-rich nuclear localization signal in the absence of importin alpha. Molecular and Cellular Biology, 19(2), 1218. Pankiv, S., Lamark, T., Bruun, J. A., Overvatn, A., Bjorkoy, G., & Johansen, T. (2010). Nucleocytoplasmic Shuttling of p62/SQSTM1 and Its Role in Recruitment of Nuclear 76 76 Polyubiquitinated Proteins to Promyelocytic Leukemia Bodies. Journal of Biological Chemistry, 285(8), 5941–5953. doi:10.1074/jbc.M109.039925 Pauken, C. (2000). The Expression and Stage-Specific Localization of Protein Kinase C Isotypes during Mouse Preimplantation Development. Developmental Biology, 223(2), 411–421. doi:10.1006/dbio.2000.9763 Pauken, C. M., & Capco, D. G. (1999). Regulation of cell adhesion during embryonic compaction of mammalian embryos: roles for PKC and beta-catenin. Molecular Reproduction and Development, 54(2), 135–144. doi:10.1002/ (SICI)1098-2795(199910)54:2<135::AID-MRD5>3.0.CO;2-A Pellettieri, J., & Seydoux, G. (2002). Anterior-Posterior Polarity in C. elegans and Drosophila--PARallels and Differences. Science. Perander, M. (2000). Nuclear Import and Export Signals Enable Rapid Nucleocytoplasmic Shuttling of the Atypical Protein Kinase C lambda. Journal of Biological Chemistry, 276(16), 13015–13024. doi:10.1074/jbc.M010356200 Plant, P. J., Fawcett, J. P., Lin, D. C. C., Holdorf, A. D., Binns, K., Kulkarni, S., & Pawson, T. (2003). A polarity complex of mPar-6 and atypical PKC binds, phosphorylates and regulates mammalian Lgl. Nature Cell Biology, 5(4), 301–308. doi:10.1038/ncb948 Pollard, V. W., Michael, W. M., Nakielny, S., Siomi, M. C., Wang, F., & Dreyfuss, G. (1996). A novel receptor-mediated nuclear protein import pathway. Cell, 86(6), 985–994. Powell, C. T., Gschwend, J. E., Fair, W. R., Brittis, N. J., Stec, D., & Huryk, R. (1996). Overexpression of Protein Kinase C-zeta (PKC-ζ) Inhibits Invasive and Metastatic Abilities of Dunning R-3327 MAT-LyLu Rat Prostate Cancer Cells. Cancer Research. Pu, Y., Peach, M. L., Garfield, S. H., Wincovitch, S., Marquez, V. E., & Blumberg, P. M. (2006). Effects on Ligand Interaction and Membrane Translocation of the Positively Charged Arginine Residues Situated along the C1 Domain Binding Cleft in the 77 77 Atypical Protein Kinase C Isoforms. Journal of Biological Chemistry, 281(44), 33773–33788. doi:10.1074/jbc.M606560200 Puls, A., Schmidt, S., Grawe, F., & Stabel, S. (1997). Interaction of protein kinase C zeta with ZIP, a novel protein kinase C-binding protein. Proceedings of the National Academy of Sciences, 94(12), 6191–6196. Qi, Y., Liu, J., Wu, X., Brakebusch, C., Leitges, M., Han, Y., et al. (2011). Cdc42 controls vascular network assembly through protein kinase Cι during embryonic vasculogenesis. Arteriosclerosis, Thrombosis, and Vascular Biology, 31(8), 1861– 1870. doi:10.1161/ATVBAHA.111.230144 Quest, A. F., & Bell, R. M. (1994). The regulatory region of protein kinase C gamma. Studies of phorbol ester binding to individual and combined functional segments expressed as glutathione S-transferase fusion proteins indicate a complex mechanism of regulation by phospholipids, phorbol esters, and divalent cations. The Journal of Biological Chemistry, 269(31), 20000–20012. Raz, T., Eliyahu, E., Yesodi, V., & Shalgi, R. (1998). Profile of protein kinase C isozymes and their possible role in mammalian egg activation. FEBS Letters, 431(3), 415– 418. Rebane, A., Aab, A., & Steitz, J. A. (2004). Transportins 1 and 2 are redundant nuclear import factors for hnRNP A1 and HuR. RNA (New York, N.Y.), 10(4), 590–599. Regala, R. P., Davis, R. K., Kunz, A., Khoor, A., Leitges, M., & Fields, A. P. (2009). Atypical protein kinase C{iota} is required for bronchioalveolar stem cell expansion and lung tumorigenesis. Cancer Research, 69(19), 7603–7611. doi: 10.1158/0008-5472.CAN-09-2066 Roepstorff, K., Grandal, M. V., Henriksen, L., Knudsen, S. L. J., Lerdrup, M., Grøvdal, L., et al. (2009). Differential Effects of EGFR Ligands on Endocytic Sorting of the 78 78 Receptor. Traffic (Copenhagen, Denmark), 10(8), 1115–1127. doi:10.1111/j. 1600-0854.2009.00943.x Rybin, V. O., Guo, J., Gertsberg, Z., Elouardighi, H., & Steinberg, S. F. (2007). Protein kinase Cepsilon (PKCepsilon) and Src control PKCdelta activation loop phosphorylation in cardiomyocytes. The Journal of Biological Chemistry, 282(32), 23631–23638. doi:10.1074/jbc.M701676200 Saitou, M., Fujimoto, K., Doi, Y., Itoh, M., Fujimoto, T., Furuse, M., et al. (1998). Occludindeficient embryonic stem cells can differentiate into polarized epithelial cells bearing tight junctions. The Journal of Cell Biology, 141(2), 397–408. Sakakibara, A., Furuse, M., Saitou, M., Ando-Akatsuka, Y., & Tsukita, S. (1997). Possible involvement of phosphorylation of occludin in tight junction formation. The Journal of Cell Biology, 137(6), 1393–1401. Samuels, I. S., Seibenhener, M. L., Neidigh, K. B. W., & Wooten, M. W. (2001). Nerve growth factor stimulates the interaction of ZIP/p62 with atypical protein kinase C and targets endosomal localization: Evidence for regulation of nerve growth factorinduced differentiation. Journal of Cellular Biochemistry, 82(3), 452–466. doi: 10.1002/jcb.1177 Sanchez, P., De Carcer, G., Sandoval, I. V., Moscat, J., & Diaz-Meco, M. T. (1998). Localization of atypical protein kinase C isoforms into lysosome-targeted endosomes through interaction with p62. Molecular and Cellular Biology, 18(5), 3069–3080. Sanz, L. (1999). The interaction of p62 with RIP links the atypical PKCs to NF-kappa B activation. The EMBO Journal, 18(11), 3044–3053. doi:10.1093/emboj/18.11.3044 Sanz, L. (2000). The atypical PKC-interacting protein p62 channels NF-kappa B activation by the IL-1-TRAF6 pathway. The EMBO Journal, 19(7), 1576–1586. doi:10.1093/ emboj/19.7.1576 79 79 Sato, T. (2005). Regulation of the Assembly and Adhesion Activity of E-cadherin by Nectin and Afadin for the Formation of Adherens Junctions in Madin-Darby Canine Kidney Cells. The Journal of Biological Chemistry, 281(8), 5288–5299. doi:10.1074/ jbc.M510070200 Sánchez-Bautista, S., Marín-Vicente, C., Gómez-Fernández, J. C., & Corbalán-García, S. (2006). The C2 domain of PKCalpha is a Ca2+ -dependent PtdIns(4,5)P2 sensing domain: a new insight into an old pathway. Journal of Molecular Biology, 362(5), 901–914. doi:10.1016/j.jmb.2006.07.093 Schaeffer, E., Smith, D., Mardon, G., Quinn, W., & Zuker, C. (1989). Isolation and characterization of two new drosophila protein kinase C genes, including one specifically expressed in photoreceptor cells. Cell, 57(3), 403–412. Seibel, N. M., Eljouni, J., Nalaskowski, M. M., & Hampe, W. (2007). Nuclear localization of enhanced green fluorescent protein homomultimers. Analytical Biochemistry, 368(1), 95–99. doi:10.1016/j.ab.2007.05.025 Seifert, K., Ibrahim, H., Stodtmeister, T., Winklbauer, R., & Niessen, C. M. (n.d.). An adhesion-independent, aPKC-dependent function for cadherins in morphogenetic movements. Jcs.Biologists.org. Selbie, L. A., Schmitz-Peiffer, C., Sheng, Y., & Biden, T. J. (1993). Molecular cloning and characterization of PKC iota, an atypical isoform of protein kinase C derived from insulin-secreting cells. The Journal of Biological Chemistry, 268(32), 24296–24302. Smith, C. A., Lau, K. M., Rahmani, Z., Dho, S. E., Brothers, G., She, Y. M., et al. (2007). aPKC-mediated phosphorylation regulates asymmetric membrane localization of the cell fate determinant Numb. The EMBO Journal, 26(2), 468–480. doi:10.1038/ sj.emboj.7601495 80 80 Smith, L. (2000). Activation of Atypical Protein Kinase C zeta by Caspase Processing and Degradation by the Ubiquitin-Proteasome System. Journal of Biological Chemistry, 275(51), 40620–40627. doi:10.1074/jbc.M908517199 Smith, L. (2002). Lack of Constitutive Activity of the Free Kinase Domain of Protein Kinase C zeta . DEPENDENCE ON TRANSPHOSPHORYLATION OF THE ACTIVATION LOOP. Journal of Biological Chemistry, 277(48), 45866–45873. doi:10.1074/ jbc.M206420200 Soloff, R. S., Katayama, C., Lin, M. Y., Feramisco, J. R., & Hedrick, S. M. (2004). Targeted deletion of protein kinase C lambda reveals a distribution of functions between the two atypical protein kinase C isoforms. Journal of Immunology (Baltimore, Md. : 1950), 173(5), 3250–3260. Sossin, W. S., & Schwartz, J. H. (1993). Ca(2+)-independent protein kinase Cs contain an amino-terminal domain similar to the C2 consensus sequence. Trends in Biochemical Sciences, 18(6), 207–208. Stade, K., Ford, C. S., Guthrie, C., & Weis, K. (1997). Exportin 1 (Crm1p) is an essential nuclear export factor. Cell, 90(6), 1041–1050. Sumandea, M. P., Rybin, V. O., Hinken, A. C., Wang, C., Kobayashi, T., Harleton, E., et al. (2008). Tyrosine phosphorylation modifies protein kinase C delta-dependent phosphorylation of cardiac troponin I. The Journal of Biological Chemistry, 283(33), 22680–22689. doi:10.1074/jbc.M802396200 Suzuki, A., Ishiyama, C., Hashiba, K., Shimizu, M., Ebnet, K., & Ohno, S. (2002). aPKC kinase activity is required for the asymmetric differentiation of the premature junctional complex during epithelial cell polarization. Journal of Cell Science, 115(Pt 18), 3565–3573. Suzuki, A., Yamanaka, T., Hirose, T., Manabe, N., Mizuno, K., Shimizu, M., et al. (2001). Atypical protein kinase C is involved in the evolutionarily conserved par protein 81 81 complex and plays a critical role in establishing epithelia-specific junctional structures. The Journal of Cell Biology, 152(6), 1183–1196. Tabuse, Y., Izumi, Y., Piano, F., Kemphues, K. J., Miwa, J., & Ohno, S. (1998). Atypical protein kinase C cooperates with PAR-3 to establish embryonic polarity in Caenorhabditis elegans. Development, 125(18), 3607–3614. Takai, Y., Kishimoto, A., Inoue, M., & Nishizuka, Y. (1977). Studies on a cyclic nucleotideindependent protein kinase and its proenzyme in mammalian tissues. I. Purification and characterization of an active enzyme from bovine cerebellum. The Journal of Biological Chemistry, 252(21), 7603–7609. Tao, R.-H., & Maruyama, I. N. (2008). All EGF(ErbB) receptors have preformed homo- and heterodimeric structures in living cells. Journal of Cell Science, 121(Pt 19), 3207– 3217. doi:10.1242/jcs.033399 Tarkowski, A. K., & Wróblewska, J. (1967). Development of blastomeres of mouse eggs isolated at the 4- and 8-cell stage. Journal of Embryology and …. Toker, A., Meyer, M., Reddy, K. K., Falck, J. R., Aneja, R., Aneja, S., et al. (1994). Activation of protein kinase C family members by the novel polyphosphoinositides PtdIns-3,4-P2 and PtdIns-3,4,5-P3. Journal of Biological …. Traweger, A., Wiggin, G., Taylor, L., Tate, S. A., Metalnikov, P., & Pawson, T. (2008). Protein phosphatase 1 regulates the phosphorylation state of the polarity scaffold Par-3. Proceedings of the National Academy of Sciences of the United States of America, 105(30), 10402–10407. doi:10.1073/pnas.0804102105 Tunggal, J. A., Helfrich, I., Schmitz, A., Schwarz, H., Günzel, D., Fromm, M., et al. (2005). E-cadherin is essential for in vivo epidermal barrier function by regulating tight junctions. The EMBO Journal, 24(6), 1146–1156. doi:10.1038/sj.emboj.7600605 82 82 Umar, S., Sellin, J. H., & Morris, A. P. (2000). Increased nuclear translocation of catalytically active PKC-zeta during mouse colonocyte hyperproliferation. American Journal of Physiology-Gastrointestinal and Liver Physiology, 279(1), G223–37. Umeda, K. (2004). Establishment and Characterization of Cultured Epithelial Cells Lacking Expression of ZO-1. The Journal of Biological Chemistry, 279(43), 44785–44794. doi:10.1074/jbc.M406563200 Vinot, S., Le, T., Ohno, S., Pawson, T., Maro, B., & Louvet-Vallée, S. (2005). Asymmetric distribution of PAR proteins in the mouse embryo begins at the 8-cell stage during compaction. Developmental Biology, 282(2), 307–319. doi:10.1016/j.ydbio. 2005.03.001 Wald, F. A., Oriolo, A. S., Mashukova, A., Fregien, N. L., Langshaw, A. H., & Salas, P. J. I. (2008). Atypical protein kinase C (iota) activates ezrin in the apical domain of intestinal epithelial cells. Journal of Cell Science, 121(5), 644–654. doi:10.1242/jcs. 016246 Wang, C., Shang, Y., Yu, J., & Zhang, M. (2012). Substrate Recognition Mechanism of Atypical Protein Kinase Cs Revealed by the Structure of PKCι in Complex with a Substrate Peptide from Par-3. Structure (London, England : 1993), 20(5), 791–801. doi:10.1016/j.str.2012.02.022 Wataru Ikeda, H. N. J. M. K. M. H. I. M. T. A. T. K. T. H. N. H. Y. A. M. S.-I. N. Y. T. (1999). Afadin: A Key Molecule Essential for Structural Organization of Cell–Cell Junctions of Polarized Epithelia during Embryogenesis. The Journal of Cell Biology, 146(5), 1117. Watkins, J. L., Lewandowski, K. T., Meek, S. E. M., Storz, P., Toker, A., & Piwnica-Worms, H. (2008). Phosphorylation of the Par-1 polarity kinase by protein kinase D regulates 14-3-3 binding and membrane association. Proceedings of the National 83 83 Academy of Sciences of the United States of America, 105(47), 18378–18383. doi: 10.1073/pnas.0809661105 Watts, J. L., Etemad-Moghadam, B., Guo, S., Boyd, L., Draper, B. W., Mello, C. C., et al. (1996). par-6, a gene involved in the establishment of asymmetry in early C. elegans embryos, mediates the asymmetric localization of PAR-3. Development, 122(10), 3133–3140. Waugh, C., Sinclair, L., Finlay, D., Bayascas, J. R., & Cantrell, D. (2009). Phosphoinositide (3,4,5)-triphosphate binding to phosphoinositide-dependent kinase 1 regulates a protein kinase B/Akt signaling threshold that dictates T-cell migration, not proliferation. Molecular and Cellular Biology, 29(21), 5952–5962. doi:10.1128/MCB. 00585-09 Welchman, D. P., Mathies, L. D., & Ahringer, J. (2007). Similar requirements for CDC-42 and the PAR-3/PAR-6/PKC-3 complex in diverse cell types. Developmental Biology, 305(1), 347–357. doi:10.1016/j.ydbio.2007.02.022 White, W. O., Seibenhener, M. L., & Wooten, M. W. (2002). Phosphorylation of tyrosine 256 facilitates nuclear import of atypical protein kinase C. Journal of Cellular Biochemistry, 85(1), 42–53. doi:10.1002/jcb.10101 Wilson, M. I., Gill, D. J., Perisic, O., Quinn, M. T., & Williams, R. L. (2003). PB1 domainmediated heterodimerization in NADPH oxidase and signaling complexes of atypical protein kinase C with Par6 and p62. Molecular Cell, 12(1), 39–50. Wodarz, A., Ramrath, A., Grimm, A., & Knust, E. (2000). Drosophila atypical protein kinase C associates with Bazooka and controls polarity of epithelia and neuroblasts. The Journal of Cell Biology, 150(6), 1361–1374. Wong, V. (1997). Phosphorylation of occludin correlates with occludin localization and function at the tight junction. The American Journal of Physiology, 273(6 Pt 1), C1859–67. 84 84 Wooten, M. W., Zhou, G., Wooten, M. C., & Seibenhener, M. L. (1997). Transport of protein kinase C isoforms to the nucleus of PC12 cells by nerve growth factor: association of atypical zeta-PKC with the nuclear matrix. Journal of Neuroscience Research, 49(4), 393–403. doi:10.1002/(SICI)1097-4547(19970815)49:4<393::AIDJNR1>3.0.CO;2-3 Wu, S. L. (1998). Structure, Expression, and Properties of an Atypical Protein Kinase C (PKC3) from Caenorhabditis elegans. PKC3 IS REQUIRED FOR THE NORMAL PROGRESSION OF EMBRYOGENESIS AND VIABILITY OF THE ORGANISM. Journal of Biological Chemistry, 273(2), 1130–1143. doi:10.1074/jbc.273.2.1130 Wu, X., Li, S., Chrostek-Grashoff, A., Czuchra, A., Meyer, H., Yurchenco, P. D., & Brakebusch, C. (2007). Cdc42 is crucial for the establishment of epithelial polarity during early mammalian development. Developmental Dynamics, 236(10), 2767– 2778. doi:10.1002/dvdy.21309 Xu, J., Kausalya, P. J., Phua, D. C. Y., Ali, S. M., Hossain, Z., & Hunziker, W. (2008). Early embryonic lethality of mice lacking ZO-2, but Not ZO-3, reveals critical and nonredundant roles for individual zonula occludens proteins in mammalian development. Molecular and Cellular Biology, 28(5), 1669–1678. YAMANAKA, T., Horikoshi, Y., Izumi, N., Suzuki, A., Mizuno, K., & Ohno, S. (2006). Lgl mediates apical domain disassembly by suppressing the PAR-3-aPKC-PAR-6 complex to orient apical membrane polarity. Journal of Cell Science, 119(Pt 10), 2107–2118. doi:10.1242/jcs.02938 YAMANAKA, T., Horikoshi, Y., Sugiyama, Y., Ishiyama, C., Suzuki, A., Hirose, T., et al. (2003). Mammalian Lgl forms a protein complex with PAR-6 and aPKC independently of PAR-3 to regulate epithelial cell polarity. Current Biology : CB, 13(9), 734–743. 85 85 Yamanaka, T., Horikoshi, Y., Suzuki, A., Sugiyama, Y., Kitamura, K., Maniwa, R., et al. (2001). PAR-6 regulates aPKC activity in a novel way and mediates cell-cell contact-induced formation of the epithelial junctional complex. Genes to Cells : Devoted to Molecular & Cellular Mechanisms, 6(8), 721–731. Zaczek, A., Brandt, B., & Bielawski, K. P. (2005). The diverse signaling network of EGFR, HER2, HER3 and HER4 tyrosine kinase receptors and the consequences for therapeutic approaches. Histology and Histopathology, 20(3), 1005–1015. Zhou, G. (1997). Nucleolin Is a Protein Kinase C-zeta Substrate. CONNECTION BETWEEN CELL SURFACE SIGNALING AND NUCLEUS IN PC12 CELLS. Journal of Biological Chemistry, 272(49), 31130–31137. doi:10.1074/jbc. 272.49.31130 Zingg, H. H. (1996). Vasopressin and oxytocin receptors. Baillière's Clinical Endocrinology and Metabolism, 10(1), 75–96. doi:10.1016/S0950-351X(96)80314-4 86 86 I Research Article 1 Functional comparison of protein domains within aPKCs involved in nucleocytoplasmic shuttling Sebastian Seidl, Ursula B. Braun and Michael Leitges* Biotechnology Centre of Oslo, University of Oslo, NO-0349, Oslo, Norway *Author for correspondence ([email protected]) Biology Open Biology Open 000, 1–10 doi: 10.1242/bio.2012505 Summary The atypical protein kinases C (PKC) isoforms i and f play crucial roles in regulation of signaling pathways related to proliferation, differentiation and cell survival. Over the years several interaction partners and phosphorylation targets have been identified. However, little is known about the regulation of atypical aPKC isoforms. To address this question, we performed a comparative analysis of atypical aPKCi/l and f in MDCK cells. By using green fluorescence protein (GFP) fusion proteins containing the full-length or truncated proteins, we were able to recognize differences in subcellular localization and nucleocytoplasmic shuttling of both isoforms. We show, that an earlier described nuclear localization sequence (NLS), plays a role in the regulation of atypical aPKCf but not in aPKCi, despite the fact that it is present in both isoforms. Leptomycin B treatment induces accumulation of GFP-fusion protein of both isoforms in the nucleus. Regardless, the loss of the NLS only decreases shuttling of aPKCf, while aPKCi remains unaffected. In Introduction Signal transduction is an essential process that enables the cell to interpret incoming signals and interact with the surrounding environment. Many different signaling pathways and a wide variety of mechanisms are utilized to accomplish this translation. Kinase activation is a very common mechanism that alone can amplify the incoming signal through the phosphorylation of specific substrates. Kinase substrates are often themselves kinases. Protein Kinase C (PKC) represents a serine/threonine kinase gene family that has often been described as having a major role in signal transduction events. Nine PKC members have been described in mammals which are divided into three subgroups based on their biochemical properties and sequence homology: Classical PKCs (a, b and c), novel PKCs (d, e, h and g) and atypical PKCs (f and i/l). Classical and novel PKCs have been found to bind and be activated by tumor-promoting phorbol esters (TPA) which has connected at least some of their physiological in vivo functions to the promotion of cancer. Atypical PKCs were the last to be identified and characterized. Remarkably, early findings showed that both aPKC isoforms are unresponsive to TPA and are also activated independently of calcium and diacylglycerin under normal cell conditions. Thus aPKCs represent a PKC subgroup that is clearly separated from the rest by its mode of activation. Both atypical PKC isoforms have been found to be regulated through their cysteine-rich C1 addition, we identified the hinge region as a potential regulator of localization of atypical PKCs. With a set of chimeric proteins we show that the hinge region of aPKCi mediates nuclear localization. In contrast, the hinge region of aPKCf causes exclusion from the nucleus, indicating two different mechanisms leading to isoform specific regulation. Taken together, we show for the first time, that the atypical isoforms aPKCi and f underly different mechanisms regarding their regulation of subcellular localization and translocation into the nucleus in MDCK cells. ß 2012. Published by The Company of Biologists Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Share Alike License (http://creativecommons.org/licenses/by-nc-sa/3.0). Key words: GFP-fusion protein, HINGE domain, NLS, Atypical Protein kinase C, Nuclear translocation, Nucleocytoplasmic shuttling domain by Par-4 activation (Dı́az-Meco et al., 1996) and through their Phox/Bem1 (PB1) domain by interaction with p62 and PAR-6 (Puls et al., 1997; Joberty et al., 2000; Sánchez et al., 1998). Another striking point within the aPKC subgroup is the high content of homologous amino acids between them (72% overall) (Akimoto et al., 1994) which limits the availability of isoform-specific tools. Thus it remains difficult to biochemically analyze and distinguish between the two aPKC isoforms. In addition, many overexpression studies have so far failed to assign functional differences to PKCf and PKCi/l (Diaz-Meco and Moscat, 2001; Uberall et al., 1999). Nevertheless recent attempts utilizing the gene targeting approach in mice have revealed that highly specific in vivo functions exist for both aPKCs. For example, the phenotypical analysis of the PKCf deficient mouse line lead to the identification of impairment of the NFkB signalling pathway (Leitges et al., 2001) as well as changes in IL-4 and IL-6 signaling (Martin et al., 2002; Galvez et al., 2009). A conventional knock-out of PKCi/l revealed a fundamental role for this kinase during embryonic development (Bandyopadhyay et al., 2004; Soloff et al., 2004; unpublished data). Tissue specific knockouts of this isoform have also shown the importance of PKC i/l in the adult organism (Farese et al., 2007; Huber et al., 2009; Murray et al., 2009; Yang et al., 2009). Whereas the embryonic lethal phenotype of PKCi/l could be partly explained by the lack of PKCf expression at the defined Nucleocytoplasmic shuttling PKCs time of development (Kovac et al., 2007) all other described phenotypes of both aPKC knockouts take place with the existence of the alternate aPKC isoform. Thus these in vivo findings clearly imply that both aPKCs have an isoform-specific, non-redundant function in the cell, even when co-expressed. How these specificities are regulated remains largely unclear. Since specific localization of PKCs within a cell is believed to be one way of controlling specificity (Rosse et al., 2010) we decided to screen for domains within both aPKCs which are able to direct localization and are different between the two isoforms. Results Biology Open 1. Generation of truncated aPKC/GFP fusion proteins. We have used truncated aPKC proteins fused with a GFP tag to follow and identify domains that confer aPKC isoform specific translocation ability. Except for the full length constructs of both isoforms, we have generated mutant constructs that focus on changes in the N-terminal regulatory region of the proteins and have a truncated C-terminal, thus they are missing the kinase domain. Although we cannot say that translocation sequences do not exist in the C-terminal kinase region, we expected to see more changes in translocation potential upon alteration of the Nterminal regulatory region. Thus we initially generated the following for both isoforms: the GFP labeled full length construct; an (aPKCDcatalytic) construct missing the whole kinase domain including a nuclear export sequence (NES); an N-terminal version (aPKC AA1-176(177*)) including the PB1 (Phox and Bem1) and a C1 (cystein-rich) domain but excluding the hinge region. We further generated a construct consisting of the hinge region alone (aPKCHINGE) (Fig. 1A). All fusion proteins have been tested for expression and stability of the protein in MDCK cells via western blot (supplementary material Fig. S1). 2 2. Isoform-specific domains cause different subcellular localization. To test whether the truncation mutants are able to identify domains within aPKCs which convey isoform-specific localization we overexpressed each construct in MDCK cells. Both full length constructs showed a widely distributed diffuse GFP signal over the whole cell without prominent membrane localization. There was a slightly increased PKCi nuclear localization when compared to aPKCf full length (Fig. 2A,B). Deletion of the C-terminal kinase domain changed the distribution. The aPKCiDcatalytic fusion protein localized exclusively in the nucleus with a regional concentration of the GFP signal within the nucleolus (Fig. 2C). In sharp contrast the corresponding truncated PKCfDcatalytic construct showed an almost exclusive and very strong membrane signal (Fig. 2D) which resembled that associated with the role of aPKC in polarity. We proceeded by testing N-terminal truncations missing the hinge region (aPKCAA1-176(177)) and found there was a reversion back to a similar localization pattern between the two isoforms (Fig. 2E,F). However, in contrast to the full length proteins, both truncated versions located to the nucleus with a distinct punctate pattern. This pattern was different to that seen with the aPKCiDcatalytic form. Based on these results further investigation focused on the hinge region alone was merited. Analysis of the aPKCiHINGE construct showed a dominant localization to the nucleus as well as a diffuse weak staining in the cytoplasm (Fig. 2G). The corresponding PKCfHINGE construct showed cytoplasmic staining with some aggregates surrounding the nucleus, no membrane staining, and most significantly, an exclusion from the nucleus (Fig. 2H). Taken together these results identified first that the hinge region of both aPKCs harbors information important for subcellular localization and second that the N-terminal causes localization to the nucleus and does not need the hinge region for this localization to occur. 3. Functional investigation of aPKC nuclear localization sequence (NLS). Fig. 1. Schematic presentation of GFP-fusion proteins. Domain organization of atypical PKC and the constructs generated to test the localization of truncated atypical PKC proteins. All proteins were expressed as a GFP fusion protein with a C-terminal tag. Given the fact that nuclear localization of aPKC represents a new area of research in aPKC in vivo function, we decided to investigate the underlying mechanism. A functional nuclear localization sequence (NLS) located within the C1 domain had been defined in both aPKCs (Perander et al., 2001). To evaluate whether this motif drives the PKCiAA1-177 fragment into the nucleus within our experimental context we mutated the amino acid sequence AKRNFRR to AKRNFEE in order to generate a nonfunctional NLS. Upon transfection with this construct in MDCK cells we were not able to detect any difference to that found with the parental construct (data not shown). These findings suggested that the N-terminal PKCiAA1-177 fragment translocates into the nucleus in an NLS independent manner through a different mechanism and we assumed that this was also true for the N-terminal PKCfAA1-176 fragment. We next asked whether the NLS could have an impact on the kinetics of nuclear translocation of both aPKCs. Differences in the nuclear translocation kinetics among aPKCs had been earlier discussed by others (Perander et al., 2001). Based on the finding that N-terminal constructs localize to the nucleus we next worked with full length constructs for both aPKCs in order to analyze the 3 Biology Open Nucleocytoplasmic shuttling PKCs Fig. 2. Differences in sub-cellular localization of truncated aPKC protein. MDCK cells were transfected with different aPKCi (A,C,E,G) or aPKCf fusion proteins (B,D,F,H). The insert shows magnification of the marked area (square) in the overview. Visualization of the nucleus was achieved by DAPI staining. Membrane staining was performed using Alexa FluorH 647 conjugated wheat-germ agglutinin (WGA). All pictures were taken with the ZEISS LSM 520 microscope. The areas representing the cytosolic fraction or nuclear fraction are indicated with bars at the top of each histogram. The histogram analysis was performed with the ‘profile tool’ in the LSM MetaH software. The analyzed area is indicated by the yellow straight line in the overview. Scale bar: 50 mm (overview), 10 mm (insert). All experiments were performed in triplicates. translocation kinetics upon Leptomycin B (LMB) treatment. Treatment with LMB effectively blocks all nuclear export related to CRM1/Exportin and represents an established method to study nucleo-cytoplasmic shuttling (Lischka et al., 2001; Kudo et al., 1998). When comparing mouse aPKC cDNA sequences we observed that aPKCf contains a G to R exchange at position 141(AKRFNRG; supplementary material Fig. S3). This sequence variation in the NLS had been described to affect the binding of importin a/b and subsequently affect the nuclear translocation Nucleocytoplasmic shuttling PKCs kinetics since the AKRNFRR motif containing three arginine’s (as found in PKCi) enables a direct binding of importin b instead of a sequential binding of importin a followed by importin b (Palmeri and Malim, 1999). Thus we first analyzed the translocation behavior of both full length aPKC-GFP fusion constructs by measuring the GFP signal ratio between the cytosol and the nucleus. Both aPKCs accumulated in the nucleus upon LMB treatment but it was clear that PKCi accumulated faster and attained a higher level after 6 hours of treatment (Fig. 3). We next introduced a construct with an R to G mutation at position 142 in PKCi which mimics a PKCf NLS. We found that the kinetics of nuclear accumulation upon LMB treatment did not change at all with this construct, which was opposite to our expectations. We then generated a R141/142E mutation in the PKCi/GFP full length construct thereby destroying the NLS motif. The subsequent analysis of this mutant (aPKCi R141/ 142E) again revealed no significant change in the nuclear translocation behavior of PKCi thus the NLS present in aPKCi appears to be nonfunctional in the context we tested here. 4 We then concentrated on PKCf, first generating a mutant of the full length construct which mimics the PKCi situation (aPKCf G141R). As indicated in Fig. 3, this conversion lead to a faster increase and higher amount of the nuclear signal after 2 hours with no significant change after 6 hours, thus resembling the aPKCi wildtype situation. Next we analyzed the aPKCf R140E/G141E mutant representing a NLS deficient aPKCf variant. In this case we were able to detect a significant decrease of the nuclear fraction after 2 and 6 hours LMB treatment implying that the NLS in PKCf is functionally involved in the nuclear transport of this aPKC. Nevertheless it was also clear that even in the NLS deficient situation a smaller fraction is translocated to the nucleus suggesting that beside the NLS driven transport other nuclear transport mechanism(s) exist which aid in the localization of PKCf to the nucleus (Fig. 3). Taken together the mutational analysis of the NLS of both aPKCs revealed that PKCi can translocate to the nucleus independent of its NLS whereas PKCf’s nuclear translocation is mainly regulated by its NLS. In addition we observed that the sequence variant we identified in mouse for PKCf slows the translocation kinetics and also that PKCf retains a nuclear translocation capacity that is independent of the NLS. Biology Open 4. Mutations within the PB1 domain alter the subcellular localization of both aPKCs. Fig. 3. Nucleocytoplasmic shuttling is dependent on the NLS in the case of aPKC f but not aPKC i. MDCK cells either expressing full-length aPKC wild-type protein of aPKCi (left panel) or aPKCf (right panel) or the indicated mutation within the NLS of both isoforms. The cells were left untreated in normal medium for 18 hours after transfection with Lipofectamin. Afterwards, the cells were treated with 4 ng/ml Leptomycin B in normal growth medium for either 2 or 6 hours and fixed afterwards with 4% paraformaldehyde. Analysis was done by using the Zeiss LSM 510 confocal microscope. Calculation of ratios between nuclear signal and cytoplasmic signal were performed as described in the methods section. n540, *P,0.05. All experiments were performed in triplicates. Having established that the generation of a NLS deficient Nterminal PKCiAA1-177 fragment does not abolish its nuclear localization we decided to investigate the possibility of other nuclear translocation domains existing within this fragment. Besides the C1 domain which includes the discussed NLS, another protein-protein interacting domain has been described in the N-terminus of both aPKCs; the Phox/Bem1 (PB1) domain. Several PB1 aPKC interacting proteins have been identified e.g. Par6 and p62 (Joberty et al., 2000; Hirano et al., 2004). Of particular interest in this context is a recent report describing the translocation of Par6 to the nucleus via an internal NLS (Cline and Nelson, 2007). Thus we hypothesized that aPKCs may be translocated to the nucleus through a ‘‘hitchhiking’’ mechanism by their binding to PB1 containing proteins, like Par6. To verify this hypothesis we first introduced a D63A mutation in the PKCiAA1-177 fragment. This D-A mutation has been shown by Hirano to disrupt interaction between the aPKC PB1 domain and the PB1 domain of Par6 and p62 (Hirano et al., 2004; Hirano et al., 2005). However, the abolishment of a functional PB1 domain did not prevent a nuclear translocation of this construct (Fig. 4A,B). In addition, the corresponding D62A mutation in the PKCfAA1-176 fragment reflected the same outcome (Fig. 4C,D). Thus we assumed that in both atypical PKC Nterminal fragments either a cryptic NLS or another sequence motif existed that was responsible for the observed nuclear localization. We then focused attention on the analysis of the full length protein fusions to investigate the consequence of a PB1 mutation in aPKC nuclear localization in this context. Thus we introduced the D63A or D62A mutations respectively in each full length aPKC construct which we subsequently analyzed in an LMB experiment. In order to verify the functionality of the introduced mutation we first checked whether the PB1 mutation caused a loss of membrane association due to the protein’s inability to form the polarity complex with Par6/aPKC/Par3 (Lin et al., 2000; Wodarz Nucleocytoplasmic shuttling PKCs 5 Biology Open subcellular localization of these constructs we observed that both aPKC isoforms harboring the D to A mutation showed a significant increase in the pool of nuclear located fusion protein in the non-LMB treated samples (Fig. 4E,F, control values). With regard to PKCf, LMB treatment caused a similar kinetic rate of nuclear accumulation for both wild type and mutated constructs whereby the D62A mutant translocation started at a significantly higher level, but both reached maximum accumulation levels after 4 hours of LMB treatment (Fig. 4F). In contrast, PKCi gave a different picture of nuclear accumulation. Whereas the wild type construct increased its amount in the nucleus constantly over the 6 hour time line, the D63A mutation of PKCi increased its nuclear level only slightly (but significantly) within the first 2 hours. We were unable to detect any further significant increase of the mutant construct in the nucleus beyond this time-point (Fig. 4E). Taken together we have shown that the PB1 domain within both aPKCs is not involved in the nuclear translocation of the Nterminal constructs used here indicating the existence of an alternate nuclear translocation mechanism for these two fusion proteins. However, this analysis also revealed that in the context of the full length protein, the PB1 domain does influence the localization of aPKCs in an isoform specific manner: whereas PKCf appears to translocate into the nucleus independent of its PB1 domain, PKCi translocation seemed unable to proceed beyond a certain level of nuclear content (reached at 2 hours after addition of LMB) implying that at least a fraction of the transported GFP fusion protein depends on a functional PB1 domain. 5. Atypical PKCs hinge region mediates different localization of aPKCi and aPKCf. Fig. 4. The PB1 domain of atypical PKCs influences localization of both atypical isoforms. MDCK cells were either transfected with a construct expressing the regulatory domain of aPKCi (A) or aPKCf (C) wildtype, or corresponding mutant proteins (B,D). Cells were tranfected with Lipofectaminß and left untreated for 18 hours before preparation for imaging analysis. Visualization of the nucleus was achieved by DAPI staining. Analysis was done by using the Zeiss LSM 510 confocal microscope. Scale bar: 10 mm. (E,F) MDCK cells either expressing full-length aPKC wild-type protein or fulllength protein containing a PB1 mutation of aPKCi (E) or aPKCf (F). Eighteen hours after transfection cells were treated with 4 ng/ml leptomycin B in normal growth medium for 2, 4 and 6 hours before preparation for imaging analysis. Calculation of ratios between nuclear signal and cytoplasmic signal were performed as described in the methods section. n540, *P,0.05. All experiments were performed in triplicates. et al., 2000; Joberty et al., 2000). In fact, we observed a clear decrease of GFP membrane signal in both constructs, indicating the introduced mutation was functionally significant (supplementary material Fig. S2). Upon further analysis of the Our initial screen revealed that the hinge region of both aPKCs appeared to be involved in the unique sub-cellular localization of each isoform (Fig. 2). To further elucidate these findings we generated mutants with exchanged hinge regions that either harbored the aPKCi specific hinge sequence within the aPKCf specific background or vice versa (Fig. 1B). Upon transfection of the N-terminal chimeric aPKCiN-fHINGE/GFP fusion protein into MDCK cells it became apparent that the aPKCf specific hinge sequence is able to keep the aPKCi protein outside of the nucleus (Fig. 5A,C). Interestingly this chimeric fusion protein did not reflect the same pattern as the aPKCfDcatalytic with regard to membrane staining (compare Fig. 5B and Fig. 5C), thus an interplay between the remaining f-N-terminus and its hinge region must exist which has the capacity to drive the aPKCf construct to the membrane. The corresponding experiment with a aPKCfN-iHINGE/GFP fusion protein showed an exact phenocopy of the parental i-hinge construct i.e. an exclusive nuclear localization with an enrichment of the GFP signal within the nucleoli (Fig. 5A,B,D). These findings clearly identified that the hinge region of atypical PKCs can be distinguished as harboring specific subcellular localization information. We then proceeded to ask the same question in the context of the full length protein. We used either wildtype or chimeric fusion proteins which contained the corresponding hinge region of the alternate aPKC isoform (Fig. 1B). We first analyzed the subcellular localization of these constructs by measuring the nuclear to cytosol ratio of the GFP signal. As indicated in Fig. 5E Nucleocytoplasmic shuttling PKCs 6 Biology Open Fig. 5. Atypical PKC hinge region mediates different localization of aPKCi and aPKCf. MDCK cells were transfected with constructs expressing either the regulatory domain of aPKCi or aPKCf (A,B) or chimeric proteins consisting of the regulatory domain of aPKCi with a aPKCf hinge region, or vice versa (C,D). The insert shows magnification of the marked area (square) in the overview. Visualization of the nucleus was achieved by DAPI staining. Membrane staining was performed using Alexa FluorH 647 conjugated wheat-germ agglutinin (WGA). All pictures were taken with the ZEISS LSM 510 microscope. The areas representing the cytosolic fraction or nuclear fraction are indicated with bars at the top of each histogram. The histogram analysis was performed with the ‘profile tool’ in the LSM MetaH software. The analyzed area is indicated by the yellow straight line in the overview. Scale bar: 50 mm (overview), 10 mm (insert). All experiments were performed in triplicates. (control lane) an aPKCf protein harboring a i-hinge region showed a significant increase in the nuclear fraction of the GFP signal whereas the chimeric aPKCi protein did not appear to be affected by the f-hinge region with regard to its nuclear localization (Fig. 5F, control lane). After 6 hours of LMB treatment the chimeric aPKCfiHINGE construct showed a higher accumulation of the GFP signal in the nucleus (at a similar level to that of the aPKCi wildtype construct) (Fig. 5E). In contrast, the chimeric aPKCifHINGE protein showed a significant decrease of its nuclear signal after 6 hours of LMB treatment thus mimicking the levels reached by the aPKCf wild type construct (Fig. 5F). In summary, both approaches identify the hinge region of both aPKCs as a domain that contains isoform specific sub-cellular localization information. Discussion Atypical PKCs represent a subgroup of the PKC family distinguished by their mode of activation and their remarkably high homology content to each other (Steinberg, 2008). Most published work on aPKCs has not distinguished between the two isoforms due to the lack of specificity of available tools such as reliably specific antibodies and peptide inhibitors. In addition, due to the high homology of the amino acid sequence, there is a great potential for redundancy between these two isoforms. Nevertheless studies using either RNA knockdown (Durgan et al., 2011) or gene targeting approaches in mice (Leitges et al., 2001; Farese et al., 2007) clearly indicate the existence of isoform-specific functions. Phenotypical analysis has revealed quite opposite in vivo functions even in cells where both isoforms coexist, for example in the intestinal epithelial cell, (Oster and Leitges, 2006; Murray et al., 2009). Thus the question of how these different functions are regulated given the high degree of homology becomes poignant. The intention of this study was to identify how specific domains within both isoforms transfer specificity to the individual protein. As described for other PKCs (Parker and Murray-Rust, 2004) we assumed that one method to achieve specificity is through protein localization within the cell. Thus in an unbiased approach we tested aPKC/GFP fusion constructs for their location after their transient transfection in MDCK cells. In accordance with others (Horikoshi et al., 2009), we found both full length constructs mainly located in the cytoplasm but we also observed that while the aPKCf construct was excluded from the nucleus the aPKCi construct showed weak nuclear staining implying a tendency for its nuclear localization compared to aPKCf . A clear difference between the two isoforms became obvious when analyzing the N-terminal constructs missing the catalytic kinase domain (aPKCfDcatalytic and aPKCiDcatalytic). It is worth stating here that this truncation eliminates a nuclear export sequence (NES) from both constructs (aPKCf AA 247–255, aPKCi AA 239–247) and leaves the truncated protein in a somewhat open conformation. Whereas the aPKCf specific construct showed prominent membrane staining, aPKCi was found exclusively in the nucleus. These observations per se Biology Open Nucleocytoplasmic shuttling PKCs indicate a clear difference between both aPKC isoforms. The robust membrane localization of aPKCf could be explained by its previously reported association with the signaling cascade of the ternary polarity par3/aPKC/par6 complex which is localized at the cell membrane (Suzuki et al., 2001), while the accumulation of the aPKCi construct might be a consequence of the missing NES. The explanation for this obvious difference in localization remains elusive. Further investigation identified the hinge region of both isoforms to be essential in this localization process. We found that in both isoforms the deletion of the hinge domain caused a nuclear localization that was different in appearance to that observed in aPKCiDcatalytic construct expression where the hinge region is intact. We also found that expression of hinge/GFP fusion proteins showed an isoform-specific difference. Whereas the aPKCiHINGE predominantly localized in the nucleus (showing a homogenous distribution within) the aPKCfHINGE was excluded. Thus, given the fact that the hinge region within aPKCs contains the most diverse nucleotide sequence it is interesting to observe that both isoforms contain information related to isoform-specific, distinct, subcellular localization in this region. This was finally confirmed by the expression of chimeric proteins that were generated containing the hinge fragment of one isoform sub-cloned to the corresponding N-terminus (or full length) of the alternate aPKC isoform (Fig. 5). In both cases i-hinge drives the protein into the nucleus whereas f-hinge either keeps it outside (N-terminal construct) or significantly reduces (in the context of the full length protein) the nuclear pool upon LMB treatment. Until now, the only verified functional motif within the atypical hinge sequence had been a caspase cleavage site which exists only in aPKCf and is involved in the regulation of the protein’s enzymatic activity rather then its localization (Frutos et al., 1999). Any other functional derivation based on the crude amino acid sequence is highly speculative without experimental verification. Current approaches in our laboratory employed mutagenesis to establish hinge region mutants with abolished localization behavior, thereby enabling the identification of the underlying sequence motifs (and mechanisms) that cause these observed differences between hinge regions in different aPKC isoforms. The N-terminal construct (depleted of the hinge region) of both aPKCs was found exclusively in the nucleus which could be explained by the NLS motif located in the C1 domain, functionally described by others (Perander et al., 2001; Pu et al., 2006). Nevertheless we investigated the NLS in more detail and showed that mutations destroying the functionality of the NLS did not completely abolish the nuclear translocation of either the N-terminal or the full length GFP fusion proteins in either aPKC. This was a surprising result since the NLS had been shown to cause localization to the nucleus in the context of both a smaller fragment and a full length construct containing a kinase defective mutation in a different cellular context (Perander et al., 2001). We found that neither an N-terminal nor a full length aPKCi/GFP construct containing an R141/142 mutation appeared to be affected in its nuclear translocation behavior. However, a full-length aPKCf/GFP construct harboring an R140/141 mutation showed a significant reduction in the amount of nuclear accumulation after 2 and 6 hours LMB treatment. Although reduced, the accumulation was significant, thus 7 indicating the possible existence of alternate methods of translocation. During our analysis we identified a sequence variant in the NLS sequence which appears to be mouse specific and converts the PKCf specific NLS to AKRFNRG (Uniprot.org entry Q02956). This variation could explain the slower nuclear translocation of PKCf observed upon LMB treatment compared with PKCi based on the described mechanism of the importin a/b system. Also the G141R mutation of PKCf which converts the fNLS into a i-NLS, supports this notion since the construct mimicked the PKCi nuclear translocation kinetics exactly (higher maximum, reached after 2 hours LMB treatment). However, this is not a valid argument for the observed differences regarding the nuclear translocation kinetics between both aPKC isoforms made previously by others (Perander et al., 2001) since the aPKC cDNAs from other species that do not contain this sequence variation were used. Thus, our observation may be either a cell type or species specific phenomena or a combination of both. In any case our data show a clear difference between both aPKCs and their NLS dependent nuclear translocation in MDCK cells upon LMB treatment when using mouse specific constructs. PKCi translocates to the nucleus independently of its NLS whereas PKCf mainly depends on a functional NLS. One reason for the NLS independent translocation of PKCi might be hidden in its hinge region which we have shown to be able to direct nuclear translocation. Other mechanisms must also exist since N-terminal constructs of both aPKC isoforms (missing each hinge region and containing NLS mutations) retain the capacity to translocate to the nucleus. We have further analyzed the PB1 domain which remained intact in our N-terminal constructs and which has been implicated as a mediator of protein-protein interactions between PB1 containing proteins (Hirano et al., 2004; Hirano et al., 2005). To our knowledge, the PB1 interacting proteins include at least 13 mammalian proteins (Lamark et al., 2003). The background notion for this attempt was that it was possible that interacting partners of aPKCs were able to translocate to the nucleus and could serve as a shuttle vehicle for aPKCs. However, when introducing a D-A mutation which had been described to abolish PB1 specific interactions (Hirano et al., 2004) we were not able to detect any effect on the N-terminal constructs with regard on the nuclear/cytoplasm ratio. Upon the introduction of the same mutation into full length proteins we were readily able to detect an increased nuclear fraction in non-treated cells. We interpreted this result as an indication that there is reduced export rather than increased import. One likely candidate for the export shuttle might be p62. This protein was originally identified as a binding partner for aPKC (Puls et al., 1997; Sánchez et al., 1998) and has received some attention recently based on its involvement in starvation induced autophagy (Pankiv et al., 2010; Wooten et al., 2008; Lamark et al., 2009). More important for us was the identification of p62 in the nuclear compartment (Bjørkøy et al., 2005) and the finding that the shuttling of p62 between cytoplasm and nucleus appears to be a very dynamic process (Pankiv et al., 2010) similar to that we have observed for aPKC. In addition, most recently it has been shown that p62 is involved in the nuclear export of ALFY (autophagy-linked FYVE) proteins through protein-protein interaction (Clausen et al., 2010). Thus, it could well be that p62 is also involved in the nuclear export of aPKC. Nevertheless, we do not exclude other PB1 containing proteins, like Par6, also Biology Open Nucleocytoplasmic shuttling PKCs recently described as a nuclear protein (Cline and Nelson, 2007), being involved in the nuclear translocation of aPKC. With regard to nuclear import, the PB1 mutation did not influence PKCf (similar kinetics and amounts of nuclear accumulation were seen) but it did reduce the total amount of PKCi in the nucleus upon LMB treatment. Thus a certain fraction of PKCi translocation to the nucleus depends on an as yet undefined PB1 domain protein-protein interaction. Our study revealed clear differences between the two aPKC isoforms which have not been analyzed in such a comparative structure to function study before. The hinge region, representing the most heterologous amino acid stretch between the two aPKCs, contains isoform-specific, sub-cellular localization information. In particular, with regard to the nuclear localization of aPKCs the functionality of the NLS, the PB1 domain and in the case of PKCi the hinge region, are shown to influence the nuclear import to a different degree when both isoforms are compared directly. We are not the first to show that aPKC is present in the nucleus but our data suggests that there are multiple modes of nuclear transport that differ between aPKC isoforms. This could mean that the physiological conditions in which each aPKC translocates to the nucleus are distinguishable. What exactly drives PKCf and PKCi into the nucleus is not clear. Our attempts to locate aPKC/GFP proteins to a more precise sub-nuclear domain or to the nucleus during specific cell cycle periods have thus far been unsuccessful (data not shown). Another option is the activation of aPKC in the context of NFkB signaling leading to a translocation of NFkB to the nucleus. Besides this translocation, specific phosphorylations are required to regulate NFkB specific gene expression. Ser 311 on the RelA subunit has been identified as a PKCf target (Duran et al., 2003) but where this phosphorylation takes place remains unknown. Thus it could well be that PKCf must be translocated into the nucleus to phosphorylate RelA on Ser 311. Both aPKC isoforms have been described as forming complexes with Par6 and Par3 (Noda et al., 2003; Henrique and Schweisguth, 2003; Joberty et al., 2000) to build a ternary complex (also called polarity complex (Suzuki and Ohno, 2006). Recent work has also identified nuclear accumulation of Par6 in MDCK cells after LMB treatment indicating nucleocytoplasmic shuttling similar to that we observed for aPKC (Cline and Nelson, 2007). Cline could not identify a specific nuclear function for Par6, but a participation in gene transcription, RNA splicing and mRNA transport was excluded. Par3 has also been found to be located in the nucleus (Fang et al., 2007). In this case an association with Ku70/Ku80 proteins was reported and functional analysis revealed that Par3 regulates DNA-PK activity through this interaction which is needed in the repair of double-strand breaks. Neither Par6 nor Par3 has been evaluated for aPKC interaction/complex capability. Thus aPKC could be involved in individual nuclear functions with Par6 and/ or Par3 but in addition it is also conceivable that the well established polarity complex (Par6/aPKC/Par3) exists in the nucleus independently and fulfills as yet uncharacterized functions. It is necessary at this point to mention that the N-terminal constructs (PKCiAA1-177 and PKCfAA1-176) we have used in our study have an average molecular weight of around 55 kDa (and even smaller with regard to the individual hinge constructs). Thus as a consequence we are not able to exclude that some of our 8 immunfluoresence data are discolored by the fact that smaller proteins can enter the nucleus by passive diffusion (Nigg, 1997). Regardless of this fact we are convinced that our major findings are not influenced by this fact since all relevant mutation have been introduced and analysed in the full length proteins as well. In addition also the hinge domains have been tested in the context of a bigger fusion protein. In conclusion, evidence for the implication of aPKCs in nuclear function(s) are accumulating, some may be redundant and some may be assigned to a single aPKC isoform. The functions may be dependent on specific stimuli since we have found that defined domains within the aPKC protein have various influences on the nuclear translocation behavior of the protein. Future challenges include the identification of the physiological conditions in which individual aPKC isoforms translocate to the nucleus which may then suggest links to specific nuclear function. Materials and Methods Cell cultures Madin Darby Canine Kidney (MDCK) cells were grown in Gibco DMEM+GlutaMAX2-I (Invitrogen) with 15% Gibco fetal calf serum (Invitrogen), Gibco non essential amino acids (Invitrogen), Penicillin (50 units/ ml) and streptomycin (100 mg/ml) (Invitrogen). For the nuclear export experiments, Leptomycin B (Sigma-Aldrich) was added to the medium to a final concentration of 4 ng/ml. Plasmid constructions and site-directed mutagenesis The murine cDNA was amplified from mouse brain RNA after reverse transcription by PCR using HotStarTaq Master Mix from QIAGEN (203,443). Following Primers were used: i/lPKCwt for: CAC CAT GCC GAC CCA GAG GGA CAG CAG C; i/lPKCwt rev: GAC ACA CTC TTC TGC AGA CAT CAA GAG GGG; fPKCwt for: CAC CAT GCC CAG CAG GAC GGA CCC CAA GAT G; fPKCwt rev: CAC GGA CTC CAC AGC AGA CAG CAG AA; i/lPKCDC rev: ACT GGA CGA CGC TTT ACC ACT CTC CCT GG; fPKCDC: CCC CTG AGA GAT TTT GAT CCC ATC CAC; i/lPKC AA1-186rev: GAC CAG CTT GTG GCA CTT CTT ATG; fPKC AA1-178rev: GAC GAG GAC GTG GCA GCG TTT ATG GAC; i/lPKC AA27-247 for CAC CAT GTC CCA CAC GGT CGC GTG; fPKC AA18-246: CAC CATGCG CGT CCG TCT GAA GGC GCA CTA CGG; i/lPKC Hinge for: CAC CATGAC AAT TGA GTG TGG GCG GCA CT; fPKC Hinge: CAC CATGGC TGA CCT GCA GGA GGC ATA TGG AT. All PCR products were sub-cloned into pENTR-D-TOPO by using the Gateway cloning system (Invitrogen) according to the manufacturer’s instructions. All plasmids were verified by restriction enzymes and sequencing to confirm the correct coding sequence. All expression plasmids were constructed using the LR clonase Kit (Invitrogen) according to the manufacturer’s instructions. The pDEST expression vector with a c-terminal GFP-tag was provided by Kjetil Tasken (The Biotechnology Centre of Oslo, Norway). For sequencing of the constructs we used following primer EGFP-N rev: CTGAACTTGTGGCCGTTTAC EGFP-N for: TCCGCCCCATTGACGCAA. For the site directed mutagenesis we used the Quickchange Site Directed Mutagenesis Kit (NO. 200518, Stratagene). The primer-design was done with the Quick Change Primer Design tool on the companies homepage. Following primers were used for the mutagenesis: i/ lPKCR141/142E for: GCC AAA CGT TTC AAT GAG GAG GCC CAC TGT GCC ATC; i/lPKCR141/142E rev: GAT GGC ACA GTG GGC GCG CCT ATT GAA ACG TTT GGC; i/lPKCR142G for: GCC AAA CGT TTC AAT AGG GGC GCC CAC TGT GC; i/lPKCR142G rev: GCA CAG TGG GCG CCC CTA TTG AAA CGT TTG GC; fPKCR140/141E for: AAG CCA AGC GCT TTA ACG AGG AAG CGT ACT GCG GCC AG; fPKCR140/141E rev: CTG GCC GCA GTA CGC TTC CTC GTT AAA GCG CTT GGC TT; fPKCG141R for: AGC GCT TTA ACA GGA GAG CGT ACT GCG GC; fPKCG141R rev: GCC GCA GTA CGC TCT CCT GTT AAA GCG CT; i/lPKCD63A for: CAC CAT GAA ATG GAT AGC TGA GGA AGG AGA CCC AT; i/lPKCD63A rev: ATG GGT CTC CTT CCT CAG CTA TCC ATT TCA TGG TG; fPKCD62A for: CCT CAA GTG GGT GGC CAG TGA AGG TGA CC; fPKCD62A rev: GGT CAC CTT CAC TGG CCA CCC ACT TGA GG. To generate aPKCfN-iHINGE and aPKCiN-fHinge constructs we designed primers to add an additional BfaI restriction site to the N-terminus of the corresponding Hinge-region and the C-terminus of the N-terminal region without changing the amino acid sequence. The following primers were used: i/lPKCNBfarev: GAC TAG GAC GTG GCA CTT CTT ATG; i/lPKCHINGE-Bfafor: Nucleocytoplasmic shuttling PKCs GTC CTA GTC ACA ATT GAG TGT GGG CGG CAC T; fPKCN-Bfarev: GAC TAG GAC GTG GCA GCG TTT ATG GAC; fPKCHINGE-Bfafor: GTC CTA GTC CCG CTG ACC TGC AGG AGG CAT ATG GAT. Both PCR products were sub-cloned into the pCRII-Topo plasmid according to the manufactures protocol (Invitrogen). The fragments were then excised using BamHI/EcoRV for the Hinge fragments and HindIII/XbaI for the N-terminal fragments. Afterwards all fragments were digested with BfaI and ligation was performed using the T4 DNA ligase from NEB according to the manufacturers protocol. The ligation product was amplified using a specific primer set (see above) and sub-cloned into the pENTR vector according to the manufacturers protocol. For the chimeric full length constructs (aPKCi-zeta HINGE, aPKCf-iHINGE) a similar approach was chosen. An additional EcoRI site was added to the PCR products of the kinase domain and aPKCfN-iHINGE and aPKCiN-fHinge constructs using specially designed primers: i/lkinaseEcoRIfor: GAA TTC CTA GGT CTG CAG GAT TTC G; i/lPKCDCEcoRIrev: GAA TTC ACT GGA CGA CGC TTT ACC ACT CTC CCT GG; fkinase EcoRIfor: GAA TTC CTG GGG CTG CAA GAC TTC G; fPKCDCEcoRIrev: GAA TTC CCC CTG AGA GAT TTT GAT CCC ATC CAC. The PCR products were then subcloned into pCRII-Topo plasmid. The resulting plasmid was digested with EcoRI for 16 h at 37 ˚C to create EcoRI fragments. Both fragments were ligated with T4 DNA ligase (NEB) according to the manufacturer’s protocol. The ligation product was amplified by PCR using primers for the wild-type full-length sequence and the PCR product was further sub-cloned into the pENTR vector. All constructs were verified by Restriction pattern and sequencing. Biology Open Subcellular localization analyzes and immunocytochemistry For the sub-cellular localization studies of the different GFP fusion proteins, MDCK cells were seeded in a 4-well dish with a 14 mm microscope cover glass (Marienfeld), coated with 0.2% Gelantine at a density of 7.36106 per well 18 h before transfection. The cells were then transfected with 0.8 mg of expression vector using Lipofectamine. The cells were fixed with 4% paraformaldehyde for 15 min and permeabilized in 0.01% Triton X-100 for 10 min at room temperature, 24 hours after transfection. We used the Vectashield mounting medium with DAPI (Vector) to mount the cells on a microscope slide (VWR). The GFP fusion proteins were visualized by confocal microscopy using the Zeiss LSM 510 Meta invert microscope equipped with a Zeiss LSM laser module and a AxioCam HMr digital camera. Image analysis The color digital images of the fluorescing cells were processed by the Adobe Photoshop CS5 (Adobe Systems Inc., USA) and analyzed by the ImageJ 1.43r (National Institute of Health, USA, http://rsb.info.nih.gov/ij) software. The ‘Mean Gray Value’ was quantitatively assessed in the selected regions of interest (ROI ‘‘Oval Selection’’) from the images using ‘‘Analyze’’ plugin (‘‘Measure’’ option). The obtained data were in the arbitrary units of the 8-bit gray scale (0–256 units). Ratios were presented as means with standard deviations. Data analysis The histogram analysis of the fluorescence signal was performed with the profile tool provided by the LSM Image Examiner from Zeiss. The software enables the user to analyze the pixel strength of a defined area and all channels. We used the linear tool to analyze the localization of the GFP-fusion protein within the cell. To visualize and analyze the dimension of a cell and the position of the nucleus we used Alexa FluorH 647 (Invitrogen) labeled Wheat Germ Agglutinin (WGA). In the histogram each peak represents a cell membrane. The two outer peaks represent the outer cell membrane and the inner peaks the nuclear envelope. The position and dimensions of the nucleus were visualized and analyzed by using 49,6diamidino-2-phenylindole (DAPI). Channel coding: red 5 WGA, blue 5 DAPI, green 5 GFP. Western Blot analysis MDCK cells were transfected according to the Lipofectamine 2000ß transfection reagent from Invitrogen dependent of the size of the used cell culture dish. 24 hours after transfection the cells were trypsinized with 16 Trypsin (Invitrogen) for 10 min at room temperature, the reaction was stopped by supplementing DMEM containing 15% FCS. The pellet was collected and incubated in 80 ml of protein extraction buffer (50 mM Tris/HCl, pH 7.5–8.0; 2 mM EDTA, pH 7.0; 10 mM EGTA, pH 7.0; 0.1% TritonX-100, 3% b-mercaptoethanol) supplemented with Proteinase Inhibitor Cocktail (Sigma, NO. P-2714), incubated on ice for 20 min. After supplementation of 25 ml of protein sample loading buffer the samples were boiled for 5 min. Subsequently. the samples were run on a 10% SDS-polyacrylamide gel and blotted onto BioRad nitrocellulose membranes. The membranes were blocked in 5% nonfat dry milk in TBST for 1 h at room temperature. Incubation with the primary antibody happened overnight in TBST at 9 4 ˚C. The following antibodies were used: anti-GFP (Santa Cruz Antibodies NO. sc-8334) (1:500). Acknowledgements We are grateful to Jorunn Solheim for technical assistance and Catherine Jackson for incredible editorial work on the manuscript. Sebastian Seidl is a fellow of Molecular Life Science - University of Oslo. Competing Interests The authors would like to declare that they do not have conflicting financial interests. References Akimoto, K., Mizuno, K., Osada, S., Hirai, S., Tanuma, S., Suzuki, K. and Ohno, S. (1994). A new member of the third class in the protein kinase C family, PKC lambda, expressed dominantly in an undifferentiated mouse embryonal carcinoma cell line and also in many tissues and cells. J. Biol. Chem. 269, 12677-12683. Bandyopadhyay, G., Standaert, M. L., Sajan, M. P., Kanoh, Y., Miura, A., Braun, U., Kruse, F., Leitges, M. and Farese, R. V. (2004). Protein kinase C-lambda knockout in embryonic stem cells and adipocytes impairs insulin-stimulated glucose transport. Mol. Endocrinol. 18, 373-383. Bjørkøy, G., Lamark, T., Brech, A., Outzen, H., Perander, M., Øvervatn, A., Stenmark, H. and Johansen, T. (2005). p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 171, 603-614. Clausen, T. H., Lamark, T., Isakson, P., Finley, K., Larsen, K. B., Brech, A., Øvervatn, A., Stenmark, H., Bjørkøy, G., Simonsen, A. et al. (2010). p62/ SQSTM1 and ALFY interact to facilitate the formation of p62 bodies/ALIS and their degradation by autophagy. Autophagy 6, 330-344. Cline, E. G. and Nelson, W. J. (2007). Characterization of mammalian Par 6 as a duallocation protein. Mol. Cell. Biol. 27, 4431-4443. Dı́az-Meco, M. T., Municio, M. M., Frutos, S., Sánchez, P., Lozano, J., Sanz, L. and Moscat, J. (1996). The product of par-4, a gene induced during apoptosis, interacts selectively with the atypical isoforms of protein kinase C. Cell 86, 777-786. Diaz-Meco, M. T. and Moscat, J. (2001). MEK5, a new target of the atypical protein kinase C isoforms in mitogenic signaling. Mol. Cell. Biol. 21, 1218-1227. Duran, A., Diaz-Meco, M. T. and Moscat, J. (2003). Essential role of RelA Ser311 phosphorylation by zetaPKC in NF-kappaB transcriptional activation. EMBO J. 22, 3910-3918. Durgan, J., Kaji, N., Jin, D. and Hall, A. (2011). Par6B and atypical PKC regulate mitotic spindle orientation during epithelial morphogenesis. J. Biol. Chem. 286, 12461-12474. Fang, L., Wang, Y., Du, D., Yang, G., Tak Kwok, T., Kai Kong, S., Chen, B., Chen, D. J. and Chen, Z. (2007). Cell polarity protein Par3 complexes with DNA-PK via Ku70 and regulates DNA double-strand break repair. Cell Res. 17, 100-116. Farese, R. V., Sajan, M. P., Yang, H., Li, P., Mastorides, S., Gower, W. R., Jr, Nimal, S., Choi, C. S., Kim, S., Shulman, G. I. et al. (2007). Muscle-specific knockout of PKC-lambda impairs glucose transport and induces metabolic and diabetic syndromes. J. Clin. Invest. 117, 2289-2301. Frutos, S., Moscat, J. and Diaz-Meco, M. T. (1999). Cleavage of zetaPKC but not lambda/iotaPKC by caspase-3 during UV-induced apoptosis. J. Biol. Chem. 274, 10765-10770. Galvez, A. S., Duran, A., Linares, J. F., Pathrose, P., Castilla, E. A., Abu-Baker, S., Leitges, M., Diaz-Meco, M. T. and Moscat, J. (2009). Protein kinase Czeta represses the interleukin-6 promoter and impairs tumorigenesis in vivo. Mol. Cell. Biol. 29, 104-115. Henrique, D. and Schweisguth, F. (2003). Cell polarity: the ups and downs of the Par6/ aPKC complex. Curr. Opin. Genet. Dev. 13, 341-350. Hirano, Y., Yoshinaga, S., Ogura, K., Yokochi, M., Noda, Y., Sumimoto, H. and Inagaki, F. (2004). Solution structure of atypical protein kinase C PB1 domain and its mode of interaction with ZIP/p62 and MEK5. J. Biol. Chem. 279, 31883-31890. Hirano, Y., Yoshinaga, S., Takeya, R., Suzuki, N. N., Horiuchi, M., Kohjima, M., Sumimoto, H. and Inagaki, F. (2005). Structure of a cell polarity regulator, a complex between atypical PKC and Par6 PB1 domains. J. Biol. Chem. 280, 96539661. Horikoshi, Y., Suzuki, A., Yamanaka, T., Sasaki, K., Mizuno, K., Sawada, H., Yonemura, S. and Ohno, S. (2009). Interaction between PAR-3 and the aPKC-PAR6 complex is indispensable for apical domain development of epithelial cells. J. Cell Sci. 122, 1595-1606. Huber, T. B., Hartleben, B., Winkelmann, K., Schneider, L., Becker, J. U., Leitges, M., Walz, G., Haller, H. and Schiffer, M. (2009). Loss of podocyte aPKClambda/ iota causes polarity defects and nephrotic syndrome. J. Am. Soc. Nephrol. 20, 798806. Joberty, G., Petersen, C., Gao, L. and Macara, I. G. (2000). The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Nat. Cell Biol. 2, 531-539. Kovac, J., Oster, H. and Leitges, M. (2007). Expression of the atypical protein kinase C (aPKC) isoforms i/l and f during mouse embryogenesis. Gene Expr. Patterns 7, 187-196. Biology Open Nucleocytoplasmic shuttling PKCs Kudo, N., Wolff, B., Sekimoto, T., Schreiner, E. P., Yoneda, Y., Yanagida, M., Horinouchi, S. and Yoshida, M. (1998). Leptomycin B inhibition of signal-mediated nuclear export by direct binding to CRM1. Exp. Cell Res. 242, 540-547. Lamark, T., Perander, M., Outzen, H., Kristiansen, K., Øvervatn, A., Michaelsen, E., Bjørkøy, G. and Johansen, T. (2003). Interaction codes within the family of mammalian Phox and Bem1p domain-containing proteins. J. Biol. Chem. 278, 3456834581. Lamark, T., Kirkin, V., Dikic, I. and Johansen, T. (2009). NBR1 and p62 as cargo receptors for selective autophagy of ubiquitinated targets. Cell Cycle 8, 1986-1990. Leitges, M., Sanz, L., Martin, P., Duran, A., Braun, U., Garcı́a, J. F., Camacho, F., Diaz-Meco, M. T., Rennert, P. D. and Moscat, J. (2001). Targeted disruption of the zetaPKC gene results in the impairment of the NF-kappaB pathway. Mol. Cell 8, 771780 Lin, D., Edwards, A. S., Fawcett, J. P., Mbamalu, G., Scott, J. D. and Pawson, T. (2000). A mammalian PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC signalling and cell polarity. Nat. Cell Biol. 2, 540-547. Lischka, P., Rosorius, O., Trommer, E. and Stamminger, T. (2001). A novel transferable nuclear export signal mediates CRM1-independent nucleocytoplasmic shuttling of the human cytomegalovirus transactivator protein pUL69. EMBO J. 20, 7271-7283. Martin, P., Duran, A., Minguet, S., Gaspar, M.-L., Dı́az-Meco, M. T., Rennert, P., Leitges, M. and Moscat, J. (2002). Role of zeta PKC in B-cell signaling and function. EMBO J. 21, 4049-4057. Murray, N. R., Weems, J., Braun, U., Leitges, M. and Fields, A. P. (2009). Protein kinase C betaII and PKCiota/lambda: collaborating partners in colon cancer promotion and progression. Cancer Res. 69, 656-662. Nigg, E. A. (1997). Nucleocytoplasmic transport: signals, mechanisms and regulation. Nature 386, 779-787. Noda, Y., Kohjima, M., Izaki, T., Ota, K., Yoshinaga, S., Inagaki, F., Ito, T. and Sumimoto, H. (2003). Molecular recognition in dimerization between PB1 domains. J. Biol. Chem. 278, 43516-43524. Oster, H. and Leitges, M. (2006). Protein kinase C alpha but not PKCzeta suppresses intestinal tumor formation in ApcMin/+ mice. Cancer Res. 66, 6955-6963. Palmeri, D. and Malim, M. H. (1999). Importin beta can mediate the nuclear import of an arginine-rich nuclear localization signal in the absence of importin alpha. Mol. Cell. Biol. 19, 1218-1225. Pankiv, S., Lamark, T., Bruun, J.-A., Øvervatn, A., Bjørkøy, G. and Johansen, T. (2010). Nucleocytoplasmic shuttling of p62/SQSTM1 and its role in recruitment of nuclear polyubiquitinated proteins to promyelocytic leukemia bodies. J. Biol. Chem. 285, 5941-5953. Parker, P. J. and Murray-Rust, J. (2004). PKC at a glance. J. Cell Sci. 117, 131-132. 10 Perander, M., Bjorkoy, G. and Johansen, T. (2001). Nuclear import and export signals enable rapid nucleocytoplasmic shuttling of the atypical protein kinase C lambda. J. Biol. Chem. 276, 13015-13024. Pu, Y., Peach, M. L., Garfield, S. H., Wincovitch, S., Marquez, V. E. and Blumberg, P. M. (2006). Effects on ligand interaction and membrane translocation of the positively charged arginine residues situated along the C1 domain binding cleft in the atypical protein kinase C isoforms. J. Biol. Chem. 281, 33773-33788. Puls, A., Schmidt, S., Grawe, F. and Stabel, S. (1997). Interaction of protein kinase C zeta with ZIP, a novel protein kinase C-binding protein Proc. Natl. Acad. Sci. USA 94, 6191-6196. Rosse, C., Linch, M., Kermorgant, S., Cameron, A. J. M., Boeckeler, K. and Parker, P. J. (2010). PKC and the control of localized signal dynamics. Nat. Rev. Mol. Cell Biol. 11, 103-112. Sánchez, P., De Carcer, G., Sandoval, I. V., Moscat, J. and Diaz-Meco, M. T. (1998). Localization of atypical protein kinase C isoforms into lysosome-targeted endosomes through interaction with p62. Mol. Cell. Biol. 18, 3069-3080. Soloff, R. S., Katayama, C., Lin, M. Y., Feramisco, J. R. and Hedrick, S. M. (2004). Targeted deletion of protein kinase C lambda reveals a distribution of functions between the two atypical protein kinase C isoforms. J. Immunol. 173, 3250-3260. Steinberg, S. F. (2008). Structural basis of protein kinase C isoform function. Physiol. Rev. 88, 1341-1378. Suzuki, A. and Ohno, S. (2006). The PAR-aPKC system: lessons in polarity. J. Cell Sci. 119, 979-987. Suzuki, A., Yamanaka, T., Hirose, T., Manabe, N., Mizuno, K., Shimizu, M., Akimoto, K., Izumi, Y., Ohnishi, T. and Ohno, S. (2001). Atypical protein kinase C is involved in the evolutionarily conserved par protein complex and plays a critical role in establishing epithelia-specific junctional structures. J. Cell Biol. 152, 11831196. Uberall, F., Hellbert, K., Kampfer, S., Maly, K., Villunger, A., Spitaler, M., Mwanjewe, J., Baier-Bitterlich, G., Baier, G. and Grunicke, H. H. (1999). Evidence that atypical protein kinase C-lambda and atypical protein kinase C-zeta participate in Ras-mediated reorganization of the F-actin cytoskeleton. J. Cell Biol. 144, 413-425. Wodarz, A., Ramrath, A., Grimm, A. and Knust, E. (2000). Drosophila atypical protein kinase C associates with Bazooka and controls polarity of epithelia and neuroblasts. J. Cell Biol. 150, 1361-1374. Wooten, M. W., Geetha, T., Babu, J. R., Seibenhener, M. L., Peng, J., Cox, N., DiazMeco, M. T. and Moscat, J. (2008). Essential role of sequestosome 1/p62 in regulating accumulation of Lys63-ubiquitinated proteins. J. Biol. Chem. 283, 67836789. Yang, J.-Q., Leitges, M., Duran, A., Diaz-Meco, M. T. and Moscat, J. (2009). Loss of PKC lambda/iota impairs Th2 establishment and allergic airway inflammation in vivo. Proc. Natl. Acad. Sci. USA 106, 1099-1104. 30 30 120 100 80 120 100 80 60 50 60 50 40 40 30 60 50 60 40 50 60 50 40 40 30 30 C G G E ns FP fec t alo ed ne HIN tra un un A tra A 1G ns 176 FP fe c al ted on e 30 40 N HIN G tra E ns G f e FP c t al ed on e 50 un 60 AA 1-17 un HIN 7 tra GE n G sfe FP c t al ed on e 120 100 80 Nun HIN G tra E ns G f e FP c t al ed on e G FP al on G FP al on e e A 120 100 80 60 50 40 30 B A C B D63A D D62A NLS CANGHTFQAKRFNRRAHCAI 137 156 128 CANGHTGQAKRFNRRAHCAI 147 137 CANGHTFQAKRFNRRAHCAI 156 127 RANGHLFQAKRFNRRAYCGQ 146 127 RANGHLFQAKRFNRGAYCGQ 146 127 RANGHLFQAKRFNRRAYCGQ 146 **** ******* *:*. II Phenotypical analysis of atypical PKCs in vivo function display a compensatory system at embryonic stage 7.5 p.c. Authors and Affiliations Sebastian Seidl1, Ursula Braun1, Norbert Roos2, Shaohua Li3, Timo H.-W. Lüdtke4, Andreas Kispert4* and Michael Leitges1,*,§ *equally contributed 1 Biotechnology centre of Oslo, University of Oslo, Gaustadalleen 21, 0349 Oslo, Norway 2 Department of Molecular Biosciences, University of Oslo, Oslo, Norway. 3 Department of Surgery, University of Medicine and Dentistry of New Jersey–Robert Wood Johnson Medical School, New Brunswick, NJ 08903 4 Institute for Molecular Biology, QE5250, Medizinische Hochschule Hannover, CarlNeuberg-Str.1, 30625 Hannover, Germany § Address correspondence to: Michael Leitges, Short title: Keywords: Abstract Background: The atypical protein kinases C (PKC) isoforms ι/λ and ζ play crucial roles in many cellular processes including development, cell proliferation, differentiation and cell survival. Possible redundancy between the two isoforms has always been an issue since most biochemical tools do not differentiate between the two proteins. Thus, many efforts have been made during the last decades to characterize the functions of aPKCs using gene targeting approaches and depletion studies. However, little is known about the specific roles of each isoform in mouse development. Methodology/Principal Findings: To evaluate the importance of PKCι/λ in mouse development we designed PKCι/λ deletion mutants using the gene targeting approach. We show that the deletion of PKCι/λ, results in a reduced size of the amniotic cavity at E7.5 and impaired growth of the embryo at E8.5 with subsequent absorption of the embryo. Our data also indicate an impaired localization of ZO-1 and disorganized structure of the epithelial tissue in the embryo. Importantly, using electron microscopy, embryoid body formation and immunofluorescence analysis, we found, that in the absence of PKCι/λ, tight junctions and apico-basal polarity were still established. Finally, our study points to a non-redundant PKCι/λ function at E9.5, since expression of aPKCζ is able to rescue the E7.5 phenotype, but resulted in embryonic lethality at a later time-point (E9.5). Conclusion: Our data show that PKCι/λ is crucial for mouse embryogenesis but is dispensable for the establishment of polarity and tight junction formation. We present a compensatory function of aPKCζ at E7.5, rescuing the phenotype. Furthermore, this study indicates at least one specific, yet unknown, PKCι/λ function that cannot be compensated by aPKCζ overexpression at E9.5. Introduction The protein kinase C (PKC) family of serine-threonine kinases consists of 9 different genes giving rise to at least 12 isoforms, subdivided into 3 subfamilies. The subdivision is based on sequence homologies and dependencies on cofactors during their activation process. Thus the classical PKCs (cPKC: α, β and γ) are supposed to be dependent on Ca2+ ions and diacylglycerol for their activation whereas the novel PKCs (nPKC: δ, ε, η and θ) based on the lack of a binding domain are Ca2+ ion independent but still need diacylglycerol for their activation. In sharp contrast, the subfamily of the atypical PKCs (aPKC: ζ and ι/λ) are independent of Ca2+ ions and diacylglycerol for their activation, thereby, representing quite a distinguishable subgroup among the PKC family. This even becomes more pronounced by the fact that aPKCs are unresponsive to Tumor Promoting Agent 12-O-Tetradecanoylphorbol-13-Acetate (TPA) treatment, an early described feature for PKC family members (see review Steinberg, 2008). Nevertheless, all PKC family members (including aPKCs) have been described to participate in a multitude of signaling pathways involved in cell growth, differentiation and apoptosis. In 1989 Nishizuka and coworkers isolated the aPKCζ isoform out of a rat cDNA library {Ono:1989tp}. Four years later a second aPKC isoform (PKCɩ) was isolated and characterized {Selbie:1993ud} followed by the identification of the mouse ortholog PKClambda {Akimoto:1994we}. As true for all other PKCs, the aPKC proteins can be divided into a regulatory N-terminal and a catalytic C-terminal part, separated by a hinge region. The exception is PKMζ which represents only the C-terminal kinase domain generated by an internal promotor whose activity has been assigned to neurons {Hernandez:2003cq}. In contrast to other PKCs the N-terminal domain contains a Phox/ Bem1 (PB1) motif mediating interaction with p62 {Puls:1997vi, Sanchez:1998vv}and other signaling molecules like Mek5 {Hirano:2004gg} and Par-6 {Noda:2003fc} all of which are supposed to mediate aPKC signaling. In addition both aPKC also contain a cystein-rich zinc-finger like domain within the regulatory N-terminal domain defined as C1. Whereas all other PKCs possess a tandem repeat, aPKCs possess only one C1 domain. Interestingly, this domain accounts for the binding of diacylglycerol and TPA in classical and novel PKCs. The aPKC C1 domain has been reported to bind directly to phosphatidylinositol (3, 4, 5)-triphosphat thereby inducing conformational changes in the protein leading to activation similar to diacylglycerol binding to other PKCs {Nakanishi: 1993tz}. But also other interacting partners, inhibitory as well as activating, have been described {DiazMeco:1996tw, Suzuki:2003il}. The aPKC C-terminal part represent the catalytic kinase domain sharing 86% homology to each other but only 45-55% to other PKCs. Overall both aPKCs show a 72% homology on amino acid level {Akimoto: 1994we}. Based on this high degree of homology and the limited availability of isoformspecific tools the in vivo analysis of isoform-specific aPKC functions remained insufficient in mammals. Nonetheless, it has been shown that aPKCs are conserved in numbers of organisms, including C. elegans {Tabuse:2002tt} and D. melanogaster {Schaeffer:1989up} in which only one isoform was detected. We have previously shown that both aPKCs are expressed during mouse embryonic development {Kovac:2007ev} as well as in distinct domains in the adult mouse brain {Oster:2004ik}. As a conclusion of these studies PKCι/λ was defined as being ubiquitously expressed whereas aPKCζ expression was pronounced in lung, kidney and brain. The spectrum of physiological processes linked to aPKCs function is huge and covers cell proliferation {Berra:1995ub}, cell polarity {Lin:2000iw}, carcinogenesis {Regala:2005gm}, neurogenesis {Baye:2007ht} and many more. Attempts to investigate individual in vivo functions also made use of the gene targeting approach. We and other have generated aPKC deficient mouse lines which were subjected to various phenotypical investigations. Interestingly, a conventional aPKCζ knockout did not display an embryonic phenotype in contrast to expectations raised by previous publications on a role for PKCζ during mouse preimplantation development {Pauken:2000ey}. Early studies using the conventional aPKCζ knockout revealed a functional link to NFkB signaling {Leitges:2001tb, Martin:2002wq}. Subsequent studies also identified aPKCζ to act as tumor suppressor due to its regulatory function on the Il-6 promotor {Galvez:2008je}. In sharp contrast a convential aPKCɩ knockout displayed an embryonic lethal phenotype {Soloff:2004vx}(personal communication with Shigeo Ohno and own data presented within this publication), clearly distinguishing both aPKC isoforms for the first time. Later studies using the conditional gene targeting approach showed inter alia specific in vivo functions for aPKCɩ but not for aPKCζ in muscle and podocytes {Farese:2007ix, Huber:2009jy}. Atypical PKCs have been described to form complexes with the partition defective proteins Par6 and Par3 {Joberty:2000uz}. Par genes have been cloned and characterized in 1995 {Guo:1995tp} and were shown to be crucial for asymmetric cell division in C. elegans and other organisms {EtienneManneville:2003tl, Watts:1996uo}. The association of aPKCs to this ternary complex, also called polarity complex {Suzuki:2006ke} integrates aPKC signaling into all aspects of polarity without any isoform specificity. Here, we subjected several established mutant mouse lines of the PKCɩ gene to a thorough developmental investigation. We present a detailed description of the embryonic lethal phenotype caused by the PKCɩ deficiency and provide more insights into the redundancy within the aPKC subfamily. Results Generation of 3 different Prkci alleles in mice. To investigate PKCɩ in vivo function, we decided to generate various mutant alleles following standard gene targeting approaches in mouse embryonic stem cells (ESs). First we generated a conventional Prkci knock-out allele by inserting a neo cassette into the second exon of the gene causing a disruption of gene transcription (PKCɩNeo, details see supplementary figure 1). Since homozygozity of this allele caused embryonic lethality (see later), we decided to generated an additional conditional allele for the Prkci. Again, the second exon of the gene was targeted by inserting loxP sites at the appropriate positions. This floxed allele (PKCɩflox) has been described and its functionality has previously been shown {Farese:2007ix, Yang:2009uh, Murray:2009hf, Huber:2009jy}. We subsequently crossed PKCɩflox/flox mice with a transgenic mouse line {FSchwenk:1995wd} expressing the Cre recombinase in the germ line and in a ubiquitous fashion starting at embryonic day (E) 13.5 (details see supplementary figure 1) and obtained a second null allele for Prkci named PKCɩ△. Third, we generated a rescue allele (PKCɩζRes) in which a PKCζ cDNA was integrated into the Prkci locus such that it became expressed under Prkci genomic and transcriptional regulatory elements (details see supplementary figure 1). PKCι/λ depletion during mouse development resulted in embryonic lethality. To investigate whether homozygozity of Prkci null alleles (PKCɩNeo and PKCɩ△) are compatible with embryonic development, we analyzed more than 100 offspring from matings of heterozygous carries for each line at 3 weeks after birth. For both individual lines we did not observe any homozygous offspring whereas heterozygous and wild-type mice were detected in the expected ratio. This implied an embryonic lethal phenotype for both mutant alleles in agreement with earlier data by Hedrick and coworkers {Soloff: 2004vx}. We next examined litters from heterozygous crosses at different developmental stages to identify the time point when first morphological abnormalities manifested in homozygous embryos. At embryonic day (E) 6.5, no morphological differences between litter-mates were apparent. At day E7.5, morphological inspection recognized a group of embryos which appeared “compressed” along the proximal-distal axis of the egg cylinder and harbored a small amniotic cavity (Figure 1A). Histological analysis showed that the epiblast was present but was thickened compared to non-affected litter-mates. Genotyping of individual embryos confirmed that this phenotype was restricted to homozygous embryos. At E8.5, mutant embryos were severely growth retarded. An anterior-posterior polarity of the body axis was not readily apparent since head folds and a linear heart tube distinguishing the anterior end of the embryo and the allantois representing the most posterior aspect were reduced or lacking (Figure 1B). In contrast to control embryos that harbored 4-6 somites at this stage, somites were not discernible by histological analysis in the mutants. By E10.5, mutant embryos were reabsorbed by the mother. Since phenotypic changes were indistinguishable between the two targeted alleles, we decided to exclusively use the PKCɩ△ line for further analysis. PKCι/λ embryos are normally patterned along the anterior-posterior body axis but exhibit defects in mesodermal differentiation. Since morphological and histological analysis indicated a deficit in axial elongation and germ layer formation, we used a panel of marker genes to test for formation and differentiation of the germ layers and establishment of an anterior-posterior body axis in E8.5 embryos. In wildtype embryos, Otx2 expression marks the forebrain {Monaghan:1995uu}, Pax2 the midbrain {Rowitch:1995we} and Fgf8 the midbrain/hindbrain boundariy {Crossley: 1995tu}. In PKCɩ-deficient embryos all three genes were expressed in the “anterior” embryonic region but the domains were compressed indicating that the (neuro-) ectoderm is patterned along the anterior-posterior axis but the expansion of the different primordial brain segments is comprised. Fgf8 is additionally expressed in the primitive streak at the posterior end of the embryo overlapping with Brachury (T) that additionally marks the notochord, a thin line of cells extending from the forebrain/midbrain border to the primitive streak underneath the neural tube {Crossley:1995tu, Wilkinson:1990ih}. Expression of both genes was established in the mutant but the primitive streak appeared much reduced and the notochord was disrupted. This shows that PKCɩ mutant embryos are polarized along the anterior-posterior body axis but that differentiation of the axial mesoderm is impaired. Tcf15 (also known as paraxis) marks the praaxial msoderm {Burgess:1995wu} which was organized into 4-8 distinct somite pairs at this stage in teh wild-type. In PKCɩ-deficient embryos a domain of Tcf15 expression was found in the middle region of the embryos but individual somites were not formed. Expression of Bmp4 in the lateral plate mesoderm, the extraembryonic mesoderm and the extraembryonic ectoderm was found in mutant embryos as in the wild-type. Tbx20 was expressed in the allantois, a derivative of the extraembryonic mesoderm, and in the linear heart tube, which derives from the cardiac subregion of the anterior lateral plate mesoderm in the wild-type {Kraus:2001vs}. Again, both expression domains were established at opposite poles of the mutant embryos but neither domain was appropriately developed into a and an allantois, respectively. Finally, Gja, that is expressed in the cardiac endoderm and dorsal aorta in wild-type embryos {Delorme:1997uu} was restricted to cell clusters at the anterior and posterior pole of the mutant embryos but clearly lacked an organization into vessel like structures. Together, this analysis suggests that PKCι/λ-deficient embryos exhibit a normal anterior-posterior polarization of their main body axis. Mesoderm formation is initiated but comes to a premature halt, mesoderm differentiation into axial, paraxial, lateral and extraembryonic subtypes occurs but subsequent formation of tissues and organs completely fails. As a consequence PKCι/ λ-deficient embryos die due to lack of a cardiavascular system. Embryonic body formation is impaired by PKCɩ deficiency: Embryonic stem cells, when cultured as aggregates, form spherical structures which are defined as embryonic bodies (EBs). These structures are thought to recapitulate early steps of the pre-implantation development including endoderm formation, basement membrane assembly, epiblast polarization and subsequent cavity formation {Coucouvanis:1995wi}. When cultured in suspension for 5 days, EBs form epithelial cysts consisting of an outer endoderm and an inner columnar epiblast epithelium (CEE), separated by a basement membrane. As PKCι/ λ mutants displayed an abnormal amniotic cavity at E7.5 we decided to use the embryonic body formation assay to analyze cavity formation in more detail. When wild-type and PKCɩ deficient embryonic stem cells {Bandyopadhyay:2003dy} were subjected to this assay, we detected obvious differences among the two genotypes. Wild-type EBs displayed the expected appearance in a phase contrast representation, aPKCɩΔ/Δ EBs showed a disorganized structure (Figures 3 B). Most of the wild-type EBs formed a single large cavity enclosed by CEE after 5 days, whereas the mutant EBs did not cavitate at all or formed multiple small cavities adjacent to the polarized CEE, although the endoderm differentiated normally. When cultured for additional 2 days, most mutant EBs formed small cavities but failed to complete cavitation (Figure 3 A, B and C). Since caspase-dependent apoptosis has been described as a key mechanism involved in the early steps of cavity formation {Coucouvanis:1995wi} we immunostained 5-day EBs for cleaved (activated) caspase-3. Wild-type EBs displayed massive central apoptosis as evidenced by cleaved caspase-3 staining (Figure 3 D). By contrast, only scattered apoptotic cells were detected in PKCι/λ deficient EBs. DAPI staining of condensed and fragmented nuclei, another hallmark of apoptosis, also showed reduced apoptosis at the center of mutant EBs (Figure 3 D). To further analyze the apoptosis during EB cavitation, we cultured EBs of both genotypes for 2 to 5 days and performed immunoblotting for cleaved caspase-3. Indeed, PKCι/λ deficient EBs expressed less apoptotic activity at all time points tested than the corresponding wild-type extracts (Figure 3 E). These results demonstrate that PKCι/λ deficient EBs fail to form a single cavity possibly due to reduced central apoptosis. Gene targeting experiments have shown that laminin-mediated basement membrane formation is essential for primitive ectoderm epithelialization and cavitation in EBs {Li: 2002hn, Murray:2000we}. The laminin α-1 chain is a key component of the embryonic basement membrane expressed early on during development {Cooper:1983wb}. In the wild-type EB the laminin α-1 staining formed a continuous thin layer between endoderm and epiblast cells (Figure 3A). We did not observe obvious changes in basement membrane assembly in mutant EBs. These findings were confirmed by using perlecan as an alternative marker for the BM (Figure 3 F and G). However, ectopic basement membrane formation was detected at the center of ~20% mutant EBs (Figure 3F). This may be caused by failure in endodermal cell migration to the EB surface. Nonetheless, these results suggest that the cavitation defect in PKCι/λ deficient EBs is unlikely caused to ectopic basement membrane assembly. Atypical PKCs have been functionally linked to the establishment and maintenance of epithelial polarity and tight junction formation due to their association with Par3 and Par6 (forming the so-called polarity complex). To determine if epiblast polarity is disrupted in the absence of PKCι/λ, we immunostained EBs for the apical marker MUPP1, Par3, the adherens junction protein E-cadherin and the Golgi marker GM130. The apical actin belt was visualized using rhodamine-phalloidin. As shown in Figure 3A, F-actin staining was detected as a continuous layer at the most inner cell membrane surrounding the single cavity in wild-type EBs. In mutant EBs, no such staining was detectable. The apical markers MUPP1 and Par3 were expressed at the same location (Figure 3F). The Golgi marker GM130 was positioned away from the basement membrane and localized on the apical side. Similarly, E-cadherin was enriched at the apex of the epiblast where they formed adherens junctions. These results provide evidence that polarity of the epiblast was intact. Since the embryo and the EB express both PKCι/λ and PKCζ, we were wondering if the remaining aPKCζ could possibly compensate for some PKCι/λ function. Therefore, we immunostained aPKC using a pan aPKC antibody in wild-type and mutant EBs. In both genotypes similar signals at the apex of the epiblast were detected (Figure 3G). Whether the signal in the wild-type reflects a combination of both aPKC isoforms is unclear but for sure the observed signal in the mutants represents PKCζ. In addition we also carried out a western blot analysis for aPKCs using protein extracts from EBs after 4 and 5 days of differentiation. The aPKC signal (ergo PKCζ in the PKCι/λ deficient background) appeared slightly up-regulated at 4 days in PKCι/λ deficient extracts whereas after 5 days it became down-regulated when compared with wild-type EBs (Figure 3H). Taken together these results suggest that PKCζ may compensate for the loss of PKCι/λ to confer an apical-basal polarity to epithelial cells in the epiblast. Immunohistochemical and electron microscopical investigation revealed subtle changes in the overall organization of PKCι deficient embryos: Since PKCι/λ deficient EBs lacked apoptosis, we wished to evaluate the contribution of this process in the mutant embryos as well. However, we failed to detect increased apoptosis by cleaved (activated) caspase-3 staining nor did we detect changes in cell proliferation using a phosphospecific histone 3 antibody between E7.5 embryos of either genotype (supplementary Figure S2). We next analyzed whether the embryonic ectoderm of E7.5 mutant embryos harbored epithelial cells with normal apical-basal polarity and junctional complexes. Again we used an antibody specific for E-cadherin as a marker for adherens junctions (AJ). As shown in the overview and the higher magnification (Figure 4A and C) both genotypes displayed a clear signal at the apical side of the embryonic ectoderm. This indicated that polarity in the epithelial cell layer was established. However, in mutant embryos the signal did not form a sharp thin line but was interrupted at the apical side (figure 4A and C). We then further applied Occludin and ZO-1 specific antibodies as marker proteins for tight junctions (TJ). In both cases the wild-type showed a punctuated pattern at the apical pole as expected (Figure 4C, white arrows). In PKCι/λ mutants we detected signals for Occludin at the apical pole of the epithelial cell layer, but weaker (Figure 4C, open arrows). In contrast we were not able to detect any signal for ZO-1 at the apical side in mutants. Instead we observed a weak cytoplasmic background signal. A semi-quantitative RT-PCR analysis of E7.5 embryos did not amplify a significant ZO-1 specific transcript. Western blot analysis did not detect ZO-1 protein in at E8.5 PKCι/λ mutants either (supplementary figure 3). Thus we concluded that TJ exists in mutant embryos but that the composition of tight junction protein complexes is altered. Based on our observation in EBs, we analyzed the aPKC content and localization in wildtype and mutant embryos. As shown in figure 4B a commonly used antibody against aPKCs (Santa Cruz # sc121 C-20) stained primarily the apical pole of the embryonic ectoderm cell layer with a minor fraction also detected in the cytoplasm in the wild-type. In the mutant embryo the signal (representing PKCζ) is maintained at the apical side. When applying a PKCι/λ specific antibody {Helfrich:2006de} the signal in the wild-type appeared broader, indicating that PKCι/λ is more widely distributed within the cells than indicated by the pan aPKC antibody, but still showing an accumulation at the apical membrane. The PKCι/λ mutant embryo did not show staining proving the specificity of the antibody. Hence, both aPKCs showed overlapping localization at the apical pole of embryonic ectodermal cells at E7.5 suggesting possible compensatory mechanisms. To further elucidate the structural organization of the cell-cell contacts, we analyzed wildtype and mutant embryonic tissue by using electron microscopy. Both genotypes showed a clear electron dense area at juxtaposed membranes located at the apical side defined as tight junctions (TJ) (Figure 5A). Adherens junctions (AJ) and desmosomes (DS) were detected without identifying any difference among the genotypes (see figure. 5A). However, when focusing on the overall appearance, we observed a general tendency of mutants to possess a looser contact zone between individual cells. This was indicated by more open gaps within the extracellular space when compared with wild-type (exemplary shown in figure 5B). At the same time we observed in sections of mutants that F-actin normally localized in tight bundles in close proximity to the membrane appeared less tight organized. In addition, the distance between the bundles and the outer membrane seemed to be larger (Figure 5C). In summary the electron microscopic analysis provides further evidences for changes in the integrity of cell-cell contacts in the absence of PKCι/ λ. PKCζ is able to rescue the early PKCι/λ in vivo function: PKCι/λ and PKCζ are structurally highly related, suggesting shared functions and redundancy. We tested this assumption by establishing a PKCɩζRes/+ mouse line which expresses a chimeric PKCζ protein under PKCι/λ conditions using its endogenous promotor and 5 ´and 3´ untranslated regulatory RNA sequences (see above and supplementary figure 1). At E7.5, we did not detect any morphological changes within 111 embryos obtained from heterozygous intercrosses of this line. In addition, we were able to identify 21 homozygous embryos (18.9%) for the rescue allele (PKCɩζRes/ζRes) when we genotyped these embryos by PCR (Figure 6, table). A Western Blot analysis of individual embryos revealed that wild-type and PKCɩ△/+ embryos showed a reasonable aPKC signal (using a pan aPKC antibody) whereas in the aPKCɩΔ/Δ no such signal was identified. Interestingly in PKCɩζRes/ζRes embryos an aPKC specific band was detectable including a 50kDa fragment which is supposed to be a proteolytic product of PKCζ, proving the isoform specificity of the expressed protein (Figure 6C). We concluded that PKCζ expressed under endogenous PKCι/λ condition is able to rescue the early PKCι/λ phenotype. In contrast, we failed to identify any PKCɩζRes/ζRes animals in 150 offspring derived from heterozygous crosses at P21 indicating that PKCζ is not able to compensate for PKCι/λ ´s function during later stages of development (see table in figure 6). To define the lethality of PKCɩζRes/ζRes embryos, we screened several embryonic stages for morphologically divergent embryos. At E9.5, PKCɩζRes/ζRes embryos were severely retarded in growth (Figure 6A). Western blot analysis revealed that PKCζ but not PKCι/λ was expressed in the rescue embryos whereas PKCζ was not expressed in the wild-type (Figure 6D). Thus, PKCζ is able to compensate for PKCι/λ in vivo function at E7.5 but not at later stages. Discussion The aim of this study was to shed more light on early embryonic in vivo functions of PKCι/λ in mouse. Earlier genetic studies in C. elegans, Xenopus and Drosophila melanogaster indicated a pivotal role of aPKC in the establishment and maintenance of polarity of oocytes and epithelial cells {Izumi:1998tb, Tabuse:1998vr, Cha:2011di, Dominguez: 1992vl}. These findings were mainly connected to the functional and physical association of aPKC to par3 and par6, which together form the polarity complex {Suzuki:2006ke}. This ternary complex is conserved among species suggesting a related phenotype upon depletion of PKCι/λ in mouse embryos. In fact a report by Soloff et. al, 2004 described an embryonic lethal phenotype when the PKCι/λ gene was knocked out by conventional gene targeting without a detailed developmental analysis. Both of our generated knock out mouse lines for PKCι/λ showed an embryonic lethal phenotype with first morphological manifestations around E7.5. Mutant embryos appeared compressed and are characterized by a severely reduced amniotic cavity. Nevertheless a histological examination revealed still the existence of epithelial cells which was rather unexpected since all studies from other species identified alterations in epithelial cell layers. So far publications describing gene knockouts in mice of polarity related proteins do not exactly match phenotypically with the PKCι/λ knockout. For example a conventional knock out of cdc42, an established activator of aPKCs in the context of the par3/aPKC/par6 complex, revealed a much earlier phenotype. Embryos deficient for cdc42 showed first signs of alterations at E5.5 and were degraded at E6.5 {Chen:2000gp}. Rac1, another small GTPase, which had been implicated many times as signal mediator of aPKC signaling also revealed an earlier phenotype in the knockout. In this case the main cause of lethality was linked to failures in the actin cytoskeletal reorganization combined with reduced motility and increased programmed cell death {Sugihara:1998ii}. A complete knock out of par3 caused mid-gestational embryonic lethality (around E9.5) which was correlated to a defective cardiac development {Hirose:2006ih}. Unfortunately published data on a par6 knockout in mice are currently not available to our knowledge. One of the most similar knock outs published so far, when taking morphological criteria into account, is represented by the afadin knockout. Similar to the PKCι/λ knockout morphological changes occurred at E7.5 and resembled what we saw in the PKCι/λ deficiency (compressed embryo and small amniotic cavity) {WataruIkeda:1999ws}. Nevertheless the described disorganized cell-cell junctions did not exactly match our observation. Interestingly afadin has been described as adapter protein connecting nectin to actin filaments {Komura:2007km} and to colocalize with par3/aPKC at adherens junctions in the neuroepithelium of the developing mouse central nervous system [55]. Thus a similar function earlier during development is conceivable but further experiments are needed to underpin this hypothesis. Our marker analysis revealed that PKCι/λ-deficient embryos start to gastrulate and establish distinct anterior-posterior and dorso-ventral body axes at around E7.5-E7.75. However, axial elongation and mesoderm formation arrests around this stage and elaboration of all mesodermal tissues and organs fails. Absence of a functional cardiovascular system is the cause of the subsequent death. Given the fact that all embryonic tissue are affected our data suggest that PKCι/λ is not regionally but cellularly required. Applying the embryonic body formation assay we showed that mutant EBs failed to establish a single cavity instead they formed multiple small cavities. Nevertheless a proper formation of the basal lamina and the apical domain by various marker proteins could be detected (see figure 3). Particular the correct localization of par3 and Mupp1 implied an established apical pole which to some content did not surprise since studies performed in C. elegans showed that loss of PKC-3 did not affect par3 localization either [56]. Interestingly EBs deficient for cdc42 not only fail to form a single lumen cavity but also showed a complete loss of aPKC and par3 localization at the apical domain [57]. One reason for this difference might be that cdc42 is not able to distinguish between the two aPKC isoforms and we showed that PKCζ is still present in PKCι/λ deficient EBs. Thus we assume that depletion of cdc42 resulted in a robust reduction of both aPKC activities causing a more severe phenotype. This finds support by the fact that overexpression of a dominant negative aPKCζ version in wild-type EBs mimics the cdc42 phenotype [57]. The formation of a single cavity has been described as a two-step process: first, multiple small lumen are formed in the periphery of the EB and within a second step smaller lumen are fused and remaining inner cells undergo apoptosis to clear the central lumen [42]. Our data suggest that the loss of PKCι/λ did not interfere with the first step but disrupted the second. Whether PKCι/λ acts on the fusion of the small cavities or the subsequently induced apoptosis or both is not solved yet but from our data it´s clear that PKCι/λ deficiency caused a decrease of activated caspase-3 and less apoptotic cells in EBs. The immunohistochemical analysis of E7.5 embryo sections revealed by the E-cadherin staining that the general polarity of the embryonic ectoderm is preserved in mutants. But it became apparent that the fine structure of the apical side is changed (indicated by its fuzzy appearance) when compared to the wild-type at higher magnification (Figure 4 C). As a possible explanation we found ZO-1, a tight junction protein, to be down-regulated and dislocated in epithelial cells deficient for PKCι/λ. ZO-1 is believed to function as a junctional organizer by direct binding to tight junctional proteins (like occludin and claudins) and the actin cytoskeleton. Thus it could well be that the absence of ZO-1 in tight junction complexes could lead to a lack of proper connections of tight junctions to the actin cytoskeleton, causing a less well organized actin belt at the apical side which leads to the initially observed fuzzy appearance. This hypothesis finds support by the EM analysis, which clearly showed that F-actin filaments are less compact organized and the distance between the outer membrane and the F-actin filaments appears to be increased in mutants. Nevertheless a conventional ZO-1 knockout displayed a later phenotype mainly associated with defect in angiogenesis and increased apoptosis [58]. One plausible explanation for this might be the existence of compensatory mechanisms in the ZO-1 knock out, which do not exist in the PKCι/λ deficiency. As for example the remaining ZO-2/3 proteins might function redundant when ZO-1 was deleted whereas a knockout of a crucial downstream kinase cannot be compensated for in this system. When analyzing aPKCs cellular localization (Figure 4B) we mainly detected aPKC at the apical side, representing the expected pattern for aPKC in epithelial cell layer [59-61]. To our surprise a nearly unchanged pattern was detected in mutants as well, indicating that either aPKCs share overlapping expression domains or PKCζ becomes up-regulated in mutants. We favor the first since neither a semi-quantitative PCR nor a Western Blot analysis of E7.5 PKCɩ△/+ and E8.5 aPKCɩΔ/Δ was able to identify an up-regulation of PKCζ (supplementary Figure 3). Thus, we assume that PKCζ can potentially take part at the predicted in vivo function of aPKCs with regard on the establishment and maintenance of polarity due to its cellular localization, thereby might compensate for PKCι/λ deficiency. In addition the increased cellular localization pattern of PKCι/λ, identified by a specific antibody, implied that PKCι might fulfill other in vivo functions than the ones predicted by its association to the par3 and par6 proteins. When PKCζ was expressed under the same spatial and temporal conditions like PKCι/λ (PKCɩζRes/ζRes allele) we were not able to detect embryos at E7.5 displaying the morphological changes described earlier. We concluded that PKCζ is able to compensate for PKCι/λ in vivo function at E7.5 when expressed at higher levels than in the wild-type. Thus the originally defined PKCι/λ specific in vivo function at E7.5 represents an aPKC signalling pathway which became PKCι/λ specific through a very tight transcriptional control. Interestingly the PKCɩζRes allele is not able to compensate for PKCι/λ functions at E9.5 since embryos homozygous for this allele showed a clear growth retardation resulting in lethality one to two days later. This points to the fact that later during development PKCι/λ in vivo function exists which are not redundant among the aPKC subfamily and could therefore be described as isoform-specific. In summary we showed that the depletion of PKCι/λ caused embryonic lethality with the earliest time-point of visible morphological changes at E7.5. To our surprise we still detected a strong staining for aPKC at the apical membrane in PKCι/λ deficient embryos indicating that a reasonable amount of PKCζ still localize to this area. This per se might be a reason why the basal to apical cell architecture in PKCι/λ deficient embryos was still conserved. In addition it also identified a possible PKCζ function in this context by its very precise localization which by far was not expected based on expression data earlier published. As a consequence of PKCι deficiency we identified a severe down-regulation of ZO-1 which could explain the subtle alteration in the cellular structure. Nevertheless the cellular mechanism of PKCι/λ in vivo function at E7.5 remained unsolved. Interestingly PKCζ was able to rescue the PKCι/λ deficient phenotype when expressed at the same levels like PKCι/λ. This identifies the aPKCs as a very redundant kinase subfamily in which transcriptional as well as spatial cues regulate its isoform specificity. Materials and Methods Generation of mutant Prkci alleles: To clone the mouse Prkci locus a 129/Ola genomic cosmid library (obtained from the Resourcenzentrum, Berlin, Germany) was screened using a full length mouse cDNA as a probe. Several cosmid clones were identified and further purified. One of those containing the genomic 5´prime part of the gene was selected for further cloning. To generate several targeting constructs for the PKCι/λ gene a 10.9 kb genomic EcoRI fragment, including the 2nd exon, was subcloned into a bluescript backbone. The convential targeting vector was generated by inserting an independent neo-cassette (derived from pMC1neoPolyA from Stratagene) into a Sal I restriction site, which was introduced into the 2nd exon by site directed mutagenesis. The conditional targeting vector was generated by introducing a single loxP site into the EcoRV restriction site 3.3 kb located upstream of the 2nd exon and insertion of a loxPflanked neo-cassette into a BglII restriction site 1.5 kb downstream of the 2nd exon. The PKCι/λ rescue targeting vector was generated by introducing an appropriate PKCζ cDNA fragment into the SalI restriction site introduced by mutation within the 2nd exon which corresponds to the 29th codon. The PKCζ cDNA fragment contained the complete 3´untranslated PKCι/λ UTR and a loxP-flanked neo-cassette along with the coding sequence. All three targeting vectors were linearized before electroporation in ES cells of the E14.1 background (129/Ola). For each electroporation 2 x 96 G418-resistant ES cell clones were screened for homologous recombination in the PKCι/λ gene locus by Southern blot analysis. For each construct at least 2 ES cell clones were identified proved to be correctly targeted. These were further used for injections into NMRI blastocysts. Chimeric males were obtained for each construct and subsequently mated to NMRI females to test for germ-line transmission. Each targeted mutation gave rise to F1 heterozygous males which were then further used for establishing the corresponding mouse lines for phenotypic analysis. Mice and genonotyping: Mice carrying a null allele of Prkci and the PKCɩζRes allele were maintained on an outbred (NMRI) background. For timed pregnancies, vaginal plugs were checked in the morning after mating; noon was taken as embryonic day (E) 0.5. Pregnant females were sacrificed by cervical dislocation; embryos were harvested in phosphate-buffered saline, decapitated, fixed in 4% paraformaldehyde overnight, and stored in 100% methanol at -20°C before further use. Genomic DNA prepared from yolk sacs or tail biopsies was used for genotyping by polymerase chain reaction (PCR). Ethics statement: All animal work conducted for this study was approved by … and performed according to Norwegian and German legislation. Hematoxylin and eosin staining of embryonic sections: For histological analysis, wildtype or aPKC mutant embryos were fixed in 4% paraformaldehyde and embedded in paraffin wax. Sections of 4 µm were processed for cytohistochemistry after deparaffinization. After rehydration the section were incubated in 1x Gill’s Hematoxylin (haematoxylin 6.0g, aluminum sulphate 42.0g, ethylene glycol 269ml, citric acid 1.4g, sodium iodate 0.6g, distilled water 680ml) for 5 minutes. After washing the samples were incubated in acid alcohol (1% HCl in 70% EtOH) and washed again. After incubation in ammonia water the samples were rinsed and incubated in eosin Y (Sigma-Aldrich, HT110132-1L) for 1 minute. Before mounting with a xylene-based mounting medium cells were dehydrated. Embryos were documented using Zeiss Lumar V.12 with AxioCam HRc camera. Whole mount RNA in situ analysis: Whole-mount in situ hybridization on E8.5 embryos was performed following a standard procedure with digoxigenin-labeled antisense riboprobes [62] Embryoid body culture and processing: The ES cell line used for this study were wildtype E14 and aPKCɩΔ/Δ ES cells [43]. Wild-type and aPKCɩΔ/Δ ES cells were cultured on mitomycin C-treated STO cells. EB formation was initiated from ES cell aggregates in suspension culture as described previously (Li 2006). For immunofluorescence, EBs were collected into 15-ml conical tubes, allowed to sediment by gravity, washed once in phosphate-buffered saline (PBS), and fixed with 3% paraformaldehyde. EBs were then embedded in OCT compound, sectioned on a Leica cryostat and immunostained for antigens of interest (Li 2006). F-actin was stained with rhodamine-phalloidin (Molecular Probes). Nuclei were counterstained with DAPI. Slides were examined with a Nikon inverted fluorescence microscope (Eclipse TE 2000) and digital images were acquired with a cooled CCD camera (Hamamatsu) controlled by IP Lab 4.0 software (Scanalytics). For immunoblotting, EBs were washed 3 times in PBS and lysed in SDS lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1% SDS) containing protease and phosphatase inhibitor cocktails. Protein concentrations were determined using BCA reagents (Pierce). Proteins of equal loads were resolved by SDS-PAGE and then transferred onto PVDF membranes, which were blocked with 5% nonfat dry milk. After incubation with primary antibodies, specific signals were detected with HRP-conjugated secondary antibodies and ECL reagents. Antibodies used: PKCζ rabbit polyclonal antibody (Cat# 07-264) and GAPDH mouse monoclonal antibody were purchased from Millipore. Perlecan rat monoclonal antibody was purchased from Santa Cruz Biotechnology, Inc. Cleaved caspase-3 rabbit polyclonal antibody was bought from Cell Signaling Technology. Actin polyclonal antibody was bought from Sigma. Immunohistochemistry and imaging analysis: For Immunohistological analysis, wild-type and aPKC mutant embryos were fixed in 4% paraformaldehyde and embedded in paraffin wax following standard protocols. Sections of 4 µm were processed for immunohistochemistry. Antigen retrieval was performed after de-waxing to enhance staining. Sections were then incubated with 5% fetal calf serum for 1 hour, and then washed three times with sterile PBS (pH 7.5) prior to overnight incubation with the appropriate primary antibodies at optimal dilutions (aPKCζ, SantaCruz, 1:200; aPKCɩ, 1:5000; aPKCζ, 1:7500 [47]; claudin, Zymed, 1:500; Occludin, Zymed, 1:500; ZO-1, Zymed, 1:100; cleaved caspase-3, Cell Signaling, 1:500, phistone 3, Cell Signaling, 1:500, E-cadherin, Santa Cruz, 1:500). The secondary antibody, AlexaFluor 647 conjugated anti-rabbit antibody was bought from InvitrogenⓇ, was used in a 1:1000 dilution and overnight incubation. The section were then mounted in Prolong Gold with DAPI reagent from InvitrogenⓇ (#P36930). Images were taken with the Zeiss LSM 510 Meta invert microscope equipped with a Zeiss LSM laser module and a AxioCam HMR digital camera. Electron microscopy: The embryos were fixed in 2% glutaraldehyde in 0.1 M sodium cacodylate buffer. After washing, specimens were rinsed twice for 10 min in 0.1 M sodium cacodylate buffer and postfixed with 2% osmiumtetroxide (OsO4) containing 1.5% potassium ferric cyanide ((K3Fe(CN)6)) for 1 h. Following extensive rinsing with water, dehydration with an alcohol series was performed. Specimens were placed in 100% alcohol and Epon 1:1 overnight and then embedded in pure Epon. Ultrathin sections were cut with a Leica microtome for TEM microscopy and placed on carbon coated copper grids. Images were taken with a Philips CM 100 transmission electron microscope (TEM) at various magnifications. Western blot analysis of embryos: Embryos were collected isolated at either E7.5 or E9.5 from the mother animal. All extraembryonic tissue was removed before lysing the whole embryo in protein extraction buffer for 20 min. on ice (50mM Tris/HCl, pH 7.5-8.0; 2 mM EDTA, pH7.0; 10 mM EGTA, pH 7.0; 0.1% TritonX-100, 3% β-mercaptoethanol) supplemented with Proteinase Inhibitor Cocktail (Sigma, #P-2714). A 31 gauge syringe was used to disrupt the tissue. The samples were centrifuged at 8.000rpm for 8 min and the supernatant was transferred into a new tube before supplementing protein sample loading buffer and boiling for 5 min. The samples analyzed on a 10% SDSpolyacrylamide gel and blotted onto BioRad nitrocellulose membranes. The membranes were blocked in 5% nonfat dry milk in TBST for 1 h at room temperature. Incubation with the primary antibody overnight in TBST at 4℃. The following antibodies were used: anti-PKCζ (Santa Cruz, C-20), anti aPKCɩ 1:10.000, anti-aPKCζ 1:5000. Semi-quantitative RT-PCR analysis: Embryos were isolated at appropriate stage and directly lysed in TRIZOL reagent from InvitrogenⓇ . The RNA isolation was performed according to the TRIZOL manual. The reverse transcription to obtain cDNA was performed using the iSCRIPT- cDNA synthesis kit from Bio-RAD. For the expression analysis the HotStar Taq PLus DNA Polymerase from Qiagen in combination with following primers was used: ZO-1 (forward-primer AGCTGTTTCCTCCATTGCTG, reverse-primer: GAGATGTTTATGCGGACGGT), aPKCζ (forward-primer: G C C T C C C T T C C A G C C C C A G A , r e v e r s e - p r i m e r : CACGGACTCCTCAGCAGACAGCA) and aPKCɩ (forward-primer: AGGAACGATTGGGTTGTCAC, reverse-primer: GGCAAGCAGAATCAGACACA). All primers were designed with an optimal annealing temperature at 60℃ and a amplicon size of around 300bp. Acknowledgments Judit Kovac for her initial help during the generation of the PKCɩζRes/+ allele. Heinz Schwarz and Gareth Griffiths for discussion on the EM data. Sebastian Seidl received funding from the University of Oslo (MLS) References 1. Ono Y, Fujii T, Ogita K, Kikkawa U, Igarashi K, et al. (1989) Protein kinase C zeta subspecies from rat brain: its structure, expression, and properties. Proc Natl Acad Sci USA 86: 3099–3103. 2. Selbie LA, Schmitz-Peiffer C, Sheng Y, Biden TJ (1993) Molecular cloning and characterization of PKC iota, an atypical isoform of protein kinase C derived from insulin-secreting cells. J Biol Chem 268: 24296–24302. 3. Akimoto K, Mizuno K, Osada S, Hirai S, Tanuma S, et al. (1994) A new member of the third class in the protein kinase C family, PKC lambda, expressed dominantly in an undifferentiated mouse embryonal carcinoma cell line and also in many tissues and cells. Journal of Biological Chemistry 269: 12677. 4. Hernandez AI, Blace N, Crary JF, Serrano PA, Leitges M, et al. (2003) Protein kinase M zeta synthesis from a brain mRNA encoding an independent protein kinase C zeta catalytic domain. Implications for the molecular mechanism of memory. J Biol Chem 278: 40305–40316. doi:10.1074/jbc.M307065200. 5. Puls A, Schmidt S, Grawe F, Stabel S (1997) Interaction of protein kinase C zeta with ZIP, a novel protein kinase C-binding protein. Proc Natl Acad Sci USA 94: 6191–6196. 6. Sanchez P, De Carcer G, Sandoval IV, Moscat J, Diaz-Meco MT (1998) Localization of atypical protein kinase C isoforms into lysosome-targeted endosomes through interaction with p62. Molecular and Cellular Biology 18: 3069–3080. 7. Hirano Y (2004) Solution Structure of Atypical Protein Kinase C PB1 Domain and Its Mode of Interaction with ZIP/p62 and MEK5. Journal of Biological Chemistry 279: 31883–31890. doi:10.1074/jbc.M403092200. 8. Noda Y (2003) Molecular Recognition in Dimerization between PB1 Domains. Journal of Biological Chemistry 278: 43516–43524. doi:10.1074/ jbc.M306330200. 9. Nakanishi H, Brewer KA, Exton JH (1993) Activation of the zeta isozyme of protein kinase C by phosphatidylinositol 3,4,5-trisphosphate. Journal of Biological Chemistry. 10. Diaz-Meco MT, Municio MM, Sanchez P, Lozano J, Moscat J (1996) Lambdainteracting protein, a novel protein that specifically interacts with the zinc finger domain of the atypical protein kinase C isotype lambda/iota and stimulates its kinase activity in vitro and in vivo. Molecular and Cellular Biology 16: 105–114. 11. Suzuki A (2003) Protein Kinase C lambda/iota (PKClambda/iota): A PKC Isotype Essential for the Development of Multicellular Organisms. J Biochem 133: 9– 16. doi:10.1093/jb/mvg018. 12. Tabuse Y (2002) Protein kinase C isotypes in C-elegans. J Biochem 132: 519–522. 13. Schaeffer E, Smith D, Mardon G, Quinn W, Zuker C (1989) Isolation and characterization of two new drosophila protein kinase C genes, including one specifically expressed in photoreceptor cells. Cell 57: 403–412. 14. Kovac J, Oster H, Leitges M (2007) Expression of the atypical protein kinase C (aPKC) isoforms ι/λ and ζ during mouse embryogenesis. Gene Expression Patterns 7: 187–196. doi:10.1016/j.modgep.2006.07.002. 15. Oster H, Eichele G, Leitges M (2004) Differential expression of atypical PKCs in the adult mouse brain. Brain Res Mol Brain Res 127: 79–88. doi:10.1016/ j.molbrainres.2004.05.009. 16. Berra E, Diaz-Meco MT, Lozano J, Frutos S, Municio MM, et al. (1995) Evidence for a role of MEK and MAPK during signal transduction by protein kinase C zeta. EMBO J 14: 6157–6163. 17. Lin D, Edwards AS, Fawcett JP, Mbamalu G, Scott JD, et al. (2000) A mammalian PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC signalling and cell polarity. Nat Cell Biol 2: 540–547. doi:10.1038/35019582. 18. Regala RP (2005) Atypical Protein Kinase C Is an Oncogene in Human NonSmall Cell Lung Cancer. Cancer Research 65: 8905–8911. doi: 10.1158/0008-5472.CAN-05-2372. 19. Baye LM, Link BA (2007) Interkinetic nuclear migration and the selection of neurogenic cell divisions during vertebrate retinogenesis. Journal of Neuroscience 27: 10143–10152. doi:10.1523/JNEUROSCI.2754-07.2007. 20. Pauken C (2000) The Expression and Stage-Specific Localization of Protein Kinase C Isotypes during Mouse Preimplantation Development. Developmental Biology 223: 411–421. doi:10.1006/dbio.2000.9763. 21. Leitges M, Sanz L, Martin P, Duran A, Braun U, et al. (2001) Targeted disruption of the [zeta] PKC gene results in the impairment of the NF-[kappa] B pathway. Molecular Cell 8: 771–780. 22. Martin P, Duran A, Minguet S, Gaspar M-L, Diaz-Meco M-T, et al. (2002) Role of zeta PKC in B-cell signaling and function. EMBO J 21: 4049–4057. 23. Galvez AS, Duran A, Linares JF, Pathrose P, Castilla EA, et al. (2008) Protein Kinase C Represses the Interleukin-6 Promoter and Impairs Tumorigenesis In Vivo. Molecular and Cellular Biology 29: 104–115. doi:10.1128/MCB. 01294-08. 24. Soloff RS, Katayama C, Lin MY, Feramisco JR, Hedrick SM (2004) Targeted deletion of protein kinase C lambda reveals a distribution of functions between the two atypical protein kinase C isoforms. J Immunol 173: 3250–3260. 25. Farese RV, Sajan MP, Yang H, Li P, Mastorides S, et al. (2007) Muscle-specific knockout of PKC-λ impairs glucose transport and induces metabolic and diabetic syndromes. J Clin Invest 117: 2289–2301. doi:10.1172/JCI31408. 26. Huber TB, Hartleben B, Winkelmann K, Schneider L, Becker JU, et al. (2009) Loss of podocyte aPKClambda/iota causes polarity defects and nephrotic syndrome. J Am Soc Nephrol 20: 798–806. doi:10.1681/ASN.2008080871. 27. Joberty G, Petersen C, Gao L, Macara IG (2000) The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Nat Cell Biol 2: 531–539. 28. Guo S, Kemphues KJ (1995) par-1, a gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed. Cell 81: 611–620. 29. Etienne-Manneville S, Hall A (2003) Cell polarity: Par6, aPKC and cytoskeletal crosstalk. Curr Opin Cell Biol 15: 67–72. 30. Watts JL, Etemad-Moghadam B, Guo S, Boyd L, Draper BW, et al. (1996) par-6, a gene involved in the establishment of asymmetry in early C. elegans embryos, mediates the asymmetric localization of PAR-3. Development 122: 3133– 3140. 31. Suzuki A (2006) The PAR-aPKC system: lessons in polarity. Journal of Cell Science 119: 979–987. doi:10.1242/jcs.02898. 32. Yang JQ, Leitges M, Duran A, Diaz-Meco MT, Moscat J (2009) Loss of PKCλ/ι impairs Th2 establishment and allergic airway inflammation in vivo. Proc Natl Acad Sci USA 106: 1099. 33. Murray NR, Weems J, Braun U, Leitges M, Fields AP (2009) Protein Kinase C II and PKC / : Collaborating Partners in Colon Cancer Promotion and Progression. Cancer Research 69: 656–662. doi: 10.1158/0008-5472.CAN-08-3001. 34. F Schwenk UBKR (1995) A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells. Nucleic Acids Research 23: 5080. 35. Monaghan AP, Grau E, Bock D, Schutz G (1995) The mouse homolog of the orphan nuclear receptor tailless is expressed in the developing forebrain. 36. Rowitch DH, McMahon AP (1995) Pax-2 expression in the murine neural plate precedes and encompasses the expression domains of Wnt-1 and En-1. Mech Dev 52: 3–8. 37. Crossley PH, Martin GR (1995) The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development 121: 439–451. 38. Wilkinson DG, Bhatt S, Herrmann BG (1990) Expression pattern of the mouse T gene and its role in mesoderm formation. Nature 343: 657–659. doi: 10.1038/343657a0. 39. Burgess R, Cserjesi P, Ligon KL, Olson EN (1995) ScienceDirect.com Developmental Biology - Paraxis: A Basic Helix-Loop-Helix Protein Expressed in Paraxial Mesoderm and Developing Somites. Developmental Biology. 40. Kraus F, Haenig B, Kispert A (2001) Cloning and expression analysis of the mouse T-box gene tbx20. Mech Dev 100: 87–91. 41. Delorme B, Dahl E, Jarry-Guichard T, Briand JP, Willecke K, et al. (1997) Expression pattern of connexin gene products at the early developmental stages of the mouse cardiovascular system. Circ Res 81: 423–437. 42. Coucouvanis E, Martin GR (1995) Signals for death and survival: a two-step mechanism for cavitation in the vertebrate embryo. Cell 83: 279–287. 43. Bandyopadhyay G (2003) Protein Kinase C- Knockout in Embryonic Stem Cells and Adipocytes Impairs Insulin-Stimulated Glucose Transport. Molecular Endocrinology 18: 373–383. doi:10.1210/me.2003-0087. 44. Li S, Harrison D, Carbonetto S, Fässler R, Smyth N, et al. (2002) Matrix assembly, regulation, and survival functions of laminin and its receptors in embryonic stem cell differentiation. The Journal of Cell Biology 157: 1279– 1290. doi:10.1083/jcb.200203073. 45. Murray P, Edgar D (2000) Regulation of Programmed Cell Death by Basement Membranes in Embryonic Development. The Journal of Cell Biology. 46. Cooper AR, MacQueen HA (1983) Subunits of laminin are differentially synthesized in mouse eggs and early embryos. Developmental Biology 96: 467–471. 47. Helfrich I, Schmitz A, Zigrino P, Michels C, Haase I, et al. (2006) Role of aPKC Isoforms and Their Binding Partners Par3 and Par6 in Epidermal Barrier Formation. J Investig Dermatol 127: 782–791. doi:10.1038/sj.jid.5700621. 48. Izumi Y, Hirose T, Tamai Y, Hirai S, Nagashima Y, et al. (1998) An atypical PKC directly associates and colocalizes at the epithelial tight junction with ASIP, a mammalian homologue of Caenorhabditis elegans polarity protein PAR-3. The Journal of Cell Biology 143: 95–106. 49. Tabuse Y, Izumi Y, Piano F, Kemphues KJ, Miwa J, et al. (1998) Atypical protein kinase C cooperates with PAR-3 to establish embryonic polarity in Caenorhabditis elegans. Development 125: 3607–3614. 50. Cha S-W, Tadjuidje E, Wylie C, Heasman J (2011) The roles of maternal Vangl2 and aPKC in Xenopus oocyte and embryo patterning. Development 138: 3989–4000. doi:10.1242/dev.068866. 51. Dominguez I, Diaz-Meco MT, Municio MM, Berra E, García de Herreros A, et al. (1992) Evidence for a role of protein kinase C zeta subspecies in maturation of Xenopus laevis oocytes. Molecular and Cellular Biology 12: 3776–3783. 52. Chen F, Ma L, Parrini MC, Mao X, Lopez M, et al. (2000) Cdc42 is required for PIP2-induced actin polymerization and early development but not for cell viability. Current Biology 10: 758–765. doi:10.1016/S0960-9822(00)00571-6. 53. Sugihara K, Nakatsuji N, Nakamura K, Nakao K, Hashimoto R, et al. (1998) Rac1 is required for the formation of three germ layers during gastrulation. Oncogene 17: 3427–3433. doi:10.1038/sj.onc.1202595. 54. Hirose T, Karasawa M, Sugitani Y, Fujisawa M, AKIMOTO K, et al. (2006) PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development 133: 1389–1398. doi:10.1242/dev.02294. 55. Wataru Ikeda HNJMKMHIMTATKTHNHYAMS-INYT (1999) Afadin: A Key Molecule Essential for Structural Organization of Cell–Cell Junctions of Polarized Epithelia during Embryogenesis. The Journal of Cell Biology 146: 1117. 56. Komura H, Ogita H, Ikeda W, Mizoguchi A, Miyoshi J, et al. (2007) Establishment of cell polarity by afadin during the formation of embryoid bodies. Genes to Cells 13: 79–90. doi:10.1111/j.1365-2443.2007.01150.x. 57. Wu X, Li S, Chrostek-Grashoff A, Czuchra A, Meyer H, et al. (2007) Cdc42 is crucial for the establishment of epithelial polarity during early mammalian development. Dev Dyn 236: 2767–2778. doi:10.1002/dvdy.21309. 58. Katsuno T, Umeda K, Matsui T, Hata M, Tamura A, et al. (2008) Deficiency of zonula occludens-1 causes embryonic lethal phenotype associated with defected yolk sac angiogenesis and apoptosis of embryonic cells. Mol Biol Cell 19: 2465–2475. doi:10.1091/mbc.E07-12-1215. 59. Morais-de-Sá E, Mirouse V, St Johnston D (2010) aPKC Phosphorylation of Bazooka Defines the Apical/Lateral Border in Drosophila Epithelial Cells. Cell 141: 509–523. doi:10.1016/j.cell.2010.02.040. 60. Ishiuchi T, Takeichi M (2011) Willin and Par3 cooperatively regulate epithelial apical constriction through aPKC-mediated ROCK phosphorylation. Nat Cell Biol 13: 860–866. doi:10.1038/ncb2274. 61. Hao Y, Du Q, Chen X, Zheng Z, Balsbaugh JL, et al. (2010) Par3 controls epithelial spindle orientation by aPKC-mediated phosphorylation of apical Pins. Curr Biol 20: 1809–1818. doi:10.1016/j.cub.2010.09.032. 62. Wilkinson DG, Nieto MA (1993) Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Meth Enzymol 225: 361– 373. Figure Legends Figure 1: Histological overview of E7.5 and E8.5 embryos. (A) Sagittal sections of wildtype and aPKCɩΔ/Δ embryos at E7.5 (right). Image of the corresponding embryo (left) (B) Sagittal sections of wild-type and aPKCɩΔ/Δ embryos at E8.5 (right). Image of the corresponding embryo (left). Abbreviations: ac, amniotic cavity; all, allantois; am, amnion; ec, ectoplacental cavity; fnf, forebrain neural-fold; hb, hindbrain; mb, midbrain; h, heart; ps, primitive streak; S=somites; tl; tiny lumina. Figure 2: Whole-mount in situ hybridization analysis of markers for germ line formation and establishment of an anterior-posterior body axis in E8.5 embryos. Figure 3: Immunofluorescence analysis of embryoid bodies (EBs) from either wild-type (WT) or aPKCɩΔ/Δ. (A) EBs from WT and aPKCɩΔ/Δ ES cells were stained with Rhodamin-Phalloidin (red, F-actin) and an antibody against Laminin-ɑ1 (green, Lm ɑ1). (B) Phase-contrast picture of 5 days old WT and aPKCɩΔ/Δ EBs. (C) Statistical analysis of lumen formation of 5 days and 7days old EBs from WT and aPKCɩΔ/Δ ES cells. (D) EBs from WT and aPKCɩΔ/Δ ES cells were stained with antibodies against cleaved caspase-3 (green, cleaved cas-3) and perlecan (red). (E) WB analysis of activated caspase-3 at different time-points in WT and aPKCɩΔ/Δ EBs. (F) Immunofluorescence analysis of EBs from either WT or aPKCɩΔ/Δ ES cells including localization of Ecadherin, MUPP1, Par3 and GM130 (green), perlecan and laminin ɑ1 (red) (G) EBs from WT and aPKCɩΔ/Δ ES cells were stained with antibodies against perlecan (green) and aPKCzeta (red, PKCζ). (H) WB analysis of PKCζ in 4days and 5days old WT and aPKCɩΔ/Δ EBs. Nucleus staining was performed with DAPI. Scale is as indicated. Figure 4: Immunofluorescence analysis of marker proteins in aPKCɩΔ/Δ embryos: Analysis were performed using the indicated antibodies. (A) Overview of a section showing a complete embryo with immunostaining against E-cadherin (E-cad). (B) Immunofluorescence analysis of aPKC localization at the apical pole of wt and PKCɩdeficient embryos in high magnification. (C) Immunofluorescence analysis of proteins involved in cellular polarity (E-cad, E-cadherin; Occl., Occludine; ZO-1, Zonula Occludens-1). Localization of Occl. is indicated by open arrows and the localization of ZO-1 by solid arrows. The scale bars indicate 20µm. Figure 5: Electron microscopic analysis of aPKCɩ-deficient embryos: Embryos were isolated at E7.5. (A) Apical junctional complex (AJC) formation in wild-type (aPKCɩ-wt) and aPKCɩ-deficient (aPKCɩΔ/Δ) embryos was compared. Functional complexes are indicated: tight junction (TJ), adherens junctions (AJ) and desmosomes (DS). The amniotoc cavity is indicated by an asterix. (B) Arrows indicate intracellular space in the apicobasal membrane in aPKCɩ-wt and aPKCɩΔ/Δ embryos. The orientation of the images is comparable to the images in A. (C) Arrows indicate the F-actin bundles parallel to the cell-membrane in aPKCɩ-wt and aPKCɩΔ/Δ embryos. EM analysis was performed as described in Materials and methods. Representative micrographs are presented. Bar is equivalent to 200 micrometer (200 μm). Figure 6: Overexpression of aPKCζ rescues PKCɩ KO phenotype: (A) Comparison of the appearance of embryos, that are either wt, heterozygous for the rescue allele (PKCƖζRes/+) or homozygous for the rescue (PKCƖζRes/ζRes) allele embryos at embryonic stage E9.5. (B) Table containing the total numbers of analyzed embryos at stage E7.5 and E9.5 and the corresponding percentage of the genotypes. (C) Western blot analysis of E7.5 embryos using an antibody against pan-aPKC (D) Western blot analysis of E9.5 embryos using indicated antibodies. Supplementary figure 1: Targeting of the PKCι/λ locus in mice. A) Schematic representation of the chosen targeting strategy. A restriction map indicating relevant restriction sites of the wild-type locus is shown. The black box represents the second exon of the PKCι/λ gene which was further used for all targeted modifications. The 2 white boxes below indicate the 5´HindIII-EcoRI RFLP probe and the 3´KpnI-EcoRI RFLP probe used for later southern blot analysis. Generated targeting constructs are listed below; convential - harbors an inserted neo cassette into the 2nd exon, conditional contains a single LoxP site 5´ and a floxed neo cassette 3´ of the 2nd exon and lastly rescue - represents an inserted PKCζ cDNA into the coding sequence of the 2nd exon followed by a floxed neo cassette. Resulting targeted alleles after homologous recombination and subsequent Cre expression are indicated. B, BamHI; Bg, BglII; E, EcoRI; EV, EcoRV; H, HindIII; K, KpnI. B) Southern blot analysis of embryonic stem cell clones after G418 selection (PKCι/λ Neo allele; PKCι/λ floxed allele) and heterozygous offspring from intercrosses of the PKCι/λ Δ allele and PKCι/λ ζRes allele. From left to right; BamHI RFLP using the 5´probe identifies 2 clones of the convential targeting by a 6.5kb band whereas the 8.0 kb band represents the wild-type band, HindIII RFLP using the 5´probe identifies 1 targeted ES clone for the floxed allele (2.0kb band); the PKCι/λ Δ allele was characterized by EcoRI using the 3´probe resulting in a 11.0kb wild-type and a 3.2kb mutant band and by BglII in association with the 5´probe resulting in a 8.4kb wild-type and 10.4kb mutant band, the PKCι/λ ζRes allele was characterized by EcoRI using the 3´probe resulting in a 11.0kb wild-type and a 5.1kb mutant band and by BglII in association with the 5´probe resulting in a 8.4kb wild-type and 14.4kb mutant band. C) PCR genotyping of DNA samples generated from progeny of heterozygous intercrosses of the indicated alleles. For PKCι/λ Δ and PKCι/λ ζRes embryos at E7.5 were used as starting material for the DNA extraction. Corresponding genotypes are indicated above the individual agarose gels. Supplementary figure 2: Proliferation and apoptosis in PKCι/λ mutant embryos: E7.5 embryos were embedded in paraffin and then sectioned into a 5µm thick slices. Immunofluorescence analysis were performed using the indicated antibodies. Markers for either apoptosis (cleaved caspase-3, 1:500) or proliferation (phospho-histone-3, 1:500) were used for immunofluorescence analysis of aPKCɩΔ/Δ embryos or wild-type (WT). All analysis were done by using the Zeiss LSM 510 confocal microscope. Scale bar: 100 µm Supplementary figure 3. Protein expression and protein levels analysis in wild-type and aPKCiota-deficient embryos (A) Expression analysis of indicated proteins in wild-type (WT) and aPKCɩΔ/Δ embryos at stage E7.5. (B) WB analysis of WT and aPKCɩΔ/Δ embryos at stage E7.5 and E8.0 using antibodies as indicated. Results of the aPKC blot are shown with different exposure times: 2 min (lower lane) and 5 min (upper lane). Contributions of individuals: SS - western blotting, rescue work, RT-PCR and IF UB - involved in most of the experimental work SL - EB work NR - EM work AK - RNA in situ and writing manuscript ML - Design, supervision and writing manuscript A B A B A WT PKC-/- B WT PKC-/- C F WT PKC-/D E G H WT PKC-/- A B Δ/Δ * * * aPKC ! Δ/Δ Δ/Δ * * E-cad * aPKC E-cad ! C * * ** E-cad Occl. ZO-1 Δ/Δ Δ/Δ Δ/Δ * E-cad * Occl. * ZO-1 A * TJ " * TJ AJ AJ DS C DS " B " A wt #"$ #"# 80 60 50 pan-aPKC pan-aPKC ß-actin "# D # E9.5 36.4% 50.5% 12.1% 107 wt 39 54 13 # " # "Δ Δ Δ C E7.5 29.7% 51.4% 18.9% 111 33 57 21 "$ wt Δ"Δ #"# ' B # $%&' A. PKC allele Bg B H E EV H B KE Bg Bg 1kb B PKC K E neo pKS E PKC pKS H PKC K neo B Bg B K Bg neo PKCc pKS K B neo Bg H K H E Bg E Bg K E Bg PKCc B. PKCι/λ ! PKCι/λ 8.0kb 3.0kb 6.5kb 2.0kb C. 14.4kb 10.4kb 5.1kb 8.4kb 3.2kb o eo eo /Ne eo +/N +/N Neo +/+ +/+ +/N PKCι/λ 11.0kb 11.0kb +/Δ +/Δ Δ/Δ +/+ Δ/Δ Δ/Δ PKCι/λ 8.4kb 5´probe 3´probe 5´probe 3´probe 5´probe 5´probe PKCι/λ" PKCι/λ +/+ /+ /+ + + ( PKCι/λ" Supplementary Figure 1. aPKCWT phistone-3 aPKCΔ/Δ phistone-3 aPKCWT cleaved casp-3 aPKCΔ/Δ cleaved casp-3 D3.&ȗ D3.&ȗ D3.&Ț D3.&ȗ D3 . & Ț : 7 D 3 .& Ț ǻ ǻ D3 . &Ț: D3 7 . & Ț ǻ D3 . &Ț: D3 7 . &Ț ǻ D3 . & Ț ǻ ǻ