Download 1335_seidl_materie-hele - DUO

Analysis of isoform specific functions of atypical PKCɩ
and PKCζ
Sebastian Seidl
The Biotechnology Centre of Oslo
University of Oslo
April 2013
© Sebastian Seidl, 2013
Series of dissertations submitted to the
Faculty of Mathematics and Natural Sciences, University of Oslo
No. 1335
ISSN 1501-7710
All rights reserved. No part of this publication may be
reproduced or transmitted, in any form or by any means, without permission.
Cover: Inger Sandved Anfinsen.
Printed in Norway: AIT Oslo AS.
Produced in co-operation with Akademika publishing.
The thesis is produced by Akademika publishing merely in connection with the
thesis defence. Kindly direct all inquiries regarding the thesis to the copyright
holder or the unit which grants the doctorate.
“Far more interesting than
problem solving is problem
creation.” Chuck Close
Table of content
Acknowledgements
Abbreviations
List of papers included
Introduction
4
5
6
7
Principles of signal transduction
7
Three large classes of the cell surface receptors
8
Ligand-gated ion channels
8
Enzyme coupled-receptors
9
G-protein receptors
Protein kinases in signal transduction
10
12
The family of Protein Kinases C
13
Domains and their roles in PKC
14
The C1 and C2 domains
14
The pseudosubstrate motif
16
The PB1 domain
16
The Hinge region
17
The kinase domain
18
Activation of PKC
21
A-loop phosphorylation
22
Phosphorylation of the turn-motif
24
The atypical PKCs
26
The role of aPKC in polarization and maintenance of cellular polarity
27
Maintenance of cellular polarization through active exclusion
32
Atypical PKCs in embryology
34
The role of aPKC in very early embryogenesis
36
2
2
Present Investigations
39
Aims of the study
39
Synopsis of the papers
40
Discussion
42
The HINGE domain and its role in sub-cellular localization of aPKCs.
42
The nuclear shuttling of aPKCs is not exclusively regulated by the NLS
44
Nuclear functions of aPKCs
48
The role of atypical PKCs in early mouse development
50
Embryoid bodies as a model system for cavity formation
51
Further insights from alternative model systems for cavity formation53
aPKCɩ deficient embryos show impaired TJ proteins
Expression of aPKCζ partially rescues the aPKCɩ phenotype
Summary and future perspectives
References
Papers
3
3
54
57
59
60
87
Acknowledgements
The present work was conducted at the Biotechnology Centre of Oslo, University of Oslo,
2008 - 2012 supported by the University of Oslo, Molecular Life Science (MLS) under the
supervision of Michael Leitges.
First and foremost a want to thank my supervisor Dr. Michael Leitges. During my
time as a Ph.D student at The Biotechnology Centre of Oslo he has been more than my
superior. He was a co-worker, a bouncing wall for ideas and most important, a motivator. I
am very grateful for the time and the energy he spent on my project. His understanding of
the field and his attitude towards science will always be an example for me
As a researcher you can only be as good as the lab you are a part of. So if I am
anything but excellent, thats my fault, since I had the pleasure of working with an
exceptional technician, Uschi. Thank you for everything, Iwill miss the time we had in the
lab.
To Catherine, Sergio, Julian, Sandra and Philip: All of you made the work in the
group interesting. Your stories and your personalities are outstanding. I am not sure
whether I going to miss all of it, but I will for sure treasure you for the rest of my life.
To my BiO colleagues: thank you for all the discussions, the retreats, christmas
parties and tuesday seminars. You were my scientific community for all those years and
you influenced my way of thinking whether you like it or not. I wish all of you the very best.
To Ola, Jorunn, Gladys, Carlos, Ragni, Melaku, George, Jean and especially Liv.
Thank you for keeping the Biotek running. You are very much appreciated.
To Catherine and Judith Staerk. Thank you for your work on the manuscript an your
much appreciated feedback.
To my family. Words cannot describe what you mean to me. Thank you to my brothers
Christian and Florian for endless support when needed and distractions when necessary.
Mama and Papa, you have always been examples and cared more about your children
than about yourselves. This thesis is as much yours as it is mine (but I understand it
better). I love you all.
To Victoria: thank you, for everything you were, you are and will be.
4
4
Abbreviations
A-loop = activation loop
NES = nuclear export sequence
ADH = antidiuretic hormone
NLS = nuclear localisation sequence
AJ = adherens junction
nPKC = novel Protein kinase C
AJC = apical junctiona complex
NRTK = non receptor tyrosine kinase
AL = activation loop
Par3/6 = partitioning defective 3/6
AMP=adenosin monophosphate
PB1 = Phox and Bem1p
AMPK = AMP activated kinase
PIP2 = Phosphatidylinositol 4,5-bisphosphate
AP = apico basal
PKA = protein kinase A
aPKC = atypical Protein Kinase C
PKC = protein kinase C
AR = androgen receptor
PKD = protein kinase D
BTC = Betacellulin protein
PKG = protein kinase G
C1 = cystein rich domain 1
PLC = phospho lipase C
CAMK = Ca2+ dependent protein kinase
PP1ɑ = protein phosphatase 1 alpha
CHO = Chinese hamster ovary
PTB = phosphotyrosine-binding domain
CKI = cyclin dependent kinase
RasGRP = RAS guanyl nucleotide-releasing protein
cPKC = conventional Protein kinase C
RGS = regulator of G-protein signaling
DAG = diacylglycerol
ROCK = Rho-associated protein kinase
EGF = epidermal growth factor
RTK = receptor tyrosine kinase
EGFR = epidermal growth factor receptor
SH2 = src homolog
FRET = Fluorescence Resonance Energy Transfer
TE = tropho-ectoderm
GAP = GTPase Activating Protein
TGFɑ = tumor growth factor alpha
GDP = Guanosyl di-phosphate
TJ = tight junction
GPCR = G-protein coupled receptor
TM = transmembrane
GTP = Guanosyl tri-phosphate
TNF = tumor necrosis factor
HB = haemoglobin
UFE = unfertilized egg
hBVR = human biliverdin reductase
V3 = variable region 3
HM = hydrophobic motif
ZA = zonula adherens
ICM = inner cell mass
ZO = zonula occludens
IP3 = inositol-tri-phosphate
JAM = junctional adhesion molecule
LGL = Lethal giant larvea
LIP = lambda interacting protein
mTOR = mammalian target of rapamycin
mTORC = mTOR-complex
5
5
List of papers included
Paper I
Functional comparison of protein domains within aPKCs involved in
nucleocytoplasmic shuttling
Sebastian Seidl, Ursula B. Braun and Michael Leitges*
May 15, 2012 Biology Open 1, 436-445. doi: 10.1242/ bio.2012505
Paper II
Manuscript (under review)
Phenotypical analysis of atypical PKCs in vivo function display a
compensatory system at embryonic stage 7.5 p.c.
Sebastian Seidl, Ursula Braun, Norbert Roos, Shaohua Li, Andreas Kispert*
and Michael Leitges*
6
6
Introduction
Principles of signal transduction
Communication and interaction between cells is probably older than any multicellular
organism, since already yeast as a single cell organism have been shown to influence
another cell by secreting a signaling molecule. Mating yeast secret a ‘mating factor’ that
causes other yeast to stop proliferating and instead to prepare for mating (Marsh, Neiman,
& Herskowitz, 1991), showing that communication between cells is crucial to control critical
cellular responses. In multi-cellular organisms, cells developed many different
mechanisms to specifically interact and/or manipulate each other. The more complex an
organism the more crucial it becomes to restrict and specify signals to prevent unwanted
crosstalk between cells. The easiest and simplest way of communication is through direct
interaction of two or more cells. In case of contact dependent signaling, the molecule, also
called ligand, is presented on the cell membrane by the neighboring cell. The receiving cell
presents a receptor on the membrane that specifically recognizes and binds one or more
signaling molecule. Contact-dependent ligand-receptor binding is the main form of
communication between cells during development and in immune response and
represents an extremely specific and local event that requires physical contact between
the effector and the receiving cell. In higher organisms signals often have to be sent over
long distances. Cells therefore started to secret soluble signaling molecule instead of
presenting the signaling molecules on the membrane. The advantage of this system is that
numerous distant cells can be reached by the secreted molecules but the effect can also
be a local event and can be limited to a single organ or to events such as infection or
injury. The secretion of a signaling molecule by a single cell or a group of cells to activate,
modulate or recruit the same cell is called autocrine signaling, whereas secretion of a
molecule by a single cell to regulate different adjacent cells is called paracrine signaling.
During autocrine signaling the hormone produced by one cell binds to receptors on the
same cell and modulates its cell response. During paracrine signaling the signaling
molecule is secreted by one cell and affects a different cell nearby. To regulate cell
responses further away higher organisms have developed endocrine signaling which is
mediated by hormones that are released into the blood stream and can affect the whole
body or control certain tissues and organs. The endocrine system ensures that an
organism can react to an event with a systemic response, such as hormone release into
7
7
the blood, which in turn can have different local effects. A signaling molecule involved in
paracrine and endocrine signaling is for example vasopressin. Vasopressin, also known as
ADH, is mainly synthesized in a region of the brain called hypothalamus where it acts as a
neurotransmitter and seems to play an important role in memory and diseases such as
Schizophrenia and Autism (Frank & Landgraf, 2008). Moreover, when secreted into the
blood, e.g. after osmotic stress, it acts as a peptide hormone and mediates diverse
biological effects depending on the interacting receptor. The vasopressin receptors V1a, b
(V1R) and V2 (V2R) are found on the surface a variety of tissue including vascular smooth
muscle, kidney, liver and spleen. In the kidney vasopressin acts by the V2R and regulates
the water balance of the organism (Zingg, 1996). The V2R is exclusively expressed in the
collecting ducts of the organ (Mutig et al., 2007) and this signaling cascade is a good
example illustrating how a systemic signal can control local biological processes. In
summary, all types of communication are based on the same principle: a specific ligandreceptor interaction. Most receptors are membrane bound and highly specific for one
group of ligand or even for one kind of signaling molecule. Whether a cell is affected by a
certain hormone or molecule is therefore dependent on the cell-surface receptors
presented on the membrane.
Three large classes of the cell surface receptors
As mentioned above, all signaling molecules bind to specific receptors presented on the
surface of the target cell. The binding of the ligand to its corresponding receptor induces a
process that is called signal transduction. Signal transduction describes the translation of
an extracellular event into an intracellular signal or signaling cascade, which further
influences cellular processes such as proliferation, migration and apoptosis. Nearly all cellsurface receptors belong to one of the main three classes, which are classified by their
mode of signal transduction after activation of the receptor and explained in more detail
below.
Ligand-gated ion channels
The ligand-gated ion channel superfamily contains numerous homologous receptor
proteins that consist of an extracellular binding domain and transmembrane domains.
Each receptor exists as a multi-subunit structure such as trimeric complexes (P2X
receptors), tetrameric complexes (NMDA, AMPA receptors) and pentameric complexes
(nicotinic acetylcholine receptor (nAChR)). The nAChR is a particularly well studied
example. nAChR belongs to the group of pentameric receptors and is most abundant on
8
8
the surface of neural cells. Upon binding of nicotine the internal receptor conformation
changes from closed to open. Each subunit binds two nicotine molecules to fully open the
pore, which subsequently allows Na+ ions to travel along their electrochemical gradient.
As a consequence, the cell membrane depolarizes and an action potential is initiated
(Brejc et al., 2001). Besides the family of nACh receptors there are several others, such as
glutamate receptors, ATP-gated channels and cAMP-gated channels. All ligand gated ion
channels share the same mechanism. Binding of the ligand induces a conformational
switch from either ‘open to close’ or ‘close to open’ and changes the permeability of the
membrane to the corresponding molecule or ion triggering intracellular process (reviewed
in Collingridge, Olsen, Peters, & Spedding, 2009).
Enzyme coupled-receptors
The second main group of cell-surface receptors is the superfamily of enzyme-coupled
receptors, also referred to as catalytic receptors. These receptors are transmembrane
proteins that consist of an extracellular domain that recognizes and binds the signaling
molecule, an intracellular domain that activates downstream signaling and
a
transmembrane helix that anchors the receptor in the membrane. Three groups of
enzymatic coupled-receptors are known:
i) Receptor serine-threonine kinases,
ii)Receptor tyrosine kinases (RTK), and
iii)Tyrosine-kinase associated receptors (cytokine receptors)
RTK exist as heterodimers when bound with a signaling molecule and perform tyrosine
phosphorylation on themselves (autophosphorylation) and each other (crossphosphorylation). Every subfamily of enzyme-coupled receptors contains several isoforms
that form a homo- and heterodimer with specific ligand-binding properties. For example,
the family of EGFR/ErbB receptors consists of four protein isoforms: EGFR (ErbB1, Her1),
ErbB2 (Her2, Neu), ErbB3 (Her3) and ErbB4 (Her4). It has been shown that all isoforms
can form homo- or heterodimers with each other and that each combination has a specific
ligand affinity with multiple possible ligands (reviewed in Harris, Chung, & Coffey, 2003).
Dimerization of the receptor occurs in the endoplasmic reticulum (ER) and not as earlier
expected on the cell membrane (Tao & Maruyama, 2008). Depending on the cell type the
heterodimer composition is different and not necessarily influenced by extrinsic factors
(Zaczek, Brandt, & Bielawski, 2005). Depending on the heterodimer composition the
9
9
receptors are able to bind several ligands including EGF, TGFɑ, AR, HB-EGF, BTC, EPR
and EPIGEN. Upon ligand binding tyrosine residues in the C-terminal tail become
phosphorylated. These so-called Src-Homology 2 (SH2) domains and Phosphotyrosinebinding domains (PTBs), act as docking sites for other signaling proteins. Receptor
activation ultimately leads to activation of downstream signaling pathways including
mitogen activated protein kinase (MAPK), phospholipase Cɣ (PLCɣ) and
phosphatidylinositol-3 kinase (PI3K), which then further modulates cellular functions. Once
a receptor is activated and active the cell has to deal with the problem of restricting and
regulating the receptor and its effects. Enzyme-coupled receptor activity is regulated by
internalization and subsequently undergoes degradation and/or recycling, depending on
the ligand. For example, the binding of EGF to the corresponding receptor is very strong
and remains even in the endosome. Even after internalization of the receptor ligand
complex the persisting binding of EGF causes continuous ubiquitination of the EGFR in
the endosome and the ubiquinated protein is then further transported to the lysosomes
where it undergoes degradation (Madshus & Stang,2009). In contrast, binding of TGFɑ to
the receptor is much weaker and pH dependent. The changed pH in the endosome causes
disassociation of the ligand from the receptor and prevents prolonged ubiquitination of the
EGFR which in turn is recycled and not degraded. The specific effects of the several
different ligands on the regulation of EGFR have been investigated in detailed by
Roepstorff and colleagues (Roepstorff et al., 2009).
G-protein receptors
G-protein coupled receptors (GPCRs) represent the largest family of membrane proteins in
the human genome. As indicated by the name, these receptors interact with or are coupled
to trimeric G-proteins on the cytoplasmic side of the membrane. Despite their classification
it has recently been shown in plants that these receptor types can signal through G-protein
independent pathways (J. G. Chen, 2004). All GPCRs share a common structure of seven
transmembrane (TM) segments with an extracellular amino terminus and an intracellular
carboxyl terminus. The greatest homology among the family members is found in the TM
segments, while the greatest diversity is found in the amino terminus and varies depending
on the corresponding interacting signaling molecule. In spite of the diversity of ligands
there seems to be a general mechanism of activation. All GPCR family members
transduce external signaling information into an intracellular event by interacting and
activating members of the family of heterotrimeric G-proteins.
10
10
Heterotrimeric G-proteins are crucial for regulation of signaling events within the cell.
These proteins turn on intracellular signaling cascades in response to extracellular stimuli
and are key components in the regulation of several cellular responses including cell
proliferation, migration and survival. Heterotrimeric G-proteins are composed of three
different subunits ɑ, β and ɣ. Due to their ability to switch between a GTP-bound
conformation and a GDP-bound conformation they are often called ‘molecular switches’. In
the GDP-bound conformation G-proteins are primed to bind the receptor while the GTPbound conformation modulates downstream effectors. In humans, 21 Gɑ subunits
(encoded by 16 genes), 6 Gβ subunits (encoded by 5 genes) and 12 Gɣ subunits have
been identified so far. The heterotrimers are classified into four main groups based on their
sequence homology of the Gɑ subunits: Gɑs, Gɑi, Gɑq and Gɑ12. The interaction between
G-proteins and GPCRs involves several regions that contribute to the interaction surface
of the complex. Even though GPCRs are able to activate several G-proteins they do not
interact with all G-proteins. Furthermore, each member of the G-protein family interacts
with many different receptors. The exact mechanism of how specificity of those
interactions is achieved remains unknown.
Upon activation of the heterotrimeric G-proteins by a stimulated receptor, the ɑ-subunit
releases the bound GDP and exchanges it for the energetically higher GTP. Subsequent
conformational changes of the ɑ-subunit lead to disassociation of the βɣ-complex,
resulting in two active signaling components. The separation of the complex activates
downstream effectors, such as adenylyl cyclase, guanylyl cyclase, phospholipase C and
others. The activity and target specificity are usually regulated by special proteins, also
known as regulator of G-protein signaling (RGSs). The RGS-protein family consists of at
least 25 members in humans of which all contain the RGS-domain that binds to the ɑsubunit. There are three main mechanisms by which RGS-proteins regulate the activity of
the ɑ-subunit:
1. RGS-proteins act as a GTPase activating protein (GAP) accelerating the hydrolysis of
GTP to GDP and therefore the reassembling of the trimeric complex.
2. RGS-proteins act as effector-antagonists that prevent binding of the G-protein to its
actual effector.
3. RGS-proteins accelerate the reformation of the trimeric complex by increasing the
affinity of the ɑ-subunit to the βɣ-complex.
The spatial and temporal regulation of G-proteins is crucial for a coordinated signaling
cascade. While the temporal regulation is mainly mediated by RGS-proteins, spatial
11
11
regulation is achieved by covalently attached lipid molecules that bind and thereby restrict
the protein to the plasma membrane. Activation of G proteins then lead to activation and
release of second messengers and activation of protein kinases. Protein kinases often
work as signaling hubs getting input from different sources and regulating important
cellular processes through a complex network.
Protein kinases in signal transduction
The human kinome includes a total of 518 kinases organized in eight superfamilies. Six
superfamilies belong to the class of serine/threonine kinases, including STE-, CKI-, AGC-,
CAMK-, CMGC- and RGC protein family. There are two classes of tyrosine kinases
including a total of 133 proteins (Manning, Whyte, Martinez, Hunter, & Sudarsanam, 2002).
Receptor tyrosine kinases (RTKs) are transmembrane proteins with an extracellular
substrate binding domain and an intracellular kinase domain that phosphorylates the
target protein. Receptor tyrosine kinases do not act as second messenger and possess
enzymatic activity that is induced upon ligand binding. The second group is the class of
non-receptor tyrosine kinases (NRTKs). These proteins are cytoplasmic molecules that are
not directly activated by extracellular signals. Instead, activation of NRTKs is mediated by
RTKs or other cell surface receptors such as G protein-coupled receptors. The family of
NRTKs is divided in subfamilies based on sequence homology and includes Src-, Abl- and
Jak kinases. The largest subfamily of NRTKs, with nine members, is the Src kinase family.
Src proteins are involved in signaling processes including mitogenesis, T- and B-cell
activation and cell structure. Src kinase has originally been isolated from cancer cells and
has been implicated in several human carcinomas, including breast, lung and colon cancer
(Biscardi, Tice, & Parsons, 1999).The remainder of human kinases is specific for the
phosphorylation of serine/threonine residues and consists of at least 385 proteins
organized in six major groups, 82 families and 135 subfamilies (Manning et al., 2002).
Serine/threonine kinases are involved in the regulation of every aspect of cellular life and
proteins and are often essential for survival of the organism. In the following the focus lies
on the family of protein kinase C (PKCs). PKCs are a group of diverse kinases activated
by the second messengers DAG and Ca2+. In general, DAG is thought to be responsible
for membrane recruitment of the protein kinase, where it binds to Ca2+ and
phosphatidylserine. Activated PKCs interact with numerous targets and are involved in
many cellular processes.
12
12
The family of Protein Kinases C
The Protein kinase C (PKC) multigene family consists of 11 serine/threonine kinases that
play a crucial role in growth factor signal transduction and are involved in various cellular
events including cell proliferation, differentiation and cell death. As members of the so
called AGC family ( named after PKA, PKG and PKC families) they share common
features. All PKCs contain a catalytic domain that is highly conserved among serine/
threonine kinases and a variable N-terminal regulatory domain that maintains the enzyme
in an inactive conformation and regulates protein-protein interactions. The PKC family is
further divided into three subfamilies depending on their modus of activation, which in part
is a consequence of the domain composition of the regulatory domain. The conventional
PKCs (ɑ, γ, and the alternatively spliced βΙ and βII) require diacylglycerol (DAG),
phosphatidylserine (PS), and calcium for activation. Novel PKCs (δ, ε, η/λ, θ) are
activated by DAG and PS but are insensitive to calcium. The atypical protein kinase C
(aPKC) subfamily is composed of two members (ζ and ι/λ) with PKCɩ being the human
homolog of mouse PKCƛ. The two atypical isoforms are highly related with an amino acid
sequence homology of 72%. The two isoforms share an almost identical kinase domain
with all members of the PKC family. In contrast, the regulatory domain lacks some features
compared to the other subfamilies and contains only one cysteine rich C1 domain, a
pseudo-substrate motif and a PB1 domain. Thus, aPKCs only require PS but neither DAG
nor calcium to acquire full activity. PKC activation is mediated by G-protein coupled
receptors and therefore connected to a variety of signaling molecules. The lipid-sensitive
enzymes are activated through growth factor induced activation of phospholipase C (PLC).
Activated PLC hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2) to generate
diacylglycerol (DAG) and inositol triphosphate (IP3), which induces an increase of
intracellular calcium (CA2+). DAG and increased calcium levels then activate most PKC
isoforms. In the inactive conformation the pseudosubstrate (PS) occupies the ATP-binding
site and prevents substrate-binding of the enzyme. Interaction and binding of cofactors
change the conformation and release the PS from the ATP-binding site, making it available
for catalysis. Even though PKCs are ubiquitously expressed, the expression pattern of the
different PKC isoforms is tissue specific, e.g.
PKCθ is expressed primarily in skeletal
muscle, lymphoid organs and hematopoietic cells, while PKC gamma is expressed in
neurons. Generally, multiple members of the PKC family are found in the same cell.
13
13
Domains and their roles in PKC
The domain composition of the N-terminus is very heterogenous among different members
of the PKC family. When first discovered by coworkers of Nishizuka at the Kobe University
in 1977 it was thought to be a new type of an unregulated kinase. It turned out that they
isolated only the catalytic domain, since the isolation procedure fragmented the protein
(Inoue, Kishimoto, Takai, & Nishizuka, 1977; Takai, Kishimoto, Inoue, & Nishizuka, 1977).
It was obvious from the time of its discovery, that any kind of regulation and specificity is
modulated by the N-terminal regulatory domain. To understand the mechanism behind the
regulation of PKC it is important to know the function of the components of the system, or
in this particular case, the individual domains. Each domain has an intrinsic function that is
under certain circumstances executed or inhibited. The sheer existence of the same
domain in two different proteins does not necessarily mean that they have exactly the
same function.
The C1 and C2 domains
The C1 domains are cysteine-rich, 50-51 amino acids long motifs. They were originally
identified as binding sites for DAG and phorbol esters in PKC, but have been found in
multiple signaling families, including PKDs, chimaerins, RasGRPs, diacylglycerol kinases
(DGKs) and others. All domains contain a conserved motif: H-x12-C-x2-C-x13/14- C-X2-C-X4H-x2- C-x7-C (H-histidine; C=cystidine; x=any AA). In cPKCs and nPKCs the C1 domain
exists as a tandem motif, C1A and C1B. This motif is responsible for DAG binding through
14
14
2 zinc ions controlled by the C1 domain. Due to the ability to bind DAG as an important
second messenger or its analog phorbol esters it is also known as phorbol esters/DAG
binding domain. In aPKCs only one C1 domain is present and PKCɩ/ƛ and ζ are DAG and
phorbol ester insensitive. Whether this insensitivity is due to the lack of one motif or
caused by intrinsic differences is still debated. Although all DAG/phorbol esters responsive
PKC contain a twin cysteine-rich motif it has been show that single C1 domains possess
all the requirements for binding of phorbol esters (Quest & Bell, 1994). Interestingly,
despite their different affinities to DAG under normal conditions c/nPKCs display the same
affinity for the ligand when forced into a 2D structure (Kazanietz et al., 1993). This
indicates that the C1 domains have either unique intrinsic structural characteristics or are
regulated by the overall conformation of the PKCs. However, it is clear that aPKCs are
DAG and phorbol ester insensitive no matter whether this is due to the ‘atypical
C1’ (Colón-González & Kazanietz, 2006) domain or not.
The C2 domain consists of 130 amino acid residues and was first identified in activated
PKCs. The fact that cPKCs, in contrast to nPKCs, are regulated by calcium suggests that
the C2 domain acts as a calcium-binding motif (Kikkawa, Kishimoto, & Nishizuka, 1989).
Further studies confirmed that the C2 domain binds anionic phospholipids in a calcium
dependent manner. The binding of calcium is thought to be the initiating step in cPKC
activation. Upon calcium binding PKCs transiently translocate to the membrane. DAG, the
membrane bound co-activator of PKCs is then able to interact with the C1 domain.
Subsequent binding of PIP2 and PS facilitates the release of the autoinhibitory
pseudosubstrate sequence allowing substrate phosphorylation (Evans, Murray, Leslie, &
Falke, 2006; Sánchez-Bautista, Marín-Vicente, Gómez-Fernández, & Corbalán-García,
2006). Novel PKCs also contain a C2 domain, although the order of those two is switched
relative to the cPKCs. Novel PKCs were originally thought to lack the C2 domain, but
phylogenetic studies identified a conserved C2 domain (Sossin & Schwartz, 1993).
Defining nPKC, the C2 domain lacks the ability to bind calcium, resulting in a DAG
dependent, but calcium independent protein activation. The atypical PKCs lack a C2
domain and are Ca2+ insensitive.
15
15
The pseudosubstrate motif
The pseudosubstrate domain is a conserved motif present in the regulatory domain of all
PKC isoforms but is differently located within the protein. Originally identified by Kemp and
coworkers, the sequence resembles that of a PKC substrate except that an alanine
occupies the phospho-acceptor position (House & Kemp, 1987). When PKC is inactivated,
the pseudosubstrate domain covers the ATP binding pocket of the otherwise active
catalytic domain. This theory was supported by the fact that an antibody against the
pseudosubstrate sequence is able to fully activate the enzyme in the absence of cofactors
(MAKOWSKE & ROSEN, 1989)
The PB1 domain
An exclusive feature of the atypical PKCs are the N-terminal PB1 (Phox and Bem1)
domains. The PB1 domains consist of about 80 amino acid residues, mediate highly
specific protein-protein interactions and are conserved in a variety of species ranging from
plants to mammals. The PB1 domains are grouped into three types, type I, type II and
typeI/II. Type I, also known as PC-motif (Phox and Cdc42) (Nakamura et al., 1998) is 28
amino acids long with four highly conserved acidic residues with the sequence Asp-X(Asp/Glu)-Gly-Asp-X8-(Glu/Asp). This motif is also known as OPR (octicosapeptide repat)
or AID (atypical PKC interaction domain) and is therefore generally named OPCA (OPR,
PC, AID).The type II variant of the PB1 domains is characterized by an invariant lysine
residue on the first beta strand. PB1 domains are highly specific for PB1-PB1 interaction
and by now at least 13 PB1 containing proteins have been identified in humans, containing
either type I, type II or both motifs. The protein-protein interactions are a result of
heterodimeric assembly between type I and type II PB1 domains in a front-to-back
manner. In this also called canonical PB1 dimerization the acidic residues on the OPCA
motif form salt bridges with basic residues of the type II domain. The aPKC PB1 domain is
a typeI/II domain and has been shown to mediate interaction with several proteins, such
as p62, par6 and Mek5 (Hirano, 2004a). In the case of the interaction between PKCɩ/ƛ and
Par6ɑ, two residues of the Par6ɑ, Arg28 and Arg89 (on strand β2, respectively β5) assist
the salt bridge formation. In addition a conserved acidic residue, Glu76, forms another salt
bridge with Arg27 on strand β2 of Par6ɑ. The specificity of the hetero-dimerization is
increased by an interaction of the ɑ2 helix of PKCɩ/ƛ with the Par6ɑ PB1 domain (Hirano,
2004b; Wilson, Gill, Perisic, Quinn, & Williams, 2003). Generally, type II domains are able
16
16
to interact with all types of PB1 domains and have the potential to mediate homooligomerization. Even though this has not yet been reported for aPKCs, p62 another typeI/
II containing protein is also capable of homologous binding (Bjorkoy, 2005). p62, also
known as sequestosome1 (SQSTM1) has also been shown to interact with both aPKCs
(S. Ohno, 2001; Puls, Schmidt, Grawe, & Stabel, 1997). However, p62 is not a substrate
and has no significant effect on the kinase activity of the protein. Therefore it is likely that
p62 acts as a scaffold protein to restrict and direct the actions of aPKCs. Taking the nature
of PB1-Pb1 interaction it is likely that over time more interactions will be identified and in
the case of aPKCs more studies are necessary to fully understand the function and
regulation of the different PB1 interactions.
The Hinge region
The Hinge domain, also called variable region 3 (V3), is approx. 60 amino acid residues
long and is located between the regulatory domain and the catalytic domain. This structure
shows very little homology among the PKCs and was originally thought to have no
particular function at all. Anyhow, some PKC isoforms including PKCδ, -ε, -θ and -ζ have
been shown to be a target of proteolytic cleavage with a primary cleavage-site exclusively
in the hinge region. PKCε possess in total 3 cleavages sites of which the primary site for
function is located in the hinge region. TNF-induced Caspase 7 mediated cleavage of
PKCε results in an active kinase fragment with an anti-apoptotic function (Basu, 2002).
PKCζ on the other hand contains two cleavage-sites, both within the hinge region. In
contrast to PKCε, the cleavage of PKCζ is mediated by several caspases, including
caspase-8, -3, -6, and-7 (L. Smith, 2000). The product of the cleavage, an active kinase
fragment, is linked to the apoptosis pathway and as with PKCε, is linked to an antiapoptotic function (Berra et al., 1997; Frutos, Moscat, & Diaz-Meco, 1999). In nitric oxideinduced apoptosis the catalytic activity of the separated kinase domain is inhibited before
the cleavage of the protein occurs. It has been shown that nitric oxide induces interaction
of aPKCζ with the p38 kinase. This interaction leads to an inhibition of autophosphorylation
at T560 and inactivation of the kinase domain (J.-S. Kim, Park, Yoo, Yu, & Chun, 2005).
This was discovered because earlier inhibition of caspase-3 in articular chondrocytes did
not rescue the inhibition of aPKCζ, although cleavage of the protein was significantly
reduced (S.-J. Kim et al., 2002). Interestingly, treatment of chondrocytes with nitric oxide
caused an enrichment of certain phospo-peptides identified through MS/MS analysis. The
MS/MS spectra showed two phospho peptides which are located in the Hinge region of
17
17
aPKCζ, indicating that phosphorylation of serine residues in the aPKCζ Hinge region might
play a role in p38 mediated inhibition of aPKCζ (J.-S. Kim et al., 2005). However, the
cleavage of PKCs does not always result in fragment with anti-apoptotic properties. It has
been shown, that the cleavage of PKCδ and PKCθ induces or promotes apoptosis in the
corresponding tissue (R. Datta, 1997; Kato et al., 2009). In summary, an high number of
publications described unique properties of the hinge region and given its location in the
center of the protein and the vast heterogeneity of the sequence it is likely that more
functions will be identified in the future. One theory is that PKCs with a cleavage site
become most vulnerable not having co-activators. The inactive conformation could leave
the Hinge region exposed and therefor more accessible to caspase-mediated cleavage. To
completely understand the role of the Hinge region in PKC more studies are necessary
and most definitely require the full solution structure of the full-length proteins.
The kinase domain
The C-terminal catalytic domain of PKCs consists of approx. 350 amino acid residues and
is highly conserved in all three subfamilies of PKC. The overall structure of this domain
shows high homology with members of the PKA, PKB/AKT families and PDK1. The tertiary
structure of the domain consists of a small N-terminal lobe, a large C-terminal lobe and a
hinge linker region. Considering the relative position of the lobes, the conformation of the
catalytic domain can be classified as either ‘open’ or ‘closed’. Recruitment of ATP happens
during the ‘open’ conformation, while transferring the y-phosphate onto its substrate
happens in ‘closed’ conformation (Johnson, Akamine, Radzio-Andzelm, Madhusudan, &
Taylor, 2001). The switch between those two states is tightly regulated and involves
phosphorylation of a specific motif of the catalytic domain. The catalytic domain has
several conserved motifs, present in all members of the AGC kinase family: 1. The ATPbinding site is located at the interface of both lobes. ATP is usually bound by its
nontransferable phosphate by a motif that contains 3 glycine residues and acts as a kind
of clamp. This motif is highly conserved among 95% of all kinases (Hanks & Hunter, 1995).
However, in aPKCs the phosphate-binding site differs from that of other family members.
The N-terminal lobe of cPKCs and nPKCs contains the ATP binding loop with the
conserved consensus sequence GXGXXG, whereas in aPKC the last glycine residue is
substituted by an alanine. Thus, it adapts an open conformation and implies a different
binding mechanism compared to other PKCs. 2. The activation loop (AL) stretches from
residue 387 to 414. It is usually in a phosphorylated state and interacts with two residues,
18
18
Lys392 and Arg368. This interaction is necessary for catalytic activity. 3. The hydrophobic
motif (HM) of the C-terminus is conserved and interacts with the hydrophobic groove of the
N-lobe.
The C-terminal tail of the catalytic domain is less conserved among the AGC kinases and
therefore shows a high sequence variation. However, in PKCi the C-terminal tail, also
called V5 domain, contains a clearly defined phosphorylation site (Thr555) of the turn motif
(Messerschmidt et al., 2005). Both, the activation loop and the V5 region play a crucial role
in the structure of the catalytic pocket and are common targets for phosphorylation.
Phosphorylation is thought to be crucial for activation of PKC, even though this theory has
been partly challenged by recent publications (Graybill, Wee, Atwood, & Prehoda, 2012).
However, to achieve full kinase activity all three phosphorylation sites need to be modified.
This maturation of the protein happens per se post-translational in cells and is mediated by
other kinases such as PDK1 (Le Good, 1998), Src (Rybin, Guo, Gertsberg, Elouardighi, &
Steinberg, 2007) and mTORC2 (Ikenoue, Inoki, Yang, Zhou, & Guan, 2008).
Many of the phosphorylation events activate the kinase and are also important for
interactions with other proteins. PKCδ, PKCɩ/ƛ and PKCζ contain a Nuclear Export
Sequence (NES; L-x1/2-L-x2-F-x-L/I) in the beginning of the catalytic domain. This motif has
been shown to interact with CRM1/exportin1 to facilitate nuclear export of PKCɩ (Perander,
2000). Interestingly, the corresponding NLS in PKCɩ requires phosphorylation by Src at
T256 in PC12 cells to become exposed and is relevant for the localization of the protein
(White, Seibenhener, & Wooten, 2002). Another well-established binding partner, Par3,
binds through a 28 amino acid motif to the catalytic domain of aPKC, called the aPKC
binding motif. Two serine residues within the motif act as substrates and phosphorylation
of these residues leads to disassociation of the complex (Wang, Shang, Yu, & Zhang,
2012). Kibra (kidney and brain protein), a WW domain containing protein and human
ribunucleoprotein 1 (hnRNP A1) exclusively interact with activated aPKCs or with
truncated proteins containing only the catalytic domain. This indicates that the tertiary
structure of the protein strongly regulates the interactions of the catalytic domain.
Noteworthy: The sequence connecting the two lobes contains a so-called “gatekeeper”
residue that controls ATP binding and access to the binding pocket. This gatekeeper
residue is usually a large hydrophobic residue and is often mutated to create a kinase that
is able to facilitate unnatural ATP analogs (Allen et al., 2007). This mutation is a highly
specific tool for identification of substrates in vivo. Conveniently, the mutated kinase is able
19
19
to facilitate normal ATP besides the unnatural analog. If applied to aPKCs this would be an
excellent tool to identify common and specific substrates of both aPKCs in comparison.
20
20
Activation of PKC
Traditionally PKCs were seen as generic enzymes that are anchored to the membrane
during their activated state and that achieve target specificity by close localization to their
substrates. However, the notion that PKCs become activated mainly through translocation
events has recently been challenged. It appears that the phosphorylation status of the
serine/threonine residues of the enzymes affect stability, function, activity and proteinprotein interactions. Cleavage of PKC releases a free kinase domain that either can act as
an inhibitory molecule or as an activator of the full-length protein. PKC can also be
activated by more traditional lipid cofactors, such as ceramide or arachidonic acid enabling
PKC to signal throughout the cell, not limited to DAG containing membranes. These
alternative regulation mechanisms were only recently published and additional studies are
necessary to fully understand these mechanisms.
As a rule of thumb inactive PKC is localized in the cytoplasma. Upon activation, PKC
translocates to the membrane, where it phosphorylates target proteins. In order to activate
PKC a series of phosphorylation events are necessary, which lead to a conformational
change and allow the protein to interact with the cell membrane. Further release of the
pseudosubstrate results in a fully activated protein. Studies involving mutational analysis of
predicted phosphorylation sites and mass spectrometry revealed three key
phosphorylation sites for the activity of the protein within the C-terminus of PKC. These
sites are known as the activation loop (AL), the turn-motif (TM) and the hydrophobic-motif
(HM). Interestingly, while all three sites are conserved in the cPKC and nPKC, the atypical
PKC lack the hydrophobic motif and harbor a negatively charged glutamic acid (Freeley,
Kelleher, & Long, 2011). Whether this site mimics a constitutively phosphorylated state or
not, remains unknown.
21
21
A-loop phosphorylation
For most of the PKC isoforms, a phosphorylated A-loop is crucial for catalysis, since
mutation of the residue to a non-phophorylatable residue abolishes activity. Furthermore,
in some PKC the A-loop seems to contribute to the stabilization of the active conformation
by forming ionic contacts with positively charged residues of the kinase domain (Grodsky
et al., 2006; Messerschmidt et al., 2005). Some PKC possess a cleavage site in the
HINGE region of the protein. When cleaved, an isolated but functional catalytic domain is
released. As known so far, only PKCδ, PKCθ, PKCε, and PKCζ undergo caspasedependent cleavage in response to a range of apoptogenic stimuli. In this context the Aloop is generally required for catalytic activity (L. Smith, 2002).
The main role in A-loop phosphorylation is played by the enzyme PhosphoinositideDependent Protein Kinase-1 (PDK-1). PDK-1 has been known to phosphorylates the Aloop of many protein kinase families besides PKC, such as PKB/Akt. PDK-1 has been
shown to phosphorylate cPKC, nPKC and aPKCs in vitro and in cell lines when
overexpressed (Le Good, 1998). Cells that lack PDK-1 have significantly reduced levels of
PKC ɑ, ΒII, ɣ and ε (McManus, Balendran). In contrast, the PKC ζ isoform was reported to
be stable in PDK-1 negative ES cells (McManus, Balendran). Very little is known about the
interaction modi of PDK-1 and PKCs. Initially it was thought, that the PH domain of PDK-1
is a key player in mediating that interaction, however, it has been shown, that in cells
overexpressing a PH deficient PKD-1 mutant instead of the wild-type protein, A-loop
phosphorylation of PKCs appears to be normal, indicating another mechanism (McManus
et al., 2004; Waugh, Sinclair, Finlay, Bayascas, & Cantrell, 2009).
Besides the evidence that PDK-1 is the A-loop kinase of PKC in various cell types, there is
proof of PKD-1 independent A-loop phosphorylation. PKC δ A-loop phosphorylation was
detected in ES cells and thymocytes lacking PDK-1(Balendran et al., 2000; McManus et
22
22
al., 2004).
In cardiomyocytes, PKC δ triggers autophosphorylation on the A-loop after
being phosphorylated by Src kinases at the hinge domain (Rybin et al., 2007; Sumandea
et al., 2008). Together these studies imply a PKD-1 independent A-loop phosphorylation or
autophosphorylation of the protein. Other kinases than PDK-1 have been implicated to
play a role in A-loop phosphorylation of PKCs. Human biliverdin reductase (hBVR) may be
involved in A-loop phosphorylation of PKCβII (Maines, Miralem, Lerner-Marmarosh, Shen,
& Gibbs, 2007) and 5’-AMP-activated protein kinase (AMPK) has been shown to directly
phosphorylate the A-loop of PKCζ during hypoxia (Gusarova et al., 2009).
23
23
Phosphorylation of the turn-motif
The turn motif (TM) is highly conserved among all PKCs. The TM is located in the C4
domain on the so-called C-terminal tail of the enzyme. The role of the TM is diverse and
incompletely understood. Phosphorylation of the TM enables interaction between the motif
and residues in the enzyme to help stabilizing the enzyme (Grodsky et al., 2006; Hauge et
al., 2007; Messerschmidt et al., 2005). In the two PKCβI and βII isoforms this
phosphorylation is required for catalytic activity (Edwards, Faux, Scott, & Newton, 1999),
while for PKCɑ, θ and ɩ it is dispensable (Bornancin & Parker, 1997; Hauge et al., 2007;
Liu, Graham, Li, Fisher, & Shaw, 2002). In the case of PKCδ and ζ the results have been
conflicting. After all it seems that the conformational and structural differences of the PKCs
are in fact the cause for their different requirements for TM phosphorylation (Edwards et
al., 1999). Anyhow, the differences reported for PKC δ and ζ indicate a more complex
activation mechanism in which the phosphorylation requirement depends not only on
interactions but also on the expressing tissue and environment. In PKCα, mutation of the
TM site has no effect on its catalytic function, but the mutant was more sensitive to thermal
instability, oxidation, proteolysis and overall dephosphorylation (Bornancin & Parker,
1997). In addition, the TM site seems to play a role in other aspects of PKCs. For example,
the catalytic activity of PKCϴ is independent of the TM site. Since the TM mutant
demonstrates an enhanced ability to activate the NF𝜅B pathway in T lymphocytes (Liu et
al., 2002). Initially the TM site was described as autophosphorylation site, but recent data
demonstrated that the mammalian target of Rapamycin (mTOR) is involved in the
regulation TM phosphorylation. mTOR is a serine/threonine protein kinase and belongs to
the phosphatydil-inositol 3-kinase-related kinase protein family. The protein forms multiprotein complexes, mTORC1 and mTORC2, and is involved in the regulation of cell
growth, -proliferation, -motility and -survival. mTORC2 is in contrast to mTORC1
insensitive to rapid rapamycin treatment and has been implicated in TM phosphorylation of
the PKC isoforms α, βI, βII, ɣ and ε (Facchinetti et al., 2008; Ikenoue et al., 2008). The
effect of mTORC2 on these PKCs appears to be indirect and needs further
investigation.Hydrophobic-motif phosphorylation
The hydrophobic-motif (HM) is a conserved motif present in cPKC and nPKC, but is
absent in aPKCs. In the case of aPKCɩ, the negatively charged glutamic acid residue
positioned within the motif seems to perform similar functions (Messerschmidt et al.,
2005). It has been shown that similar to the TM phosphorylation, HM phosphorylation
24
24
regulates catalytic activity of the enzyme as well as stability and function. In PKCɑ,
phosphorylation of the HM protects the protein from phosphatasesand prevents its
inactivation. Studies on its influence on the catalytic activity seem however highly
dependent on the isoform. Mutation of the HM has no effect on PKCβII activity (Edwards &
Newton, 1997), but induces a 5-fold reduction of PKC ϴ activity (Liu et al., 2002), whereas
in PKC δ it increases activity (Karmacharya, Jang, Lee, Lee, & Soh, 2010). The present
studies highlight the varying roles of these phosphorylation sites on the functions of PKCs
and it is difficult to explain how one isoform is affected while another is not. Contradicting
results may be explained by the use of different cell-lines. Depending on the cellular
context the set of binding partners might vary and thereby change the behavior of the
proteins.
25
25
The atypical PKCs
Atypical protein kinase C isoforms PKCiota and aPKCζ define a subclass of the PKC
family and are functionally and structurally distinct from other PKCs. In contrast to other
PKCs the catalytic activity of atypical PKC is not dependent on calcium or
phosphatidylserine. This is due to a unique composition of the N-terminal regulatory
domain that lacks the corresponding binding motifs. Instead, aPKC activity can be
regulated by 3-phosphoinositides, phosphorylation by PDK1 and through protein-protein
interactions with Par-6 (Graybill et al., 2012). As a result of a screening to identify PKC
isoforms in the rat brain aPKCζ was the first isoform to be identified, cloned and analyzed
(Ono et al., 1989). Due to the insensitivity of the protein to Ca2+ and phorbol esters it
became the first member of the atypical PKC family. The mouse ortholog of aPKCζ shows
a 99% amino acid homology and is located on chromosome 4 (Goodnight, Kazanietz,
Blumberg, Mushinski, & Mischak, 1992).The second member of atypical PKCs was
identified during an attempt to identify the aPKCζ isoform in a mouse P19 embryonal
carcinoma cell line (Akimoto et al., 1994). The murine protein was named PKClambda,
based on its 72% sequence homology to aPKCζ. Around the same time a group around
Lisa Selbie isolated another atypical PKC from human insulin secreting cells. It later turned
out to be the human homolog of PKClambda, leading to the consensus PKCiota/lambda
(aPKCɩ/ƛ). Both genes consist of 18 exons and the corresponding proteins have a size of
approx. 67 kDA, although the protein size on a SDS gel can vary between 72 and 80 kDA.
Expression analysis of both isoforms showed a much broader, almost universal expression
of PKCiota (Selbie, Schmitz-Peiffer, Sheng, & Biden, 1993), while the expression of aPKCζ
is restricted to a few organs including lung, kidney, testicles and the intestine (Goodnight et
al., 1992). Initial studies failed to assign cellular functions to aPKCs, however, over the last
20 years researchers were able to link these proteins to various cellular processes
including the regulation of cell proliferation (Berra et al., 1993), DNA synthesis (Akimoto et
al., 1998; Berra et al., 1995), induction of apoptosis and NFκB signaling (Sanz, 1999;
2000), cartilage destruction (Litherland et al., 2010) and cell differentiation (Kampfer,
2001). The high homology of the proteins in combination with the fact that most
commercially available biochemical tools could not reliably distinguish the two isoforms
produced a number of ambiguous studies. More recently, however, tools and methods
have significantly improved and both isoforms have now been assigned to distinct, nonoverlapping roles.
26
26
The role of aPKC in polarization and maintenance of cellular polarity
All multicellular organisms, including simple metazoans and highly complex mammals
share acommon feature: Polarity. Macroscopic (from the outside), polarity often presents
itself as a front and back or head and tail. However, on a cellular level it describes the
asymmetric distribution of intracellular components and functional asymmetry within the
cell. The establishment and maintenance of ‘cell polarity’ is an essential feature of all
eukaryotes. It appears that the same complexes are conserved in at least C. elagans, D.
melanogaster and mammals. As expected such an important feature is tightly regulated
and involves many signaling pathways and molecules. The aPKCs are crucial components
at the crossroad of polarization and their kinase activity is highly regulated through
interaction partners. This kinase activity is required for polarization, as overexpression of
kinase-dead aPKC mutants blocks the formation of important cell junctions and leads to
mislocalization of polarity proteins (Suzuki et al., 2001). The aPKC themselves interact
only with few polarity proteins, such as Par-6, Par-3 and LGLs. In the following paragraph
we will discuss the mechanisms behind polarization of epithelial cells, the key components
of this process and how aPKC is involved in polarization, regulation and maintenance of
cellular polarity.
By default cells are isotropic, meaning that the cell content is equally distributed within the
cell. In this state, cells can be referred to as ‘unpolar’. Certain stimuli, external and internal,
are able to stimulate the cell to redistribute the cellular contents, thereby become ‘polar’.
For example, during cell division the cytoskeleton reorganizes and the DNA aligns
perfectly in the center, thereby the cell forms two equal daughter cells in a so called
symmetric cell division. However, in multi-cellular organisms the challenge is not only to
keep the cell-division symmetric, but also in plane with the surrounding tissue. Even the
simplest multi-cellular organisms such as Spirogyra must tightly regulate the orientation of
cell division to survive. Spirogyra is an algae growing as a single string of aligned cells with
one basal cell responsible for attachment of the organism. Already in this context (1D)
impaired orientation of cell division would affect growth and have severe consequences for
Spyrogyra. In culture, adherent cells grow in a monolayer (2D) with cells next to each
other. When the cells reach confluency they stop to proliferate and establish tight
connections with each other. This process is called contact inhibition. Cancer cells often
lack this control mechanism and therefore uncontrolled proliferation is one of the six
hallmarks of cancer (Hanahan & Weinberg, 2011). In a monolayer, cells are no longer
isotropic. At that stage the cell can be divided into three distinct functional domains. The
27
27
apical domain, which is the surface of the cell and in contact with the extracellular space
and responsible for receiving signals and nutritions from ‘outside’. The basal domain,
which is in contact with the surface and responsible for attachment and cell movement
and, third, the lateral domain, which is in contact with neighboring cells, maintains the cellcell communication and is important for the integrity of the cytoskeleton and the
monolayer. However, depending on the cell line, the monolayer can be so compact that it
is impermeable for molecules and thereby it may function as a barrier between ‘outside’
and ‘inside’. To achieve this level of interaction between cells they are connected by socalled cell-junctions. There are four major types of cell-junctions. Tight Junctions (TJs)
form the closest contact between cells and are localized in the apical region around the
cell's circumference. Desmosomes (DS) serve localized adhesive function and connect the
plasma membrane to intermediate filaments in the cytoplasm. Adherens junctions (AJs)
play an important role in intracellular adhesion and the interaction of the actomyosin
cytoskeleton with the plasma membrane, and Gap junctions (GJs) that consist of
intercellular channels in the plasma membrane of adjacent cells. Small molecules can
diffuse across the channel and into the cytoplasm of the other cell. Their contribution to the
tightness of the cell-cell contact is minimal. All four types of junctions are localized in the
lateral surface of the cell and together they are grouped into the term apical junctional
complexes (AJCs). Since TJ are the most important AJCs to establish polarity, the
following paragraphs focus on TJs
Tight junctions are the most apical components of the intercellular junctional complexes
and a major player in the regulation of the degree of tightness of the cell layer. These
multi-protein complexes mediate the strongest cell-cell contact to be found in nature and
are almost unique to epithelial and endothelial cells. By the tight attachment of cell to their
neighbors and the formation of a belt encircling the cell, this complex is preventing
molecules from diffusing from the apical domain into the sheet between to cells, the lateral
domain. This barrier function is a major mechanism in maintaining the apico-basal (AP)
polarity by restricting macromolecules to their distinct domains. Although the complete
mechanism of TJ formation remains unknown, three protein families have been identified
to be involved. The three main transmembrane protein families found in TJs are members
of the occludin, claudins and junctional adhesion molecules (JAMs) families.
Occludin was the first tight junction integral membrane protein to be discovered and was
originally isolated from chick liver (Furuse et al., 1993). Depending on the tissue the
expression levels of occludin vary dependent on the required “tightness” of the TJ. For
example, occludins are highly expressed in brain endothelium which forms a very tight
28
28
barrier, but are expressed at much lower levels in endothelial cells of non-neuronal tissue
that are characterized by much lower barrier properties (Hirase et al., 1997). Besides the
role in regulating the quality of the barrier function, occludin is either not required for
maintenance of the integrity of TJs or other proteins can compensate for the loss of
occludin, since its absence has no effect on the structure of TJs (Saitou et al., 1998).
Moreover, occludin interacts with a number of regulatory proteins at tight junction,
including aPKCζ, c-Yes, PI3K (Nusrat et al., 2000) and ZO-1 (Furuse et al., 1994). The ZO
family members (ZO-1, -2 and -3) interact with a wide variety of cellular proteins through
multiple interaction domains and play a central role in organizing TJs. Besides many other
interaction partners ZO-1 binds in vitro to F-actin and thus might serve as a linker for
occludin to the cytoskeleton (Fanning, Jameson, Jesaitis, & Anderson, 1998) and to JAM
(Ebnet, 2000). JAMs, another family of important structural proteins, are single pass
transmembrane proteins found in epithelial and endothelial tight junctions. Overexpression
of JAM reduces paracellular permeability in CHO (Chinese hamster ovary) cells in a
calcium-dependent manner (Aurrand-Lions, Duncan, Ballestrem, & Imhof, 2001), showing
that that it is an important component of tight junctions. JAM physically interacts with
several tight junction proteins besides ZO-1, such as AF-6 and ASIP (Par3) (Ebnet,
Schulz, Meyer Zu Brickwedde, Pendl, & Vestweber, 2000; Ebnet et al., 2001). The third
large family of transmembrane proteins are claudins. Claudins have been shown to be
important for TJ formation andwere discovered in occludin expressing chicken livers
(Furuse, Fujita, Hiiragi, Fujimoto, & Tsukita, 1998), and later studies showed that claudins
are expressed in many other tissues. Moreover, expression of claudin family members is
specific for certain tissues. The properties of the barrier function mediated by TJs
correlates with the claudin composition (Furuse, Sasaki, & Tsukita, 1999). Not surprisingly,
claudins interact with ZO-1 through a conserved binding motif in the C-terminus of the
protein (Itoh et al., 1999). In summary, all TJs are composed of members of one of the
main transmembrane protein families, providing the basis for polarity by actively regulating
the distribution of macromolecules along the cell membrane.
In contrast to the AJCs, which is embedded into the apical and sub-apical membrane, the
trimeric polarity complex is located in the cytosol and thereby able to translocate to
different compartments in the cell. The three proteins that form the polarity complex,
aPKC, Par6 and Par-3 are considered as the core compounds of cellular polarity and have
been shown to regulate multiple cellular processes via protein-protein interaction and
modification of substrates. When par-6 was initially discovered in a screen for mutants with
partitioning-defective phenotype in C. elegans it was immediately linked to cellular
29
29
asymmetry and Par-3 (Watts et al., 1996). This early study showed that mutations in par-6
result in disruption of asymmetry in the early embryo causing disrupted spindle orientation
at the second cell division (Watts et al., 1996). Furthermore Par-6 plays a role in Par-3
localization. Under normal first cell division of the C. elegans embryo, Par-3 is localized to
the anterior periphery of the embryo. Mutations in Par-6 lead to mislocalization of Par-3 in
the embryo (Watts et al., 1996). Par-3 itself was identified as an important player in
establishing polarity through interaction with PKC-3, the homolog of the human aPKCs, in
C. elegans. The expression pattern of PKC-3 has just been published earlier in the same
year. (S. L. Wu, 1998). Knockdown of PKC-3 resulted in a Par-3 like phenotype, indicating
a functional relationship. Subsequent immunoprecipitation analysis confirmed the direct
interaction of both protein in C. elegans (Tabuse et al., 1998). Only two month later the
same group published data showing that the same interaction happens in mammalian
cells (Izumi et al., 1998). It didn’t take long until a direct link between PKC-3, Par-6 and
Par-3 was discovered, leading to the establishment of the trimeric polarity complex (Hung
& Kemphues, 1999) also in human and mouse (Etienne-Manneville & Hall, 2003; Joberty,
Petersen, Gao, & Macara, 2000). Today, the polarity complex is established as a crucial
polarity component and the mechanism by which the three proteins interact are well
understood. The Par-6 and aPKCs proteins interact with each other through their PB1
domains present in the N-terminal regions of the proteins (Hirano, 2004a). The Par-6/Par-3
interaction is mediated through PDZ domains present in both proteins (Hung & Kemphues,
1999). While Par-6 contains only one PDZ domain Par-3 has three (PDZ1-3). Finally,
Par-3 is interacting with the catalytic domain of aPKC through an ‘aPKC binding motif’. The
mechanism behind complex formation and how the different proteins modify each other
and possible substrates is not completely understood and still a focus for many
researchers. There is however little doubt about the function of the complex. Work from
several laboratories have demonstrated a role of the polarity complex in establishing AP
polarity and in regulating asymmetric cell division in C. elegans (Pellettieri & Seydoux,
2002) as well as mammals (D. Lin et al., 2000). The present data suggest that the inactive
Par-6/aPKC complex is stable and constitutively formed under normal conditions, while
Par-3 is transiently interacting with the complex. In this complex the Par-6 protein is
considered to be the regulator of aPKC activity, since studies have shown that
overexpression of a truncated Par-6 protein, N-terminus alone, is able to increase aPKC
kinase activity (Joberty et al., 2000), but overexpression of the full-length Par-6 failed to do
so (Yamanaka et al., 2001). The current model puts the repression of aPKC by Par-6 in
30
30
the center, with transient interaction partner that regulates localization and target
specificity.
The first evidence for a role of aPKC in TJ formation was published in 2001 by Suzuki and
coworkers. The introduction of a dominant negative mutant of aPKC into MDCK II cells
blocks the completion of the two-step TJ formation and impairs cell surface polarity,
causing inter-domain diffusion of a marker molecule (Suzuki et al., 2001). One year later
the same group showed that aPKC is recruited to the spot-like AJ complex where it colocalizes with other ZO-1, Jam, occludin and claudin to promote the formation of TJs
(Suzuki et al., 2002). In C. elegans the recruitment of the Par-6/aPKC complex is mediated
by Par-3. In the one-cell embryo, Par-3 translocates to the cell periphery in the absence of
PKC-3 (aPKC) or Par-6, while both absolutely require Par-3 (Hung & Kemphues, 1999;
Tabuse et al., 1998; Watts et al., 1996). Similar observations have been made in MDCK
cells where Par-3 is transiently localized at the spot-like AJ before the Par-6/aPKC
complex translocates (Suzuki et al., 2002).This theory is supported by the most recent
study showing that JAM, a Par-3 interaction partner, is phosphorylated at Ser285 in vitro
and in epithelial cells (Iden et al., 2012). Non-phosphorylated JAM localizes to pAJ and
most likely recruits Par-3. Once the trimeric polarity complex has formed at the pAJ Par6
becomes activated by through binding of Rho family small GTPases (Joberty et al., 2000;
D. Lin et al., 2000), aPKC is activated and phosphorylates JAM. JAM phosphorylation
subsequently promotes the maturation of pAJ into TJ by recruiting other proteins such as
ZO-1 to the site (Iden et al., 2012). In addition, there are numerous other proteins that
might be involved in recruitment, interaction and/or regulation of aPKCs or that might be
targets of phosphorylation. Two members of the FERM (protein4.1, ezrin, radixin, moesin)domain family of proteins, Willin and ezrin have been directly linked to aPKC. Willin,
together with Par-3, plays a role in the recruitment of aPKC and in the phosphorylation of
the Rho-associated protein kinase (ROCK) by aPKC in epithelial apical morphogenesis
(Ishiuchi & Takeichi, 2011). Ezrin seems to be a target of aPKCs and its phosphorylation
leads to activation and localization to tight junction in mammalian cells (Wald et al., 2008).
In summary, the Par-3/Par-6/aPKC complex is located at the apical domain of polarized
cells through Par-3 mediated translocation, where it is involved in maturation of TJs by
interacting with network of membrane bound proteins and thereby orchestrates the
formation of the AJCs. The regulation of the polarity complex is not fully understood, but it
seems that the catalytic activity of aPKC is essential for TJ maturation and is regulated by
Par-6 binding.
31
31
As mentioned earlier, the interaction between the Par-6/aPKC complex and Par-3 is
transient and other interaction partners have been identified. Several studies suggest that
Lethal giant larvea (LGL) competes with Par-3 for Par-6/aPKC interaction and that the
Par-6/aPKC/Lgl complex plays a role in earlier processes of polarity formation. LGL has
first been identified as an interaction partner of Par-6/aPKC in Drosophila using
immunoprecipitation experiments, which becomes phosphorylated by aPKC (Betschinger,
Mechtler, & Knoblich, 2003). The same complex was identified in mammalian cells
showing mammalian Lgl (mLgl) phosphorylation in fibroblasts after applying scratch
wounds (Plant et al., 2003). Finally, mLgl1 and mLgl2 were identified to compete with
Par-3 at an early stage of MDCK polarization during calcium switch and is segregated from
the complex to the baso-lateral domain after phosphorylation by aPKC (YAMANAKA et al.,
2003). This observation is supported by the fact that overexpression of aPKCkn induces
abnormal co-distribution of Par-6 and Lgl (YAMANAKA et al., 2003). Additional studies
confirmed this model and postulated that mLgl functions as a mediator of cell adhesion
stimuli to create a corresponding apical membrane domain and lumen during epithelial
tissue morphogenesis by inhibiting the Par-3Par-6/aPKC-complex formation and Cdc42
binding to Par-6 (YAMANAKA et al., 2006).
Maintenance of cellular polarization through active exclusion
The mechanism described above occurs in a tightly regulated spacial context which is
mostly regulated by aPKC localization and activity. As part of the polarity complex, aPKC is
involved in maintaining cellular polarity through active exclusion of important protein from
distinct domains. The polarity complex is often localized in a complementary pattern to that
of Par-1. This pattern seems to be facilitated through mutual phosphorylation of the two
kinases, aPKC and Par-1. By phosphorylation they exclude each other from the
complementary region of the cell. Par-1 phosphorylates directly Baz/Par-3 at several
residues including S1085 (Benton & St Johnston, 2003). Phosphorylation of the S1085
residue creates at Par-5 (which is a 14-3-3 protein) binding site and this binding effectively
inhibits interaction with aPKC (Benton & St Johnston, 2003). The 14-3-3 binding to the
Par-3 protein can be reversed by protein phosphatase 1ɑ (PP1ɑ) (Traweger et al., 2008),
allowing the relocalization of Par-3 to the anterior cortex and reformation of the polarity
complex. Conversely, Par-1 phosphorylation by aPKC inhibits both, the localization of the
kinase at the membrane domain and the activity of the Par-1 kinase domain. Apparently,
Par-1 gets phosphorylated at two residues and both of them have the same
consequences. Direct phosphorylation through aPKC at T595 (Hurov, Watkins, & Piwnica32
32
Worms, 2004) and aPKC dependent PKD mediated phosphorylation at S400 (Watkins et
al., 2008). Furthermore, aPKCs are involved in the cellular distribution of many more cell
fate determinants such as Numb (C. A. Smith et al., 2007), Miranda (Atwood & Prehoda,
2009) and the polarity protein LgL (Betschinger et al., 2003). In all cases phosphorylation
by aPKC removes the target protein from the corresponding cellular cortex.
33
33
Atypical PKCs in embryology
During development of the pre-implantation embryo two major mechanisms are involved in
generating cell diversity: asymmetric cell division, leading to the formation of two daughter
cells with different protein composition, and cellular interaction, leading to cells to adopt a
distinct fate based on the environment. Thus, two distinguishable cell-lines first appear at
the 16-cell stage, recognizable by position and phenotype (polarized and unpolar). The
outer cells (polarized, trophoectoderm) are epithelial cells surrounding a cavity and a
group of undifferentiated (unpolar) cells, the inner cell mass (ICM). This so-called ‘insideoutside’-model is based on the theory that the position of the cell determines the fate
(Tarkowski & Wróblewska, 1967). The apico-basal (AP) axis is first formed at the
compacted 8-cell stage (also E2.5). Each cell (blastomer) polarizes its cytoplasm along the
AP-axis, which enables the cells to undergo asymmetric cell division leading to the two
cell-lines at the 16-cell stage (also E3.0). These morphological events (asymmetrical
contacts and polarity) are essential processes that contribute to the generation of
trophectoderm (TE) and inner cell mass (ICM) through asymmetric divisions. The
formation of these two cell types is a crucial process for the development of the mouse
embryo since the ICM will mainly contribute to the formation of the embryo while the TE
will participate to extra-embryonic structures.
Early studies investigating the establishment of polarity showed that in C. elegans
embryos the anterior-posterior-axis occurs as early as during the first cell cycle and is
dependent on the functions of Par proteins (Kemphues, Priess, Morton, & Cheng, 1988)
and PKC-3 (Tabuse et al., 1998), the ortholog of mammalian aPKCs. Without normal
function of these proteins the asymmetric distribution of proteins is altered and especially
PKC-3 is required for viability in C. elegans (S. L. Wu, 1998). The fact that PKC-3 does not
localize to the periphery without PAR-3 (Tabuse et al., 1998) suggested that PAR-3 recruits
PKC-3. Interestingly, in C. elegans fertilization induces polarized localization of PKC-3,
Par-3 and Par-6 to the apical pole (Hung & Kemphues, 1999; Tabuse et al., 1998) with
Par-1 localized to the basal pole (Boyd, Guo, Levitan, Stinchcomb, & Kemphues, 1996; S.
Guo & Kemphues, 1995). The characterization of Par-3 and Par-6 proteins present in the
early mouse embryo revealed that the proteins are expressed from the 2-cell stage
onwards. Interestingly, asymmetric distribution of Par proteins occurs at the 8-cell
compaction stage with mPar1 localized at the basal domain (Vinot et al., 2005). However,
aPKCζ protein expression levels are very low until the 8-cell stage but increases at 16-cell
34
34
stage and onwards (Vinot et al., 2005). In contrast to the relatively late onset of aPKCζ
expression, aPKCɩ is already detectable at the 4-cell stage with increasing expression
onwards (Dard, Le, Maro, & Louvet-Vallée, 2009; Eckert & Fleming, 2008). These
differences in expression made aPKCɩ a more likely player in polarity formation, since
aPKCζ is either absent or expressed at very low amounts. Expression analysis of both
aPKC isoforms at later stages of mouse embryogenesis using in situ hybridization (ISH)
showed ubiquitous expression of both isoform at E7.5 (Kovac, Oster, & Leitges, 2007).
Further analysis showed consistently lower expression of aPKCζ compared to aPKCɩ in
all tested stages (E7.5 - E14.5) and highly specific expression patterns, especially for
aPKCζ at later time-points (Kovac et al., 2007). In summary, very little is known about
isoform specific functions of the proteins in pre-implantation embryo and during
embryogenesis. As mentioned before experimental approaches to adequately investigate
this question were limited due to the lack of specific biochemical tools. The first data about
isoform specificity came from gene targeting approaches against aPKCζ. Leitges et al.
showed that the disruption of aPKCζ protein expression has no effect on embryonic
development but causes an impairment of the NFkB pathway in adult animals (Leitges et
al., 2001). This study also shows that aPKCζ associates with, and directly phosphorylates
p65 and that aPKCζ is required for the cytokine-induced p65 phosphorylation in mouse
embryonic fibroblasts (MEFs). Since aPKCɩ is present in the same tissues this data
exclude possible redundancy between the two aPKCs and, for the first time assigns a
specific in vivo function to the aPKCζ protein. In contrast, disruption of aPKCɩ expression
causes a severe phenotype. The aPKCɩΔ/Δ embryos display structural abnormalities as
early as E6.5 and by E9.5 the embryos are shrunken with no recognizable structures
(Soloff, Katayama, Lin, Feramisco, & Hedrick, 2004). Further analysis of the phenotype
were performed in aPKCɩΔ/Δ cell.line and showed an alteration in actin stress fibers in
MEFs but no impairment of the NFkB pathway (Soloff et al., 2004), supporting the specific
aPKCζ function. However, the gene targeting studies were based on knockdown studies in
very early stages of mouse embryogenesis that repeatedly failed to assign specific
functions to an aPKC isoform. This was likely due to the lack of adequate biochemical
tools and not due to a lack of scientific effort. Despite these problems the scientific field
continued to investigate the role of aPKCs in early embryogenesis. In the following years
aPKCs were linked to important functions in polarity formation in the preimplantation
embryo. As mentioned above, between the 16-cell and 32-cell (blastocyst) stage, the outer
cells progressively differentiate into epithelial cells. During this phase cell junctions start to
mature, characterized by a step-by-step accumulation of tight junction proteins at the
35
35
border of the apical and the basolateral domains. During 8-cell stage compaction adhesive
E-cadherin recruits ZO-1, rab13 and the Par-3/6/apKC-complex to the site of TJ formation.
From the 8-cell stage to the blastocyst stage recruitment of JAM, Cdc42, cingulin and
ZO-2 results in a functional TJ and a basolateral Zonula adherens (ZA) as reviewed in
Eckert and Fleming (Eckert & Fleming, 2008). It also has been shown that both proteins
show lineage-distinct staining patterns in blastocysts. While PKCiota is distributed to the
TE membrane and cytoplasm, aPKCζ is predominantly localized at the apical membrane
of TE, showing a similar staining than the ZO-1 protein (Eckert et al., 2004). While it is
clear from these data that both proteins have distinct localization patterns, the role of the
individual aPKC isoforms remains unclear. Despite the indications that aPKCζ might play
the more important role in TJ formation, it is aPKCɩ that has been linked to this process in
early mouse development and not aPKCζ. Mutant embryos either expressing a kinase
dead dominant mutant or siRNA against endogenous aPKCɩ displayed mislocated ZO-1
and cingulin, indicating a defect in TJ formation, while the setting up of polarity along the
radial axis at 8-cell stage by E-cadherin showed no impairment (Dard et al., 2009).
The role of aPKC in very early embryogenesis
One of the biggest challenges in developmental biology is to understand how asymmetries
are elaborated along the main body axis. Remarkably, the origin of this process can in
many organisms be traced back to the one-cell stage. The one-cell stage or the egg
contains cell axis determinants that localize to opposite ends of the cell, thereby controlling
the symmetry or asymmetry of the cell. Genetic screens in Drososphila and C-.elegans
have identified several regulators of egg polarity. Soon after the discovery of a group of
genes crucial for polarization of cells (par-genes) in C. elegans these genes were
investigated in Drosophila. It turned out that these mechanisms were conserved with one
exception: In C. elegans Par-3 and par-6 localize together with aPKC at the anterior
domain, while par-1 and par-2 occupy the posterior domain. The remaining par-4 and
par-5 are equally distributed throughout the cytosol. In Drosophila, the par-2 protein is
missing, while otherwise the machinery seems to be fully conserved. Par6 was first
identified for its role in polarizing the C. elegans zygote (Watts et al., 1996). PAR-6 and
PKC-3 become restricted to an anterior cortical domain of the zygote and regulate the
localization of developmental determinants and proteins required for asymmetric cleavage
(Pellettieri & Seydoux, 2002). PKC3 was first described to play a role in cell organization
in C. elegans. Oocytes lacking PKC3 failed to hatch (S. L. Wu, 1998). Examination by
36
36
interference microscopy revealed that arrested embryos contained highly disorganized
cells. Thus, it appears that the atypical PKC3 of C. elegans is essential for the normal
progression of early to mid-embryogenesis and the viability of the intact organism.
In both organisms D. melanogaster and C. elegans only one atypical PKC is expressed
and several studies investigated the role of aPKC in both organisms over the last two
centuries: The first description of aPKC in D. melanogaster was published in 1989 as a
detailed description including gene description, sequence analysis and protein expression
(Schaeffer, Smith, Mardon, Quinn, & Zuker, 1989). Later studies showed Drosophila
atypical Protein Kinase C associates with Baz/Par-3 and controls polarity of epithelia and
neuroblasts (Wodarz, Ramrath, Grimm, & Knust, 2000). Surprisingly, Baz does not simply
function as a scaffold to anchor DaPKC in the apical cytocortex, but is itself dependent on
DaPKC for proper localization and stability. The dependency of Par-3 on aPKC for its
localization is unique to D. melanogaster and not completely understood. In C. elegans the
PKC3 protein was first described by Wu et al. (S. L. Wu, 1998). As part of a bigger study,
functional investigations showed that more than 90% (338 of 367) of embryos containing
antisense against PKC3 mRNA failed to hatch. More detailed examination by interference
microscopy revealed that arrested embryos contain 100–200 highly disorganized cells.
Thus, it appears that atypical PKC3 of C. elegans is essential for the normal progression of
early to mid-embryogenesis and the viability of the intact organism.
In contrast to C. elegans and D. melanogaster, mammalian cells contain two aPKC
isoforms, confronting the field with the problem of possible overlapping function and
specific role in embryogenesis. Several studies have investigated the PKC expression
pattern in the unfertilized mammalian egg (UFE), early stages of egg activation as well as
embryogenesis (Dard et al., 2009; Eckert et al., 2004; Eckert & Fleming, 2008; Halet,
2004; Kovac et al., 2007; Pauken, 2000; Pauken & Capco, 1999; Raz, Eliyahu, Yesodi, &
Shalgi, 1998; Vinot et al., 2005). When fertilization-competent cells were detergent
extracted, which means that all soluble unbound content is removed, aPKCζ remained
tightly associated with the meiotic spindle and seemed to be bound to spindle fibers
(Baluch, Koeneman, Hatch, McGaughey, & Capco, 2004). The model that aPKCζ stays
associated with the spindle apparatus during the complete cell division was confirmed by
fluorescence resonance energy transfer (FRET) using tubulin as an acceptor and aPKCζ
as a donor (Baluch et al., 2004). After completion of the first cell cycle aPKCζ localizes to
the cytoplasm and the nucleus of two daughter cells. Interestingly, aPKCζ expression
starts as early (or ‘as late as’ in the context of the previous data) as in the 2-cell stage and
increases in the 4- and 8-cell stage (Pauken, 2000). In contrast to the expression data,
37
37
aPKCζ protein is already detected in the UFE, which might be maternal protein and not
newly expressed protein. However, the localization in the 2- and 8-cell stage (before
compaction) is mainly cytoplasmic with nuclear localization, but exclusion from the
nucleoli, while the localization pattern slightly changes during the 4-cell stage. In the 4-cell
stage aPKCζ suddenly translocates from the cytoplasm to the cell membrane facing the
external milieu and relocates to the cytosol in uncompacted 8-cell embryos. During
compaction aPKCζ relocalizes to the membrane and shows no nuclear localization
(Pauken, 2000; Vinot et al., 2005).
Recent studies on aPKCɩ expression in the preimplantation mouse embryo revealed
detectable, increasing protein expression from the 4-cell stage upwards with higher
expression relative to aPKCζ (Dard et al., 2009; Kovac et al., 2007), with an important role
in allocation of cell lineages (Dard et al., 2009). To further investigate the role of aPKCɩ
during early embryogenesis fertilized eggs or embryos in the 2-cell stage were transfected
with siRNA against aPKCɩ. Depletion of aPKCɩ has no effect on the development of the
stage before 8-cell stage embryos and apico-basal polarity is correctly set up at
compaction. At the 16-cell stage embryo the absence of aPKCɩ shows an effect. In aPKCɩ
depleted embryos ZO-1 and cingulin were mislocalized, causing impaired junction
formation. Because of the impaired polarity the ratio between inside cells (forming ICM)
and outside cells (tropho-ectoderm) is changed. The absence of aPKCɩ causes an
increase in asymmetric cell division during the 8-16 cell stage resulting in decreased inner
cells (Dard et al., 2009). Considering these studies, both atypical PKCs are co-expressed
in the mouse embryo at least at the 4-cell stage and later. It has been shown that the
aPKCζ protein is present at very high levels in the unfertilized egg without detectable
mRNA present. Since the protein is likely from the mother, we cannot exclude the
presence of maternal aPKCɩ protein.
38
38
Present Investigations
Aims of the study
The atypical PKCs represent the third of the superfamily of serine/threonine kinases PKC.
Atypical PKCs have been shown to be involved in a number of important cellular
mechanisms such as proliferation, migration, differentiation and apoptosis. However, little
is known regarding isoform specificity in mammals and PKCɩ and PKCζ are often
considered to be functionally redundant. While biochemical studies have problems linking
certain functions to the specific isoforms, genetic targeting approaches clearly show
different phenotypes in aPKC knockout animals, indicating non-overlapping functions.
The main goal of this study is to investigate isoform specificity. Considering published data
and available unique tools in our lab we based the study on two approaches.
1. To identify possible isoform-specific functions we designed a number of aPKC GFPfusion proteins and expressed those in MDCK cells, an established model cell-line to
study polarity. It is known that kinase specificity is often achieved by (either) interaction
and/or localization. Based on that rationale we investigated the role of distinct domains
within aPKC in mediating localization in MDCK cells to conclude possible isoform
specificity. The proteins investigated include truncated proteins of both isoforms and
mutant versions that specifically target known interaction partners to verify their possible
role in aPKC regulation.
2. To further investigate possible redundancies between the two atypical PKC we
performed a detailed analysis of aPKCɩΔ/Δ mice regarding the role of aPKCɩ during
early stages of development and the possible reason for the observed lethal phenotype.
As part of that study we also investigate the possible role of aPKCζ in the context of
aPKCɩ deficiency.
39
39
Synopsis of the papers
Paper I: Functional Comparison of protein domains within aPKCs involved in
nucleocytoplasmic shuttling. The regulation of aPKC localization, translocation and
interaction was investigated based on functional components and differences in the amino
acid sequence. The comparative analysis of atypical PKCɩ/ƛ and PKCζ was performed in
MDCK cells, an established model system for proteins involved in either establishing or
maintaining cellular polarity. We expressed a series of GFP-fusion proteins including the
full-length proteins, truncated proteins and functional mutants to investigate the role of the
single domains in localization and nucleocytoplasmic shuttling. For the comparison of
nuclear translocation of both aPKCs we were using the nuclear export inhibitor Leptomycin
B showed. The analysis of the shuttling properties of both full-length proteins showed
different kinetics of the two isoforms. Overexpression of truncated proteins revealed
differences in subcellular localization between the two isoforms. Expression of the
regulatory domain of aPKCɩ resulted in a protein with predominant nuclear localization. In
contrast the regulatory domain of aPKCζ was almost exclusively located at the membrane
with little cytoplasmic signal. These results indicated a different regulation of localization
between the two aPKC members. A more detailed study of the regulatory domain identified
the Hinge region as a possible carrier of a yet unidentified motif that mediates specific
localization in MDCK cells. Analysis of the aPKCɩHINGE showed a dominant localization to
the nucleus of the cell. The corresponding aPKCζ construct showed a cytoplasmic staining
with an obvious absence of nuclear localization. Mutational analysis of the NLS of both
PKCs revealed that PKCɩ can translocate to the nucleus independent of its NLS whereas
PKCζ’s translocation is mainly regulated by its NLS. In the context of the full-length protein
the PB1 domain partly regulates the translocation of aPKCɩ, but not aPKCζ. Together
these data argue for a different regulation of aPKC isoforms regarding cellular localization
and translocation.
40
40
Paper II: Phenotypical analysis of atypical PKCs in vivo display a compensatory
system at embryonic stage 7.5 p.c. (under review in PlosOne) The atypical protein
kinases C (PKC) isoforms ι/λ and ζ play crucial roles in many cellular processes including
development, cell proliferation, differentiation and cell survival. Possible redundancy
between the two isoforms has always been an issue since most biochemical tools do not
differentiate between the two proteins. Thus, many efforts have been made during the last
decades to characterize the functions of aPKCs using gene targeting approaches and
depletion studies. However, little is known about the specific roles of each isoform during
mouse development. We show that deletion of PKCι/λ, results in a reduced size of the
amniotic cavity at E7.5 and impaired growth of the embryo at E8.5 with subsequent
absorption of the embryo. Our data also indicate an impaired localization of ZO-1 and a
disorganized structure of the epithelial tissue in the embryo. Importantly, using electron
microscopy, embryoid body formation and immunofluorescence analysis, we found, that in
the absence of PKCι/λ, tight junctions and apico-basal polarity were still established.
Finally, our study indicates a non-redundant PKCι/λ function at E9.5, since expression of
aPKCζ is able to rescue the E7.5 phenotype, but resulted in embryonic lethality at a later
time-point (E9.5). Our data show for the first time that PKCι/λ is crucial for mouse
embryogenesis but is dispensable for the establishment of polarity and tight junction
formation. We present a compensatory function of aPKCζ at E7.5, rescuing the phenotype.
Furthermore, this study indicates at least one specific, yet unknown, PKCι/λ function that
cannot be compensated by aPKCζ overexpression at E9.5.
41
41
Discussion
Atypical PKCs represent a subgroup of the PKC family that shows a remarkable homology
to each other. Irrespective of the distinguishable mode of activation compared to the rest
of the family, very little is known about possible differences between the two atypical
PKCs. Several studies using gene targeting or RNA knockdown approaches have
indicated the existence of isoform-specific functions. In recent years the view that specific
interaction partners restrict the individual isoforms to certain cellular domains to create a
specificity of action (Jaken & Parker, 2000). Several interaction partners have been
identified to act on aPKCs, including lipid second messengers (e.g. PI-3,4,5-trisphosphate
and ceramide) and members of the Par-family (Par3, -4 and -6). Some of the known
binding proteins seem to interact with both isoforms, whereas others are specific for one
isoform. For example, Zip/p62 has been shown to interact with both isoforms in PC12 cells
(Samuels, Seibenhener, Neidigh, & Wooten, 2001) and links aPKCs (in this case) to the
regulation of nerve growth factor (NGF)-induced differentiation and Par4 selectively
interacts with both aPKCs during apoptosis (Diaz-Meco et al., 1996a). In contrast, lambda
interacting protein (LIP) selectively interacts with the zinc finger of aPKCɩ and is a very
specific, potent activator of aPKCɩ but not aPKCζ. It has been suggested that LIP activated
aPKCɩ might play a role in the transactivation of a κB dependent promotors (Diaz-Meco,
Municio, Sanchez, Lozano, & Moscat, 1996b). Isoform specificity is an important issue and
a better understanding of the regulation of the specific isoforms is crucial for drug
development and targeted studies. Thus, the aim of this thesis was to identify functional
differences among aPKCs and to study the role of specific protein domains in mediating
isoform specific localization and/or interactions.
The HINGE domain and its role in sub-cellular localization of aPKCs.
As a starting point of our biochemical study (Paper I) we assumed that isoform specific
function is linked to a specific localization in the cell and that localization is mediated by
protein domains and their interaction partners. Moreover, we decided to focus on the
regulatory domain, since this region contains conserved domains as well as highly variable
regions. We hypothesized that conserved domains are either regulated differently in the
two isoforms and/or that localization is mediated by the variable regions through
interactions with different proteins. We thought that removing the kinase domain would
42
42
simulate an open conformation of the regulatory domain and thereby promote protein
interactions.
We were indeed able to show that the isolated hinge regions of the aPKC isoforms have
distinct cellular localization. Furthermore, we demonstrated that the hinge regions are
essential for the localization of the regulatory domain. Switching the hinge regions of the
aPKC isoforms changed the localization of the chimeric proteins and confirmed a dominant
effect of the hinge region on the localization of the regulatory domain and in the context of
the full-length proteins. Our data shows that the hinge region of aPKCiota is involved
mediating nuclear localization, while the aPKCzeta hinge region causes membrane and/or
cytoplasmic localization. So far the only characterized motif in the hinge region is a
caspase cleavage site that has previously been described in the hinge region of aPKCzeta
(Frutos et al., 1999). In HeLa cells, longer exposure to UV light was shown to inactivate
aPKCzeta that precedes it proteolytic degradation and produces a fragment of
approximately 50 kDa (Frutos et al., 1999). In our setup, however, none of the aPKCzeta
constructs showed significant increase in caspase cleavage of the GFP-fusion protein and
no accumulation of a 50 kDa fragment could be detected. To gain further understanding of
the mechanism that influences localization and to possibly identify new motifs that might
be relevant for the specific cellular localization we develop a strategy based on random
mutagenesis. The idea is to create a fusion protein library containing hinge domains
mutants of both isoforms. The number of mutant has to be sufficient to statistically hit all
amino-acids in the sequence with at least one mutation. We are aware of studies that have
shown that the GFP tag might be suboptimal for this kind of high throughput localization
studies (Seibel, Eljouni, Nalaskowski, & Hampe, 2007) and we think that the intrinsic
nuclear localization of the GFP protein might interfere with our read-out. We therefore
consider an approach using a smaller tag such as Myc or FLAG. To avoid that diffusion of
the protein interferes with our experimental setup we also consider a much larger LacZ
fusion protein. This approach is currently in process in our laboratory.
43
43
The nuclear shuttling of aPKCs is not exclusively regulated by the NLS
When we first observed the nuclear localization of the N-terminal construct without the
hinge region we assumed that this is due to the NLS motif present in the C1 domain of
both isoforms, functionally described by others (Perander, 2000; Pu et al., 2006). Since the
NLS has only been shown to be functional in the context of shorter fragments and not in
the full-length protein (Perander, 2000) we decided to investigate the role of the NLS in
more detail. Using MDCK cells, we were able to confirm earlier work performed in Cos7
and HeLa cells that showed increased shuttling of aPKCiota compared to aPKCzeta
(Perander, 2000). However, when we mutated the NLS in both isoforms, the aPKCɩ mutant
did not appear to be affected, whereas aPKCζ protein levels in the nucleus were
significantly decreased. Although reduced, the accumulation of aPKCζ in the nucleus of
MDCK cells was significant. Together our results strongly indicate the presence of
alternative translocation mechanisms in both aPKCs.
In contrast to our data, in studies using PC12 cells both aPKCs have been reported to
translocate into the nucleus after neural growth factor treatment (NGF) (Neri et al., 1999;
M. W. Wooten, Zhou, Wooten, & Seibenhener, 1997; G. Zhou, 1997). In fact Wooten et al.
convincingly showed phosphorylation of aPKCiota at Tyr256 by Src after NGF treatment.
Sequence alignment of aPKCɩ and aPKCζ shows that the Tyr256 residue is conserved in
both isoforms suggesting that it may play a role in the translocation of aPKCζ as well. It
seems that phosphorylation of Tyr256 causes a conformational change leading to the
exposure of the NLS and subsequent importin-β binding (White et al., 2002). It is likely that
importin-β binds directly to aPKCɩ, since arginine-rich NLS motifs do not need importin-ɑ
(Palmeri & Malim, 1999). This is supported by other in vitro studies that have shown that
human aPKCζ, which has the same NLS sequence then murine aPKCɩ, does not directly
bind to importin-ɑ (Maiyar, Leong, & Firestone, 2003). Similar results were observed by
Neri and colleagues, who showed a PI3K dependent translocation of aPKCζ into the
nucleus of PC12 cells upon NGF stimulation. Unfortunately, none of these studies
addressed whether these mechanisms are specific for aPKCɩ or aPKCζ as well. Neri et al.
suggested that the two phosphorylation products of PI3K, PtdIns(3,4)P2 and
PtdIns(3,4,5)P3, are involved in the nuclear localization of the protein. Both products have
been shown to activate aPKCζ in vitro (Nakanishi, Brewer, & Exton, 1993; Toker et al.,
1994). In their model aPKCζ shuttles between the cytosol and the nucleus and after NGF
44
44
stimulation PI3K translocates to the nucleus where nuclear PtdIns(3,4,5)P3 activates
aPKCζ. Activated aPKCζ then remains in the nucleus.
We used Leptomycin B (LMB) to show that both isoforms shuttle between the cytoplasm
and the nucleus. LMB has been described to specifically inhibit the export of protein with a
leucine rich NES by inactivating CRM1 (Stade, Ford, Guthrie, & Weis, 1997). CRM1
belongs to the superfamily of importin-β and together with four other family members
(CAS, exportin1, exportin and importin 13) it mediates nuclear export (Fornerod, Ohno,
Yoshida, & Mattaj, 1997). Of these five proteins CRM1 regulates the vast majority of
shuttling protein containing a leucine-rich NES, such as aPKCs, while the others are very
specific for unique export substrates. Even though the sequence alignment of the two NES
in aPKCs do not show a different amount of leucine residues we cannot exclude that the
decreased accumulation of aPKCζ is partly a result of using LMB as an inhibitor and that
other export proteins might be involved. Regarding the role of the NLS in aPKCiota we can
only speculate that other yet unidentified NLS motifs are present or that importin
independent mechanisms are involved in the nuclear translocation of this isoform.
Despite extensive studies on the sequence of both aPKCs very little is known about novel
NLS or other sequences related to nuclear import. However, importin independent
mechanisms do exist like for example:
1. β-catenin, which as a part of the Wnt/Wingless pathway, binds to the cytoplasmic tail of
cadherin adhesion molecules and has been shown to translocate to the nucleus through
importin-independent mechanisms. The protein binds directly to the nuclear pore
machinery and translocates into the nucleus in a possibly Ran-dependent manner
(Fagotto, Glück, & Gumbiner, 1998). The β-catenin armadillo-repeats are present in a
number of proteins including importin-β and present data suggest a role of this motif in
nuclear translocation (Fagotto et al., 1998). Interestingly, an interaction between βcatenin and aPKCs also has been shown in various tissues and is believed to be
mediated by the armadillo-repeat present in β-catenin and a yet unknown motif in
aPKCs (Luna-Ulloa et al., 2011; Seifert et al., n.d.). In addition to the direct interaction of
these proteins, aPKCζ kinase activity is important for the nuclear localization of βcatenin in cancer cell lines (Luna-Ulloa et al., 2011). Together these data show that βcatenin shuttles importin-independent and CRM1-dependent between the nucleus and
the cytosol. Not only the transcriptional activity of β-catenin is regulated by aPKCζ, it
also interacts directly with aPKCζ through its armadillo-repeat. We think that the link
between β-catenin nuclear localization and aPKCζ activity might also be relevant for
45
45
other pathways and that β-catenin is a potential regulator of aPKC localization in an
importin independent manner.
2. Alternatively, Pollard et al. described a 38 amino acid transport signal, termed M9, which
confers bidirectional transport across the nuclear envelope (Pollard et al., 1996). For its
nucleocytoplasmic shuttling, M9 serves as a NLS and nuclear export signal (NES) and
its transport receptor is transportin (Trn)/karyopherin β2 (Calado, Kutay, Kühn, Wahle, &
Carmo-Fonseca, 2000; Rebane, Aab, & Steitz, 2004). Attempts to define the sequence
for Trn interaction produced a consensus Trn interaction sequence (Bogerd et al., 1999).
This sequence is present in the kinase domain of both aPKCs and has the potential to
interact with TRN. Whether the interaction between Trn and aPKC happens in vivo or in
vitro and whether this plays a role in translocation needs to be further investigated.
In this study we also investigated an involvement of a “hitchhiking” o “Piggyback”mechanism (Fagotto et al., 1998; Fang et al., 2007; Luna-Ulloa, Hernandez-Maqueda,
Santoyo-Ramos, Castaneda-Patlan, & Robles-Flores, 2011; Pollard et al., 1996) as
possible importin independent mechanism through which aPKCs might translocate into the
nucleus. This principle is not completely new and the importin-β mediated translocation
follows the same mechanism. Interestingly, importin-β competes with β-catenin for binding
the nuclear envelope, suggesting a novel function for β-catenin (Fagotto et al., 1998).
Earlier export models of β-catenin included APC as a carrier protein (Fagotto et al., 1998;
Henderson, 2000) but a more recent study showed that β-catenin can bind directly to
CRM1 independently of APC (Ki, Oh, Chung, & Kim, 2008).
Since the aPKC-PB1-domain is a protein-protein interaction domain (Hirano, 2004a;
2004b) that theoretically interacts with at least 12 additional mammalian PB1-containing
proteins (Lamark, 2003) we investigated the role of that domain during translocation.
Interestingly, Par-6, a protein that has been shown to interact with aPKCs via the PB1
domain is localized in the nucleus of MDCK cells. Therefor Par-6 represents a possible
candidate to act as a partner during ‘hitchhiking’. Thus we mutated the PB1 domains in the
full-length proteins to observe possible changes in the localization or translocation
behaviour. We expected to see decreased nuclear accumulation of the mutant upon LMB
46
46
treatment. Instead, we observed an increased nuclear fraction of aPKCs in untreated cells,
indicating an impaired shuttling. One possible interpretation of these data is that under
normal conditions aPKCs are predominantly localized in the cytosol of the cell through
interaction with Par-6. A fraction of that aPKC pool might translocate to other cell
compartments through binding to other protein such as Par-3 and Cdc42. Another fraction
of the same aPKC pool shuttles into the nucleus depending on importin-β and yet
unknown binding partners.The disruption of the PB1 domain leads to the disruption of the
Par6-aPKC interaction (Wilson et al., 2003) and might cause a shift in the distribution of
the protein (Noda, 2003). As a result of the Par-6 release the aPKC pseudo-substrate
interacts with the kinase domain and causes a conformational change. Thus, more mutant
protein is available for other interactions and this might lead to increased nuclear import.
We think that Par-6 might act as an anchor and is not actively involved in the nuclear
translocation of aPKC even though Par-6 has been described in the nucleus and it shows
weak shuttling between the nucleus and the cytosol (Cline & Nelson, 2007).
While this study focus on the involvement and alteration of possible import mechanism of
aPKCs into the nucleus we cannot fully exclude that our observations are a result of an
impaired export of the proteins. Some of the domains that we postulate to be involved in
nuclear import have also been shown to play a role in the nuclear export of proteins. A
recent publication has shown that another PB1 containing protein, p62, is important for
the nuclear export of ALFY (autophagy-linked FYVE) in HeLA cells (Clausen et al., 2010)
demonstrating that proteins can also “hitchhike” out of the nucleus. This suggests, as we
have mentioned, that the increased amount of nuclear protein might as well be a result of
decreased export rather than increased import. The p62 protein, also known as zeta
interacting protein (ZIP), has previously been identified as a binding partner of aPKCs
(Puls et al., 1997; Sanchez, De Carcer, Sandoval, Moscat, & Diaz-Meco, 1998) and has
recently received more attention as a player in starvation induced autophagy (Lamark,
Kirkin, Dikic, & Johansen, 2009; Pankiv et al., 2010) Bjørkøy et al. identified p62 as a
nuclear protein with shuttling properties similar to aPKC (Pankiv et al., 2010). Thus, we
consider p62 as a likely candidate to mediate nuclear shuttling of aPKCs.
47
47
Nuclear functions of aPKCs
Very little has been published regarding the nuclear functions of atypical PKCs and none
of those publications differentiates between the two isoforms. We were and still are
particularly interested in possible nuclear functions since our study is the first to suggest
multiple mechanisms of nuclear transport. This could mean that the cellular context plays a
major role in the regulation of nuclear translocation and that the physiological conditions
for nuclear translocation and activity of both aPKCs are different. However, over the last
decade three nuclear processes have been identified which potentially could be linked to
aPKC function:
1. Both isoforms have been described as a binding partner of Par-3 and Par-6 (Henrique,
2003; Joberty et al., 2000; Noda, 2003), forming a ternary complex, also known as
polarity complex. Recent work has revealed a nuclear localization of both Par proteins.
In MDCK cells, Par-6 has been characterized as a constitutive dual-location protein
present at the membrane and in the nucleus (Cline & Nelson, 2007). Furthermore the
nuclear localization of Par-6 is partially dependent on a putative NLS present in the
protein, but independent of aPKC, since deletion of the PB1 in Par-3 has no effect on
the nuclear localization (Cline & Nelson, 2007). However, when we overexpressed the
aPKC/???PB1 mutant in MDCK cells we noticed an increased nuclear localization of
Par-6 (data not published), supporting a possible role of aPKC in regulation of Par-6
localization. Par-3 has also been shown to be located in the nucleus and in contrast to
Par-6 it has been associated with a distinct function. Par-3 was shown to interact with
Ku70/Ku80 after ɣ-radiation (IR), a potent double strand break inducer in DNA often
used in DNA repair studies. Subsequently, the DNA-dependent protein kinase (DNA-PK)
associates with this complex (Fang et al., 2007). This study shows an unexpected link of
Par-3 to DNA repair and that Par-3 is absolutely required for efficient DNA repair and
cell survival following DNA damage.The cellular localization of Par-3 has been shown to
be independent of aPKC and Par-6 interaction. During the formation of tight junction,
Par-3 is recruiting Par-6 and aPKC. Considering the robustness of the polarity complex
in the cytosol it might as well exist in the nucleus with yet undiscovered functions.
Furthermore, when we used known online tools to scan the protein sequence of both
aPKCs for possible motifs we found a conserved phosphorylation motif for DNA-PK
present in both proteins. The presence of a DNA-PK motif might represent a functional
link between aPKCs and Par-3 in the nucleus that has not been reported before. More
48
48
detailed studies are necessary and conclusions based on these data are highly
speculative so far. However, we do think that aPKCs potentially play a role in DNA
damage repair including interaction with Par-3 and Par-6.
2. The role of aPKCζ in colonic epithelial proliferation. After aPKCζ has earlier been
implicated in the control of cellular mitogenic signaling and survival (Diaz-Meco et al.,
1996a; Gómez et al., 1995; Powell et al., 1996). Recent studies in the murine colon
showed a correlation of increased aPKCζ expression and crypt hyperproliferation
(Umar, Sellin, & Morris, 2000). Furthermore, the study shows increased nuclear
localization of aPKC in hyperproliferating crypt nuclei indicating a role in transmissible
murine colonic hyperplysia (TMCH).
3. Lastly it has been shown in 293 cells and embryonic fibroblasts that treatment with
TNFɑ leads to the activation of aPKCs which subsequently activates the NFκB signaling
pathway thereby causing a translocation of NFκB to the nucleus. Activation and
translocation of NFκB requires specific phosphorylation, for example at Ser311 at the
RelA subunit, which is a target of aPKCζ (Duran, Diaz-Meco, & Moscat, 2003).Cells
deficient for aPKCζ showed a reduced RelA phosphorylation at Ser311 indicating that
this process is specific for aPKCζ and aPKCɩ is not involved. Whether the
phosphorylation of RelA by aPKCζ takes place in the cytosol or within the nucleus of the
cell still remains unknown.
49
49
The role of atypical PKCs in early mouse development
Many studies have been performed describing the role of aPKC during embryonic
development including various species. Earlier studies on aPKCs were mainly performed
in C. elegans, Xenopus and D. melanogaster and showed an important role of aPKC in the
establishment and maintenance of the apico-basal polarity and epithelial structures. In
contrast to mammals these organisms have only one aPKC isoform and therefore provide
a straight forward model system with limited information about possible mechanisms
controlled by specific isoforms in mammals. The first evidence that there is functional
exclusiveness of aPKC isoforms came from gene targeting approaches for both aPKCs. In
2004, Soloff et al. described an embryonic lethal phenotype when the aPKCɩ gene was
knocked out by conventional gene targeting. Nevertheless that study did not investigate
details such as the exact time and possible causes of the lethality. In comparison to the
viable aPKCζ knock out animals this defines an important role of aPKCɩ during early
mouse development. When we generated various aPKCɩ knockout alleles in our lab, mice
deficient for aPKCɩ showed a lethal phenotype as well. Further analysis of the mutants
discovered first morphological irregularities at E7.5. At this stage mutant embryos showed
reduced size and an impaired formation of the amniotic cavity.
Only very little is known about the role of aPKCɩ in cavity formation and this is the first time
that the protein could be linked to the process of the amniotic cavity formation. Based on
what is known about the role of aPKCɩ in polarization of cells we expected that the
phenotype is a result of impaired polarity. We therefore compared our phenotype with
described phenotypes of other polarity proteins. Surprisingly only a few knockout studies
have been performed on proteins involved in polarization events that show comparable
phenotypes.
1. Studies on Zonula Occludens-1 (ZO-1) showed that ZO-1 deficiency causes a lethal
phenotype between E10.5 and E11.5. Compared to the loss of aPKCɩ this phenotype
occurs later and is most likely due to a defected yolk sac angiogenesis and apoptosis
(Katsuno et al., 2008).
2. A phenotype that is strikingly similar to the aPKCɩ-deficiency is caused by the loss of
afadin. Afadin deficient embryos showed first morphological impairment at E7.5 and
degradation of the embryo at E9.5 (Wataru Ikeda, 1999). The loss of afadin causes
impaired localization of ZO-1 and E-cadherin leading to disorganized cell-cell junctions
of the embryonic ectoderm. Afadin has been shown to regulate aPKC activity through
50
50
Cdc42 (Atwood & Prehoda, 2009; Sato, 2005; Welchman, Mathies, & Ahringer, 2007)
and therefore represents a link to the role of aPKCs.
3. Cdc42-deficient mice show a much more dramatic phenotype then ZO-1 and Afadin.
The lack of Cdc42 severely impairs the development of the embryo resulting in a
reduction in size at E5.5 and absorption of the embryo at E6.5. As the author suggests
the onset of the phenotype could even be earlier and that it may be delayed by the
maternal Cdc42 (F. Chen et al., 2000).
Even though all three proteins have been described to play a role during the formation of
tight junctions and adherens junctions (Komura et al., 2007; X. Wu et al., 2007) the various
phenotypes all occur at different timepoints of the embryonic development and/or are
different from what we see in the aPKCɩ deficient animals. Since our attempt to find a
mechanistic explanations or hinds for the phenotype of the aPKCɩ deficiency by comparing
existing knockout studies did not succeed, we choose alternative approaches.
Embryoid bodies as a model system for cavity formation
First we wanted to look at the process of cavity formation and the potential role of aPKCɩ
since we observed a severe reduction of the amniotic cavity in aPKCɩ deficient embryos. A
commonly used system to investigate the molecular mechanism of cavity formation is the
embroid bodie (EB) formation assay. This model system recapitulates early stages of
embryonic development in vitro (Keller 1995). Our initial analysis using
immunofluorescence showed correct formation of the basal lamina and the apical domain.
E-cadherin was found to be at the apical site facing the lumen in both genotypes,
indicating the presence of cell junctions (Tunggal et al., 2005). We also used Par-3 as a
marker for TJ-formation and established AP, as well as the adapter protein MUPP1, to
check for the interaction of JACs with the cytoskeleton (Guillemot, Paschoud, Pulimeno,
Foglia, & Citi, 2008). The localization of Par3 and MUPP1 were unaffected by the loss of
aPKCɩ in analyzed EBs. The fact that Par3 localization remains unaffected in EB formation
using aPKCɩ deficient mammals ES cells confirms earlier results from studies performed in
C. elegans(Hung & Kemphues, 1999). Furthermore, our data show that the impaired cavity
formation as a result of the loss of aPKCɩ is not caused by the loss of apico-basal polarity.
Our study also shows a remaining aPKC signal at the apical domain of aPKCɩ deficient
mutants. Western Blot analysis and RNA expression studies confirmed the complete
depletion of aPKCiota, thus the aPKC signal in deficient embryos must be aPKCzeta. We
think that it is likely that the remaining aPKCζ is compensating for the loss of aPKCɩ. To
51
51
verify this theory we are in the process of making a double knockout of both aPKCs.
However, supporting evidence for compensatory effects of aPKCζ come from earlier
knockout/knockdown studies on regulators of aPKC activity.
Cdc42, as a member of the small Rho-GTPase-family has been shown to interact with the
Par6/aPKC-complex (D. Lin et al., 2000; Qi et al., 2011) and plays a role in cell polarity. In
contrast to the aPKCɩ KO, EBs derived from Cdc42- deficient ES cells not only fail to
produce a single lumen, but also show a total loss of both aPKCs and Par-3 at the apical
domain (X. Wu et al., 2007). This phenotype is much stronger than aPKCɩ KO alone and
we think this is because Cdc42 interacts with both aPKC isoforms in a non-discriminating
way. Thus, depletion of Cdc42 caused reduced activity of both aPKCs and resulted in a
more dramatic phenotype. The overexpression of dn-aPKCζ in Cdc42 wild-type EB leads
to an identical phenotype compared to the Cdc42 knockout (X. Wu et al., 2007), which
supports our theory. Similar to the phenotype of the Cdc42-deficiency, the loss of afadin
causes a loss lumen formation and impaired distribution of Par-3, Par-6 and aPKC in EBs
(Komura et al., 2007). It is important to note that the formation of a single cavity is a twostep process: first, multiple small lumen form in the periphery of the EB with initiation
ofAP at each site (Coucouvanis & Martin, 1995). In a second step the smaller lumen fuse
and the inner cells undergo apoptosis to clear the central lumen. Our data suggest that the
loss of aPKCɩ does not interfere with the first step, since we see multiple lumen in the
periphery of the EB, but disrupt the second step involving apoptosis. Activation of
caspase-3 is an important step in apoptosis. Thus the reduced levels of activated
caspase-3 in aPKCɩ deficient EBs support the importance of aPKCɩ in the second part of
cavity formation. At this point we are not aware of any mechanism that might explain that
observation. However, an earlier study using aPKCζ pseudosubstrate to inhibit both
aPKCs in MDCK cyst formation showed increased caspase-3 activation with a negative
correlation with aPKC activity (M. Kim et al., 2007). These results imply that the loss of
aPKCɩ might elaborate aPKCζ activity in EBs, which causes inhibition of apoptosis.
Taken together, the loss of aPKCɩ causes impaired lumen formation and reduced
apoptosis in embryoid bodies without influencing the AP formation. Whether this
phenotype is strictly an effect of the loss of aPKCɩ or is a result of reduced apoptosis by
the remaining aPKCζ is unclear.
52
52
Further insights from alternative model systems for cavity formation
Data regarding the role of Par-6 and Par-3 in cavity formation comes from another model
system using MDCK cells in a three-dimensional (3D) epithelial culture. In this model
epithelial cells organize themselves into cyst structures that resemble their in vivo
architecture and are an established model for lumen formation.
1. Knockdown of Par-3 in this system results in a reduced lumen size, formation of multiple
lumen and complete loss of aPKC at the apical domain (Hao et al., 2010; Horikoshi et
al., 2009). Thus, the correct localization of Par-3 in aPKCɩ deficient EBs might explain
the remaining aPKC signal of aPKCζ at the apical domain in aPKCɩ deficient EBs.
2. Studies regarding Par-6 have shown that overexpression of the Par-6 N-terminus in
MDCK cells results in impaired cyst formation with a smaller central lumen and
redistribution of aPKC to the cytosol (M. Kim, Datta, Brakeman, Yu, & Mostov, 2007).
Considering the majority of publication, Par-6 binding to aPKC is thought to inhibit aPKC
activity in general (Yamanaka et al., 2001). In complex with Par-6, aPKC becomes
activated through interaction with other proteins. However, a more recent study has
demonstrated that Par-6 binding to aPKC replaces the pseudosubstrate from the kinase
domain and activates aPKC (Graybill et al., 2012). It seems difficult to combine both
studies to a general mechanism and it is possible that each mechanism applies to one
specific aPKC isoform. In fact, Yamanaka et al. presumably investigated aPKCɩ only,
while the Graybill et al. study is based entirely on aPKCζ. If this model is true,
overexpression of the Par-6 N-terminus would inhibit aPKCɩ and activate aPKCζ at the
same time. Thus, it is likely that the remaining aPKC signal at the apical pole in MDCK
cysts is activated aPKCζ. Finally, similar to the EB model, overexpression of kinasedead aPKCɩ in MDCK cells results in the formation of multiple-lumen cyst, just like in the
Par-3 knockdown studies.
We therefore conclude that both aPKC isoforms are necessary for complete formation of a
single central lumen in both models and that the deletion of aPKCɩ might be partly
compensated by aPKCζ. To verify the results from aPKC inhibition studies it would be
crucial to investigate cavity/lumen formation using a system deficient for both aPKC
isoforms on which we are currently working.
53
53
aPKCɩ deficient embryos show impaired TJ proteins
Others have reported that the absence, inhibition or depletion of aPKCs has an influence
on TJ formation and lumen formation in various in vitro model systems (Desclozeaux et al.,
2008; Hao et al., 2010; Izumi et al., 1998). The fact that we see a size reduced amniotic
cavity in aPKCɩ deficient embryos suggest an underlying mechanism that is similar to the
systems using cell-based approaches. Thus we further looked at the localization of marker
proteins for polarity and cell-cell junctions in mutants embryos. First we investigated the
localization of E-cadherin and occludin using immunofluorescence (IF). The correct
localization of E-cadherin showed that the apical domain was established even though the
signal was slightly diffuse. The localization of occludin at the intersection of two cells in a
spot-like manner is an important marker for TJ formation and was detectable in both
genotypes. Similar to the E-cadherin the Occludin signal was more diffuse compared to
the wildtype.. Next we looked at the localization of ZO-1, a marker for TJs in aPKCɩ
deficient embryos. We found a massive reduction of the ZO-1 protein at the apical domain
of mutant embryos which might be due to reduced expression levels. It has been shown
that inhibition of aPKCs or expression of a dominant-negative
(dn) version of aPKC
results in loss of ZO-1 at the TJ and causes reduced tightness of the TJs (Gopalakrishnan
et al., 2007). The main different between these studies and the study on aPKCɩ deficiency
in embryos is that the knockout approach is specific for one isofrom, while the expression
of a dn protein affects both isoforms. Most inhibitors, such as myristolated
pseudosubstrate (PS) act on both isoforms, therefore all effects upon PS treatment are a
result of a pan-aPKC inhibition. Atypical PKCs play a crucial role in TJ formation, but the
existing body of evidence does not proof that the loss of aPKCs directly causes ZO-1
relocation which directly causes TJ disassembly. Besides, if aPKCɩ and ZO-1 would share
a common exclusive pathway the phenotypes of the KO mice would be expected to be
similar, unless there is a functional redundant substitute. When we compared the two
phenotypes we saw that ZO-1 deficient mice die around E9.5, thus later than the aPKCɩ
deficient embryos (Katsuno et al., 2008). Likely candidates to compensate the loss of ZO-1
are naturally ZO-2 and ZO-3. The deletion of ZO-2 causes a phenotype with first signs of
growth retardation at E6.5. At E8.5 the embryos display impaired gastrulation resulting in
complete apoptosis (Xu et al., 2008). In contrast, ZO-3 deficient mice show no apparent
phenotype (Xu et al., 2008). However, in ZO-1-/- Eph4 cells it has been shown that ZO-2
gets recruited to the junctional areas during polarization and substitutes ZO-1 (Umeda,
2004). In spite ZO-2 localization at the junctional site ZO-1 deficient cells still show
54
54
retarded recruitment of occludin. This indicates a unique function of ZO-1 in regulating the
tightness of the TJs.
In the case of occludin we have to rely data from other model systems. In MDCK cells and
chick intestinal epithelial cells occludin phosphorylation highly correlates with TJ formation
(Sakakibara, Furuse, Saitou, Ando-Akatsuka, & Tsukita, 1997; Wong, 1997). Even though
there are no studies showing definitive data that aPKCs might be the kinase that regulates
occludin phosphorylation and localization it had been shown in MDCK cells that
overexpression of kinase-dead aPKCɩ causes delocalization of various TJ proteins
including ZO-1, Par-3, occludin and E-cadherin. A study on the role of aPKC activity in TJ
formation showed that treatment with myristolated pseudosubstrate results in decreased
levels of phoshorylated occludin and ZO-1 in MDCK cells. In addition, aPKCs have been
reported to directly interact with or phosphorylate a number of proteins that colocalize at
the TJ including JAM-1 (Iden et al., 2012), Par3 (Gopalakrishnan, Hallett, Atkinson, &
Marrs, 2007), Par-6 (Heather E Cunliffe, 2012) and ZO-1 (Fanning, Ma, & Anderson,
2002). Thus, occludin appears to be a likely substrate of aPKCs.
Both, the EB data and the immunoflourescence data from the mutant embryos indicates
that the loss of aPKCɩ influences the formation of cell-cell junctions. Thus, we used
electron microscopy to further support our data from the IF analysis and we found no
apparent differences in mutants compared to wild-type animals regarding AJCs. According
to our work, neither TJ formation nor AJ and desmosomes were impaired in embryos
lacking aPKCɩ.
The fact that we still have correct localization in the absence of aPKCɩ indicates a similar
role of aPKCζ regarding occludin regulation.
Considering the present data the following model would be possible: Deletion of aPKCɩ
interferes with the recruitment of ZO-1 and thereby with the establishment of TJs.
However, ZO-2 is able to substitute ZO-1 at the apical domain and allows the formation of
TJ. The incorporation of ZO-2 influences the recruitment of occludin and causes slight
structural impairments. As a result of a feedback loop, the formation of TJs causes a
decline in ZO-1 expression by a yet unknown mechanism (Anderson et al., 1989). In later
stages of embryogenesis the functionally impaired TJ result in growth retardation and
finally reabsorption of the embryo. This model is not entirely conclusive since we still
detect ZO-1 expression in wild-type embryos where proper TJ are established and
therefore also should suppress ZO-1 expression. The ZO-1 signal might be unaffected,
because this mechanism only effects the cells forming the apical domain and therefore
55
55
reflects a small pool of the whole embryo. Regarding the role of aPKCζ in ZO-1
phosphorylation and possible redundancy we assume that expression levels of the protein
are too low to compensate the loss of the aPKCɩ function. This is backed-up by our own
data from mutant embryos that shows no up-regulation of aPKCζ expression in aPKCɩ
deficient embryos.
56
56
Expression of aPKCζ partially rescues the aPKCɩ phenotype
The issue of redundancy among aPKCs has probably been discussed since scientists
have looked at the first sequence alignment of the two isoforms. With a staggering
72%(Clustal2W) homology those two proteins are very similar to each other. Even more
interesting is that most of the differences are found within two regions of the proteins: the
very N-terminal part (approximately 14aa) and the hinge region (approximately 60aa) are
highly variable. Sequence alignment of these two regions shows a 7% homology
(Clustal2W) between the isoforms. In contrast, alignment of the functional domains results
in 80% homology. Only little work has been published showing a direct functional
comparison of the two aPKCs and both isoforms have been treated as equals in most
studies. However, when Kovac et al. compared expression levels in the early stages of
embryogenesis and specific tissues in adult mice they were showing ubiquitous expression
of aPKCɩ and in comparison a more restricted and lower aPKCζ expression (Kovac, Oster,
& Leitges, 2007; Oster, Eichele, & Leitges, 2004). Analysis of aPKCɩ and aPKCζ in
zebrafish revealed multiple and redundant functions during vertebrate retinogenesis (Cui,
Otten, Rohr, Abdelilah-Seyfried, & Link, 2007). The majority of the early data is either
based on unspecific inhibition studies, overexpression of one isoform without considering
the other or on the use of ‘specific antibodies’. Thus, most biochemical studies regarding
aPKCs are studies on aPKC functions with limited information about isoform-specificity. In
recent years an increasing amount of data has been published using deletion models of
aPKC isoforms either from conventional knockouts or, in the case of aPKCɩ, conditional
knockout material. Many of these publications address the role of aPKC isoforms in
various cancer types including among others lung (Regala et al., 2009), breast (Heather E
Cunliffe, 2012) and colon cancer (N. R. Murray, Weems, Braun, Leitges, & Fields, 2009)
However, we know from earlier studies that aPKCζ expression is lower in most tissues
compared to aPKCɩ (Kovac et al., 2007; Oster et al., 2004). Thus, one can argue that
the phenotype of the aPKCɩ deficient mice is stronger than of the aPKCζ-deficient mice
because aPKCζ is not present in sufficient protein levels. Consequently, the aPKCζ
phenotype is milder because of the high expression of aPKCɩ that compensates the loss.
To further address this possibility we decided to design a knock-in approach based on the
aPKCɩ KO mice. If both isoforms are functionally redundant then overexpression of aPKCζ
without aPKCɩ present should rescue the phenotype. Therefore, the knock-in approach
was designed to assure comparable expression levels of the introduced aPKCζ compared
57
57
to the native aPKCɩ. This was achieved by using the same regulatory elements that
regulate the endogenous aPKCɩ expression. Similar to the aPKCɩ deficiency, no
homozygous rescue animals were born, indicating a lethal phenotype. When we analyzed
embryos we noticed that:
1. Embryos at E7.5 we were not able to distinguish between wild-type embryos and
homozygous carrier of the rescue allele ( all embryos appeared to be normal). Our
study indicates that whatever causes the lethality at stage E7.5 in aPKCɩ deficient
embryos can be rescued by aPKCζ expression.
2. Embryos at E8.5 appeared to be normal. We detected embryos with reduced size at
E9.5 which were proven to be homozygous for the rescue allele exclusively. This
clearly shows that the phenotype of the aPKCɩ deficient embryo at E7.5 can be
rescued by additional aPKCζ, indicating a redundancy between both proteins at this
stage of development.
After E7.5 and before E11.5 the deficiency of aPKCɩ is causing a problem that cannot be
compensated by aPKCζ and subsequently leads to absorption of the embryos. Our studies
did not include further experiments on the rescue animals but further studies on the
phenotype will be performed in the future.
58
58
Summary and future perspectives
In this thesis we present evidence for distinct functions and specific regulatory
mechanisms of the atypical PKC isoforms. Despite the order of publication, the idea of
paperI was based on preliminary data from paperII. Since the phenotypes of the aPKC
knock-out are so dramatically different we hypothesized that specific function of the aPKCs
might be achieved by specific localization and/or regulation of the proteins. Our effort
resulted in the first publication “Functional comparison of protein domains within aPKCs
involved in nucleocytoplasmic shuttling”. This paper clearly shows that the current
perception of atypical PKCs as two proteins with redundant functions needs to be
reconsidered and that both isoforms not only have overlapping roles but also might have
unique functions not only in cancer but also in other cellular processes. For the first time
we were able show the hinge region as a functional domain within aPKCs with distinct
properties in each isoform. Subsequentlywe performed the analysis of the aPKCiota
deficient embryos which partly was based on data from paper I in order to characterize the
underlying mechanism of the observed phenotype.
As a result, paperII “Phenotypical analysis of atypical PKCs in vivo functions display a
compensatory system at embryonic stage 7.5 p.c.” provides more than a description of a
phenotype. In PaperII we show that the phenotype is not due to impaired apico-basal
polarization or failure in development of the germlines. It seems that the lethal phenotype
of aPKCiota deficiency at 7.5 p.c. is mostly due to the insufficient amounts of aPKCzeta
present at this stage. This theory is backed up by overexpression of aPKCzeta, which is
able to rescue the early lethality but leads to a lethal phenotype at 10.5 p.c. At the same
time we could see an increased expression of aPKCzeta in aPKCiota deficient EBs. To
further investigate whether aPKCzeta is indeed upregulated in aPKCiota deficient embryos
we are in the process to produce embryos deficient for both aPKS. These animals will
allow us to verify the remaining signal and to show whether it really is aPKCzeta or a
unspecific background. Even if aPKCzeta is overexpressed in aPKCiota deficient embryos
we still do not understand why the rescue animals that expression additional aPKCzeta die
around E.9.5. Future work on the role of aPKCzeta in embryogenesis will include the role
of caspase cleavage of the protein in the observed rescue phenotype and which specific
function of aPKCiota is not compensated by aPKC zeta expression. The latest will include
morphological analysis of the rescue animals
59
59
References
Akimoto, K., Mizuno, K., Osada, S., Hirai, S., Tanuma, S., Suzuki, K., & Ohno, S. (1994).
A new member of the third class in the protein kinase C family, PKC lambda,
expressed dominantly in an undifferentiated mouse embryonal carcinoma cell line
and also in many tissues and cells. Journal of Biological Chemistry, 269(17), 12677.
Akimoto, K., Nakaya, M., Yamanaka, T., Tanaka, J., Matsuda, S., Weng, Q. P., et al.
(1998). Atypical protein kinase Clambda binds and regulates p70 S6 kinase.
Biochemical Journal, 335(Pt 2), 417.
Allen, J. J., Li, M., Brinkworth, C. S., Paulson, J. L., Wang, D., Hübner, A., et al. (2007). A
semisynthetic epitope for kinase substrates. Nature Methods, 4(6), 511–516. doi:
10.1038/nmeth1048
Anderson, J. M., Van Itallie, C. M., Peterson, M. D., Stevenson, B. R., Carew, E. A., &
Mooseker, M. S. (1989). ZO-1 mRNA and protein expression during tight junction
assembly in Caco-2 cells. The Journal of Cell Biology, 109(3), 1047–1056.
Atwood, S. X., & Prehoda, K. E. (2009). aPKC phosphorylates Miranda to polarize fate
determinants during neuroblast asymmetric cell division. Current Biology : CB,
19(9), 723–729. doi:10.1016/j.cub.2009.03.056
Aurrand-Lions, M., Duncan, L., Ballestrem, C., & Imhof, B. A. (2001). JAM-2, a novel
immunoglobulin superfamily molecule, expressed by endothelial and lymphatic
cells. The Journal of Biological Chemistry, 276(4), 2733–2741. doi:10.1074/
jbc.M005458200
Balendran, A., Biondi, R. M., Cheung, P. C., Casamayor, A., Deak, M., & Alessi, D. R.
(2000). A 3-phosphoinositide-dependent protein kinase-1 (PDK1) docking site is
required for the phosphorylation of protein kinase Czeta (PKCzeta ) and PKC-
60
60
related kinase 2 by PDK1. The Journal of Biological Chemistry, 275(27), 20806–
20813. doi:10.1074/jbc.M000421200
Baluch, D. P., Koeneman, B. A., Hatch, K. R., McGaughey, R. W., & Capco, D. G. (2004).
PKC isotypes in post-activated and fertilized mouse eggs: association with the
meiotic spindle. Developmental Biology, 274(1), 45–55. doi:10.1016/j.ydbio.
2004.05.030
Basu, A. (2002). Proteolytic Activation of Protein Kinase C-epsilon by Caspase-mediated
Processing and Transduction of Antiapoptotic Signals. Journal of Biological
Chemistry, 277(44), 41850–41856. doi:10.1074/jbc.M205997200
Benton, R., & St Johnston, D. (2003). Drosophila PAR-1 and 14-3-3 inhibit Bazooka/PAR-3
to establish complementary cortical domains in polarized cells. Cell, 115(6), 691–
704.
Berra, E., Diaz-Meco, M. T., Dominguez, I., Municio, M. M., Sanz, L., Lozano, J., et al.
(1993). Protein kinase C zeta isoform is critical for mitogenic signal transduction.
Cell, 74(3), 555–563.
Berra, E., Diaz-Meco, M. T., Lozano, J., Frutos, S., Municio, M. M., Sanchez, P., et al.
(1995). Evidence for a role of MEK and MAPK during signal transduction by protein
kinase C zeta. The EMBO Journal, 14(24), 6157–6163.
Berra, E., Municio, M. M., Sanz, L., Frutos, S., Diaz-Meco, M. T., & Moscat, J. (1997).
Positioning atypical protein kinase C isoforms in the UV-induced apoptotic signaling
cascade. Molecular and Cellular Biology, 17(8), 4346–4354.
Betschinger, J., Mechtler, K., & Knoblich, J. A. (2003). The Par complex directs asymmetric
cell division by phosphorylating the cytoskeletal protein Lgl. Nature, 422(6929),
326–330. doi:10.1038/nature01486
Biscardi, J. S., Tice, D. A., & Parsons, S. J. (1999). c-Src, receptor tyrosine kinases, and
human cancer. Advances in Cancer Research, 76, 61–119.
61
61
Bjorkoy, G. (2005). p62/SQSTM1 forms protein aggregates degraded by autophagy and
has a protective effect on huntingtin-induced cell death. The Journal of Cell Biology,
171(4), 603–614. doi:10.1083/jcb.200507002
Bogerd, H. P., Benson, R. E., Truant, R., Herold, A., Phingbodhipakkiya, M., & Cullen, B.
R. (1999). Definition of a consensus transportin-specific nucleocytoplasmic
transport signal. The Journal of Biological Chemistry, 274(14), 9771–9777.
Bornancin, F., & Parker, P. J. (1997). Phosphorylation of protein kinase C-alpha on serine
657 controls the accumulation of active enzyme and contributes to its phosphataseresistant state. The Journal of Biological Chemistry, 272(6), 3544–3549.
Boyd, L., Guo, S., Levitan, D., Stinchcomb, D. T., & Kemphues, K. J. (1996). PAR-2 is
asymmetrically distributed and promotes association of P granules and PAR-1 with
the cortex in C. elegans embryos. Development, 122(10), 3075–3084.
Brejc, K., van Dijk, W. J., Klaassen, R. V., Schuurmans, M., van der Oost, J., Smit, A. B., &
Sixma, T. K. (2001). Crystal structure of an ACh-binding protein reveals the ligandbinding domain of nicotinic receptors. Nature, 411(6835), 269–276. doi:
10.1038/35077011
Calado, A., Kutay, U., Kühn, U., Wahle, E., & Carmo-Fonseca, M. (2000). Deciphering the
cellular pathway for transport of poly(A)-binding protein II. RNA (New York, N.Y.),
6(2), 245–256.
Chen, F., Ma, L., Parrini, M. C., Mao, X., Lopez, M., Wu, C., et al. (2000). Cdc42 is
required for PIP2-induced actin polymerization and early development but not for
cell viability. Current Biology, 10(13), 758–765. doi:10.1016/
S0960-9822(00)00571-6
Chen, J. G. (2004). GCR1 Can Act Independently of Heterotrimeric G-Protein in Response
to Brassinosteroids and Gibberellins in Arabidopsis Seed Germination. Plant
Physiology, 135(2), 907–915. doi:10.1104/pp.104.038992
62
62
Clausen, T. H., Lamark, T., Isakson, P., Finley, K., Larsen, K. B., Brech, A., et al. (2010).
p62/SQSTM1 and ALFY interact to facilitate the formation of p62 bodies/ALIS and
their degradation by autophagy. Autophagy, 6(3), 330–344.
Cline, E. G., & Nelson, W. J. (2007). Characterization of Mammalian Par 6 as a DualLocation Protein. Molecular and Cellular Biology, 27(12), 4431–4443. doi:10.1128/
MCB.02235-06
Collingridge, G. L., Olsen, R. W., Peters, J., & Spedding, M. (2009). A nomenclature for
ligand-gated ion channels. Neuropharmacology, 56(1), 2–5. doi:10.1016/
j.neuropharm.2008.06.063
Colón-González, F., & Kazanietz, M. G. (2006). C1 domains exposed: from diacylglycerol
binding to protein-protein interactions. Biochimica Et Biophysica Acta, 1761(8),
827–837. doi:10.1016/j.bbalip.2006.05.001
Coucouvanis, E., & Martin, G. R. (1995). Signals for death and survival: a two-step
mechanism for cavitation in the vertebrate embryo. Cell, 83(2), 279–287.
Cui, S., Otten, C., Rohr, S., Abdelilah-Seyfried, S., & Link, B. A. (2007). Analysis of
aPKClambda and aPKCzeta reveals multiple and redundant functions during
vertebrate retinogenesis. Molecular and Cellular Neurosciences, 34(3), 431–444.
doi:10.1016/j.mcn.2006.11.016
Dard, N., Le, T., Maro, B., & Louvet-Vallée, S. (2009). Inactivation of aPKCλ Reveals a
Context Dependent Allocation of Cell Lineages in Preimplantation Mouse Embryos.
PLoS ONE, 4(9), e7117. doi:10.1371/journal.pone.0007117
Datta, R. (1997). Caspase-3-mediated Cleavage of Protein Kinase C theta in Induction of
Apoptosis. Journal of Biological Chemistry, 272(33), 20317–20320. doi:10.1074/jbc.
272.33.20317
Desclozeaux, M., Venturato, J., Wylie, F. G., Kay, J. G., Joseph, S. R., Le, H. T., & Stow, J.
L. (2008). Active Rab11 and functional recycling endosome are required for E63
63
cadherin trafficking and lumen formation during epithelial morphogenesis. American
Journal of Physiology-Cell Physiology, 295(2), C545–56. doi:10.1152/ajpcell.
00097.2008
Diaz-Meco, M. T., Municio, M. M., Frutos, S., Sanchez, P., Lozano, J., Sanz, L., & Moscat,
J. (1996a). The product of par-4, a gene induced during apoptosis, interacts
selectively with the atypical isoforms of protein kinase C. Cell, 86(5), 777–786.
Diaz-Meco, M. T., Municio, M. M., Sanchez, P., Lozano, J., & Moscat, J. (1996b). Lambdainteracting protein, a novel protein that specifically interacts with the zinc finger
domain of the atypical protein kinase C isotype lambda/iota and stimulates its
kinase activity in vitro and in vivo. Molecular and Cellular Biology, 16(1), 105–114.
Duran, A., Diaz-Meco, M. T., & Moscat, J. (2003). Essential role of RelA Ser311
phosphorylation by zetaPKC in NF-kappaB transcriptional activation. The EMBO
Journal, 22(15), 3910–3918. doi:10.1093/emboj/cdg370
Durgan, J., Kaji, N., Jin, D., & Hall, A. (2011). Par6B and Atypical PKC Regulate Mitotic
Spindle Orientation during Epithelial Morphogenesis. Journal of Biological
Chemistry, 286(14), 12461–12474. doi:10.1074/jbc.M110.174235
Ebnet, K., Schulz, C. U., Meyer Zu Brickwedde, M. K., Pendl, G. G., & Vestweber, D.
(2000). Junctional adhesion molecule interacts with the PDZ domain-containing
proteins AF-6 and ZO-1. The Journal of Biological Chemistry, 275(36), 27979–
27988. doi:10.1074/jbc.M002363200
Ebnet, K., Suzuki, A., Horikoshi, Y., Hirose, T., Meyer Zu Brickwedde, M. K., Ohno, S., &
Vestweber, D. (2001). The cell polarity protein ASIP/PAR-3 directly associates with
junctional adhesion molecule (JAM). The EMBO Journal, 20(14), 3738–3748. doi:
10.1093/emboj/20.14.3738
64
64
Eckert, J. J., & Fleming, T. P. (2008). Tight junction biogenesis during early development.
Biochimica Et Biophysica Acta, 1778(3), 717–728. doi:10.1016/j.bbamem.
2007.09.031
Eckert, J. J., McCallum, A., Mears, A., Rumsby, M. G., Cameron, I. T., & Fleming, T. P.
(2004). Specific PKC isoforms regulate blastocoel formation during mouse
preimplantation development. Developmental Biology, 274(2), 384–401. doi:
10.1016/j.ydbio.2004.07.027
Edwards, A. S., & Newton, A. C. (1997). Phosphorylation at conserved carboxyl-terminal
hydrophobic motif regulates the catalytic and regulatory domains of protein kinase
C. The Journal of Biological Chemistry, 272(29), 18382–18390.
Edwards, A. S., Faux, M. C., Scott, J. D., & Newton, A. C. (1999). Carboxyl-terminal
phosphorylation regulates the function and subcellular localization of protein kinase
C betaII. The Journal of Biological Chemistry, 274(10), 6461–6468.
Etienne-Manneville, S., & Hall, A. (2003). Cell polarity: Par6, aPKC and cytoskeletal
crosstalk. Current Opinion in Cell Biology, 15(1), 67–72.
Evans, J. H., Murray, D., Leslie, C. C., & Falke, J. J. (2006). Specific translocation of
protein kinase Calpha to the plasma membrane requires both Ca2+ and PIP2
recognition by its C2 domain. Molecular Biology of the Cell, 17(1), 56–66. doi:
10.1091/mbc.E05-06-0499
Facchinetti, V., Ouyang, W., Wei, H., Soto, N., Lazorchak, A., Gould, C., et al. (2008). The
mammalian target of rapamycin complex 2 controls folding and stability of Akt and
protein kinase C. The EMBO Journal, 27(14), 1932–1943. doi:10.1038/emboj.
2008.120
Fagotto, F., Glück, U., & Gumbiner, B. M. (1998). Nuclear localization signal-independent
and importin/karyopherin-independent nuclear import of β-catenin. Current Biology,
8(4), 181–190. doi:10.1016/S0960-9822(98)70082-X
65
65
Fang, L., Wang, Y., Du, D., Yang, G., Tak Kwok, T., Kai Kong, S., et al. (2007). Cell polarity
protein Par3 complexes with DNA-PK via Ku70 and regulates DNA double-strand
break repair. Cell Research, 17(2), 100–116. doi:10.1038/sj.cr.7310145
Fanning, A. S., Jameson, B. J., Jesaitis, L. A., & Anderson, J. M. (1998). The tight junction
protein ZO-1 establishes a link between the transmembrane protein occludin and
the actin cytoskeleton. The Journal of Biological Chemistry, 273(45), 29745–29753.
Fanning, A. S., Ma, T. Y., & Anderson, J. M. (2002). Isolation and functional
characterization of the actin binding region in the tight junction protein ZO-1. FASEB
Journal : Official Publication of the Federation of American Societies for
Experimental Biology, 16(13), 1835–1837. doi:10.1096/fj.02-0121fje
Fornerod, M., Ohno, M., Yoshida, M., & Mattaj, I. W. (1997). CRM1 is an export receptor
for leucine-rich nuclear export signals. Cell, 90(6), 1051–1060.
Frank, E., & Landgraf, R. (2008). The vasopressin system--from antidiuresis to
psychopathology. European Journal of Pharmacology, 583(2-3), 226–242. doi:
10.1016/j.ejphar.2007.11.063
Freeley, M., Kelleher, D., & Long, A. (2011). Regulation of Protein Kinase C function by
phosphorylation on conserved and non-conserved sites. Cellular Signalling, 23(5),
753–762. doi:10.1016/j.cellsig.2010.10.013
Frutos, S., Moscat, J., & Diaz-Meco, M. T. (1999). Cleavage of ζPKC but not λ/ιPKC by
caspase-3 during UV-induced apoptosis. Journal of Biological Chemistry, 274(16),
10765.
Furuse, M., Fujita, K., Hiiragi, T., Fujimoto, K., & Tsukita, S. (1998). Claudin-1 and -2: novel
integral membrane proteins localizing at tight junctions with no sequence similarity
to occludin. The Journal of Cell Biology, 141(7), 1539–1550.
66
66
Furuse, M., Hirase, T., Itoh, M., Nagafuchi, A., Yonemura, S., Tsukita, S., & Tsukita, S.
(1993). Occludin: a novel integral membrane protein localizing at tight junctions.
The Journal of Cell Biology, 123(6 Pt 2), 1777–1788.
Furuse, M., Itoh, M., Hirase, T., Nagafuchi, A., Yonemura, S., Tsukita, S., & Tsukita, S.
(1994). Direct association of occludin with ZO-1 and its possible involvement in the
localization of occludin at tight junctions. The Journal of Cell Biology, 127(6 Pt 1),
1617–1626.
Furuse, M., Sasaki, H., & Tsukita, S. (1999). Manner of interaction of heterogeneous
claudin species within and between tight junction strands. The Journal of Cell
Biology, 147(4), 891–903.
Goodnight, J., Kazanietz, M. G., Blumberg, P. M., Mushinski, J. F., & Mischak, H. (1992).
The cDNA sequence, expression pattern and protein characteristics of mouse
protein kinase C-zeta. Gene, 122(2), 305–311.
Gopalakrishnan, S., Hallett, M. A., Atkinson, S. J., & Marrs, J. A. (2007). aPKC-PAR
complex dysfunction and tight junction disassembly in renal epithelial cells during
ATP depletion. American Journal of Physiology-Cell Physiology, 292(3), C1094–
102. doi:10.1152/ajpcell.00099.2006
Gómez, J., Pitton, C., García, A., Martinez de Aragón, A., Silva, A., & Rebollo, A. (1995).
The zeta isoform of protein kinase C controls interleukin-2-mediated proliferation in
a murine T cell line: evidence for an additional role of protein kinase C epsilon and
beta. Experimental Cell Research, 218(1), 105–113. doi:10.1006/excr.1995.1136
Graybill, C., Wee, B., Atwood, S. X., & Prehoda, K. E. (2012). Par-6 activates atypical
protein kinase C by pseudosubstrate displacement. The Journal of Biological
Chemistry. doi:10.1074/jbc.M112.360495
Grodsky, N., Li, Y., Bouzida, D., Love, R., Jensen, J., Nodes, B., et al. (2006). Structure of
the catalytic domain of human protein kinase C beta II complexed with a
67
67
bisindolylmaleimide inhibitor. Biochemistry, 45(47), 13970–13981. doi:10.1021/
bi061128h
Guillemot, L., Paschoud, S., Pulimeno, P., Foglia, A., & Citi, S. (2008). The cytoplasmic
plaque of tight junctions: a scaffolding and signalling center. Biochimica Et
Biophysica Acta, 1778(3), 601–613. doi:10.1016/j.bbamem.2007.09.032
Guo, S., & Kemphues, K. J. (1995). par-1, a gene required for establishing polarity in C.
elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically
distributed. Cell, 81(4), 611–620.
Gusarova, G. A., Dada, L. A., Kelly, A. M., Brodie, C., Witters, L. A., Chandel, N. S., &
Sznajder, J. I. (2009). Alpha1-AMP-activated protein kinase regulates hypoxiainduced Na,K-ATPase endocytosis via direct phosphorylation of protein kinase C
zeta. Molecular and Cellular Biology, 29(13), 3455–3464. doi:10.1128/MCB.
00054-09
Halet, G. (2004). PKC signaling at fertilization in mammalian eggs. Biochimica Et
Biophysica Acta, 1742(1-3), 185–189. doi:10.1016/j.bbamcr.2004.09.012
Hanahan, D., & Weinberg, R. A. (2011). Hallmarks of cancer: the next generation. Cell,
144(5), 646–674. doi:10.1016/j.cell.2011.02.013
Hanks, S. K., & Hunter, T. (1995). Protein kinases 6. The eukaryotic protein kinase
superfamily: kinase (catalytic) domain structure and classification. FASEB Journal :
Official Publication of the Federation of American Societies for Experimental
Biology, 9(8), 576–596.
Hao, Y., Du, Q., Chen, X., Zheng, Z., Balsbaugh, J. L., Maitra, S., et al. (2010). Par3
controls epithelial spindle orientation by aPKC-mediated phosphorylation of apical
Pins. Current Biology : CB, 20(20), 1809–1818. doi:10.1016/j.cub.2010.09.032
Harris, R. C., Chung, E., & Coffey, R. J. (2003). EGF receptor ligands. Experimental Cell
Research, 284(1), 2–13.
68
68
Hauge, C., Antal, T. L., Hirschberg, D., Doehn, U., Thorup, K., Idrissova, L., et al. (2007).
Mechanism for activation of the growth factor-activated AGC kinases by turn motif
phosphorylation. The EMBO Journal, 26(9), 2251–2261. doi:10.1038/sj.emboj.
7601682
Heather E Cunliffe, Y. J. K. M. F. F. Y. P. S. M. (2012). PAR6B is required for tight junction
formation and activated PKCζ localization in breast cancer. American Journal of
Cancer Research, 2(5), 478.
Henderson, B. R. (2000). Nuclear-cytoplasmic shuttling of APC regulates beta-catenin
subcellular localization and turnover. Nature Cell Biology, 2(9), 653–660. doi:
10.1038/35023605
Henrique, D. (2003). Cell polarity: the ups and downs of the Par6/aPKC complex. Current
Opinion in Genetics & Development, 13(4), 341–350. doi:10.1016/
S0959-437X(03)00077-7
Hirano, Y. (2004a). Solution Structure of Atypical Protein Kinase C PB1 Domain and Its
Mode of Interaction with ZIP/p62 and MEK5. Journal of Biological Chemistry,
279(30), 31883–31890. doi:10.1074/jbc.M403092200
Hirano, Y. (2004b). Structure of a Cell Polarity Regulator, a Complex between Atypical
PKC and Par6 PB1 Domains. Journal of Biological Chemistry, 280(10), 9653–9661.
doi:10.1074/jbc.M409823200
Hirase, T., Staddon, J. M., Saitou, M., Ando-Akatsuka, Y., Itoh, M., Furuse, M., et al.
(1997). Occludin as a possible determinant of tight junction permeability in
endothelial cells. Journal of Cell Science, 110 ( Pt 14), 1603–1613.
Horikoshi, Y., Suzuki, A., Yamanaka, T., Sasaki, K., Mizuno, K., Sawada, H., et al. (2009).
Interaction between PAR-3 and the aPKC-PAR-6 complex is indispensable for
apical domain development of epithelial cells. Journal of Cell Science, 122(10),
1595–1606. doi:10.1242/jcs.043174
69
69
House, C., & Kemp, B. E. (1987). Protein kinase C contains a pseudosubstrate prototope
in its regulatory domain. Science, 238(4834), 1726–1728.
Hung, T. J., & Kemphues, K. J. (1999). PAR-6 is a conserved PDZ domain-containing
protein that colocalizes with PAR-3 in Caenorhabditis elegans embryos.
Development, 126(1), 127–135.
Hurov, J. B., Watkins, J. L., & Piwnica-Worms, H. (2004). Atypical PKC phosphorylates
PAR-1 kinases to regulate localization and activity. Current Biology : CB, 14(8),
736–741. doi:10.1016/j.cub.2004.04.007
Iden, S., Misselwitz, S., Peddibhotla, S. S. D., Tuncay, H., Rehder, D., Gerke, V., et al.
(2012). aPKC phosphorylates JAM-A at Ser285 to promote cell contact maturation
and tight junction formation. The Journal of Cell Biology, 196(5), 623–639. doi:
10.1083/jcb.201104143
Ikenoue, T., Inoki, K., Yang, Q., Zhou, X., & Guan, K.-L. (2008). Essential function of
TORC2 in PKC and Akt turn motif phosphorylation, maturation and signalling. The
EMBO Journal, 27(14), 1919–1931. doi:10.1038/emboj.2008.119
Inoue, M., Kishimoto, A., Takai, Y., & Nishizuka, Y. (1977). Studies on a cyclic nucleotideindependent protein kinase and its proenzyme in mammalian tissues. II. Proenzyme
and its activation by calcium-dependent protease from rat brain. The Journal of
Biological Chemistry, 252(21), 7610–7616.
Ishiuchi, T., & Takeichi, M. (2011). Willin and Par3 cooperatively regulate epithelial apical
constriction through aPKC-mediated ROCK phosphorylation. Nature Cell Biology,
13(7), 860–866. doi:10.1038/ncb2274
Itoh, M., Furuse, M., Morita, K., Kubota, K., Saitou, M., & Tsukita, S. (1999). Direct binding
of three tight junction-associated MAGUKs, ZO-1, ZO-2, and ZO-3, with the COOH
termini of claudins. The Journal of Cell Biology, 147(6), 1351–1363.
70
70
Izumi, Y., Hirose, T., Tamai, Y., Hirai, S., Nagashima, Y., Fujimoto, T., et al. (1998). An
atypical PKC directly associates and colocalizes at the epithelial tight junction with
ASIP, a mammalian homologue of Caenorhabditis elegans polarity protein PAR-3.
The Journal of Cell Biology, 143(1), 95–106.
Jaken, S., & Parker, P. J. (2000). Protein kinase C binding partners. BioEssays : News and
Reviews in Molecular, Cellular and Developmental Biology, 22(3), 245–254. doi:
10.1002/(SICI)1521-1878(200003)22:3<245::AID-BIES6>3.0.CO;2-X
Joberty, G., Petersen, C., Gao, L., & Macara, I. G. (2000). The cell-polarity protein Par6
links Par3 and atypical protein kinase C to Cdc42. Nature Cell Biology, 2(8), 531–
539.
Johnson, D. A., Akamine, P., Radzio-Andzelm, E., Madhusudan, M., & Taylor, S. S. (2001).
Dynamics of cAMP-dependent protein kinase. Chemical Reviews, 101(8), 2243–
2270.
Karmacharya, M. B., Jang, J.-I., Lee, Y.-J., Lee, Y.-S., & Soh, J.-W. (2010). Mutation of the
hydrophobic motif in a phosphorylation-deficient mutant renders protein kinase C
delta more apoptotically active. Archives of Biochemistry and Biophysics, 493(2),
242–248. doi:10.1016/j.abb.2009.11.007
Kato, K., Yamanouchi, D., Esbona, K., Kamiya, K., Zhang, F., Kent, K. C., & Liu, B. (2009).
Caspase-mediated protein kinase C-delta cleavage is necessary for apoptosis of
vascular smooth muscle cells. American Journal of Physiology. Heart and
Circulatory Physiology, 297(6), H2253–61. doi:10.1152/ajpheart.00274.2009
Katsuno, T., Umeda, K., Matsui, T., Hata, M., Tamura, A., Itoh, M., et al. (2008). Deficiency
of zonula occludens-1 causes embryonic lethal phenotype associated with defected
yolk sac angiogenesis and apoptosis of embryonic cells. Molecular Biology of the
Cell, 19(6), 2465–2475. doi:10.1091/mbc.E07-12-1215
71
71
Kazanietz, M. G., Areces, L. B., Bahador, A., Mischak, H., Goodnight, J., Mushinski, J. F.,
& Blumberg, P. M. (1993). Characterization of ligand and substrate specificity for the
calcium-dependent and calcium-independent protein kinase C isozymes. Molecular
Pharmacology, 44(2), 298–307.
Kemphues, K. J., Priess, J. R., Morton, D. G., & Cheng, N. S. (1988). Identification of
genes required for cytoplasmic localization in early C. elegans embryos. Cell, 52(3),
311–320.
Ki, H., Oh, M., Chung, S. W., & Kim, K. (2008). β-Catenin can bind directly to CRM1
independently of adenomatous polyposis coli, which affects its nuclear localization
and LEF-1/β-catenin-dependent gene expression. Pharmacological Research,
32(4), 394–400. doi:10.1016/j.cellbi.2007.12.008
Kikkawa, U., Kishimoto, A., & Nishizuka, Y. (1989). The protein kinase C family:
heterogeneity and its implications. Annual Review of Biochemistry, 58, 31–44. doi:
10.1146/annurev.bi.58.070189.000335
Kim, J.-S., Park, Z.-Y., Yoo, Y.-J., Yu, S.-S., & Chun, J.-S. (2005). p38 kinase mediates
nitric oxide-induced apoptosis of chondrocytes through the inhibition of protein
kinase C zeta by blocking autophosphorylation. Cell Death and Differentiation,
12(3), 201–212. doi:10.1038/sj.cdd.4401511
Kim, M., Datta, A., Brakeman, P., Yu, W., & Mostov, K. E. (2007). Polarity proteins PAR6
and aPKC regulate cell death through GSK-3beta in 3D epithelial morphogenesis.
Journal of Cell Science, 120(14), 2309–2317. doi:10.1242/jcs.007443
Kim, S.-J., Kim, H.-G., Oh, C.-D., Hwang, S.-G., Song, W.-K., Yoo, Y.-J., et al. (2002). p38
kinase-dependent and -independent Inhibition of protein kinase C zeta and -alpha
regulates nitric oxide-induced apoptosis and dedifferentiation of articular
chondrocytes. The Journal of Biological Chemistry, 277(33), 30375–30381. doi:
10.1074/jbc.M205193200
72
72
Komura, H., Ogita, H., Ikeda, W., Mizoguchi, A., Miyoshi, J., & Takai, Y. (2007).
Establishment of cell polarity by afadin during the formation of embryoid bodies.
Genes to Cells, 13(1), 79–90. doi:10.1111/j.1365-2443.2007.01150.x
Kovac, J., Oster, H., & Leitges, M. (2007). Expression of the atypical protein kinase C
(aPKC) isoforms ι/λ and ζ during mouse embryogenesis. Gene Expression
Patterns, 7(1-2), 187–196. doi:10.1016/j.modgep.2006.07.002
Lamark, T. (2003). Interaction Codes within the Family of Mammalian Phox and Bem1p
Domain-containing Proteins. Journal of Biological Chemistry, 278(36), 34568–
34581. doi:10.1074/jbc.M303221200
Lamark, T., Kirkin, V., Dikic, I., & Johansen, T. (2009). NBR1 and p62 as cargo receptors
for selective autophagy of ubiquitinated targets. Cell Cycle (Georgetown, Tex.),
8(13), 1986–1990.
Le Good, J. A. (1998). Protein Kinase C Isotypes Controlled by Phosphoinositide 3-Kinase
Through the Protein Kinase PDK1. Science, 281(5385), 2042–2045. doi:10.1126/
science.281.5385.2042
Leitges, M., Sanz, L., Martin, P., Duran, A., Braun, U., Garci'a, J. F., et al. (2001). Targeted
disruption of the [zeta] PKC gene results in the impairment of the NF-[kappa] B
pathway. Molecular Cell, 8(4), 771–780.
Lin, D., Edwards, A. S., Fawcett, J. P., Mbamalu, G., Scott, J. D., & Pawson, T. (2000). A
mammalian PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC signalling
and cell polarity. Nature Cell Biology, 2(8), 540–547. doi:10.1038/35019582
Litherland, G. J., Elias, M. S., Hui, W., Macdonald, C. D., Catterall, J. B., Barter, M. J., et
al. (2010). Protein kinase C isoforms zeta and iota mediate collagenase expression
and cartilage destruction via STAT3- and ERK-dependent c-fos induction. The
Journal of Biological Chemistry, 285(29), 22414–22425. doi:10.1074/
jbc.M110.120121
73
73
Liu, Y., Graham, C., Li, A., Fisher, R. J., & Shaw, S. (2002). Phosphorylation of the protein
kinase C-theta activation loop and hydrophobic motif regulates its kinase activity,
but only activation loop phosphorylation is critical to in vivo nuclear-factor-kappaB
induction. Biochemical Journal, 361(Pt 2), 255–265.
Luna-Ulloa, L. B., Hernandez-Maqueda, J. G., Santoyo-Ramos, P., Castaneda-Patlan, M.
C., & Robles-Flores, M. (2011). Protein kinase C is a positive modulator of
canonical Wnt signaling pathway in tumoral colon cell lines. Carcinogenesis, 32(11),
1615–1624. doi:10.1093/carcin/bgr190
Madshus, I. H., & Stang, E. (n.d.). Internalization and intracellular sorting of the EGF
receptor: a model for understanding the mechanisms of receptor trafficking.
Jcs.Biologists.org.
Maines, M. D., Miralem, T., Lerner-Marmarosh, N., Shen, J., & Gibbs, P. E. M. (2007).
Human biliverdin reductase, a previously unknown activator of protein kinase C
betaII. The Journal of Biological Chemistry, 282(11), 8110–8122. doi:10.1074/
jbc.M513427200
Maiyar, A. C., Leong, M. L. L., & Firestone, G. L. (2003). Importin-alpha mediates the
regulated nuclear targeting of serum- and glucocorticoid-inducible protein kinase
(Sgk) by recognition of a nuclear localization signal in the kinase central domain.
Molecular Biology of the Cell, 14(3), 1221–1239. doi:10.1091/mbc.E02-03-0170
MAKOWSKE, M., & ROSEN, O. (1989). Complete Activation of Protein Kinase-C by an
Antipeptide Antibody Directed Against the Pseudosubstrate Prototope. The Journal
of Biological Chemistry, 264(27), 16155–16159.
Manning, G., Whyte, D. B., Martinez, R., Hunter, T., & Sudarsanam, S. (2002). The protein
kinase complement of the human genome. Science, 298(5600), 1912–1934. doi:
10.1126/science.1075762
74
74
Marsh, L., Neiman, A. M., & Herskowitz, I. (1991). Signal transduction during pheromone
response in yeast. Annual Review of Cell ….
McManus, E. J., Collins, B. J., Ashby, P. R., Prescott, A. R., Murray-Tait, V., Armit, L. J., et
al. (2004). The in vivo role of PtdIns(3,4,5)P3 binding to PDK1 PH domain defined
by knockin mutation. The EMBO Journal, 23(10), 2071–2082. doi:10.1038/sj.emboj.
7600218
Messerschmidt, A., Macieira, S., Velarde, M., Bädeker, M., Benda, C., Jestel, A., et al.
(2005). Crystal structure of the catalytic domain of human atypical protein kinase Ciota reveals interaction mode of phosphorylation site in turn motif. Journal of
Molecular Biology, 352(4), 918–931. doi:10.1016/j.jmb.2005.07.060
Murray, N. R., Weems, J., Braun, U., Leitges, M., & Fields, A. P. (2009). Protein Kinase C II and PKC/: Collaborating Partners in Colon Cancer Promotion and Progression.
Cancer Research, 69(2), 656–662. doi:10.1158/0008-5472.CAN-08-3001
Mutig, K., Paliege, A., Kahl, T., Jöns, T., Müller-Esterl, W., & Bachmann, S. (2007).
Vasopressin V2 receptor expression along rat, mouse, and human renal epithelia
with focus on TAL. American Journal of Physiology. Renal Physiology, 293(4),
F1166–77. doi:10.1152/ajprenal.00196.2007
Nakamura, R., Sumimoto, H., Mizuki, K., Hata, K., Ago, T., Kitajima, S., et al. (1998). The
PC motif: a novel and evolutionarily conserved sequence involved in interaction
between p40phox and p67phox, SH3 domain-containing cytosolic factors of the
phagocyte NADPH oxidase. European Journal of Biochemistry / FEBS, 251(3),
583–589.
Nakanishi, H., Brewer, K. A., & Exton, J. H. (1993). Activation of the zeta isozyme of
protein kinase C by phosphatidylinositol 3,4,5-trisphosphate. Journal of Biological
Chemistry.
75
75
Neri, L. M., Martelli, A. M., Borgatti, P., Colamussi, M. L., Marchisio, M., & Capitani, S.
(1999). Increase in nuclear phosphatidylinositol 3-kinase activity and
phosphatidylinositol (3,4,5) trisphosphate synthesis precede PKC-zeta translocation
to the nucleus of NGF-treated PC12 cells. FASEB Journal : Official Publication of
the Federation of American Societies for Experimental Biology, 13(15), 2299–2310.
Noda, Y. (2003). Molecular Recognition in Dimerization between PB1 Domains. Journal of
Biological Chemistry, 278(44), 43516–43524. doi:10.1074/jbc.M306330200
Nusrat, A., Chen, J. A., Foley, C. S., Liang, T. W., Tom, J., Cromwell, M., et al. (2000). The
coiled-coil domain of occludin can act to organize structural and functional elements
of the epithelial tight junction. The Journal of Biological Chemistry, 275(38), 29816–
29822. doi:10.1074/jbc.M002450200
Ohno, S. (2001). Intercellular junctions and cellular polarity: the PAR-aPKC complex, a
conserved core cassette playing fundamental roles in cell polarity. Current Opinion
in Cell Biology, 13(5), 641–648.
Ono, Y., Fujii, T., Ogita, K., Kikkawa, U., Igarashi, K., & Nishizuka, Y. (1989). Protein kinase
C zeta subspecies from rat brain: its structure, expression, and properties.
Proceedings of the National Academy of Sciences, 86(9), 3099–3103.
Oster, H., Eichele, G., & Leitges, M. (2004). Differential expression of atypical PKCs in the
adult mouse brain. Brain Research. Molecular Brain Research, 127(1-2), 79–88.
doi:10.1016/j.molbrainres.2004.05.009
Palmeri, D., & Malim, M. H. (1999). Importin beta can mediate the nuclear import of an
arginine-rich nuclear localization signal in the absence of importin alpha. Molecular
and Cellular Biology, 19(2), 1218.
Pankiv, S., Lamark, T., Bruun, J. A., Overvatn, A., Bjorkoy, G., & Johansen, T. (2010).
Nucleocytoplasmic Shuttling of p62/SQSTM1 and Its Role in Recruitment of Nuclear
76
76
Polyubiquitinated Proteins to Promyelocytic Leukemia Bodies. Journal of Biological
Chemistry, 285(8), 5941–5953. doi:10.1074/jbc.M109.039925
Pauken, C. (2000). The Expression and Stage-Specific Localization of Protein Kinase C
Isotypes during Mouse Preimplantation Development. Developmental Biology,
223(2), 411–421. doi:10.1006/dbio.2000.9763
Pauken, C. M., & Capco, D. G. (1999). Regulation of cell adhesion during embryonic
compaction of mammalian embryos: roles for PKC and beta-catenin. Molecular
Reproduction and Development, 54(2), 135–144. doi:10.1002/
(SICI)1098-2795(199910)54:2<135::AID-MRD5>3.0.CO;2-A
Pellettieri, J., & Seydoux, G. (2002). Anterior-Posterior Polarity in C. elegans and
Drosophila--PARallels and Differences. Science.
Perander, M. (2000). Nuclear Import and Export Signals Enable Rapid Nucleocytoplasmic
Shuttling of the Atypical Protein Kinase C lambda. Journal of Biological Chemistry,
276(16), 13015–13024. doi:10.1074/jbc.M010356200
Plant, P. J., Fawcett, J. P., Lin, D. C. C., Holdorf, A. D., Binns, K., Kulkarni, S., & Pawson,
T. (2003). A polarity complex of mPar-6 and atypical PKC binds, phosphorylates and
regulates mammalian Lgl. Nature Cell Biology, 5(4), 301–308. doi:10.1038/ncb948
Pollard, V. W., Michael, W. M., Nakielny, S., Siomi, M. C., Wang, F., & Dreyfuss, G. (1996).
A novel receptor-mediated nuclear protein import pathway. Cell, 86(6), 985–994.
Powell, C. T., Gschwend, J. E., Fair, W. R., Brittis, N. J., Stec, D., & Huryk, R. (1996).
Overexpression of Protein Kinase C-zeta (PKC-ζ) Inhibits Invasive and Metastatic
Abilities of Dunning R-3327 MAT-LyLu Rat Prostate Cancer Cells. Cancer
Research.
Pu, Y., Peach, M. L., Garfield, S. H., Wincovitch, S., Marquez, V. E., & Blumberg, P. M.
(2006). Effects on Ligand Interaction and Membrane Translocation of the Positively
Charged Arginine Residues Situated along the C1 Domain Binding Cleft in the
77
77
Atypical Protein Kinase C Isoforms. Journal of Biological Chemistry, 281(44),
33773–33788. doi:10.1074/jbc.M606560200
Puls, A., Schmidt, S., Grawe, F., & Stabel, S. (1997). Interaction of protein kinase C zeta
with ZIP, a novel protein kinase C-binding protein. Proceedings of the National
Academy of Sciences, 94(12), 6191–6196.
Qi, Y., Liu, J., Wu, X., Brakebusch, C., Leitges, M., Han, Y., et al. (2011). Cdc42 controls
vascular network assembly through protein kinase Cι during embryonic
vasculogenesis. Arteriosclerosis, Thrombosis, and Vascular Biology, 31(8), 1861–
1870. doi:10.1161/ATVBAHA.111.230144
Quest, A. F., & Bell, R. M. (1994). The regulatory region of protein kinase C gamma.
Studies of phorbol ester binding to individual and combined functional segments
expressed as glutathione S-transferase fusion proteins indicate a complex
mechanism of regulation by phospholipids, phorbol esters, and divalent cations.
The Journal of Biological Chemistry, 269(31), 20000–20012.
Raz, T., Eliyahu, E., Yesodi, V., & Shalgi, R. (1998). Profile of protein kinase C isozymes
and their possible role in mammalian egg activation. FEBS Letters, 431(3), 415–
418.
Rebane, A., Aab, A., & Steitz, J. A. (2004). Transportins 1 and 2 are redundant nuclear
import factors for hnRNP A1 and HuR. RNA (New York, N.Y.), 10(4), 590–599.
Regala, R. P., Davis, R. K., Kunz, A., Khoor, A., Leitges, M., & Fields, A. P. (2009). Atypical
protein kinase C{iota} is required for bronchioalveolar stem cell expansion and lung
tumorigenesis. Cancer Research, 69(19), 7603–7611. doi:
10.1158/0008-5472.CAN-09-2066
Roepstorff, K., Grandal, M. V., Henriksen, L., Knudsen, S. L. J., Lerdrup, M., Grøvdal, L.,
et al. (2009). Differential Effects of EGFR Ligands on Endocytic Sorting of the
78
78
Receptor. Traffic (Copenhagen, Denmark), 10(8), 1115–1127. doi:10.1111/j.
1600-0854.2009.00943.x
Rybin, V. O., Guo, J., Gertsberg, Z., Elouardighi, H., & Steinberg, S. F. (2007). Protein
kinase Cepsilon (PKCepsilon) and Src control PKCdelta activation loop
phosphorylation in cardiomyocytes. The Journal of Biological Chemistry, 282(32),
23631–23638. doi:10.1074/jbc.M701676200
Saitou, M., Fujimoto, K., Doi, Y., Itoh, M., Fujimoto, T., Furuse, M., et al. (1998). Occludindeficient embryonic stem cells can differentiate into polarized epithelial cells bearing
tight junctions. The Journal of Cell Biology, 141(2), 397–408.
Sakakibara, A., Furuse, M., Saitou, M., Ando-Akatsuka, Y., & Tsukita, S. (1997). Possible
involvement of phosphorylation of occludin in tight junction formation. The Journal
of Cell Biology, 137(6), 1393–1401.
Samuels, I. S., Seibenhener, M. L., Neidigh, K. B. W., & Wooten, M. W. (2001). Nerve
growth factor stimulates the interaction of ZIP/p62 with atypical protein kinase C
and targets endosomal localization: Evidence for regulation of nerve growth factorinduced differentiation. Journal of Cellular Biochemistry, 82(3), 452–466. doi:
10.1002/jcb.1177
Sanchez, P., De Carcer, G., Sandoval, I. V., Moscat, J., & Diaz-Meco, M. T. (1998).
Localization of atypical protein kinase C isoforms into lysosome-targeted
endosomes through interaction with p62. Molecular and Cellular Biology, 18(5),
3069–3080.
Sanz, L. (1999). The interaction of p62 with RIP links the atypical PKCs to NF-kappa B
activation. The EMBO Journal, 18(11), 3044–3053. doi:10.1093/emboj/18.11.3044
Sanz, L. (2000). The atypical PKC-interacting protein p62 channels NF-kappa B activation
by the IL-1-TRAF6 pathway. The EMBO Journal, 19(7), 1576–1586. doi:10.1093/
emboj/19.7.1576
79
79
Sato, T. (2005). Regulation of the Assembly and Adhesion Activity of E-cadherin by Nectin
and Afadin for the Formation of Adherens Junctions in Madin-Darby Canine Kidney
Cells. The Journal of Biological Chemistry, 281(8), 5288–5299. doi:10.1074/
jbc.M510070200
Sánchez-Bautista, S., Marín-Vicente, C., Gómez-Fernández, J. C., & Corbalán-García, S.
(2006). The C2 domain of PKCalpha is a Ca2+ -dependent PtdIns(4,5)P2 sensing
domain: a new insight into an old pathway. Journal of Molecular Biology, 362(5),
901–914. doi:10.1016/j.jmb.2006.07.093
Schaeffer, E., Smith, D., Mardon, G., Quinn, W., & Zuker, C. (1989). Isolation and
characterization of two new drosophila protein kinase C genes, including one
specifically expressed in photoreceptor cells. Cell, 57(3), 403–412.
Seibel, N. M., Eljouni, J., Nalaskowski, M. M., & Hampe, W. (2007). Nuclear localization of
enhanced green fluorescent protein homomultimers. Analytical Biochemistry,
368(1), 95–99. doi:10.1016/j.ab.2007.05.025
Seifert, K., Ibrahim, H., Stodtmeister, T., Winklbauer, R., & Niessen, C. M. (n.d.). An
adhesion-independent, aPKC-dependent function for cadherins in morphogenetic
movements. Jcs.Biologists.org.
Selbie, L. A., Schmitz-Peiffer, C., Sheng, Y., & Biden, T. J. (1993). Molecular cloning and
characterization of PKC iota, an atypical isoform of protein kinase C derived from
insulin-secreting cells. The Journal of Biological Chemistry, 268(32), 24296–24302.
Smith, C. A., Lau, K. M., Rahmani, Z., Dho, S. E., Brothers, G., She, Y. M., et al. (2007).
aPKC-mediated phosphorylation regulates asymmetric membrane localization of
the cell fate determinant Numb. The EMBO Journal, 26(2), 468–480. doi:10.1038/
sj.emboj.7601495
80
80
Smith, L. (2000). Activation of Atypical Protein Kinase C zeta by Caspase Processing and
Degradation by the Ubiquitin-Proteasome System. Journal of Biological Chemistry,
275(51), 40620–40627. doi:10.1074/jbc.M908517199
Smith, L. (2002). Lack of Constitutive Activity of the Free Kinase Domain of Protein Kinase
C zeta . DEPENDENCE ON TRANSPHOSPHORYLATION OF THE ACTIVATION
LOOP. Journal of Biological Chemistry, 277(48), 45866–45873. doi:10.1074/
jbc.M206420200
Soloff, R. S., Katayama, C., Lin, M. Y., Feramisco, J. R., & Hedrick, S. M. (2004). Targeted
deletion of protein kinase C lambda reveals a distribution of functions between the
two atypical protein kinase C isoforms. Journal of Immunology (Baltimore, Md. :
1950), 173(5), 3250–3260.
Sossin, W. S., & Schwartz, J. H. (1993). Ca(2+)-independent protein kinase Cs contain an
amino-terminal domain similar to the C2 consensus sequence. Trends in
Biochemical Sciences, 18(6), 207–208.
Stade, K., Ford, C. S., Guthrie, C., & Weis, K. (1997). Exportin 1 (Crm1p) is an essential
nuclear export factor. Cell, 90(6), 1041–1050.
Sumandea, M. P., Rybin, V. O., Hinken, A. C., Wang, C., Kobayashi, T., Harleton, E., et al.
(2008). Tyrosine phosphorylation modifies protein kinase C delta-dependent
phosphorylation of cardiac troponin I. The Journal of Biological Chemistry, 283(33),
22680–22689. doi:10.1074/jbc.M802396200
Suzuki, A., Ishiyama, C., Hashiba, K., Shimizu, M., Ebnet, K., & Ohno, S. (2002). aPKC
kinase activity is required for the asymmetric differentiation of the premature
junctional complex during epithelial cell polarization. Journal of Cell Science, 115(Pt
18), 3565–3573.
Suzuki, A., Yamanaka, T., Hirose, T., Manabe, N., Mizuno, K., Shimizu, M., et al. (2001).
Atypical protein kinase C is involved in the evolutionarily conserved par protein
81
81
complex and plays a critical role in establishing epithelia-specific junctional
structures. The Journal of Cell Biology, 152(6), 1183–1196.
Tabuse, Y., Izumi, Y., Piano, F., Kemphues, K. J., Miwa, J., & Ohno, S. (1998). Atypical
protein kinase C cooperates with PAR-3 to establish embryonic polarity in
Caenorhabditis elegans. Development, 125(18), 3607–3614.
Takai, Y., Kishimoto, A., Inoue, M., & Nishizuka, Y. (1977). Studies on a cyclic nucleotideindependent protein kinase and its proenzyme in mammalian tissues. I. Purification
and characterization of an active enzyme from bovine cerebellum. The Journal of
Biological Chemistry, 252(21), 7603–7609.
Tao, R.-H., & Maruyama, I. N. (2008). All EGF(ErbB) receptors have preformed homo- and
heterodimeric structures in living cells. Journal of Cell Science, 121(Pt 19), 3207–
3217. doi:10.1242/jcs.033399
Tarkowski, A. K., & Wróblewska, J. (1967). Development of blastomeres of mouse eggs
isolated at the 4- and 8-cell stage. Journal of Embryology and ….
Toker, A., Meyer, M., Reddy, K. K., Falck, J. R., Aneja, R., Aneja, S., et al. (1994).
Activation of protein kinase C family members by the novel polyphosphoinositides
PtdIns-3,4-P2 and PtdIns-3,4,5-P3. Journal of Biological ….
Traweger, A., Wiggin, G., Taylor, L., Tate, S. A., Metalnikov, P., & Pawson, T. (2008).
Protein phosphatase 1 regulates the phosphorylation state of the polarity scaffold
Par-3. Proceedings of the National Academy of Sciences of the United States of
America, 105(30), 10402–10407. doi:10.1073/pnas.0804102105
Tunggal, J. A., Helfrich, I., Schmitz, A., Schwarz, H., Günzel, D., Fromm, M., et al. (2005).
E-cadherin is essential for in vivo epidermal barrier function by regulating tight
junctions. The EMBO Journal, 24(6), 1146–1156. doi:10.1038/sj.emboj.7600605
82
82
Umar, S., Sellin, J. H., & Morris, A. P. (2000). Increased nuclear translocation of
catalytically active PKC-zeta during mouse colonocyte hyperproliferation. American
Journal of Physiology-Gastrointestinal and Liver Physiology, 279(1), G223–37.
Umeda, K. (2004). Establishment and Characterization of Cultured Epithelial Cells Lacking
Expression of ZO-1. The Journal of Biological Chemistry, 279(43), 44785–44794.
doi:10.1074/jbc.M406563200
Vinot, S., Le, T., Ohno, S., Pawson, T., Maro, B., & Louvet-Vallée, S. (2005). Asymmetric
distribution of PAR proteins in the mouse embryo begins at the 8-cell stage during
compaction. Developmental Biology, 282(2), 307–319. doi:10.1016/j.ydbio.
2005.03.001
Wald, F. A., Oriolo, A. S., Mashukova, A., Fregien, N. L., Langshaw, A. H., & Salas, P. J. I.
(2008). Atypical protein kinase C (iota) activates ezrin in the apical domain of
intestinal epithelial cells. Journal of Cell Science, 121(5), 644–654. doi:10.1242/jcs.
016246
Wang, C., Shang, Y., Yu, J., & Zhang, M. (2012). Substrate Recognition Mechanism of
Atypical Protein Kinase Cs Revealed by the Structure of PKCι in Complex with a
Substrate Peptide from Par-3. Structure (London, England : 1993), 20(5), 791–801.
doi:10.1016/j.str.2012.02.022
Wataru Ikeda, H. N. J. M. K. M. H. I. M. T. A. T. K. T. H. N. H. Y. A. M. S.-I. N. Y. T. (1999).
Afadin: A Key Molecule Essential for Structural Organization of Cell–Cell Junctions
of Polarized Epithelia during Embryogenesis. The Journal of Cell Biology, 146(5),
1117.
Watkins, J. L., Lewandowski, K. T., Meek, S. E. M., Storz, P., Toker, A., & Piwnica-Worms,
H. (2008). Phosphorylation of the Par-1 polarity kinase by protein kinase D
regulates 14-3-3 binding and membrane association. Proceedings of the National
83
83
Academy of Sciences of the United States of America, 105(47), 18378–18383. doi:
10.1073/pnas.0809661105
Watts, J. L., Etemad-Moghadam, B., Guo, S., Boyd, L., Draper, B. W., Mello, C. C., et al.
(1996). par-6, a gene involved in the establishment of asymmetry in early C.
elegans embryos, mediates the asymmetric localization of PAR-3. Development,
122(10), 3133–3140.
Waugh, C., Sinclair, L., Finlay, D., Bayascas, J. R., & Cantrell, D. (2009). Phosphoinositide
(3,4,5)-triphosphate binding to phosphoinositide-dependent kinase 1 regulates a
protein kinase B/Akt signaling threshold that dictates T-cell migration, not
proliferation. Molecular and Cellular Biology, 29(21), 5952–5962. doi:10.1128/MCB.
00585-09
Welchman, D. P., Mathies, L. D., & Ahringer, J. (2007). Similar requirements for CDC-42
and the PAR-3/PAR-6/PKC-3 complex in diverse cell types. Developmental Biology,
305(1), 347–357. doi:10.1016/j.ydbio.2007.02.022
White, W. O., Seibenhener, M. L., & Wooten, M. W. (2002). Phosphorylation of tyrosine
256 facilitates nuclear import of atypical protein kinase C. Journal of Cellular
Biochemistry, 85(1), 42–53. doi:10.1002/jcb.10101
Wilson, M. I., Gill, D. J., Perisic, O., Quinn, M. T., & Williams, R. L. (2003). PB1 domainmediated heterodimerization in NADPH oxidase and signaling complexes of
atypical protein kinase C with Par6 and p62. Molecular Cell, 12(1), 39–50.
Wodarz, A., Ramrath, A., Grimm, A., & Knust, E. (2000). Drosophila atypical protein kinase
C associates with Bazooka and controls polarity of epithelia and neuroblasts. The
Journal of Cell Biology, 150(6), 1361–1374.
Wong, V. (1997). Phosphorylation of occludin correlates with occludin localization and
function at the tight junction. The American Journal of Physiology, 273(6 Pt 1),
C1859–67.
84
84
Wooten, M. W., Zhou, G., Wooten, M. C., & Seibenhener, M. L. (1997). Transport of
protein kinase C isoforms to the nucleus of PC12 cells by nerve growth factor:
association of atypical zeta-PKC with the nuclear matrix. Journal of Neuroscience
Research, 49(4), 393–403. doi:10.1002/(SICI)1097-4547(19970815)49:4<393::AIDJNR1>3.0.CO;2-3
Wu, S. L. (1998). Structure, Expression, and Properties of an Atypical Protein Kinase C
(PKC3) from Caenorhabditis elegans. PKC3 IS REQUIRED FOR THE NORMAL
PROGRESSION OF EMBRYOGENESIS AND VIABILITY OF THE ORGANISM.
Journal of Biological Chemistry, 273(2), 1130–1143. doi:10.1074/jbc.273.2.1130
Wu, X., Li, S., Chrostek-Grashoff, A., Czuchra, A., Meyer, H., Yurchenco, P. D., &
Brakebusch, C. (2007). Cdc42 is crucial for the establishment of epithelial polarity
during early mammalian development. Developmental Dynamics, 236(10), 2767–
2778. doi:10.1002/dvdy.21309
Xu, J., Kausalya, P. J., Phua, D. C. Y., Ali, S. M., Hossain, Z., & Hunziker, W. (2008). Early
embryonic lethality of mice lacking ZO-2, but Not ZO-3, reveals critical and
nonredundant roles for individual zonula occludens proteins in mammalian
development. Molecular and Cellular Biology, 28(5), 1669–1678.
YAMANAKA, T., Horikoshi, Y., Izumi, N., Suzuki, A., Mizuno, K., & Ohno, S. (2006). Lgl
mediates apical domain disassembly by suppressing the PAR-3-aPKC-PAR-6
complex to orient apical membrane polarity. Journal of Cell Science, 119(Pt 10),
2107–2118. doi:10.1242/jcs.02938
YAMANAKA, T., Horikoshi, Y., Sugiyama, Y., Ishiyama, C., Suzuki, A., Hirose, T., et al.
(2003). Mammalian Lgl forms a protein complex with PAR-6 and aPKC
independently of PAR-3 to regulate epithelial cell polarity. Current Biology : CB,
13(9), 734–743.
85
85
Yamanaka, T., Horikoshi, Y., Suzuki, A., Sugiyama, Y., Kitamura, K., Maniwa, R., et al.
(2001). PAR-6 regulates aPKC activity in a novel way and mediates cell-cell
contact-induced formation of the epithelial junctional complex. Genes to Cells :
Devoted to Molecular & Cellular Mechanisms, 6(8), 721–731.
Zaczek, A., Brandt, B., & Bielawski, K. P. (2005). The diverse signaling network of EGFR,
HER2, HER3 and HER4 tyrosine kinase receptors and the consequences for
therapeutic approaches. Histology and Histopathology, 20(3), 1005–1015.
Zhou, G. (1997). Nucleolin Is a Protein Kinase C-zeta Substrate. CONNECTION
BETWEEN CELL SURFACE SIGNALING AND NUCLEUS IN PC12 CELLS.
Journal of Biological Chemistry, 272(49), 31130–31137. doi:10.1074/jbc.
272.49.31130
Zingg, H. H. (1996). Vasopressin and oxytocin receptors. Baillière's Clinical Endocrinology
and Metabolism, 10(1), 75–96. doi:10.1016/S0950-351X(96)80314-4
86
86
I
Research Article
1
Functional comparison of protein domains within
aPKCs involved in nucleocytoplasmic shuttling
Sebastian Seidl, Ursula B. Braun and Michael Leitges*
Biotechnology Centre of Oslo, University of Oslo, NO-0349, Oslo, Norway
*Author for correspondence ([email protected])
Biology Open
Biology Open 000, 1–10
doi: 10.1242/bio.2012505
Summary
The atypical protein kinases C (PKC) isoforms i and f play
crucial roles in regulation of signaling pathways related to
proliferation, differentiation and cell survival. Over the years
several interaction partners and phosphorylation targets have
been identified. However, little is known about the regulation
of atypical aPKC isoforms. To address this question, we
performed a comparative analysis of atypical aPKCi/l and f
in MDCK cells. By using green fluorescence protein (GFP)
fusion proteins containing the full-length or truncated
proteins, we were able to recognize differences in
subcellular localization and nucleocytoplasmic shuttling of
both isoforms. We show, that an earlier described nuclear
localization sequence (NLS), plays a role in the regulation of
atypical aPKCf but not in aPKCi, despite the fact that it is
present in both isoforms. Leptomycin B treatment induces
accumulation of GFP-fusion protein of both isoforms in the
nucleus. Regardless, the loss of the NLS only decreases
shuttling of aPKCf, while aPKCi remains unaffected. In
Introduction
Signal transduction is an essential process that enables the cell to
interpret incoming signals and interact with the surrounding
environment. Many different signaling pathways and a wide
variety of mechanisms are utilized to accomplish this translation.
Kinase activation is a very common mechanism that alone can
amplify the incoming signal through the phosphorylation of
specific substrates. Kinase substrates are often themselves
kinases.
Protein Kinase C (PKC) represents a serine/threonine kinase
gene family that has often been described as having a major role
in signal transduction events. Nine PKC members have been
described in mammals which are divided into three subgroups
based on their biochemical properties and sequence homology:
Classical PKCs (a, b and c), novel PKCs (d, e, h and g) and
atypical PKCs (f and i/l). Classical and novel PKCs have been
found to bind and be activated by tumor-promoting phorbol
esters (TPA) which has connected at least some of their
physiological in vivo functions to the promotion of cancer.
Atypical PKCs were the last to be identified and characterized.
Remarkably, early findings showed that both aPKC isoforms are
unresponsive to TPA and are also activated independently of
calcium and diacylglycerin under normal cell conditions. Thus
aPKCs represent a PKC subgroup that is clearly separated from
the rest by its mode of activation. Both atypical PKC isoforms
have been found to be regulated through their cysteine-rich C1
addition, we identified the hinge region as a potential
regulator of localization of atypical PKCs. With a set of
chimeric proteins we show that the hinge region of aPKCi
mediates nuclear localization. In contrast, the hinge region of
aPKCf causes exclusion from the nucleus, indicating two
different mechanisms leading to isoform specific regulation.
Taken together, we show for the first time, that the atypical
isoforms aPKCi and f underly different mechanisms
regarding their regulation of subcellular localization and
translocation into the nucleus in MDCK cells.
ß 2012. Published by The Company of Biologists Ltd. This is
an Open Access article distributed under the terms of the
Creative Commons Attribution Non-Commercial Share Alike
License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Key words: GFP-fusion protein, HINGE domain, NLS, Atypical
Protein kinase C, Nuclear translocation, Nucleocytoplasmic shuttling
domain by Par-4 activation (Dı́az-Meco et al., 1996) and through
their Phox/Bem1 (PB1) domain by interaction with p62 and
PAR-6 (Puls et al., 1997; Joberty et al., 2000; Sánchez et al.,
1998). Another striking point within the aPKC subgroup is the
high content of homologous amino acids between them (72%
overall) (Akimoto et al., 1994) which limits the availability of
isoform-specific tools. Thus it remains difficult to biochemically
analyze and distinguish between the two aPKC isoforms. In
addition, many overexpression studies have so far failed to assign
functional differences to PKCf and PKCi/l (Diaz-Meco and
Moscat, 2001; Uberall et al., 1999).
Nevertheless recent attempts utilizing the gene targeting
approach in mice have revealed that highly specific in vivo
functions exist for both aPKCs. For example, the phenotypical
analysis of the PKCf deficient mouse line lead to the
identification of impairment of the NFkB signalling pathway
(Leitges et al., 2001) as well as changes in IL-4 and IL-6
signaling (Martin et al., 2002; Galvez et al., 2009). A
conventional knock-out of PKCi/l revealed a fundamental role
for this kinase during embryonic development (Bandyopadhyay
et al., 2004; Soloff et al., 2004; unpublished data). Tissue specific
knockouts of this isoform have also shown the importance of
PKC i/l in the adult organism (Farese et al., 2007; Huber et al.,
2009; Murray et al., 2009; Yang et al., 2009).
Whereas the embryonic lethal phenotype of PKCi/l could be
partly explained by the lack of PKCf expression at the defined
Nucleocytoplasmic shuttling PKCs
time of development (Kovac et al., 2007) all other described
phenotypes of both aPKC knockouts take place with the
existence of the alternate aPKC isoform. Thus these in vivo
findings clearly imply that both aPKCs have an isoform-specific,
non-redundant function in the cell, even when co-expressed. How
these specificities are regulated remains largely unclear. Since
specific localization of PKCs within a cell is believed to be one
way of controlling specificity (Rosse et al., 2010) we decided to
screen for domains within both aPKCs which are able to direct
localization and are different between the two isoforms.
Results
Biology Open
1. Generation of truncated aPKC/GFP fusion proteins.
We have used truncated aPKC proteins fused with a GFP tag to
follow and identify domains that confer aPKC isoform specific
translocation ability. Except for the full length constructs of both
isoforms, we have generated mutant constructs that focus on
changes in the N-terminal regulatory region of the proteins and
have a truncated C-terminal, thus they are missing the kinase
domain. Although we cannot say that translocation sequences do
not exist in the C-terminal kinase region, we expected to see
more changes in translocation potential upon alteration of the Nterminal regulatory region. Thus we initially generated the
following for both isoforms: the GFP labeled full length
construct; an (aPKCDcatalytic) construct missing the whole
kinase domain including a nuclear export sequence (NES); an
N-terminal version (aPKC AA1-176(177*)) including the PB1
(Phox and Bem1) and a C1 (cystein-rich) domain but excluding
the hinge region. We further generated a construct consisting of
the hinge region alone (aPKCHINGE) (Fig. 1A). All fusion
proteins have been tested for expression and stability of the
protein in MDCK cells via western blot (supplementary material
Fig. S1).
2
2. Isoform-specific domains cause different
subcellular localization.
To test whether the truncation mutants are able to identify
domains within aPKCs which convey isoform-specific
localization we overexpressed each construct in MDCK cells.
Both full length constructs showed a widely distributed diffuse
GFP signal over the whole cell without prominent membrane
localization. There was a slightly increased PKCi nuclear
localization when compared to aPKCf full length (Fig. 2A,B).
Deletion of the C-terminal kinase domain changed the
distribution. The aPKCiDcatalytic fusion protein localized
exclusively in the nucleus with a regional concentration of the
GFP signal within the nucleolus (Fig. 2C). In sharp contrast the
corresponding truncated PKCfDcatalytic construct showed an
almost exclusive and very strong membrane signal (Fig. 2D)
which resembled that associated with the role of aPKC in
polarity.
We proceeded by testing N-terminal truncations missing the
hinge region (aPKCAA1-176(177)) and found there was a reversion
back to a similar localization pattern between the two isoforms
(Fig. 2E,F). However, in contrast to the full length proteins, both
truncated versions located to the nucleus with a distinct punctate
pattern. This pattern was different to that seen with the
aPKCiDcatalytic form.
Based on these results further investigation focused on the
hinge region alone was merited. Analysis of the aPKCiHINGE
construct showed a dominant localization to the nucleus as well
as a diffuse weak staining in the cytoplasm (Fig. 2G). The
corresponding PKCfHINGE construct showed cytoplasmic
staining with some aggregates surrounding the nucleus, no
membrane staining, and most significantly, an exclusion from the
nucleus (Fig. 2H).
Taken together these results identified first that the hinge
region of both aPKCs harbors information important for
subcellular localization and second that the N-terminal causes
localization to the nucleus and does not need the hinge region for
this localization to occur.
3. Functional investigation of aPKC nuclear localization
sequence (NLS).
Fig. 1. Schematic presentation of GFP-fusion proteins. Domain
organization of atypical PKC and the constructs generated to test the
localization of truncated atypical PKC proteins. All proteins were expressed as
a GFP fusion protein with a C-terminal tag.
Given the fact that nuclear localization of aPKC represents a new
area of research in aPKC in vivo function, we decided to
investigate the underlying mechanism. A functional nuclear
localization sequence (NLS) located within the C1 domain had
been defined in both aPKCs (Perander et al., 2001). To evaluate
whether this motif drives the PKCiAA1-177 fragment into the
nucleus within our experimental context we mutated the amino
acid sequence AKRNFRR to AKRNFEE in order to generate a
nonfunctional NLS. Upon transfection with this construct in
MDCK cells we were not able to detect any difference to that
found with the parental construct (data not shown). These
findings suggested that the N-terminal PKCiAA1-177 fragment
translocates into the nucleus in an NLS independent manner
through a different mechanism and we assumed that this was also
true for the N-terminal PKCfAA1-176 fragment.
We next asked whether the NLS could have an impact on the
kinetics of nuclear translocation of both aPKCs. Differences in
the nuclear translocation kinetics among aPKCs had been earlier
discussed by others (Perander et al., 2001). Based on the finding
that N-terminal constructs localize to the nucleus we next worked
with full length constructs for both aPKCs in order to analyze the
3
Biology Open
Nucleocytoplasmic shuttling PKCs
Fig. 2. Differences in sub-cellular localization of truncated aPKC protein. MDCK cells were transfected with different aPKCi (A,C,E,G) or aPKCf fusion
proteins (B,D,F,H). The insert shows magnification of the marked area (square) in the overview. Visualization of the nucleus was achieved by DAPI staining.
Membrane staining was performed using Alexa FluorH 647 conjugated wheat-germ agglutinin (WGA). All pictures were taken with the ZEISS LSM 520 microscope.
The areas representing the cytosolic fraction or nuclear fraction are indicated with bars at the top of each histogram. The histogram analysis was performed with the
‘profile tool’ in the LSM MetaH software. The analyzed area is indicated by the yellow straight line in the overview. Scale bar: 50 mm (overview), 10 mm (insert). All
experiments were performed in triplicates.
translocation kinetics upon Leptomycin B (LMB) treatment.
Treatment with LMB effectively blocks all nuclear export related
to CRM1/Exportin and represents an established method to study
nucleo-cytoplasmic shuttling (Lischka et al., 2001; Kudo et al.,
1998).
When comparing mouse aPKC cDNA sequences we
observed that aPKCf contains a G to R exchange at position
141(AKRFNRG; supplementary material Fig. S3). This sequence
variation in the NLS had been described to affect the binding of
importin a/b and subsequently affect the nuclear translocation
Nucleocytoplasmic shuttling PKCs
kinetics since the AKRNFRR motif containing three arginine’s
(as found in PKCi) enables a direct binding of importin b instead
of a sequential binding of importin a followed by importin b
(Palmeri and Malim, 1999). Thus we first analyzed the
translocation behavior of both full length aPKC-GFP fusion
constructs by measuring the GFP signal ratio between the cytosol
and the nucleus. Both aPKCs accumulated in the nucleus upon
LMB treatment but it was clear that PKCi accumulated faster and
attained a higher level after 6 hours of treatment (Fig. 3).
We next introduced a construct with an R to G mutation at
position 142 in PKCi which mimics a PKCf NLS. We found that
the kinetics of nuclear accumulation upon LMB treatment did not
change at all with this construct, which was opposite to our
expectations. We then generated a R141/142E mutation in the
PKCi/GFP full length construct thereby destroying the NLS
motif. The subsequent analysis of this mutant (aPKCi R141/
142E) again revealed no significant change in the nuclear
translocation behavior of PKCi thus the NLS present in aPKCi
appears to be nonfunctional in the context we tested here.
4
We then concentrated on PKCf, first generating a mutant of
the full length construct which mimics the PKCi situation
(aPKCf G141R). As indicated in Fig. 3, this conversion lead to a
faster increase and higher amount of the nuclear signal after
2 hours with no significant change after 6 hours, thus resembling
the aPKCi wildtype situation. Next we analyzed the aPKCf
R140E/G141E mutant representing a NLS deficient aPKCf
variant. In this case we were able to detect a significant
decrease of the nuclear fraction after 2 and 6 hours LMB
treatment implying that the NLS in PKCf is functionally
involved in the nuclear transport of this aPKC. Nevertheless it
was also clear that even in the NLS deficient situation a smaller
fraction is translocated to the nucleus suggesting that beside the
NLS driven transport other nuclear transport mechanism(s) exist
which aid in the localization of PKCf to the nucleus (Fig. 3).
Taken together the mutational analysis of the NLS of both
aPKCs revealed that PKCi can translocate to the nucleus
independent of its NLS whereas PKCf’s nuclear translocation
is mainly regulated by its NLS. In addition we observed that the
sequence variant we identified in mouse for PKCf slows the
translocation kinetics and also that PKCf retains a nuclear
translocation capacity that is independent of the NLS.
Biology Open
4. Mutations within the PB1 domain alter the subcellular
localization of both aPKCs.
Fig. 3. Nucleocytoplasmic shuttling is dependent on the NLS in the case of
aPKC f but not aPKC i. MDCK cells either expressing full-length aPKC
wild-type protein of aPKCi (left panel) or aPKCf (right panel) or the indicated
mutation within the NLS of both isoforms. The cells were left untreated in
normal medium for 18 hours after transfection with Lipofectamin. Afterwards,
the cells were treated with 4 ng/ml Leptomycin B in normal growth medium for
either 2 or 6 hours and fixed afterwards with 4% paraformaldehyde. Analysis
was done by using the Zeiss LSM 510 confocal microscope. Calculation of
ratios between nuclear signal and cytoplasmic signal were performed as
described in the methods section. n540, *P,0.05. All experiments were
performed in triplicates.
Having established that the generation of a NLS deficient Nterminal PKCiAA1-177 fragment does not abolish its nuclear
localization we decided to investigate the possibility of other
nuclear translocation domains existing within this fragment.
Besides the C1 domain which includes the discussed NLS,
another protein-protein interacting domain has been described in
the N-terminus of both aPKCs; the Phox/Bem1 (PB1) domain.
Several PB1 aPKC interacting proteins have been identified e.g.
Par6 and p62 (Joberty et al., 2000; Hirano et al., 2004). Of
particular interest in this context is a recent report describing the
translocation of Par6 to the nucleus via an internal NLS (Cline
and Nelson, 2007). Thus we hypothesized that aPKCs may be
translocated to the nucleus through a ‘‘hitchhiking’’ mechanism
by their binding to PB1 containing proteins, like Par6. To verify
this hypothesis we first introduced a D63A mutation in the
PKCiAA1-177 fragment. This D-A mutation has been shown by
Hirano to disrupt interaction between the aPKC PB1 domain and
the PB1 domain of Par6 and p62 (Hirano et al., 2004; Hirano et
al., 2005). However, the abolishment of a functional PB1 domain
did not prevent a nuclear translocation of this construct
(Fig. 4A,B). In addition, the corresponding D62A mutation in
the PKCfAA1-176 fragment reflected the same outcome
(Fig. 4C,D). Thus we assumed that in both atypical PKC Nterminal fragments either a cryptic NLS or another sequence
motif existed that was responsible for the observed nuclear
localization.
We then focused attention on the analysis of the full length
protein fusions to investigate the consequence of a PB1 mutation
in aPKC nuclear localization in this context. Thus we introduced
the D63A or D62A mutations respectively in each full length
aPKC construct which we subsequently analyzed in an LMB
experiment.
In order to verify the functionality of the introduced mutation
we first checked whether the PB1 mutation caused a loss of
membrane association due to the protein’s inability to form the
polarity complex with Par6/aPKC/Par3 (Lin et al., 2000; Wodarz
Nucleocytoplasmic shuttling PKCs
5
Biology Open
subcellular localization of these constructs we observed that both
aPKC isoforms harboring the D to A mutation showed a
significant increase in the pool of nuclear located fusion
protein in the non-LMB treated samples (Fig. 4E,F, control
values).
With regard to PKCf, LMB treatment caused a similar kinetic
rate of nuclear accumulation for both wild type and mutated
constructs whereby the D62A mutant translocation started at a
significantly higher level, but both reached maximum
accumulation levels after 4 hours of LMB treatment (Fig. 4F).
In contrast, PKCi gave a different picture of nuclear
accumulation. Whereas the wild type construct increased its
amount in the nucleus constantly over the 6 hour time line, the
D63A mutation of PKCi increased its nuclear level only slightly
(but significantly) within the first 2 hours. We were unable to
detect any further significant increase of the mutant construct in
the nucleus beyond this time-point (Fig. 4E).
Taken together we have shown that the PB1 domain within
both aPKCs is not involved in the nuclear translocation of the Nterminal constructs used here indicating the existence of an
alternate nuclear translocation mechanism for these two fusion
proteins. However, this analysis also revealed that in the context
of the full length protein, the PB1 domain does influence the
localization of aPKCs in an isoform specific manner: whereas
PKCf appears to translocate into the nucleus independent of its
PB1 domain, PKCi translocation seemed unable to proceed
beyond a certain level of nuclear content (reached at 2 hours after
addition of LMB) implying that at least a fraction of the
transported GFP fusion protein depends on a functional PB1
domain.
5. Atypical PKCs hinge region mediates different localization of
aPKCi and aPKCf.
Fig. 4. The PB1 domain of atypical PKCs influences localization of both
atypical isoforms. MDCK cells were either transfected with a construct
expressing the regulatory domain of aPKCi (A) or aPKCf (C) wildtype, or
corresponding mutant proteins (B,D). Cells were tranfected with
Lipofectaminß and left untreated for 18 hours before preparation for imaging
analysis. Visualization of the nucleus was achieved by DAPI staining. Analysis
was done by using the Zeiss LSM 510 confocal microscope. Scale bar: 10 mm.
(E,F) MDCK cells either expressing full-length aPKC wild-type protein or fulllength protein containing a PB1 mutation of aPKCi (E) or aPKCf (F). Eighteen
hours after transfection cells were treated with 4 ng/ml leptomycin B in normal
growth medium for 2, 4 and 6 hours before preparation for imaging analysis.
Calculation of ratios between nuclear signal and cytoplasmic signal were
performed as described in the methods section. n540, *P,0.05. All
experiments were performed in triplicates.
et al., 2000; Joberty et al., 2000). In fact, we observed a clear
decrease of GFP membrane signal in both constructs, indicating
the introduced mutation was functionally significant
(supplementary material Fig. S2). Upon further analysis of the
Our initial screen revealed that the hinge region of both aPKCs
appeared to be involved in the unique sub-cellular localization of
each isoform (Fig. 2). To further elucidate these findings we
generated mutants with exchanged hinge regions that either
harbored the aPKCi specific hinge sequence within the aPKCf
specific background or vice versa (Fig. 1B). Upon transfection of
the N-terminal chimeric aPKCiN-fHINGE/GFP fusion protein into
MDCK cells it became apparent that the aPKCf specific hinge
sequence is able to keep the aPKCi protein outside of the nucleus
(Fig. 5A,C). Interestingly this chimeric fusion protein did not
reflect the same pattern as the aPKCfDcatalytic with regard to
membrane staining (compare Fig. 5B and Fig. 5C), thus an
interplay between the remaining f-N-terminus and its hinge
region must exist which has the capacity to drive the aPKCf
construct to the membrane.
The corresponding experiment with a aPKCfN-iHINGE/GFP
fusion protein showed an exact phenocopy of the parental i-hinge
construct i.e. an exclusive nuclear localization with an
enrichment of the GFP signal within the nucleoli (Fig. 5A,B,D).
These findings clearly identified that the hinge region of
atypical PKCs can be distinguished as harboring specific subcellular localization information.
We then proceeded to ask the same question in the context of
the full length protein. We used either wildtype or chimeric
fusion proteins which contained the corresponding hinge region
of the alternate aPKC isoform (Fig. 1B). We first analyzed the
subcellular localization of these constructs by measuring the
nuclear to cytosol ratio of the GFP signal. As indicated in Fig. 5E
Nucleocytoplasmic shuttling PKCs
6
Biology Open
Fig. 5. Atypical PKC hinge region
mediates different localization of
aPKCi and aPKCf. MDCK cells were
transfected with constructs expressing
either the regulatory domain of aPKCi
or aPKCf (A,B) or chimeric proteins
consisting of the regulatory domain of
aPKCi with a aPKCf hinge region, or
vice versa (C,D). The insert shows
magnification of the marked area
(square) in the overview. Visualization
of the nucleus was achieved by DAPI
staining. Membrane staining was
performed using Alexa FluorH 647
conjugated wheat-germ agglutinin
(WGA). All pictures were taken with the
ZEISS LSM 510 microscope. The areas
representing the cytosolic fraction or
nuclear fraction are indicated with bars
at the top of each histogram. The
histogram analysis was performed with
the ‘profile tool’ in the LSM MetaH
software. The analyzed area is indicated
by the yellow straight line in the
overview. Scale bar: 50 mm (overview),
10 mm (insert). All experiments were
performed in triplicates.
(control lane) an aPKCf protein harboring a i-hinge region
showed a significant increase in the nuclear fraction of the GFP
signal whereas the chimeric aPKCi protein did not appear to be
affected by the f-hinge region with regard to its nuclear
localization (Fig. 5F, control lane). After 6 hours of LMB
treatment the chimeric aPKCfiHINGE construct showed a higher
accumulation of the GFP signal in the nucleus (at a similar level
to that of the aPKCi wildtype construct) (Fig. 5E). In contrast,
the chimeric aPKCifHINGE protein showed a significant decrease
of its nuclear signal after 6 hours of LMB treatment thus
mimicking the levels reached by the aPKCf wild type construct
(Fig. 5F).
In summary, both approaches identify the hinge region of both
aPKCs as a domain that contains isoform specific sub-cellular
localization information.
Discussion
Atypical PKCs represent a subgroup of the PKC family
distinguished by their mode of activation and their remarkably
high homology content to each other (Steinberg, 2008). Most
published work on aPKCs has not distinguished between the two
isoforms due to the lack of specificity of available tools such as
reliably specific antibodies and peptide inhibitors. In addition,
due to the high homology of the amino acid sequence, there is a
great potential for redundancy between these two isoforms.
Nevertheless studies using either RNA knockdown (Durgan et
al., 2011) or gene targeting approaches in mice (Leitges et al.,
2001; Farese et al., 2007) clearly indicate the existence of
isoform-specific functions. Phenotypical analysis has revealed
quite opposite in vivo functions even in cells where both isoforms
coexist, for example in the intestinal epithelial cell, (Oster and
Leitges, 2006; Murray et al., 2009). Thus the question of how
these different functions are regulated given the high degree of
homology becomes poignant.
The intention of this study was to identify how specific
domains within both isoforms transfer specificity to the
individual protein. As described for other PKCs (Parker and
Murray-Rust, 2004) we assumed that one method to achieve
specificity is through protein localization within the cell. Thus in
an unbiased approach we tested aPKC/GFP fusion constructs for
their location after their transient transfection in MDCK cells.
In accordance with others (Horikoshi et al., 2009), we found
both full length constructs mainly located in the cytoplasm but
we also observed that while the aPKCf construct was excluded
from the nucleus the aPKCi construct showed weak nuclear
staining implying a tendency for its nuclear localization
compared to aPKCf .
A clear difference between the two isoforms became obvious
when analyzing the N-terminal constructs missing the catalytic
kinase domain (aPKCfDcatalytic and aPKCiDcatalytic). It is worth
stating here that this truncation eliminates a nuclear export
sequence (NES) from both constructs (aPKCf AA 247–255,
aPKCi AA 239–247) and leaves the truncated protein in a
somewhat open conformation. Whereas the aPKCf specific
construct showed prominent membrane staining, aPKCi was
found exclusively in the nucleus. These observations per se
Biology Open
Nucleocytoplasmic shuttling PKCs
indicate a clear difference between both aPKC isoforms. The
robust membrane localization of aPKCf could be explained by its
previously reported association with the signaling cascade of the
ternary polarity par3/aPKC/par6 complex which is localized at
the cell membrane (Suzuki et al., 2001), while the accumulation
of the aPKCi construct might be a consequence of the missing
NES. The explanation for this obvious difference in localization
remains elusive.
Further investigation identified the hinge region of both
isoforms to be essential in this localization process. We found
that in both isoforms the deletion of the hinge domain caused a
nuclear localization that was different in appearance to that
observed in aPKCiDcatalytic construct expression where the hinge
region is intact. We also found that expression of hinge/GFP
fusion proteins showed an isoform-specific difference.
Whereas the aPKCiHINGE predominantly localized in the
nucleus (showing a homogenous distribution within) the
aPKCfHINGE was excluded. Thus, given the fact that the hinge
region within aPKCs contains the most diverse nucleotide
sequence it is interesting to observe that both isoforms contain
information related to isoform-specific, distinct, subcellular
localization in this region. This was finally confirmed by the
expression of chimeric proteins that were generated containing
the hinge fragment of one isoform sub-cloned to the
corresponding N-terminus (or full length) of the alternate aPKC
isoform (Fig. 5). In both cases i-hinge drives the protein into the
nucleus whereas f-hinge either keeps it outside (N-terminal
construct) or significantly reduces (in the context of the full
length protein) the nuclear pool upon LMB treatment.
Until now, the only verified functional motif within the
atypical hinge sequence had been a caspase cleavage site which
exists only in aPKCf and is involved in the regulation of the
protein’s enzymatic activity rather then its localization (Frutos et
al., 1999). Any other functional derivation based on the crude
amino acid sequence is highly speculative without experimental
verification. Current approaches in our laboratory employed
mutagenesis to establish hinge region mutants with abolished
localization behavior, thereby enabling the identification of the
underlying sequence motifs (and mechanisms) that cause these
observed differences between hinge regions in different aPKC
isoforms.
The N-terminal construct (depleted of the hinge region) of both
aPKCs was found exclusively in the nucleus which could be
explained by the NLS motif located in the C1 domain,
functionally described by others (Perander et al., 2001; Pu et
al., 2006). Nevertheless we investigated the NLS in more detail
and showed that mutations destroying the functionality of the
NLS did not completely abolish the nuclear translocation of
either the N-terminal or the full length GFP fusion proteins in
either aPKC. This was a surprising result since the NLS had been
shown to cause localization to the nucleus in the context of both a
smaller fragment and a full length construct containing a kinase
defective mutation in a different cellular context (Perander et al.,
2001). We found that neither an N-terminal nor a full length
aPKCi/GFP construct containing an R141/142 mutation appeared
to be affected in its nuclear translocation behavior. However, a
full-length aPKCf/GFP construct harboring an R140/141
mutation showed a significant reduction in the amount of
nuclear accumulation after 2 and 6 hours LMB treatment.
Although reduced, the accumulation was significant, thus
7
indicating the possible existence of alternate methods of
translocation.
During our analysis we identified a sequence variant in the
NLS sequence which appears to be mouse specific and converts
the PKCf specific NLS to AKRFNRG (Uniprot.org entry
Q02956). This variation could explain the slower nuclear
translocation of PKCf observed upon LMB treatment compared
with PKCi based on the described mechanism of the importin a/b
system. Also the G141R mutation of PKCf which converts the fNLS into a i-NLS, supports this notion since the construct
mimicked the PKCi nuclear translocation kinetics exactly (higher
maximum, reached after 2 hours LMB treatment). However, this
is not a valid argument for the observed differences regarding the
nuclear translocation kinetics between both aPKC isoforms made
previously by others (Perander et al., 2001) since the aPKC
cDNAs from other species that do not contain this sequence
variation were used. Thus, our observation may be either a cell
type or species specific phenomena or a combination of both. In
any case our data show a clear difference between both aPKCs
and their NLS dependent nuclear translocation in MDCK cells
upon LMB treatment when using mouse specific constructs.
PKCi translocates to the nucleus independently of its NLS
whereas PKCf mainly depends on a functional NLS.
One reason for the NLS independent translocation of PKCi
might be hidden in its hinge region which we have shown to be
able to direct nuclear translocation. Other mechanisms must also
exist since N-terminal constructs of both aPKC isoforms (missing
each hinge region and containing NLS mutations) retain the
capacity to translocate to the nucleus.
We have further analyzed the PB1 domain which remained
intact in our N-terminal constructs and which has been implicated
as a mediator of protein-protein interactions between PB1
containing proteins (Hirano et al., 2004; Hirano et al., 2005).
To our knowledge, the PB1 interacting proteins include at least
13 mammalian proteins (Lamark et al., 2003).
The background notion for this attempt was that it was possible
that interacting partners of aPKCs were able to translocate to the
nucleus and could serve as a shuttle vehicle for aPKCs. However,
when introducing a D-A mutation which had been described to
abolish PB1 specific interactions (Hirano et al., 2004) we were
not able to detect any effect on the N-terminal constructs with
regard on the nuclear/cytoplasm ratio. Upon the introduction of
the same mutation into full length proteins we were readily able
to detect an increased nuclear fraction in non-treated cells. We
interpreted this result as an indication that there is reduced export
rather than increased import.
One likely candidate for the export shuttle might be p62. This
protein was originally identified as a binding partner for aPKC
(Puls et al., 1997; Sánchez et al., 1998) and has received some
attention recently based on its involvement in starvation induced
autophagy (Pankiv et al., 2010; Wooten et al., 2008; Lamark et
al., 2009). More important for us was the identification of p62 in
the nuclear compartment (Bjørkøy et al., 2005) and the finding
that the shuttling of p62 between cytoplasm and nucleus appears
to be a very dynamic process (Pankiv et al., 2010) similar to that
we have observed for aPKC. In addition, most recently it has
been shown that p62 is involved in the nuclear export of ALFY
(autophagy-linked FYVE) proteins through protein-protein
interaction (Clausen et al., 2010). Thus, it could well be that
p62 is also involved in the nuclear export of aPKC. Nevertheless,
we do not exclude other PB1 containing proteins, like Par6, also
Biology Open
Nucleocytoplasmic shuttling PKCs
recently described as a nuclear protein (Cline and Nelson, 2007),
being involved in the nuclear translocation of aPKC.
With regard to nuclear import, the PB1 mutation did not
influence PKCf (similar kinetics and amounts of nuclear
accumulation were seen) but it did reduce the total amount of
PKCi in the nucleus upon LMB treatment. Thus a certain fraction
of PKCi translocation to the nucleus depends on an as yet
undefined PB1 domain protein-protein interaction.
Our study revealed clear differences between the two aPKC
isoforms which have not been analyzed in such a comparative
structure to function study before. The hinge region, representing
the most heterologous amino acid stretch between the two
aPKCs, contains isoform-specific, sub-cellular localization
information. In particular, with regard to the nuclear
localization of aPKCs the functionality of the NLS, the PB1
domain and in the case of PKCi the hinge region, are shown to
influence the nuclear import to a different degree when both
isoforms are compared directly.
We are not the first to show that aPKC is present in the nucleus
but our data suggests that there are multiple modes of nuclear
transport that differ between aPKC isoforms. This could mean
that the physiological conditions in which each aPKC
translocates to the nucleus are distinguishable. What exactly
drives PKCf and PKCi into the nucleus is not clear. Our attempts
to locate aPKC/GFP proteins to a more precise sub-nuclear
domain or to the nucleus during specific cell cycle periods have
thus far been unsuccessful (data not shown).
Another option is the activation of aPKC in the context of
NFkB signaling leading to a translocation of NFkB to the
nucleus. Besides this translocation, specific phosphorylations are
required to regulate NFkB specific gene expression. Ser 311 on
the RelA subunit has been identified as a PKCf target (Duran et
al., 2003) but where this phosphorylation takes place remains
unknown. Thus it could well be that PKCf must be translocated
into the nucleus to phosphorylate RelA on Ser 311.
Both aPKC isoforms have been described as forming
complexes with Par6 and Par3 (Noda et al., 2003; Henrique
and Schweisguth, 2003; Joberty et al., 2000) to build a ternary
complex (also called polarity complex (Suzuki and Ohno, 2006).
Recent work has also identified nuclear accumulation of Par6 in
MDCK cells after LMB treatment indicating nucleocytoplasmic
shuttling similar to that we observed for aPKC (Cline and Nelson,
2007). Cline could not identify a specific nuclear function for
Par6, but a participation in gene transcription, RNA splicing and
mRNA transport was excluded.
Par3 has also been found to be located in the nucleus (Fang et
al., 2007). In this case an association with Ku70/Ku80 proteins
was reported and functional analysis revealed that Par3 regulates
DNA-PK activity through this interaction which is needed in the
repair of double-strand breaks. Neither Par6 nor Par3 has been
evaluated for aPKC interaction/complex capability. Thus aPKC
could be involved in individual nuclear functions with Par6 and/
or Par3 but in addition it is also conceivable that the well
established polarity complex (Par6/aPKC/Par3) exists in the
nucleus independently and fulfills as yet uncharacterized
functions.
It is necessary at this point to mention that the N-terminal
constructs (PKCiAA1-177 and PKCfAA1-176) we have used in our
study have an average molecular weight of around 55 kDa (and
even smaller with regard to the individual hinge constructs). Thus
as a consequence we are not able to exclude that some of our
8
immunfluoresence data are discolored by the fact that smaller
proteins can enter the nucleus by passive diffusion (Nigg, 1997).
Regardless of this fact we are convinced that our major findings
are not influenced by this fact since all relevant mutation have
been introduced and analysed in the full length proteins as well.
In addition also the hinge domains have been tested in the context
of a bigger fusion protein.
In conclusion, evidence for the implication of aPKCs in
nuclear function(s) are accumulating, some may be redundant
and some may be assigned to a single aPKC isoform. The
functions may be dependent on specific stimuli since we have
found that defined domains within the aPKC protein have various
influences on the nuclear translocation behavior of the protein.
Future challenges include the identification of the physiological
conditions in which individual aPKC isoforms translocate to the
nucleus which may then suggest links to specific nuclear
function.
Materials and Methods
Cell cultures
Madin Darby Canine Kidney (MDCK) cells were grown in Gibco
DMEM+GlutaMAX2-I (Invitrogen) with 15% Gibco fetal calf serum
(Invitrogen), Gibco non essential amino acids (Invitrogen), Penicillin (50 units/
ml) and streptomycin (100 mg/ml) (Invitrogen). For the nuclear export
experiments, Leptomycin B (Sigma-Aldrich) was added to the medium to a final
concentration of 4 ng/ml.
Plasmid constructions and site-directed mutagenesis
The murine cDNA was amplified from mouse brain RNA after reverse
transcription by PCR using HotStarTaq Master Mix from QIAGEN (203,443).
Following Primers were used: i/lPKCwt for: CAC CAT GCC GAC CCA GAG
GGA CAG CAG C; i/lPKCwt rev: GAC ACA CTC TTC TGC AGA CAT CAA
GAG GGG; fPKCwt for: CAC CAT GCC CAG CAG GAC GGA CCC CAA GAT
G; fPKCwt rev: CAC GGA CTC CAC AGC AGA CAG CAG AA; i/lPKCDC
rev: ACT GGA CGA CGC TTT ACC ACT CTC CCT GG; fPKCDC: CCC CTG
AGA GAT TTT GAT CCC ATC CAC; i/lPKC AA1-186rev: GAC CAG CTT
GTG GCA CTT CTT ATG; fPKC AA1-178rev: GAC GAG GAC GTG GCA
GCG TTT ATG GAC; i/lPKC AA27-247 for CAC CAT GTC CCA CAC GGT
CGC GTG; fPKC AA18-246: CAC CATGCG CGT CCG TCT GAA GGC GCA
CTA CGG; i/lPKC Hinge for: CAC CATGAC AAT TGA GTG TGG GCG GCA
CT; fPKC Hinge: CAC CATGGC TGA CCT GCA GGA GGC ATA TGG AT. All
PCR products were sub-cloned into pENTR-D-TOPO by using the Gateway
cloning system (Invitrogen) according to the manufacturer’s instructions. All
plasmids were verified by restriction enzymes and sequencing to confirm the
correct coding sequence. All expression plasmids were constructed using the LR
clonase Kit (Invitrogen) according to the manufacturer’s instructions. The pDEST
expression vector with a c-terminal GFP-tag was provided by Kjetil Tasken (The
Biotechnology Centre of Oslo, Norway). For sequencing of the constructs we used
following primer EGFP-N rev: CTGAACTTGTGGCCGTTTAC EGFP-N for:
TCCGCCCCATTGACGCAA. For the site directed mutagenesis we used the
Quickchange Site Directed Mutagenesis Kit (NO. 200518, Stratagene). The
primer-design was done with the Quick Change Primer Design tool on the
companies homepage. Following primers were used for the mutagenesis: i/
lPKCR141/142E for: GCC AAA CGT TTC AAT GAG GAG GCC CAC TGT
GCC ATC; i/lPKCR141/142E rev: GAT GGC ACA GTG GGC GCG CCT ATT
GAA ACG TTT GGC; i/lPKCR142G for: GCC AAA CGT TTC AAT AGG GGC
GCC CAC TGT GC; i/lPKCR142G rev: GCA CAG TGG GCG CCC CTA TTG
AAA CGT TTG GC;
fPKCR140/141E for: AAG CCA AGC GCT TTA ACG AGG AAG CGT ACT
GCG GCC AG; fPKCR140/141E rev: CTG GCC GCA GTA CGC TTC CTC GTT
AAA GCG CTT GGC TT; fPKCG141R for: AGC GCT TTA ACA GGA GAG
CGT ACT GCG GC; fPKCG141R rev: GCC GCA GTA CGC TCT CCT GTT
AAA GCG CT; i/lPKCD63A for: CAC CAT GAA ATG GAT AGC TGA GGA
AGG AGA CCC AT; i/lPKCD63A rev: ATG GGT CTC CTT CCT CAG CTA
TCC ATT TCA TGG TG; fPKCD62A for: CCT CAA GTG GGT GGC CAG TGA
AGG TGA CC; fPKCD62A rev: GGT CAC CTT CAC TGG CCA CCC ACT
TGA GG.
To generate aPKCfN-iHINGE and aPKCiN-fHinge constructs we designed
primers to add an additional BfaI restriction site to the N-terminus of the
corresponding Hinge-region and the C-terminus of the N-terminal region without
changing the amino acid sequence. The following primers were used: i/lPKCNBfarev: GAC TAG GAC GTG GCA CTT CTT ATG; i/lPKCHINGE-Bfafor:
Nucleocytoplasmic shuttling PKCs
GTC CTA GTC ACA ATT GAG TGT GGG CGG CAC T; fPKCN-Bfarev: GAC
TAG GAC GTG GCA GCG TTT ATG GAC; fPKCHINGE-Bfafor: GTC CTA
GTC CCG CTG ACC TGC AGG AGG CAT ATG GAT.
Both PCR products were sub-cloned into the pCRII-Topo plasmid according to
the manufactures protocol (Invitrogen). The fragments were then excised using
BamHI/EcoRV for the Hinge fragments and HindIII/XbaI for the N-terminal
fragments. Afterwards all fragments were digested with BfaI and ligation was
performed using the T4 DNA ligase from NEB according to the manufacturers
protocol. The ligation product was amplified using a specific primer set (see
above) and sub-cloned into the pENTR vector according to the manufacturers
protocol.
For the chimeric full length constructs (aPKCi-zeta HINGE, aPKCf-iHINGE) a
similar approach was chosen. An additional EcoRI site was added to the PCR
products of the kinase domain and aPKCfN-iHINGE and aPKCiN-fHinge
constructs using specially designed primers: i/lkinaseEcoRIfor: GAA TTC CTA
GGT CTG CAG GAT TTC G; i/lPKCDCEcoRIrev: GAA TTC ACT GGA CGA
CGC TTT ACC ACT CTC CCT GG; fkinase EcoRIfor: GAA TTC CTG GGG
CTG CAA GAC TTC G; fPKCDCEcoRIrev: GAA TTC CCC CTG AGA GAT
TTT GAT CCC ATC CAC.
The PCR products were then subcloned into pCRII-Topo plasmid. The resulting
plasmid was digested with EcoRI for 16 h at 37 ˚C to create EcoRI fragments. Both
fragments were ligated with T4 DNA ligase (NEB) according to the
manufacturer’s protocol. The ligation product was amplified by PCR using
primers for the wild-type full-length sequence and the PCR product was further
sub-cloned into the pENTR vector. All constructs were verified by Restriction
pattern and sequencing.
Biology Open
Subcellular localization analyzes and immunocytochemistry
For the sub-cellular localization studies of the different GFP fusion proteins,
MDCK cells were seeded in a 4-well dish with a 14 mm microscope cover glass
(Marienfeld), coated with 0.2% Gelantine at a density of 7.36106 per well 18 h
before transfection. The cells were then transfected with 0.8 mg of expression
vector using Lipofectamine. The cells were fixed with 4% paraformaldehyde for
15 min and permeabilized in 0.01% Triton X-100 for 10 min at room temperature,
24 hours after transfection. We used the Vectashield mounting medium with DAPI
(Vector) to mount the cells on a microscope slide (VWR). The GFP fusion proteins
were visualized by confocal microscopy using the Zeiss LSM 510 Meta invert
microscope equipped with a Zeiss LSM laser module and a AxioCam HMr digital
camera.
Image analysis
The color digital images of the fluorescing cells were processed by the Adobe
Photoshop CS5 (Adobe Systems Inc., USA) and analyzed by the ImageJ 1.43r
(National Institute of Health, USA, http://rsb.info.nih.gov/ij) software. The ‘Mean
Gray Value’ was quantitatively assessed in the selected regions of interest (ROI
‘‘Oval Selection’’) from the images using ‘‘Analyze’’ plugin (‘‘Measure’’ option).
The obtained data were in the arbitrary units of the 8-bit gray scale (0–256 units).
Ratios were presented as means with standard deviations.
Data analysis
The histogram analysis of the fluorescence signal was performed with the profile
tool provided by the LSM Image Examiner from Zeiss. The software enables the
user to analyze the pixel strength of a defined area and all channels. We used the
linear tool to analyze the localization of the GFP-fusion protein within the cell. To
visualize and analyze the dimension of a cell and the position of the nucleus we
used Alexa FluorH 647 (Invitrogen) labeled Wheat Germ Agglutinin (WGA). In
the histogram each peak represents a cell membrane. The two outer peaks
represent the outer cell membrane and the inner peaks the nuclear envelope. The
position and dimensions of the nucleus were visualized and analyzed by using 49,6diamidino-2-phenylindole (DAPI). Channel coding: red 5 WGA, blue 5 DAPI,
green 5 GFP.
Western Blot analysis
MDCK cells were transfected according to the Lipofectamine 2000ß transfection
reagent from Invitrogen dependent of the size of the used cell culture dish.
24 hours after transfection the cells were trypsinized with 16 Trypsin (Invitrogen)
for 10 min at room temperature, the reaction was stopped by supplementing
DMEM containing 15% FCS. The pellet was collected and incubated in 80 ml of
protein extraction buffer (50 mM Tris/HCl, pH 7.5–8.0; 2 mM EDTA, pH 7.0;
10 mM EGTA, pH 7.0; 0.1% TritonX-100, 3% b-mercaptoethanol) supplemented
with Proteinase Inhibitor Cocktail (Sigma, NO. P-2714), incubated on ice for
20 min. After supplementation of 25 ml of protein sample loading buffer the
samples were boiled for 5 min. Subsequently. the samples were run on a 10%
SDS-polyacrylamide gel and blotted onto BioRad nitrocellulose membranes. The
membranes were blocked in 5% nonfat dry milk in TBST for 1 h at room
temperature. Incubation with the primary antibody happened overnight in TBST at
9
4 ˚C. The following antibodies were used: anti-GFP (Santa Cruz Antibodies NO.
sc-8334) (1:500).
Acknowledgements
We are grateful to Jorunn Solheim for technical assistance and
Catherine Jackson for incredible editorial work on the manuscript.
Sebastian Seidl is a fellow of Molecular Life Science - University of
Oslo.
Competing Interests
The authors would like to declare that they do not have conflicting
financial interests.
References
Akimoto, K., Mizuno, K., Osada, S., Hirai, S., Tanuma, S., Suzuki, K. and Ohno, S.
(1994). A new member of the third class in the protein kinase C family, PKC lambda,
expressed dominantly in an undifferentiated mouse embryonal carcinoma cell line and
also in many tissues and cells. J. Biol. Chem. 269, 12677-12683.
Bandyopadhyay, G., Standaert, M. L., Sajan, M. P., Kanoh, Y., Miura, A., Braun,
U., Kruse, F., Leitges, M. and Farese, R. V. (2004). Protein kinase C-lambda
knockout in embryonic stem cells and adipocytes impairs insulin-stimulated glucose
transport. Mol. Endocrinol. 18, 373-383.
Bjørkøy, G., Lamark, T., Brech, A., Outzen, H., Perander, M., Øvervatn, A.,
Stenmark, H. and Johansen, T. (2005). p62/SQSTM1 forms protein aggregates
degraded by autophagy and has a protective effect on huntingtin-induced cell death. J.
Cell Biol. 171, 603-614.
Clausen, T. H., Lamark, T., Isakson, P., Finley, K., Larsen, K. B., Brech, A.,
Øvervatn, A., Stenmark, H., Bjørkøy, G., Simonsen, A. et al. (2010). p62/
SQSTM1 and ALFY interact to facilitate the formation of p62 bodies/ALIS and their
degradation by autophagy. Autophagy 6, 330-344.
Cline, E. G. and Nelson, W. J. (2007). Characterization of mammalian Par 6 as a duallocation protein. Mol. Cell. Biol. 27, 4431-4443.
Dı́az-Meco, M. T., Municio, M. M., Frutos, S., Sánchez, P., Lozano, J., Sanz, L. and
Moscat, J. (1996). The product of par-4, a gene induced during apoptosis, interacts
selectively with the atypical isoforms of protein kinase C. Cell 86, 777-786.
Diaz-Meco, M. T. and Moscat, J. (2001). MEK5, a new target of the atypical protein
kinase C isoforms in mitogenic signaling. Mol. Cell. Biol. 21, 1218-1227.
Duran, A., Diaz-Meco, M. T. and Moscat, J. (2003). Essential role of RelA Ser311
phosphorylation by zetaPKC in NF-kappaB transcriptional activation. EMBO J. 22,
3910-3918.
Durgan, J., Kaji, N., Jin, D. and Hall, A. (2011). Par6B and atypical PKC regulate
mitotic spindle orientation during epithelial morphogenesis. J. Biol. Chem. 286,
12461-12474.
Fang, L., Wang, Y., Du, D., Yang, G., Tak Kwok, T., Kai Kong, S., Chen, B., Chen,
D. J. and Chen, Z. (2007). Cell polarity protein Par3 complexes with DNA-PK via
Ku70 and regulates DNA double-strand break repair. Cell Res. 17, 100-116.
Farese, R. V., Sajan, M. P., Yang, H., Li, P., Mastorides, S., Gower, W. R., Jr,
Nimal, S., Choi, C. S., Kim, S., Shulman, G. I. et al. (2007). Muscle-specific
knockout of PKC-lambda impairs glucose transport and induces metabolic and
diabetic syndromes. J. Clin. Invest. 117, 2289-2301.
Frutos, S., Moscat, J. and Diaz-Meco, M. T. (1999). Cleavage of zetaPKC but not
lambda/iotaPKC by caspase-3 during UV-induced apoptosis. J. Biol. Chem. 274,
10765-10770.
Galvez, A. S., Duran, A., Linares, J. F., Pathrose, P., Castilla, E. A., Abu-Baker, S.,
Leitges, M., Diaz-Meco, M. T. and Moscat, J. (2009). Protein kinase Czeta
represses the interleukin-6 promoter and impairs tumorigenesis in vivo. Mol. Cell.
Biol. 29, 104-115.
Henrique, D. and Schweisguth, F. (2003). Cell polarity: the ups and downs of the Par6/
aPKC complex. Curr. Opin. Genet. Dev. 13, 341-350.
Hirano, Y., Yoshinaga, S., Ogura, K., Yokochi, M., Noda, Y., Sumimoto, H. and
Inagaki, F. (2004). Solution structure of atypical protein kinase C PB1 domain and its
mode of interaction with ZIP/p62 and MEK5. J. Biol. Chem. 279, 31883-31890.
Hirano, Y., Yoshinaga, S., Takeya, R., Suzuki, N. N., Horiuchi, M., Kohjima, M.,
Sumimoto, H. and Inagaki, F. (2005). Structure of a cell polarity regulator, a
complex between atypical PKC and Par6 PB1 domains. J. Biol. Chem. 280, 96539661.
Horikoshi, Y., Suzuki, A., Yamanaka, T., Sasaki, K., Mizuno, K., Sawada, H.,
Yonemura, S. and Ohno, S. (2009). Interaction between PAR-3 and the aPKC-PAR6 complex is indispensable for apical domain development of epithelial cells. J. Cell
Sci. 122, 1595-1606.
Huber, T. B., Hartleben, B., Winkelmann, K., Schneider, L., Becker, J. U., Leitges,
M., Walz, G., Haller, H. and Schiffer, M. (2009). Loss of podocyte aPKClambda/
iota causes polarity defects and nephrotic syndrome. J. Am. Soc. Nephrol. 20, 798806.
Joberty, G., Petersen, C., Gao, L. and Macara, I. G. (2000). The cell-polarity protein
Par6 links Par3 and atypical protein kinase C to Cdc42. Nat. Cell Biol. 2, 531-539.
Kovac, J., Oster, H. and Leitges, M. (2007). Expression of the atypical protein kinase
C (aPKC) isoforms i/l and f during mouse embryogenesis. Gene Expr. Patterns 7,
187-196.
Biology Open
Nucleocytoplasmic shuttling PKCs
Kudo, N., Wolff, B., Sekimoto, T., Schreiner, E. P., Yoneda, Y., Yanagida, M.,
Horinouchi, S. and Yoshida, M. (1998). Leptomycin B inhibition of signal-mediated
nuclear export by direct binding to CRM1. Exp. Cell Res. 242, 540-547.
Lamark, T., Perander, M., Outzen, H., Kristiansen, K., Øvervatn, A., Michaelsen,
E., Bjørkøy, G. and Johansen, T. (2003). Interaction codes within the family of
mammalian Phox and Bem1p domain-containing proteins. J. Biol. Chem. 278, 3456834581.
Lamark, T., Kirkin, V., Dikic, I. and Johansen, T. (2009). NBR1 and p62 as cargo
receptors for selective autophagy of ubiquitinated targets. Cell Cycle 8, 1986-1990.
Leitges, M., Sanz, L., Martin, P., Duran, A., Braun, U., Garcı́a, J. F., Camacho, F.,
Diaz-Meco, M. T., Rennert, P. D. and Moscat, J. (2001). Targeted disruption of the
zetaPKC gene results in the impairment of the NF-kappaB pathway. Mol. Cell 8, 771780
Lin, D., Edwards, A. S., Fawcett, J. P., Mbamalu, G., Scott, J. D. and Pawson, T.
(2000). A mammalian PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC
signalling and cell polarity. Nat. Cell Biol. 2, 540-547.
Lischka, P., Rosorius, O., Trommer, E. and Stamminger, T. (2001). A novel
transferable nuclear export signal mediates CRM1-independent nucleocytoplasmic
shuttling of the human cytomegalovirus transactivator protein pUL69. EMBO J. 20,
7271-7283.
Martin, P., Duran, A., Minguet, S., Gaspar, M.-L., Dı́az-Meco, M. T., Rennert, P.,
Leitges, M. and Moscat, J. (2002). Role of zeta PKC in B-cell signaling and
function. EMBO J. 21, 4049-4057.
Murray, N. R., Weems, J., Braun, U., Leitges, M. and Fields, A. P. (2009). Protein
kinase C betaII and PKCiota/lambda: collaborating partners in colon cancer
promotion and progression. Cancer Res. 69, 656-662.
Nigg, E. A. (1997). Nucleocytoplasmic transport: signals, mechanisms and regulation.
Nature 386, 779-787.
Noda, Y., Kohjima, M., Izaki, T., Ota, K., Yoshinaga, S., Inagaki, F., Ito, T. and
Sumimoto, H. (2003). Molecular recognition in dimerization between PB1 domains.
J. Biol. Chem. 278, 43516-43524.
Oster, H. and Leitges, M. (2006). Protein kinase C alpha but not PKCzeta suppresses
intestinal tumor formation in ApcMin/+ mice. Cancer Res. 66, 6955-6963.
Palmeri, D. and Malim, M. H. (1999). Importin beta can mediate the nuclear import of
an arginine-rich nuclear localization signal in the absence of importin alpha. Mol.
Cell. Biol. 19, 1218-1225.
Pankiv, S., Lamark, T., Bruun, J.-A., Øvervatn, A., Bjørkøy, G. and Johansen, T.
(2010). Nucleocytoplasmic shuttling of p62/SQSTM1 and its role in recruitment of
nuclear polyubiquitinated proteins to promyelocytic leukemia bodies. J. Biol. Chem.
285, 5941-5953.
Parker, P. J. and Murray-Rust, J. (2004). PKC at a glance. J. Cell Sci. 117, 131-132.
10
Perander, M., Bjorkoy, G. and Johansen, T. (2001). Nuclear import and export signals
enable rapid nucleocytoplasmic shuttling of the atypical protein kinase C lambda. J.
Biol. Chem. 276, 13015-13024.
Pu, Y., Peach, M. L., Garfield, S. H., Wincovitch, S., Marquez, V. E. and Blumberg,
P. M. (2006). Effects on ligand interaction and membrane translocation of the
positively charged arginine residues situated along the C1 domain binding cleft in the
atypical protein kinase C isoforms. J. Biol. Chem. 281, 33773-33788.
Puls, A., Schmidt, S., Grawe, F. and Stabel, S. (1997). Interaction of protein kinase C
zeta with ZIP, a novel protein kinase C-binding protein Proc. Natl. Acad. Sci. USA 94,
6191-6196.
Rosse, C., Linch, M., Kermorgant, S., Cameron, A. J. M., Boeckeler, K. and Parker,
P. J. (2010). PKC and the control of localized signal dynamics. Nat. Rev. Mol. Cell
Biol. 11, 103-112.
Sánchez, P., De Carcer, G., Sandoval, I. V., Moscat, J. and Diaz-Meco, M. T. (1998).
Localization of atypical protein kinase C isoforms into lysosome-targeted endosomes
through interaction with p62. Mol. Cell. Biol. 18, 3069-3080.
Soloff, R. S., Katayama, C., Lin, M. Y., Feramisco, J. R. and Hedrick, S. M. (2004).
Targeted deletion of protein kinase C lambda reveals a distribution of functions
between the two atypical protein kinase C isoforms. J. Immunol. 173, 3250-3260.
Steinberg, S. F. (2008). Structural basis of protein kinase C isoform function. Physiol.
Rev. 88, 1341-1378.
Suzuki, A. and Ohno, S. (2006). The PAR-aPKC system: lessons in polarity. J. Cell Sci.
119, 979-987.
Suzuki, A., Yamanaka, T., Hirose, T., Manabe, N., Mizuno, K., Shimizu, M.,
Akimoto, K., Izumi, Y., Ohnishi, T. and Ohno, S. (2001). Atypical protein kinase C
is involved in the evolutionarily conserved par protein complex and plays a critical
role in establishing epithelia-specific junctional structures. J. Cell Biol. 152, 11831196.
Uberall, F., Hellbert, K., Kampfer, S., Maly, K., Villunger, A., Spitaler, M.,
Mwanjewe, J., Baier-Bitterlich, G., Baier, G. and Grunicke, H. H. (1999).
Evidence that atypical protein kinase C-lambda and atypical protein kinase C-zeta
participate in Ras-mediated reorganization of the F-actin cytoskeleton. J. Cell Biol.
144, 413-425.
Wodarz, A., Ramrath, A., Grimm, A. and Knust, E. (2000). Drosophila atypical
protein kinase C associates with Bazooka and controls polarity of epithelia and
neuroblasts. J. Cell Biol. 150, 1361-1374.
Wooten, M. W., Geetha, T., Babu, J. R., Seibenhener, M. L., Peng, J., Cox, N., DiazMeco, M. T. and Moscat, J. (2008). Essential role of sequestosome 1/p62 in
regulating accumulation of Lys63-ubiquitinated proteins. J. Biol. Chem. 283, 67836789.
Yang, J.-Q., Leitges, M., Duran, A., Diaz-Meco, M. T. and Moscat, J. (2009). Loss of
PKC lambda/iota impairs Th2 establishment and allergic airway inflammation in
vivo. Proc. Natl. Acad. Sci. USA 106, 1099-1104.
30
30
120
100
80
120
100
80
60
50
60
50
40
40
30
60
50
60
40
50
60
50
40
40
30
30
C
G
G
E
ns
FP fec
t
alo ed
ne
HIN
tra
un
un A
tra A 1G ns 176
FP fe
c
al ted
on
e
30
40
N HIN
G
tra
E
ns
G
f
e
FP c
t
al ed
on
e
50
un
60
AA
1-17
un HIN 7
tra GE
n
G sfe
FP c
t
al ed
on
e
120
100
80
Nun
HIN
G
tra
E
ns
G
f
e
FP c
t
al ed
on
e
G FP
al
on
G FP
al
on
e
e
A
120
100
80
60
50
40
30
B
A
C
B
D63A
D
D62A
NLS
CANGHTFQAKRFNRRAHCAI
137
156
128 CANGHTGQAKRFNRRAHCAI 147
137 CANGHTFQAKRFNRRAHCAI 156
127 RANGHLFQAKRFNRRAYCGQ 146
127 RANGHLFQAKRFNRGAYCGQ 146
127 RANGHLFQAKRFNRRAYCGQ 146
**** ******* *:*.
II
Phenotypical analysis of atypical PKCs in vivo function
display a compensatory system at embryonic stage 7.5 p.c.
Authors and Affiliations
Sebastian Seidl1, Ursula Braun1, Norbert Roos2, Shaohua Li3, Timo H.-W. Lüdtke4,
Andreas Kispert4* and Michael Leitges1,*,§
*equally contributed
1 Biotechnology centre of Oslo, University of Oslo, Gaustadalleen 21, 0349 Oslo,
Norway
2 Department of Molecular Biosciences, University of Oslo, Oslo, Norway.
3 Department of Surgery, University of Medicine and Dentistry of New Jersey–Robert
Wood Johnson Medical School, New Brunswick, NJ 08903
4 Institute for Molecular Biology, QE5250, Medizinische Hochschule Hannover, CarlNeuberg-Str.1, 30625 Hannover, Germany
§ Address correspondence to: Michael Leitges,
Short title:
Keywords:
Abstract
Background: The atypical protein kinases C (PKC) isoforms ι/λ and ζ play crucial roles in
many cellular processes including development, cell proliferation, differentiation and cell
survival. Possible redundancy between the two isoforms has always been an issue since
most biochemical tools do not differentiate between the two proteins. Thus, many efforts
have been made during the last decades to characterize the functions of aPKCs using
gene targeting approaches and depletion studies. However, little is known about the
specific roles of each isoform in mouse development.
Methodology/Principal Findings: To evaluate the importance of PKCι/λ in mouse
development we designed PKCι/λ deletion mutants using the gene targeting approach. We
show that the deletion of PKCι/λ, results in a reduced size of the amniotic cavity at E7.5
and impaired growth of the embryo at E8.5 with subsequent absorption of the embryo.
Our data also indicate an impaired localization of ZO-1 and disorganized structure of the
epithelial tissue in the embryo. Importantly, using electron microscopy, embryoid body
formation and immunofluorescence analysis, we found, that in the absence of PKCι/λ,
tight junctions and apico-basal polarity were still established. Finally, our study points to
a non-redundant PKCι/λ function at E9.5, since expression of aPKCζ is able to rescue the
E7.5 phenotype, but resulted in embryonic lethality at a later time-point (E9.5).
Conclusion: Our data show that PKCι/λ is crucial for mouse embryogenesis but is
dispensable for the establishment of polarity and tight junction formation. We present a
compensatory function of aPKCζ at E7.5, rescuing the phenotype. Furthermore, this
study indicates at least one specific, yet unknown, PKCι/λ function that cannot be
compensated by aPKCζ overexpression at E9.5.
Introduction
The protein kinase C (PKC) family of serine-threonine kinases consists of 9 different
genes giving rise to at least 12 isoforms, subdivided into 3 subfamilies. The subdivision is
based on sequence homologies and dependencies on cofactors during their activation
process. Thus the classical PKCs (cPKC: α, β and γ) are supposed to be dependent on
Ca2+ ions and diacylglycerol for their activation whereas the novel PKCs (nPKC: δ, ε, η
and θ) based on the lack of a binding domain are Ca2+ ion independent but still need
diacylglycerol for their activation. In sharp contrast, the subfamily of the atypical PKCs
(aPKC: ζ and ι/λ) are independent of Ca2+ ions and diacylglycerol for their activation,
thereby, representing quite a distinguishable subgroup among the PKC family. This even
becomes more pronounced by the fact that aPKCs are unresponsive to Tumor Promoting
Agent 12-O-Tetradecanoylphorbol-13-Acetate (TPA) treatment, an early described
feature for PKC family members (see review Steinberg, 2008). Nevertheless, all PKC
family members (including aPKCs) have been described to participate in a multitude of
signaling pathways involved in cell growth, differentiation and apoptosis.
In 1989 Nishizuka and coworkers isolated the aPKCζ isoform out of a rat cDNA library
{Ono:1989tp}. Four years later a second aPKC isoform (PKCɩ) was isolated and
characterized {Selbie:1993ud} followed by the identification of the mouse ortholog
PKClambda {Akimoto:1994we}. As true for all other PKCs, the aPKC proteins can be
divided into a regulatory N-terminal and a catalytic C-terminal part, separated by a hinge
region. The exception is PKMζ which represents only the C-terminal kinase domain
generated by an internal promotor whose activity has been assigned to neurons
{Hernandez:2003cq}. In contrast to other PKCs the N-terminal domain contains a Phox/
Bem1 (PB1) motif mediating interaction with p62 {Puls:1997vi, Sanchez:1998vv}and
other signaling molecules like Mek5 {Hirano:2004gg} and Par-6 {Noda:2003fc} all of
which are supposed to mediate aPKC signaling. In addition both aPKC also contain a
cystein-rich zinc-finger like domain within the regulatory N-terminal domain defined as
C1. Whereas all other PKCs possess a tandem repeat, aPKCs possess only one C1
domain. Interestingly, this domain accounts for the binding of diacylglycerol and TPA in
classical and novel PKCs. The aPKC C1 domain has been reported to bind directly to
phosphatidylinositol (3, 4, 5)-triphosphat thereby inducing conformational changes in the
protein leading to activation similar to diacylglycerol binding to other PKCs {Nakanishi:
1993tz}. But also other interacting partners, inhibitory as well as activating, have been
described {DiazMeco:1996tw, Suzuki:2003il}. The aPKC C-terminal part represent the
catalytic kinase domain sharing 86% homology to each other but only 45-55% to other
PKCs. Overall both aPKCs show a 72% homology on amino acid level {Akimoto:
1994we}. Based on this high degree of homology and the limited availability of isoformspecific tools the in vivo analysis of isoform-specific aPKC functions remained
insufficient in mammals. Nonetheless, it has been shown that aPKCs are conserved in
numbers of organisms, including C. elegans {Tabuse:2002tt} and D. melanogaster
{Schaeffer:1989up} in which only one isoform was detected.
We have previously shown that both aPKCs are expressed during mouse embryonic
development {Kovac:2007ev} as well as in distinct domains in the adult mouse brain
{Oster:2004ik}. As a conclusion of these studies PKCι/λ was defined as being
ubiquitously expressed whereas aPKCζ expression was pronounced in lung, kidney and
brain. The spectrum of physiological processes linked to aPKCs function is huge and
covers cell proliferation {Berra:1995ub}, cell polarity {Lin:2000iw}, carcinogenesis
{Regala:2005gm}, neurogenesis {Baye:2007ht} and many more. Attempts to investigate
individual in vivo functions also made use of the gene targeting approach. We and other
have generated aPKC deficient mouse lines which were subjected to various phenotypical
investigations. Interestingly, a conventional aPKCζ knockout did not display an
embryonic phenotype in contrast to expectations raised by previous publications on a role
for PKCζ during mouse preimplantation development {Pauken:2000ey}. Early studies
using the conventional aPKCζ knockout revealed a functional link to NFkB signaling
{Leitges:2001tb, Martin:2002wq}. Subsequent studies also identified aPKCζ to act as
tumor suppressor due to its regulatory function on the Il-6 promotor {Galvez:2008je}. In
sharp contrast a convential aPKCɩ knockout displayed an embryonic lethal phenotype
{Soloff:2004vx}(personal communication with Shigeo Ohno and own data presented
within this publication), clearly distinguishing both aPKC isoforms for the first time.
Later studies using the conditional gene targeting approach showed inter alia specific in
vivo functions for aPKCɩ but not for aPKCζ in muscle and podocytes {Farese:2007ix,
Huber:2009jy}.
Atypical PKCs have been described to form complexes with the partition defective
proteins Par6 and Par3 {Joberty:2000uz}. Par genes have been cloned and characterized
in 1995 {Guo:1995tp} and were shown to be crucial for asymmetric cell division in C.
elegans and other organisms {EtienneManneville:2003tl, Watts:1996uo}. The association
of aPKCs to this ternary complex, also called polarity complex {Suzuki:2006ke}
integrates aPKC signaling into all aspects of polarity without any isoform specificity.
Here, we subjected several established mutant mouse lines of the PKCɩ gene to a
thorough developmental investigation. We present a detailed description of the embryonic
lethal phenotype caused by the PKCɩ deficiency and provide more insights into the
redundancy within the aPKC subfamily.
Results
Generation of 3 different Prkci alleles in mice. To investigate PKCɩ in vivo function, we
decided to generate various mutant alleles following standard gene targeting approaches
in mouse embryonic stem cells (ESs). First we generated a conventional Prkci knock-out
allele by inserting a neo cassette into the second exon of the gene causing a disruption of
gene transcription (PKCɩNeo, details see supplementary figure 1). Since homozygozity of
this allele caused embryonic lethality (see later), we decided to generated an additional
conditional allele for the Prkci. Again, the second exon of the gene was targeted by
inserting loxP sites at the appropriate positions. This floxed allele (PKCɩflox) has been
described and its functionality has previously been shown {Farese:2007ix, Yang:2009uh,
Murray:2009hf, Huber:2009jy}. We subsequently crossed PKCɩflox/flox mice with a
transgenic mouse line {FSchwenk:1995wd} expressing the Cre recombinase in the germ
line and in a ubiquitous fashion starting at embryonic day (E) 13.5 (details see
supplementary figure 1) and obtained a second null allele for Prkci named PKCɩ△. Third,
we generated a rescue allele (PKCɩζRes) in which a PKCζ cDNA was integrated into the
Prkci locus such that it became expressed under Prkci genomic and transcriptional
regulatory elements (details see supplementary figure 1).
PKCι/λ depletion during mouse development resulted in embryonic lethality. To
investigate whether homozygozity of Prkci null alleles (PKCɩNeo and PKCɩ△) are
compatible with embryonic development, we analyzed more than 100 offspring from
matings of heterozygous carries for each line at 3 weeks after birth. For both individual
lines we did not observe any homozygous offspring whereas heterozygous and wild-type
mice were detected in the expected ratio. This implied an embryonic lethal phenotype for
both mutant alleles in agreement with earlier data by Hedrick and coworkers {Soloff:
2004vx}. We next examined litters from heterozygous crosses at different developmental
stages to identify the time point when first morphological abnormalities manifested in
homozygous embryos. At embryonic day (E) 6.5, no morphological differences between
litter-mates were apparent. At day E7.5, morphological inspection recognized a group of
embryos which appeared “compressed” along the proximal-distal axis of the egg cylinder
and harbored a small amniotic cavity (Figure 1A). Histological analysis showed that the
epiblast was present but was thickened compared to non-affected litter-mates.
Genotyping of individual embryos confirmed that this phenotype was restricted to
homozygous embryos.
At E8.5, mutant embryos were severely growth retarded. An anterior-posterior polarity of
the body axis was not readily apparent since head folds and a linear heart tube
distinguishing the anterior end of the embryo and the allantois representing the most
posterior aspect were reduced or lacking (Figure 1B). In contrast to control embryos that
harbored 4-6 somites at this stage, somites were not discernible by histological analysis in
the mutants. By E10.5, mutant embryos were reabsorbed by the mother. Since phenotypic
changes were indistinguishable between the two targeted alleles, we decided to
exclusively use the PKCɩ△ line for further analysis.
PKCι/λ embryos are normally patterned along the anterior-posterior body axis but
exhibit defects in mesodermal differentiation. Since morphological and histological
analysis indicated a deficit in axial elongation and germ layer formation, we used a panel
of marker genes to test for formation and differentiation of the germ layers and
establishment of an anterior-posterior body axis in E8.5 embryos.
In wildtype embryos, Otx2 expression marks the forebrain {Monaghan:1995uu}, Pax2
the midbrain {Rowitch:1995we} and Fgf8 the midbrain/hindbrain boundariy {Crossley:
1995tu}. In PKCɩ-deficient embryos all three genes were expressed in the “anterior”
embryonic region but the domains were compressed indicating that the (neuro-) ectoderm
is patterned along the anterior-posterior axis but the expansion of the different primordial
brain segments is comprised. Fgf8 is additionally expressed in the primitive streak at the
posterior end of the embryo overlapping with Brachury (T) that additionally marks the
notochord, a thin line of cells extending from the forebrain/midbrain border to the
primitive streak underneath the neural tube {Crossley:1995tu, Wilkinson:1990ih}.
Expression of both genes was established in the mutant but the primitive streak appeared
much reduced and the notochord was disrupted. This shows that PKCɩ mutant embryos
are polarized along the anterior-posterior body axis but that differentiation of the axial
mesoderm is impaired. Tcf15 (also known as paraxis) marks the praaxial msoderm
{Burgess:1995wu} which was organized into 4-8 distinct somite pairs at this stage in teh
wild-type. In PKCɩ-deficient embryos a domain of Tcf15 expression was found in the
middle region of the embryos but individual somites were not formed. Expression of
Bmp4 in the lateral plate mesoderm, the extraembryonic mesoderm and the
extraembryonic ectoderm was found in mutant embryos as in the wild-type. Tbx20 was
expressed in the allantois, a derivative of the extraembryonic mesoderm, and in the linear
heart tube, which derives from the cardiac subregion of the anterior lateral plate
mesoderm in the wild-type {Kraus:2001vs}. Again, both expression domains were
established at opposite poles of the mutant embryos but neither domain was appropriately
developed into a and an allantois, respectively. Finally, Gja, that is expressed in the
cardiac endoderm and dorsal aorta in wild-type embryos {Delorme:1997uu} was
restricted to cell clusters at the anterior and posterior pole of the mutant embryos but
clearly lacked an organization into vessel like structures. Together, this analysis suggests
that PKCι/λ-deficient embryos exhibit a normal anterior-posterior polarization of their
main body axis. Mesoderm formation is initiated but comes to a premature halt,
mesoderm differentiation into axial, paraxial, lateral and extraembryonic subtypes occurs
but subsequent formation of tissues and organs completely fails. As a consequence PKCι/
λ-deficient embryos die due to lack of a cardiavascular system.
Embryonic body formation is impaired by PKCɩ deficiency: Embryonic stem cells, when
cultured as aggregates, form spherical structures which are defined as embryonic bodies
(EBs). These structures are thought to recapitulate early steps of the pre-implantation
development including endoderm formation, basement membrane assembly, epiblast
polarization and subsequent cavity formation {Coucouvanis:1995wi}. When cultured in
suspension for 5 days, EBs form epithelial cysts consisting of an outer endoderm and an
inner columnar epiblast epithelium (CEE), separated by a basement membrane. As PKCι/
λ mutants displayed an abnormal amniotic cavity at E7.5 we decided to use the
embryonic body formation assay to analyze cavity formation in more detail.
When wild-type and PKCɩ deficient embryonic stem cells {Bandyopadhyay:2003dy}
were subjected to this assay, we detected obvious differences among the two genotypes.
Wild-type EBs displayed the expected appearance in a phase contrast representation,
aPKCɩΔ/Δ EBs showed a disorganized structure (Figures 3 B). Most of the wild-type EBs
formed a single large cavity enclosed by CEE after 5 days, whereas the mutant EBs did
not cavitate at all or formed multiple small cavities adjacent to the polarized CEE,
although the endoderm differentiated normally. When cultured for additional 2 days, most
mutant EBs formed small cavities but failed to complete cavitation (Figure 3 A, B and C).
Since caspase-dependent apoptosis has been described as a key mechanism involved in
the early steps of cavity formation {Coucouvanis:1995wi} we immunostained 5-day EBs
for cleaved (activated) caspase-3. Wild-type EBs displayed massive central apoptosis as
evidenced by cleaved caspase-3 staining (Figure 3 D). By contrast, only scattered
apoptotic cells were detected in PKCι/λ deficient EBs. DAPI staining of condensed and
fragmented nuclei, another hallmark of apoptosis, also showed reduced apoptosis at the
center of mutant EBs (Figure 3 D). To further analyze the apoptosis during EB cavitation,
we cultured EBs of both genotypes for 2 to 5 days and performed immunoblotting for
cleaved caspase-3. Indeed, PKCι/λ deficient EBs expressed less apoptotic activity at all
time points tested than the corresponding wild-type extracts (Figure 3 E). These results
demonstrate that PKCι/λ deficient EBs fail to form a single cavity possibly due to
reduced central apoptosis.
Gene targeting experiments have shown that laminin-mediated basement membrane
formation is essential for primitive ectoderm epithelialization and cavitation in EBs {Li:
2002hn, Murray:2000we}. The laminin α-1 chain is a key component of the embryonic
basement membrane expressed early on during development {Cooper:1983wb}. In the
wild-type EB the laminin α-1 staining formed a continuous thin layer between endoderm
and epiblast cells (Figure 3A). We did not observe obvious changes in basement
membrane assembly in mutant EBs. These findings were confirmed by using perlecan as
an alternative marker for the BM (Figure 3 F and G). However, ectopic basement
membrane formation was detected at the center of ~20% mutant EBs (Figure 3F). This
may be caused by failure in endodermal cell migration to the EB surface. Nonetheless,
these results suggest that the cavitation defect in PKCι/λ deficient EBs is unlikely caused
to ectopic basement membrane assembly.
Atypical PKCs have been functionally linked to the establishment and maintenance of
epithelial polarity and tight junction formation due to their association with Par3 and Par6
(forming the so-called polarity complex). To determine if epiblast polarity is disrupted in
the absence of PKCι/λ, we immunostained EBs for the apical marker MUPP1, Par3, the
adherens junction protein E-cadherin and the Golgi marker GM130. The apical actin belt
was visualized using rhodamine-phalloidin. As shown in Figure 3A, F-actin staining was
detected as a continuous layer at the most inner cell membrane surrounding the single
cavity in wild-type EBs. In mutant EBs, no such staining was detectable. The apical
markers MUPP1 and Par3 were expressed at the same location (Figure 3F). The Golgi
marker GM130 was positioned away from the basement membrane and localized on the
apical side. Similarly, E-cadherin was enriched at the apex of the epiblast where they
formed adherens junctions. These results provide evidence that polarity of the epiblast
was intact.
Since the embryo and the EB express both PKCι/λ and PKCζ, we were wondering if the
remaining aPKCζ could possibly compensate for some PKCι/λ function. Therefore, we
immunostained aPKC using a pan aPKC antibody in wild-type and mutant EBs. In both
genotypes similar signals at the apex of the epiblast were detected (Figure 3G). Whether
the signal in the wild-type reflects a combination of both aPKC isoforms is unclear but
for sure the observed signal in the mutants represents PKCζ. In addition we also carried
out a western blot analysis for aPKCs using protein extracts from EBs after 4 and 5 days
of differentiation. The aPKC signal (ergo PKCζ in the PKCι/λ deficient background)
appeared slightly up-regulated at 4 days in PKCι/λ deficient extracts whereas after 5 days
it became down-regulated when compared with wild-type EBs (Figure 3H). Taken
together these results suggest that PKCζ may compensate for the loss of PKCι/λ to confer
an apical-basal polarity to epithelial cells in the epiblast.
Immunohistochemical and electron microscopical investigation revealed subtle changes
in the overall organization of PKCι deficient embryos: Since PKCι/λ deficient EBs lacked
apoptosis, we wished to evaluate the contribution of this process in the mutant embryos
as well. However, we failed to detect increased apoptosis by cleaved (activated)
caspase-3 staining nor did we detect changes in cell proliferation using a phosphospecific histone 3 antibody between E7.5 embryos of either genotype (supplementary
Figure S2).
We next analyzed whether the embryonic ectoderm of E7.5 mutant embryos harbored
epithelial cells with normal apical-basal polarity and junctional complexes. Again we
used an antibody specific for E-cadherin as a marker for adherens junctions (AJ). As
shown in the overview and the higher magnification (Figure 4A and C) both genotypes
displayed a clear signal at the apical side of the embryonic ectoderm. This indicated that
polarity in the epithelial cell layer was established. However, in mutant embryos the
signal did not form a sharp thin line but was interrupted at the apical side (figure 4A and
C). We then further applied Occludin and ZO-1 specific antibodies as marker proteins for
tight junctions (TJ). In both cases the wild-type showed a punctuated pattern at the apical
pole as expected (Figure 4C, white arrows). In PKCι/λ mutants we detected signals for
Occludin at the apical pole of the epithelial cell layer, but weaker (Figure 4C, open
arrows). In contrast we were not able to detect any signal for ZO-1 at the apical side in
mutants. Instead we observed a weak cytoplasmic background signal. A semi-quantitative
RT-PCR analysis of E7.5 embryos did not amplify a significant ZO-1 specific transcript.
Western blot analysis did not detect ZO-1 protein in at E8.5 PKCι/λ mutants either
(supplementary figure 3). Thus we concluded that TJ exists in mutant embryos but that
the composition of tight junction protein complexes is altered.
Based on our observation in EBs, we analyzed the aPKC content and localization in wildtype and mutant embryos. As shown in figure 4B a commonly used antibody against
aPKCs (Santa Cruz # sc121 C-20) stained primarily the apical pole of the embryonic
ectoderm cell layer with a minor fraction also detected in the cytoplasm in the wild-type.
In the mutant embryo the signal (representing PKCζ) is maintained at the apical side.
When applying a PKCι/λ specific antibody {Helfrich:2006de} the signal in the wild-type
appeared broader, indicating that PKCι/λ is more widely distributed within the cells than
indicated by the pan aPKC antibody, but still showing an accumulation at the apical
membrane. The PKCι/λ mutant embryo did not show staining proving the specificity of
the antibody. Hence, both aPKCs showed overlapping localization at the apical pole of
embryonic ectodermal cells at E7.5 suggesting possible compensatory mechanisms.
To further elucidate the structural organization of the cell-cell contacts, we analyzed wildtype and mutant embryonic tissue by using electron microscopy. Both genotypes showed
a clear electron dense area at juxtaposed membranes located at the apical side defined as
tight junctions (TJ) (Figure 5A). Adherens junctions (AJ) and desmosomes (DS) were
detected without identifying any difference among the genotypes (see figure. 5A).
However, when focusing on the overall appearance, we observed a general tendency of
mutants to possess a looser contact zone between individual cells. This was indicated by
more open gaps within the extracellular space when compared with wild-type (exemplary
shown in figure 5B). At the same time we observed in sections of mutants that F-actin
normally localized in tight bundles in close proximity to the membrane appeared less
tight organized. In addition, the distance between the bundles and the outer membrane
seemed to be larger (Figure 5C). In summary the electron microscopic analysis provides
further evidences for changes in the integrity of cell-cell contacts in the absence of PKCι/
λ.
PKCζ is able to rescue the early PKCι/λ in vivo function: PKCι/λ and PKCζ are
structurally highly related, suggesting shared functions and redundancy. We tested this
assumption by establishing a PKCɩζRes/+ mouse line which expresses a chimeric PKCζ
protein under PKCι/λ conditions using its endogenous promotor and 5 ´and 3´
untranslated regulatory RNA sequences (see above and supplementary figure 1).
At E7.5, we did not detect any morphological changes within 111 embryos obtained from
heterozygous intercrosses of this line. In addition, we were able to identify 21
homozygous embryos (18.9%) for the rescue allele (PKCɩζRes/ζRes) when we genotyped
these embryos by PCR (Figure 6, table). A Western Blot analysis of individual embryos
revealed that wild-type and PKCɩ△/+ embryos showed a reasonable aPKC signal (using a
pan aPKC antibody) whereas in the aPKCɩΔ/Δ no such signal was identified.
Interestingly in PKCɩζRes/ζRes embryos an aPKC specific band was detectable including a
50kDa fragment which is supposed to be a proteolytic product of PKCζ, proving the
isoform specificity of the expressed protein (Figure 6C). We concluded that PKCζ
expressed under endogenous PKCι/λ condition is able to rescue the early PKCι/λ
phenotype. In contrast, we failed to identify any PKCɩζRes/ζRes animals in 150 offspring
derived from heterozygous crosses at P21 indicating that PKCζ is not able to compensate
for PKCι/λ ´s function during later stages of development (see table in figure 6). To
define the lethality of PKCɩζRes/ζRes embryos, we screened several embryonic stages for
morphologically divergent embryos. At E9.5, PKCɩζRes/ζRes embryos were severely
retarded in growth (Figure 6A). Western blot analysis revealed that PKCζ but not PKCι/λ
was expressed in the rescue embryos whereas PKCζ was not expressed in the wild-type
(Figure 6D). Thus, PKCζ is able to compensate for PKCι/λ in vivo function at E7.5 but
not at later stages.
Discussion
The aim of this study was to shed more light on early embryonic in vivo functions of PKCι/λ in
mouse. Earlier genetic studies in C. elegans, Xenopus and Drosophila melanogaster
indicated a pivotal role of aPKC in the establishment and maintenance of polarity of
oocytes and epithelial cells {Izumi:1998tb, Tabuse:1998vr, Cha:2011di, Dominguez:
1992vl}. These findings were mainly connected to the functional and physical association
of aPKC to par3 and par6, which together form the polarity complex {Suzuki:2006ke}.
This ternary complex is conserved among species suggesting a related phenotype upon
depletion of PKCι/λ in mouse embryos. In fact a report by Soloff et. al, 2004 described an
embryonic lethal phenotype when the PKCι/λ gene was knocked out by conventional
gene targeting without a detailed developmental analysis. Both of our generated knock
out mouse lines for PKCι/λ showed an embryonic lethal phenotype with first
morphological manifestations around E7.5. Mutant embryos appeared compressed and
are characterized by a severely reduced amniotic cavity. Nevertheless a histological
examination revealed still the existence of epithelial cells which was rather unexpected
since all studies from other species identified alterations in epithelial cell layers. So far
publications describing gene knockouts in mice of polarity related proteins do not exactly
match phenotypically with the PKCι/λ knockout. For example a conventional knock out
of cdc42, an established activator of aPKCs in the context of the par3/aPKC/par6
complex, revealed a much earlier phenotype. Embryos deficient for cdc42 showed first
signs of alterations at E5.5 and were degraded at E6.5 {Chen:2000gp}. Rac1, another
small GTPase, which had been implicated many times as signal mediator of aPKC
signaling also revealed an earlier phenotype in the knockout. In this case the main cause
of lethality was linked to failures in the actin cytoskeletal reorganization combined with
reduced motility and increased programmed cell death {Sugihara:1998ii}. A complete
knock out of par3 caused mid-gestational embryonic lethality (around E9.5) which was
correlated to a defective cardiac development {Hirose:2006ih}. Unfortunately published
data on a par6 knockout in mice are currently not available to our knowledge. One of the
most similar knock outs published so far, when taking morphological criteria into
account, is represented by the afadin knockout. Similar to the PKCι/λ knockout
morphological changes occurred at E7.5 and resembled what we saw in the PKCι/λ
deficiency (compressed embryo and small amniotic cavity) {WataruIkeda:1999ws}.
Nevertheless the described disorganized cell-cell junctions did not exactly match our
observation. Interestingly afadin has been described as adapter protein connecting nectin
to actin filaments {Komura:2007km} and to colocalize with par3/aPKC at adherens
junctions in the neuroepithelium of the developing mouse central nervous system [55].
Thus a similar function earlier during development is conceivable but further experiments
are needed to underpin this hypothesis.
Our marker analysis revealed that PKCι/λ-deficient embryos start to gastrulate and
establish distinct anterior-posterior and dorso-ventral body axes at around E7.5-E7.75.
However, axial elongation and mesoderm formation arrests around this stage and
elaboration of all mesodermal tissues and organs fails. Absence of a functional
cardiovascular system is the cause of the subsequent death. Given the fact that all
embryonic tissue are affected our data suggest that PKCι/λ is not regionally but cellularly
required.
Applying the embryonic body formation assay we showed that mutant EBs failed to
establish a single cavity instead they formed multiple small cavities. Nevertheless a
proper formation of the basal lamina and the apical domain by various marker proteins
could be detected (see figure 3). Particular the correct localization of par3 and Mupp1
implied an established apical pole which to some content did not surprise since studies
performed in C. elegans showed that loss of PKC-3 did not affect par3 localization either
[56]. Interestingly EBs deficient for cdc42 not only fail to form a single lumen cavity but
also showed a complete loss of aPKC and par3 localization at the apical domain [57].
One reason for this difference might be that cdc42 is not able to distinguish between the
two aPKC isoforms and we showed that PKCζ is still present in PKCι/λ deficient EBs.
Thus we assume that depletion of cdc42 resulted in a robust reduction of both aPKC
activities causing a more severe phenotype. This finds support by the fact that
overexpression of a dominant negative aPKCζ version in wild-type EBs mimics the
cdc42 phenotype [57]. The formation of a single cavity has been described as a two-step
process: first, multiple small lumen are formed in the periphery of the EB and within a
second step smaller lumen are fused and remaining inner cells undergo apoptosis to clear
the central lumen [42]. Our data suggest that the loss of PKCι/λ did not interfere with the
first step but disrupted the second. Whether PKCι/λ acts on the fusion of the small
cavities or the subsequently induced apoptosis or both is not solved yet but from our data
it´s clear that PKCι/λ deficiency caused a decrease of activated caspase-3 and less
apoptotic cells in EBs.
The immunohistochemical analysis of E7.5 embryo sections revealed by the E-cadherin
staining that the general polarity of the embryonic ectoderm is preserved in mutants. But
it became apparent that the fine structure of the apical side is changed (indicated by its
fuzzy appearance) when compared to the wild-type at higher magnification (Figure 4 C).
As a possible explanation we found ZO-1, a tight junction protein, to be down-regulated
and dislocated in epithelial cells deficient for PKCι/λ. ZO-1 is believed to function as a
junctional organizer by direct binding to tight junctional proteins (like occludin and
claudins) and the actin cytoskeleton. Thus it could well be that the absence of ZO-1 in
tight junction complexes could lead to a lack of proper connections of tight junctions to
the actin cytoskeleton, causing a less well organized actin belt at the apical side which
leads to the initially observed fuzzy appearance. This hypothesis finds support by the EM
analysis, which clearly showed that F-actin filaments are less compact organized and the
distance between the outer membrane and the F-actin filaments appears to be increased in
mutants. Nevertheless a conventional ZO-1 knockout displayed a later phenotype mainly
associated with defect in angiogenesis and increased apoptosis [58]. One plausible
explanation for this might be the existence of compensatory mechanisms in the ZO-1
knock out, which do not exist in the PKCι/λ deficiency. As for example the remaining
ZO-2/3 proteins might function redundant when ZO-1 was deleted whereas a knockout of
a crucial downstream kinase cannot be compensated for in this system.
When analyzing aPKCs cellular localization (Figure 4B) we mainly detected aPKC at the
apical side, representing the expected pattern for aPKC in epithelial cell layer [59-61]. To
our surprise a nearly unchanged pattern was detected in mutants as well, indicating that
either aPKCs share overlapping expression domains or PKCζ becomes up-regulated in
mutants. We favor the first since neither a semi-quantitative PCR nor a Western Blot
analysis of E7.5 PKCɩ△/+ and E8.5 aPKCɩΔ/Δ was able to identify an up-regulation of
PKCζ (supplementary Figure 3). Thus, we assume that PKCζ can potentially take part at
the predicted in vivo function of aPKCs with regard on the establishment and
maintenance of polarity due to its cellular localization, thereby might compensate for
PKCι/λ deficiency. In addition the increased cellular localization pattern of PKCι/λ,
identified by a specific antibody, implied that PKCι might fulfill other in vivo functions
than the ones predicted by its association to the par3 and par6 proteins.
When PKCζ was expressed under the same spatial and temporal conditions like PKCι/λ
(PKCɩζRes/ζRes allele) we were not able to detect embryos at E7.5 displaying the
morphological changes described earlier. We concluded that PKCζ is able to compensate
for PKCι/λ in vivo function at E7.5 when expressed at higher levels than in the wild-type.
Thus the originally defined PKCι/λ specific in vivo function at E7.5 represents an aPKC
signalling pathway which became PKCι/λ specific through a very tight transcriptional
control. Interestingly the PKCɩζRes allele is not able to compensate for PKCι/λ functions at
E9.5 since embryos homozygous for this allele showed a clear growth retardation
resulting in lethality one to two days later. This points to the fact that later during
development PKCι/λ in vivo function exists which are not redundant among the aPKC
subfamily and could therefore be described as isoform-specific.
In summary we showed that the depletion of PKCι/λ caused embryonic lethality with the
earliest time-point of visible morphological changes at E7.5. To our surprise we still
detected a strong staining for aPKC at the apical membrane in PKCι/λ deficient embryos
indicating that a reasonable amount of PKCζ still localize to this area. This per se might
be a reason why the basal to apical cell architecture in PKCι/λ deficient embryos was still
conserved. In addition it also identified a possible PKCζ function in this context by its
very precise localization which by far was not expected based on expression data earlier
published. As a consequence of PKCι deficiency we identified a severe down-regulation
of ZO-1 which could explain the subtle alteration in the cellular structure. Nevertheless
the cellular mechanism of PKCι/λ in vivo function at E7.5 remained unsolved.
Interestingly PKCζ was able to rescue the PKCι/λ deficient phenotype when expressed at
the same levels like PKCι/λ. This identifies the aPKCs as a very redundant kinase
subfamily in which transcriptional as well as spatial cues regulate its isoform specificity.
Materials and Methods
Generation of mutant Prkci alleles: To clone the mouse Prkci locus a 129/Ola genomic
cosmid library (obtained from the Resourcenzentrum, Berlin, Germany) was screened
using a full length mouse cDNA as a probe. Several cosmid clones were identified and
further purified. One of those containing the genomic 5´prime part of the gene was
selected for further cloning. To generate several targeting constructs for the PKCι/λ gene
a 10.9 kb genomic EcoRI fragment, including the 2nd exon, was subcloned into a
bluescript backbone. The convential targeting vector was generated by inserting an
independent neo-cassette (derived from pMC1neoPolyA from Stratagene) into a Sal I
restriction site, which was introduced into the 2nd exon by site directed mutagenesis. The
conditional targeting vector was generated by introducing a single loxP site into the
EcoRV restriction site 3.3 kb located upstream of the 2nd exon and insertion of a loxPflanked neo-cassette into a BglII restriction site 1.5 kb downstream of the 2nd exon. The
PKCι/λ rescue targeting vector was generated by introducing an appropriate PKCζ
cDNA fragment into the SalI restriction site introduced by mutation within the 2nd exon
which corresponds to the 29th codon. The PKCζ cDNA fragment contained the complete
3´untranslated PKCι/λ UTR and a loxP-flanked neo-cassette along with the coding
sequence. All three targeting vectors were linearized before electroporation in ES cells of
the E14.1 background (129/Ola). For each electroporation 2 x 96 G418-resistant ES cell
clones were screened for homologous recombination in the PKCι/λ gene locus by
Southern blot analysis. For each construct at least 2 ES cell clones were identified proved
to be correctly targeted. These were further used for injections into NMRI blastocysts.
Chimeric males were obtained for each construct and subsequently mated to NMRI
females to test for germ-line transmission. Each targeted mutation gave rise to F1
heterozygous males which were then further used for establishing the corresponding
mouse lines for phenotypic analysis.
Mice and genonotyping: Mice carrying a null allele of Prkci and the PKCɩζRes allele were
maintained on an outbred (NMRI) background. For timed pregnancies, vaginal plugs
were checked in the morning after mating; noon was taken as embryonic day (E) 0.5.
Pregnant females were sacrificed by cervical dislocation; embryos were harvested in
phosphate-buffered saline, decapitated, fixed in 4% paraformaldehyde overnight, and
stored in 100% methanol at -20°C before further use. Genomic DNA prepared from yolk
sacs or tail biopsies was used for genotyping by polymerase chain reaction (PCR).
Ethics statement: All animal work conducted for this study was approved by … and
performed according to Norwegian and German legislation.
Hematoxylin and eosin staining of embryonic sections: For histological analysis, wildtype or aPKC mutant embryos were fixed in 4% paraformaldehyde and embedded in
paraffin wax. Sections of 4 µm were processed for cytohistochemistry after deparaffinization. After rehydration the section were incubated in 1x Gill’s Hematoxylin
(haematoxylin 6.0g, aluminum sulphate 42.0g, ethylene glycol 269ml, citric acid 1.4g,
sodium iodate 0.6g, distilled water 680ml) for 5 minutes. After washing the samples were
incubated in acid alcohol (1% HCl in 70% EtOH) and washed again. After incubation in
ammonia water the samples were rinsed and incubated in eosin Y (Sigma-Aldrich,
HT110132-1L) for 1 minute. Before mounting with a xylene-based mounting medium
cells were dehydrated. Embryos were documented using Zeiss Lumar V.12 with
AxioCam HRc camera.
Whole mount RNA in situ analysis: Whole-mount in situ hybridization on E8.5 embryos
was performed following a standard procedure with digoxigenin-labeled antisense
riboprobes [62]
Embryoid body culture and processing: The ES cell line used for this study were wildtype E14 and aPKCɩΔ/Δ ES cells [43]. Wild-type and aPKCɩΔ/Δ ES cells were cultured
on mitomycin C-treated STO cells. EB formation was initiated from ES cell aggregates in
suspension culture as described previously (Li 2006). For immunofluorescence, EBs were
collected into 15-ml conical tubes, allowed to sediment by gravity, washed once in
phosphate-buffered saline (PBS), and fixed with 3% paraformaldehyde. EBs were then
embedded in OCT compound, sectioned on a Leica cryostat and immunostained for
antigens of interest (Li 2006). F-actin was stained with rhodamine-phalloidin (Molecular
Probes). Nuclei were counterstained with DAPI. Slides were examined with a Nikon
inverted fluorescence microscope (Eclipse TE 2000) and digital images were acquired
with a cooled CCD camera (Hamamatsu) controlled by IP Lab 4.0 software (Scanalytics).
For immunoblotting, EBs were washed 3 times in PBS and lysed in SDS lysis buffer (50
mM Tris, pH 7.4, 150 mM NaCl, 1% SDS) containing protease and phosphatase inhibitor
cocktails. Protein concentrations were determined using BCA reagents (Pierce). Proteins
of equal loads were resolved by SDS-PAGE and then transferred onto PVDF membranes,
which were blocked with 5% nonfat dry milk. After incubation with primary antibodies,
specific signals were detected with HRP-conjugated secondary antibodies and ECL
reagents. Antibodies used: PKCζ rabbit polyclonal antibody (Cat# 07-264) and GAPDH
mouse monoclonal antibody were purchased from Millipore. Perlecan rat monoclonal
antibody was purchased from Santa Cruz Biotechnology, Inc. Cleaved caspase-3 rabbit
polyclonal antibody was bought from Cell Signaling Technology. Actin polyclonal
antibody was bought from Sigma.
Immunohistochemistry and imaging analysis: For Immunohistological analysis, wild-type
and aPKC mutant embryos were fixed in 4% paraformaldehyde and embedded in paraffin
wax following standard protocols. Sections of 4 µm were processed for
immunohistochemistry. Antigen retrieval was performed after de-waxing to enhance
staining. Sections were then incubated with 5% fetal calf serum for 1 hour, and then
washed three times with sterile PBS (pH 7.5) prior to overnight incubation with the
appropriate primary antibodies at optimal dilutions (aPKCζ, SantaCruz, 1:200; aPKCɩ,
1:5000; aPKCζ, 1:7500 [47]; claudin, Zymed, 1:500; Occludin, Zymed, 1:500; ZO-1,
Zymed, 1:100; cleaved caspase-3, Cell Signaling, 1:500, phistone 3, Cell Signaling,
1:500, E-cadherin, Santa Cruz, 1:500). The secondary antibody, AlexaFluor 647
conjugated anti-rabbit antibody was bought from InvitrogenⓇ, was used in a 1:1000
dilution and overnight incubation. The section were then mounted in Prolong Gold with
DAPI reagent from InvitrogenⓇ (#P36930). Images were taken with the Zeiss LSM 510
Meta invert microscope equipped with a Zeiss LSM laser module and a AxioCam HMR
digital camera.
Electron microscopy: The embryos were fixed in 2% glutaraldehyde in 0.1 M sodium
cacodylate buffer. After washing, specimens were rinsed twice for 10 min in 0.1 M
sodium cacodylate buffer and postfixed with 2% osmiumtetroxide (OsO4) containing
1.5% potassium ferric cyanide ((K3Fe(CN)6)) for 1 h. Following extensive rinsing with
water, dehydration with an alcohol series was performed. Specimens were placed in
100% alcohol and Epon 1:1 overnight and then embedded in pure Epon. Ultrathin
sections were cut with a Leica microtome for TEM microscopy and placed on carbon
coated copper grids. Images were taken with a Philips CM 100 transmission electron
microscope (TEM) at various magnifications.
Western blot analysis of embryos: Embryos were collected isolated at either E7.5 or E9.5
from the mother animal. All extraembryonic tissue was removed before lysing the whole
embryo in protein extraction buffer for 20 min. on ice (50mM Tris/HCl, pH 7.5-8.0; 2
mM EDTA, pH7.0; 10 mM EGTA, pH 7.0; 0.1% TritonX-100, 3% β-mercaptoethanol)
supplemented with Proteinase Inhibitor Cocktail (Sigma, #P-2714). A 31 gauge syringe
was used to disrupt the tissue. The samples were centrifuged at 8.000rpm for 8 min and
the supernatant was transferred into a new tube before supplementing protein sample
loading buffer and boiling for 5 min. The samples analyzed on a 10% SDSpolyacrylamide gel and blotted onto BioRad nitrocellulose membranes. The membranes
were blocked in 5% nonfat dry milk in TBST for 1 h at room temperature. Incubation
with the primary antibody overnight in TBST at 4℃. The following antibodies were
used: anti-PKCζ (Santa Cruz, C-20), anti aPKCɩ 1:10.000, anti-aPKCζ 1:5000.
Semi-quantitative RT-PCR analysis: Embryos were isolated at appropriate stage and
directly lysed in TRIZOL reagent from InvitrogenⓇ . The RNA isolation was performed
according to the TRIZOL manual. The reverse transcription to obtain cDNA was
performed using the iSCRIPT- cDNA synthesis kit from Bio-RAD. For the expression
analysis the HotStar Taq PLus DNA Polymerase from Qiagen in combination with
following primers was used: ZO-1 (forward-primer AGCTGTTTCCTCCATTGCTG,
reverse-primer: GAGATGTTTATGCGGACGGT), aPKCζ (forward-primer:
G C C T C C C T T C C A G C C C C A G A , r e v e r s e - p r i m e r :
CACGGACTCCTCAGCAGACAGCA) and aPKCɩ (forward-primer:
AGGAACGATTGGGTTGTCAC, reverse-primer: GGCAAGCAGAATCAGACACA).
All primers were designed with an optimal annealing temperature at 60℃ and a amplicon
size of around 300bp.
Acknowledgments
Judit Kovac for her initial help during the generation of the PKCɩζRes/+ allele. Heinz
Schwarz and Gareth Griffiths for discussion on the EM data. Sebastian Seidl received
funding from the University of Oslo (MLS)
References
1. Ono Y, Fujii T, Ogita K, Kikkawa U, Igarashi K, et al. (1989) Protein kinase C zeta
subspecies from rat brain: its structure, expression, and properties. Proc Natl
Acad Sci USA 86: 3099–3103.
2. Selbie LA, Schmitz-Peiffer C, Sheng Y, Biden TJ (1993) Molecular cloning and
characterization of PKC iota, an atypical isoform of protein kinase C derived
from insulin-secreting cells. J Biol Chem 268: 24296–24302.
3. Akimoto K, Mizuno K, Osada S, Hirai S, Tanuma S, et al. (1994) A new member of
the third class in the protein kinase C family, PKC lambda, expressed
dominantly in an undifferentiated mouse embryonal carcinoma cell line and
also in many tissues and cells. Journal of Biological Chemistry 269: 12677.
4. Hernandez AI, Blace N, Crary JF, Serrano PA, Leitges M, et al. (2003) Protein
kinase M zeta synthesis from a brain mRNA encoding an independent protein
kinase C zeta catalytic domain. Implications for the molecular mechanism of
memory. J Biol Chem 278: 40305–40316. doi:10.1074/jbc.M307065200.
5. Puls A, Schmidt S, Grawe F, Stabel S (1997) Interaction of protein kinase C zeta
with ZIP, a novel protein kinase C-binding protein. Proc Natl Acad Sci USA
94: 6191–6196.
6. Sanchez P, De Carcer G, Sandoval IV, Moscat J, Diaz-Meco MT (1998)
Localization of atypical protein kinase C isoforms into lysosome-targeted
endosomes through interaction with p62. Molecular and Cellular Biology 18:
3069–3080.
7. Hirano Y (2004) Solution Structure of Atypical Protein Kinase C PB1 Domain and
Its Mode of Interaction with ZIP/p62 and MEK5. Journal of Biological
Chemistry 279: 31883–31890. doi:10.1074/jbc.M403092200.
8. Noda Y (2003) Molecular Recognition in Dimerization between PB1 Domains.
Journal of Biological Chemistry 278: 43516–43524. doi:10.1074/
jbc.M306330200.
9. Nakanishi H, Brewer KA, Exton JH (1993) Activation of the zeta isozyme of
protein kinase C by phosphatidylinositol 3,4,5-trisphosphate. Journal of
Biological Chemistry.
10. Diaz-Meco MT, Municio MM, Sanchez P, Lozano J, Moscat J (1996) Lambdainteracting protein, a novel protein that specifically interacts with the zinc
finger domain of the atypical protein kinase C isotype lambda/iota and
stimulates its kinase activity in vitro and in vivo. Molecular and Cellular
Biology 16: 105–114.
11. Suzuki A (2003) Protein Kinase C lambda/iota (PKClambda/iota): A PKC Isotype
Essential for the Development of Multicellular Organisms. J Biochem 133: 9–
16. doi:10.1093/jb/mvg018.
12. Tabuse Y (2002) Protein kinase C isotypes in C-elegans. J Biochem 132: 519–522.
13. Schaeffer E, Smith D, Mardon G, Quinn W, Zuker C (1989) Isolation and
characterization of two new drosophila protein kinase C genes, including one
specifically expressed in photoreceptor cells. Cell 57: 403–412.
14. Kovac J, Oster H, Leitges M (2007) Expression of the atypical protein kinase C
(aPKC) isoforms ι/λ and ζ during mouse embryogenesis. Gene Expression
Patterns 7: 187–196. doi:10.1016/j.modgep.2006.07.002.
15. Oster H, Eichele G, Leitges M (2004) Differential expression of atypical PKCs in
the adult mouse brain. Brain Res Mol Brain Res 127: 79–88. doi:10.1016/
j.molbrainres.2004.05.009.
16. Berra E, Diaz-Meco MT, Lozano J, Frutos S, Municio MM, et al. (1995) Evidence
for a role of MEK and MAPK during signal transduction by protein kinase C
zeta. EMBO J 14: 6157–6163.
17. Lin D, Edwards AS, Fawcett JP, Mbamalu G, Scott JD, et al. (2000) A mammalian
PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC signalling and
cell polarity. Nat Cell Biol 2: 540–547. doi:10.1038/35019582.
18. Regala RP (2005) Atypical Protein Kinase C Is an Oncogene in Human NonSmall Cell Lung Cancer. Cancer Research 65: 8905–8911. doi:
10.1158/0008-5472.CAN-05-2372.
19. Baye LM, Link BA (2007) Interkinetic nuclear migration and the selection of
neurogenic cell divisions during vertebrate retinogenesis. Journal of
Neuroscience 27: 10143–10152. doi:10.1523/JNEUROSCI.2754-07.2007.
20. Pauken C (2000) The Expression and Stage-Specific Localization of Protein
Kinase C Isotypes during Mouse Preimplantation Development.
Developmental Biology 223: 411–421. doi:10.1006/dbio.2000.9763.
21. Leitges M, Sanz L, Martin P, Duran A, Braun U, et al. (2001) Targeted disruption
of the [zeta] PKC gene results in the impairment of the NF-[kappa] B pathway.
Molecular Cell 8: 771–780.
22. Martin P, Duran A, Minguet S, Gaspar M-L, Diaz-Meco M-T, et al. (2002) Role of
zeta PKC in B-cell signaling and function. EMBO J 21: 4049–4057.
23. Galvez AS, Duran A, Linares JF, Pathrose P, Castilla EA, et al. (2008) Protein
Kinase C Represses the Interleukin-6 Promoter and Impairs Tumorigenesis In
Vivo. Molecular and Cellular Biology 29: 104–115. doi:10.1128/MCB.
01294-08.
24. Soloff RS, Katayama C, Lin MY, Feramisco JR, Hedrick SM (2004) Targeted
deletion of protein kinase C lambda reveals a distribution of functions between
the two atypical protein kinase C isoforms. J Immunol 173: 3250–3260.
25. Farese RV, Sajan MP, Yang H, Li P, Mastorides S, et al. (2007) Muscle-specific
knockout of PKC-λ impairs glucose transport and induces metabolic and
diabetic syndromes. J Clin Invest 117: 2289–2301. doi:10.1172/JCI31408.
26. Huber TB, Hartleben B, Winkelmann K, Schneider L, Becker JU, et al. (2009)
Loss of podocyte aPKClambda/iota causes polarity defects and nephrotic
syndrome. J Am Soc Nephrol 20: 798–806. doi:10.1681/ASN.2008080871.
27. Joberty G, Petersen C, Gao L, Macara IG (2000) The cell-polarity protein Par6
links Par3 and atypical protein kinase C to Cdc42. Nat Cell Biol 2: 531–539.
28. Guo S, Kemphues KJ (1995) par-1, a gene required for establishing polarity in C.
elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically
distributed. Cell 81: 611–620.
29. Etienne-Manneville S, Hall A (2003) Cell polarity: Par6, aPKC and cytoskeletal
crosstalk. Curr Opin Cell Biol 15: 67–72.
30. Watts JL, Etemad-Moghadam B, Guo S, Boyd L, Draper BW, et al. (1996) par-6, a
gene involved in the establishment of asymmetry in early C. elegans embryos,
mediates the asymmetric localization of PAR-3. Development 122: 3133–
3140.
31. Suzuki A (2006) The PAR-aPKC system: lessons in polarity. Journal of Cell
Science 119: 979–987. doi:10.1242/jcs.02898.
32. Yang JQ, Leitges M, Duran A, Diaz-Meco MT, Moscat J (2009) Loss of PKCλ/ι
impairs Th2 establishment and allergic airway inflammation in vivo. Proc Natl
Acad Sci USA 106: 1099.
33. Murray NR, Weems J, Braun U, Leitges M, Fields AP (2009) Protein Kinase C II
and PKC / : Collaborating Partners in Colon Cancer Promotion and
Progression. Cancer Research 69: 656–662. doi:
10.1158/0008-5472.CAN-08-3001.
34. F Schwenk UBKR (1995) A cre-transgenic mouse strain for the ubiquitous
deletion of loxP-flanked gene segments including deletion in germ cells.
Nucleic Acids Research 23: 5080.
35. Monaghan AP, Grau E, Bock D, Schutz G (1995) The mouse homolog of the
orphan nuclear receptor tailless is expressed in the developing forebrain.
36. Rowitch DH, McMahon AP (1995) Pax-2 expression in the murine neural plate
precedes and encompasses the expression domains of Wnt-1 and En-1. Mech
Dev 52: 3–8.
37. Crossley PH, Martin GR (1995) The mouse Fgf8 gene encodes a family of
polypeptides and is expressed in regions that direct outgrowth and patterning
in the developing embryo. Development 121: 439–451.
38. Wilkinson DG, Bhatt S, Herrmann BG (1990) Expression pattern of the mouse T
gene and its role in mesoderm formation. Nature 343: 657–659. doi:
10.1038/343657a0.
39. Burgess R, Cserjesi P, Ligon KL, Olson EN (1995) ScienceDirect.com Developmental Biology - Paraxis: A Basic Helix-Loop-Helix Protein
Expressed in Paraxial Mesoderm and Developing Somites. Developmental
Biology.
40. Kraus F, Haenig B, Kispert A (2001) Cloning and expression analysis of the
mouse T-box gene tbx20. Mech Dev 100: 87–91.
41. Delorme B, Dahl E, Jarry-Guichard T, Briand JP, Willecke K, et al. (1997)
Expression pattern of connexin gene products at the early developmental
stages of the mouse cardiovascular system. Circ Res 81: 423–437.
42. Coucouvanis E, Martin GR (1995) Signals for death and survival: a two-step
mechanism for cavitation in the vertebrate embryo. Cell 83: 279–287.
43. Bandyopadhyay G (2003) Protein Kinase C- Knockout in Embryonic Stem Cells
and Adipocytes Impairs Insulin-Stimulated Glucose Transport. Molecular
Endocrinology 18: 373–383. doi:10.1210/me.2003-0087.
44. Li S, Harrison D, Carbonetto S, Fässler R, Smyth N, et al. (2002) Matrix
assembly, regulation, and survival functions of laminin and its receptors in
embryonic stem cell differentiation. The Journal of Cell Biology 157: 1279–
1290. doi:10.1083/jcb.200203073.
45. Murray P, Edgar D (2000) Regulation of Programmed Cell Death by Basement
Membranes in Embryonic Development. The Journal of Cell Biology.
46. Cooper AR, MacQueen HA (1983) Subunits of laminin are differentially
synthesized in mouse eggs and early embryos. Developmental Biology 96:
467–471.
47. Helfrich I, Schmitz A, Zigrino P, Michels C, Haase I, et al. (2006) Role of aPKC
Isoforms and Their Binding Partners Par3 and Par6 in Epidermal Barrier
Formation. J Investig Dermatol 127: 782–791. doi:10.1038/sj.jid.5700621.
48. Izumi Y, Hirose T, Tamai Y, Hirai S, Nagashima Y, et al. (1998) An atypical PKC
directly associates and colocalizes at the epithelial tight junction with ASIP, a
mammalian homologue of Caenorhabditis elegans polarity protein PAR-3. The
Journal of Cell Biology 143: 95–106.
49. Tabuse Y, Izumi Y, Piano F, Kemphues KJ, Miwa J, et al. (1998) Atypical protein
kinase C cooperates with PAR-3 to establish embryonic polarity in
Caenorhabditis elegans. Development 125: 3607–3614.
50. Cha S-W, Tadjuidje E, Wylie C, Heasman J (2011) The roles of maternal Vangl2
and aPKC in Xenopus oocyte and embryo patterning. Development 138:
3989–4000. doi:10.1242/dev.068866.
51. Dominguez I, Diaz-Meco MT, Municio MM, Berra E, García de Herreros A, et al.
(1992) Evidence for a role of protein kinase C zeta subspecies in maturation of
Xenopus laevis oocytes. Molecular and Cellular Biology 12: 3776–3783.
52. Chen F, Ma L, Parrini MC, Mao X, Lopez M, et al. (2000) Cdc42 is required for
PIP2-induced actin polymerization and early development but not for cell
viability. Current Biology 10: 758–765. doi:10.1016/S0960-9822(00)00571-6.
53. Sugihara K, Nakatsuji N, Nakamura K, Nakao K, Hashimoto R, et al. (1998) Rac1
is required for the formation of three germ layers during gastrulation.
Oncogene 17: 3427–3433. doi:10.1038/sj.onc.1202595.
54. Hirose T, Karasawa M, Sugitani Y, Fujisawa M, AKIMOTO K, et al. (2006) PAR3
is essential for cyst-mediated epicardial development by establishing apical
cortical domains. Development 133: 1389–1398. doi:10.1242/dev.02294.
55. Wataru Ikeda HNJMKMHIMTATKTHNHYAMS-INYT (1999) Afadin: A Key
Molecule Essential for Structural Organization of Cell–Cell Junctions of
Polarized Epithelia during Embryogenesis. The Journal of Cell Biology 146:
1117.
56. Komura H, Ogita H, Ikeda W, Mizoguchi A, Miyoshi J, et al. (2007)
Establishment of cell polarity by afadin during the formation of embryoid
bodies. Genes to Cells 13: 79–90. doi:10.1111/j.1365-2443.2007.01150.x.
57. Wu X, Li S, Chrostek-Grashoff A, Czuchra A, Meyer H, et al. (2007) Cdc42 is
crucial for the establishment of epithelial polarity during early mammalian
development. Dev Dyn 236: 2767–2778. doi:10.1002/dvdy.21309.
58. Katsuno T, Umeda K, Matsui T, Hata M, Tamura A, et al. (2008) Deficiency of
zonula occludens-1 causes embryonic lethal phenotype associated with
defected yolk sac angiogenesis and apoptosis of embryonic cells. Mol Biol
Cell 19: 2465–2475. doi:10.1091/mbc.E07-12-1215.
59. Morais-de-Sá E, Mirouse V, St Johnston D (2010) aPKC Phosphorylation of
Bazooka Defines the Apical/Lateral Border in Drosophila Epithelial Cells. Cell
141: 509–523. doi:10.1016/j.cell.2010.02.040.
60. Ishiuchi T, Takeichi M (2011) Willin and Par3 cooperatively regulate epithelial
apical constriction through aPKC-mediated ROCK phosphorylation. Nat Cell
Biol 13: 860–866. doi:10.1038/ncb2274.
61. Hao Y, Du Q, Chen X, Zheng Z, Balsbaugh JL, et al. (2010) Par3 controls
epithelial spindle orientation by aPKC-mediated phosphorylation of apical
Pins. Curr Biol 20: 1809–1818. doi:10.1016/j.cub.2010.09.032.
62. Wilkinson DG, Nieto MA (1993) Detection of messenger RNA by in situ
hybridization to tissue sections and whole mounts. Meth Enzymol 225: 361–
373.
Figure Legends
Figure 1: Histological overview of E7.5 and E8.5 embryos. (A) Sagittal sections of wildtype and aPKCɩΔ/Δ embryos at E7.5 (right). Image of the corresponding embryo (left)
(B) Sagittal sections of wild-type and aPKCɩΔ/Δ embryos at E8.5 (right). Image of the
corresponding embryo (left). Abbreviations: ac, amniotic cavity; all, allantois; am,
amnion; ec, ectoplacental cavity; fnf, forebrain neural-fold; hb, hindbrain; mb, midbrain;
h, heart; ps, primitive streak; S=somites; tl; tiny lumina.
Figure 2: Whole-mount in situ hybridization analysis of markers for germ line formation
and establishment of an anterior-posterior body axis in E8.5 embryos.
Figure 3: Immunofluorescence analysis of embryoid bodies (EBs) from either wild-type
(WT) or aPKCɩΔ/Δ. (A) EBs from WT and aPKCɩΔ/Δ ES cells were stained with
Rhodamin-Phalloidin (red, F-actin) and an antibody against Laminin-ɑ1 (green, Lm ɑ1).
(B) Phase-contrast picture of 5 days old WT and aPKCɩΔ/Δ EBs. (C) Statistical analysis
of lumen formation of 5 days and 7days old EBs from WT and aPKCɩΔ/Δ ES cells. (D)
EBs from WT and aPKCɩΔ/Δ ES cells were stained with antibodies against cleaved
caspase-3 (green, cleaved cas-3) and perlecan (red). (E) WB analysis of activated
caspase-3 at different time-points in WT and aPKCɩΔ/Δ EBs. (F) Immunofluorescence
analysis of EBs from either WT or aPKCɩΔ/Δ ES cells including localization of Ecadherin, MUPP1, Par3 and GM130 (green), perlecan and laminin ɑ1 (red) (G) EBs from
WT and aPKCɩΔ/Δ ES cells were stained with antibodies against perlecan (green) and
aPKCzeta (red, PKCζ). (H) WB analysis of PKCζ in 4days and 5days old WT and
aPKCɩΔ/Δ EBs. Nucleus staining was performed with DAPI. Scale is as indicated.
Figure 4: Immunofluorescence analysis of marker proteins in aPKCɩΔ/Δ embryos:
Analysis were performed using the indicated antibodies. (A) Overview of a section
showing a complete embryo with immunostaining against E-cadherin (E-cad). (B)
Immunofluorescence analysis of aPKC localization at the apical pole of wt and PKCɩdeficient embryos in high magnification. (C) Immunofluorescence analysis of proteins
involved in cellular polarity (E-cad, E-cadherin; Occl., Occludine; ZO-1, Zonula
Occludens-1). Localization of Occl. is indicated by open arrows and the localization of
ZO-1 by solid arrows. The scale bars indicate 20µm.
Figure 5: Electron microscopic analysis of aPKCɩ-deficient embryos: Embryos were
isolated at E7.5. (A) Apical junctional complex (AJC) formation in wild-type (aPKCɩ-wt)
and aPKCɩ-deficient (aPKCɩΔ/Δ) embryos was compared. Functional complexes are
indicated: tight junction (TJ), adherens junctions (AJ) and desmosomes (DS). The
amniotoc cavity is indicated by an asterix. (B) Arrows indicate intracellular space in the
apicobasal membrane in aPKCɩ-wt and aPKCɩΔ/Δ embryos. The orientation of the
images is comparable to the images in A. (C) Arrows indicate the F-actin bundles parallel
to the cell-membrane in aPKCɩ-wt and aPKCɩΔ/Δ embryos. EM analysis was performed
as described in Materials and methods. Representative micrographs are presented. Bar is
equivalent to 200 micrometer (200 μm).
Figure 6: Overexpression of aPKCζ rescues PKCɩ KO phenotype: (A) Comparison of the
appearance of embryos, that are either wt, heterozygous for the rescue allele (PKCƖζRes/+)
or homozygous for the rescue (PKCƖζRes/ζRes) allele embryos at embryonic stage E9.5. (B)
Table containing the total numbers of analyzed embryos at stage E7.5 and E9.5 and the
corresponding percentage of the genotypes. (C) Western blot analysis of E7.5 embryos
using an antibody against pan-aPKC (D) Western blot analysis of E9.5 embryos using
indicated antibodies.
Supplementary figure 1: Targeting of the PKCι/λ locus in mice. A) Schematic
representation of the chosen targeting strategy. A restriction map indicating relevant
restriction sites of the wild-type locus is shown. The black box represents the second
exon of the PKCι/λ gene which was further used for all targeted modifications. The 2
white boxes below indicate the 5´HindIII-EcoRI RFLP probe and the 3´KpnI-EcoRI
RFLP probe used for later southern blot analysis. Generated targeting constructs are listed
below; convential - harbors an inserted neo cassette into the 2nd exon, conditional contains a single LoxP site 5´ and a floxed neo cassette 3´ of the 2nd exon and lastly
rescue - represents an inserted PKCζ cDNA into the coding sequence of the 2nd exon
followed by a floxed neo cassette. Resulting targeted alleles after homologous
recombination and subsequent Cre expression are indicated. B, BamHI; Bg, BglII; E,
EcoRI; EV, EcoRV; H, HindIII; K, KpnI. B) Southern blot analysis of embryonic stem
cell clones after G418 selection (PKCι/λ Neo allele; PKCι/λ floxed allele) and
heterozygous offspring from intercrosses of the PKCι/λ Δ allele and PKCι/λ ζRes allele.
From left to right; BamHI RFLP using the 5´probe identifies 2 clones of the convential
targeting by a 6.5kb band whereas the 8.0 kb band represents the wild-type band, HindIII
RFLP using the 5´probe identifies 1 targeted ES clone for the floxed allele (2.0kb band);
the PKCι/λ Δ allele was characterized by EcoRI using the 3´probe resulting in a 11.0kb
wild-type and a 3.2kb mutant band and by BglII in association with the 5´probe resulting
in a 8.4kb wild-type and 10.4kb mutant band, the PKCι/λ ζRes allele was characterized
by EcoRI using the 3´probe resulting in a 11.0kb wild-type and a 5.1kb mutant band and
by BglII in association with the 5´probe resulting in a 8.4kb wild-type and 14.4kb mutant
band. C) PCR genotyping of DNA samples generated from progeny of heterozygous
intercrosses of the indicated alleles. For PKCι/λ Δ and PKCι/λ ζRes embryos at E7.5 were
used as starting material for the DNA extraction. Corresponding genotypes are indicated
above the individual agarose gels.
Supplementary figure 2: Proliferation and apoptosis in PKCι/λ mutant embryos: E7.5
embryos were embedded in paraffin and then sectioned into a 5µm thick slices.
Immunofluorescence analysis were performed using the indicated antibodies. Markers for
either apoptosis (cleaved caspase-3, 1:500) or proliferation (phospho-histone-3, 1:500)
were used for immunofluorescence analysis of aPKCɩΔ/Δ embryos or wild-type (WT).
All analysis were done by using the Zeiss LSM 510 confocal microscope. Scale bar: 100
µm
Supplementary figure 3. Protein expression and protein levels analysis in wild-type and
aPKCiota-deficient embryos (A) Expression analysis of indicated proteins in wild-type
(WT) and aPKCɩΔ/Δ embryos at stage E7.5. (B) WB analysis of WT and aPKCɩΔ/Δ
embryos at stage E7.5 and E8.0 using antibodies as indicated. Results of the aPKC blot
are shown with different exposure times: 2 min (lower lane) and 5 min (upper lane).
Contributions of individuals:
SS - western blotting, rescue work, RT-PCR and IF
UB - involved in most of the experimental work
SL - EB work
NR - EM work
AK - RNA in situ and writing manuscript
ML - Design, supervision and writing manuscript
A
B
A
B
A
WT
PKC-/-
B
WT
PKC-/-
C
F
WT
PKC-/D
E
G
H
WT
PKC-/-
A
B
Δ/Δ
*
*
*
aPKC
!
Δ/Δ
Δ/Δ
*
*
E-cad
*
aPKC
E-cad
!
C
*
*
**
E-cad
Occl.
ZO-1
Δ/Δ
Δ/Δ
Δ/Δ
*
E-cad
*
Occl.
*
ZO-1
A *
TJ
"
*
TJ
AJ
AJ
DS
C DS
"
B "
A
wt
#"$
#"#
80
60
50
pan-aPKC
pan-aPKC
ß-actin
"#
D
#
E9.5
36.4%
50.5%
12.1%
107
wt
39
54
13
# " #
"Δ
Δ
Δ
C
E7.5
29.7%
51.4%
18.9%
111
33
57
21
"$
wt
Δ"Δ
#"#
'
B
#
$%&'
A.
PKC
allele
Bg B H E
EV
H
B
KE
Bg
Bg
1kb
B
PKC
K
E
neo
pKS
E
PKC
pKS
H
PKC
K
neo
B
Bg B
K
Bg
neo
PKCc
pKS
K
B
neo
Bg
H
K
H E
Bg
E
Bg
K E
Bg
PKCc
B.
PKCι/λ !
PKCι/λ
8.0kb
3.0kb
6.5kb
2.0kb
C.
14.4kb
10.4kb 5.1kb
8.4kb
3.2kb
o
eo eo /Ne
eo
+/N +/N Neo +/+ +/+ +/N
PKCι/λ
11.0kb
11.0kb
+/Δ +/Δ Δ/Δ +/+ Δ/Δ Δ/Δ
PKCι/λ
8.4kb
5´probe
3´probe
5´probe
3´probe
5´probe
5´probe
PKCι/λ"
PKCι/λ
+/+
/+ /+
+
+
(
PKCι/λ"
Supplementary Figure 1.
aPKCWT
phistone-3
aPKCΔ/Δ
phistone-3
aPKCWT
cleaved casp-3
aPKCΔ/Δ
cleaved casp-3
D3.&ȗ
D3.&ȗ
D3.&Ț
D3.&ȗ
D3
.
&
Ț
:
7
D
3
.&
Ț
ǻ
ǻ
D3
.
&Ț:
D3
7
.
&
Ț
ǻ
D3
.
&Ț:
D3
7
.
&Ț
ǻ
D3
.
&
Ț
ǻ
ǻ