Download Conference Abstracts - Canadian Society for Transfusion Medicine

CSTM 2016 – Conference Abstracts
Contents
"Knowledge to Munch On": A National Organization-Wide Lunch & Learn Program to Disseminate
Research Results ................................................................................................................................... 5
2015 Ontario O Rh Negative Red Blood Cell (RBC) Audit .................................................................... 6
A Clinical Decision Support System for the Use of Intravenous Immune Globulin ................................ 7
A Novel Clot-Dissolving Agent Derived from a Plasma Protein ............................................................. 9
A Resource for Nursing Professionals in Transfusion Medicine .......................................................... 11
A REVIEW OF INTERFACILITY BLOOD TRANSPORTATION BY AMBULANCE TO A REGIONAL
TRAUMA CENTRE .............................................................................................................................. 12
A Simulation Approach to Platelets Contingency Planning and Inventory Management .................... 13
ABO-incompatible kidney transplantation using ABO Immunoadsorption Column: A single center
experience ............................................................................................................................................ 14
Antibiotic Neutralization in Cord Blood Sterility Testing Samples – Plasma and RBC ........................ 15
Antibodies of undetermined significance in solid-phase technology, exploring incidence, associated
patient factors and laboratory impact ................................................................................................... 16
Antibody-mediated immune suppression to red cells in a murine model: The role of IgG Glycans in
suppression .......................................................................................................................................... 18
Appropriateness of ABO Mismatch Red Blood Cell Transfusions in a Large Tertiary Care Hospital.. 19
Are You Out There? Ten years of providing distance transfusion education for physicians in Ontario
............................................................................................................................................................. 20
Assessing the impact on redistribution programs in Ontario with the shift to new CBS shipping
containers ............................................................................................................................................. 22
Assessment of Automated Capture-R Ready ID Assay for Antibody Investigation in Pregnant Women
............................................................................................................................................................. 23
Assessment of morphological changes due to oxidative stress: leukodepleted packed red blood cells
stored in SAGM .................................................................................................................................... 24
Audit of Provincial IVIG Request Forms and Documentation of Efficacy in Four Tertiary Care Centres
............................................................................................................................................................. 26
Bacterial Growth During Storage of Thawed Cryoprecipitate at 20-24 oC for 24 Hours ..................... 27
Best Blood Manitoba; collaboration with multi-organizational and multi-disciplinary partners to
improve Transfusion Medicine Practice in Manitoba. .......................................................................... 28
Black Women as Blood Donors ........................................................................................................... 30
Can we use membrane osmotic parameters to characterize the red blood cell storage lesion? ........ 31
Canadian Blood Services Implementation of a National Phenotype Testing Program........................ 32
Care in the community - Home Transfusion by Community Care Paramedics ................................... 34
Case Study: Cryopreservation of a Gerbich Null Phenotype Red Cell Concentrate .......................... 35
Case Study: Quality Assessment of a Rare Cryopreserved Red Cell Concentrate after a Transient
Warming Event ..................................................................................................................................... 36
Comparison of bacterial attachment between apheresis and buffy coat platelet bags ....................... 37
Converting from an Unlicensed RHD Genotyping Test Kit to a Health Canada Licensed Test in Five
Days ..................................................................................................................................................... 38
CSTM 2016 – Conference Abstracts
Counting the Colloid: An Audit of Overall and Individual Allocations of Albumin by Patient Care Area.
............................................................................................................................................................. 40
Designing the Ontario Transfusion Quality Improvement Plan (OTQIP) ............................................. 42
Detection of Hemoglobin C acquired from a donor red blood cell unit following exchange transfusion
............................................................................................................................................................. 44
Determining the quality benchmark metric for appropriate use of red blood cell transfusion: A quality
audit at 10 hospitals ............................................................................................................................. 45
Development and Evaluation of an Online Training Program for Stem Cell Drive Recruiters ............. 47
Development and Management of Hereditary Angioedema Recommendations................................. 48
Development of a cord blood thaw protocol based on post thaw cell viability and potency ................ 49
Development of the Ontario Transfusion Quality Improvement Plan (OTQIP) Toolkit ........................ 50
Does Blood Transfusion Practice in Prairie Mountain Health Meet AABB Guidelines? ...................... 52
e-Learning Transfusion Practice Modules: Better Blood Transfusion ................................................. 54
Enhancing the Proinflammatory Immune Response Using Plasma-Derived miRNA-Based
Therapeutics ........................................................................................................................................ 55
Enveloped Virus Assimilation of Host Coagulation Factors ................................................................. 56
Evaluating the Accuracy and Efficiency of an Anemia Index Component of a Red Cell Inventory
Ordering Algorithm Using Advanced Statistics and Simulation Methods ............................................ 57
Evaluating the Impact of Installing a Gammacell Irradiator ................................................................. 58
Evaluation of Nurses Transfusion Knowledge in the setting of a Fragmented Educational Strategy;
Supporting Comprehensive and Consistent Transfusion Education within the WRHA ....................... 60
Expansion of Stem Cell Club to Four Medical Schools in Ontario ....................................................... 61
FREQUENCY OF LIFE THREATENING ALLERGIES AMONG BLOOD DONORS........................... 63
Genotyping for the Resolution of Pan-Reactive Antibodies ................................................................. 64
Hemolytic Disease of the Fetus and Newborn and its Prevention with Rh Immune Globulin ............. 65
Hemorheology of Liposome-Treated Red Blood Cells during Hypothermic Storage .......................... 67
Hemostatic function of stored buffy coat platelet concentrate in plasma treated with pathogen
inactivation system ............................................................................................................................... 68
Impact Of Blood Transfusion On Troponin I Levels and Cardiac Outcomes After Cardiac Surgery; A
Cohort Study ........................................................................................................................................ 69
Impact of Holder pasteurisation and high-pressure processing on human milk components ............. 71
Impact of Phenotype Reagent Antiserum Utilization Following the Discontinuation of Retyping Red
cell Components Labeled as Antigen Negative by CBS. ..................................................................... 73
IMPACT OF RECENT CHANGES IN DEFERRAL CRITERIA AND REMOVAL OF CONFIDENTIAL
UNIT EXCLUSION (CUE) .................................................................................................................... 74
Implementation of blood group genotyping as routine testing for sickle cell patients in a multi-site
transfusion medicine laboratory program ............................................................................................. 75
Implementing and Evaluating Simulation Scenarios Related to Adverse Transfusion Reactions ....... 77
Improving Platelet Utilization in a Rural Setting ................................................................................... 78
In Vitro Platelet Function of Pathogen Reduced Platelet Using the INTERCEPT Platelet Processing
Set with Dual Storage Containers ........................................................................................................ 80
CSTM 2016 – Conference Abstracts
Inactivation of Zika virus in RBC Components using Amustaline and GSH ........................................ 81
Incidence of Post-Transfusion Screen-Positivity in Pre-Transfusion Screen-Negative Patients by
Disease Population .............................................................................................................................. 82
Installation of Ortho Vision™ Analyzer at Surrey Memorial Hospital ................................................... 84
Introduction Of a 7-Day Shelf Life For Platelet Concentrates: Challenges For Inventory Management
To Meet No Outdating And Client Satisfaction .................................................................................... 85
Is there a higher rate of transfusion reaction in chronically transfused patients? ................................ 86
Life in Kell: The challenges of providing Kell negative RBC units in a multi-facility health region ....... 87
Mandatory Transfusion Reaction Reporting in British Columbia: A Seven Year Review .................... 89
McMaster Data Driven Research Program: an integrated database network tool driving education and
research forward .................................................................................................................................. 90
Meeting Health Canada Blood Regulations Requirements: A Collaboration between British
Columbia’s Transfusion Medicine Services and Patient Safety & Learning System. .......................... 92
Modelling disruptions in blood distribution network with a generic simulation framework ................... 93
Molecular Heterogeneity of the JK-null Phenotype .............................................................................. 94
Optimal conditions for the performance of a monocyte monolayer assay ........................................... 96
Optimizing Blood Inventory in Northern Alberta Hospitals ................................................................... 97
Optimizing Inventory: Integration of a Hub Model in Northern BC. ...................................................... 98
Osteoblasts release factors that promotes the survival and expansion of progenitors with platelet
engraftment activity .............................................................................................................................. 99
Pathogen inactivation by riboflavin and ultraviolet light treatment influences the indices of erythrocyte
storage lesion and programmed cell death ........................................................................................ 100
Patients with Rare Blood Types Identified by an Automated Platform for Blood Group Genotyping 102
Plasma Component Factor Xa is Modulated by Direct Oral Anticoagulants to Enhance Clot
Dissolution .......................................................................................................................................... 104
Polymer-Mediated Immunocamouflage of Allogeneic Lymphocytes Induces Tolerance via Generation
of Functional Regulatory T Cells and a Decrease in CD8+ T cells .................................................... 106
Pooling Components for Exchange Transfusion ............................................................................... 108
Process-Induced Hemolysis: A comparative analysis of gamma-irradiated and pathogen-inactivated
red cell concentrates .......................................................................................................................... 109
Promoting Choosing Wisely Canada’s Recommendations to Transfuse Safely; An interprofessional,
multi organizational awareness campaign by Best Blood Manitoba .................................................. 111
Prophylactic antigen-matched donor blood for patients with warm-reactive IgG autoantibodies: an
evaluation of safety and efficacy ........................................................................................................ 113
Prothrombin Complex Concentrates (PCCs) – Dosing Implications.................................................. 114
Prothrombin is the key component in a reconstructed prothrombin complex concentrate effective in
reducing bleeding in coagulopathic mice ........................................................................................... 116
Quality Improvement Through Reporting and Collaboration ............................................................. 118
Real Time Inventory Reporting to Support British Columbia Blood Contingency Preparedness ...... 120
Red Blood Cell Microparticle Content with Dynamic Light Scattering – A check for quality .............. 121
Red cell alloimmunization rates in allogeneic hematopoietic stem cell transplant recipients ............ 123
CSTM 2016 – Conference Abstracts
Reducing Transfusion In Cardiac Surgery Using Red Blood Cell Utilization As A Quality Indicator . 126
Resolution of Questionable ABO Blood Grouping in the Setting of Solid Organ Transplantation ..... 128
Review of the Prenatal Anti-M Testing Algorithm Results and Associated Neonatal Outcomes ...... 129
SCIG vs. IVIG for recurrent infection in patients with secondary immunodeficiency due to chronic
lymphocytic leukemia. ........................................................................................................................ 131
Screening for HDFN: to titrate or not, that is the question ................................................................. 132
Selection and characterization of a DNA aptamer inhibiting coagulation factor XIa.......................... 133
Simulation for Process Improvement in Testing Laboratories ........................................................... 134
Solvent-Detergent Plasma for the Treatment of Thrombotic Microangiopathies: A Canadian Tertiary
Care Centre Experience ..................................................................................................................... 135
Spontaneous Intracranial Haemorrhage in Paediatric Oncology Patients ......................................... 137
Standard Blood Transfusion Indices and the Efficiency of Blood Utilization ..................................... 139
STAT and ASAP Delivery Study in Canadian Blood Services' Brampton Catchment ....................... 140
Stem Cell Club Training Resources: A Needs Assessment .............................................................. 142
Stem Cell Drive Materials ................................................................................................................... 143
Successful Allogeneic Bone Marrow Transplantation in Acute Myeloid Leukemia with incidental
resolution of concomitant Celiac disease, IgA Deficiency, and Platelet Refractoriness .................... 144
Successful Reduction in Institutional IVIG Utilization by Effective Implementation of Provincial
Guidelines .......................................................................................................................................... 146
The Development and Evolution of a Massive Bleeding Policy in a Tertiary Care Pediatric Center – a
Quality Improvement Initiative ............................................................................................................ 147
The impact of gamma irradiation on quality parameters and function during a 9-day storage of
platelets prepared with the new REVEOS system ............................................................................. 148
The impact of pathogen inactivation treatment on selected platelet mRNA transcripts .................... 149
Thromboembolic events after on-label and off-label use of Recombinant Activated Factor VII (rFVIIa)
at a tertiary care hospital. ................................................................................................................... 150
Transfusion Premedication Practices among Pediatric Health Care Practitioners in Canada: Results
of a National Survey ........................................................................................................................... 152
UNCHARTED TERRITORY: The experience of being among the first wave of ORTHO VISION
Analyzer customers. Real life successes and limitations associated with implementation of emerging
technology in a medium-sized acute care setting. ............................................................................. 153
Understanding intravenous iron ordering practices for inpatients and outpatients at a large academic
institution ............................................................................................................................................ 154
Unnecessary Use of Intravenous Albumin at a Large Community Hospital ...................................... 156
Use of intravenous immunoglobulin in neonates at a tertiary academic hospital: One third of use is
inappropriate ...................................................................................................................................... 157
Utilization, Quality and Safety of Amniotic Membrane Transplant Allografts ..................................... 159
When is a Positive Truly So? Defining a New Cut-Off in a Precautionary Approach to D Typing in
Child-Bearing Age Female Individuals. .............................................................................................. 161
Who’s your daddy? Weakened KEL2 antigen (Cellano) expression responsible for apparent paternal
exclusion: a case study ...................................................................................................................... 163
Zika virus: Risk Assessment and Rapid Response to an Emerging Threat ...................................... 164
CSTM 2016 – Conference Abstracts
"Knowledge to Munch On": A National Organization-Wide
Lunch & Learn Program to Disseminate Research Results
Abstract Title
"Knowledge to Munch On": A National Organization-Wide Lunch & Learn Program to
Disseminate Research Results
Authors/Co-Authors & Affiliations
Mia Golder, PhD, Canadian Blood Services Tina Viner, Canadian Blood Services Sue
Gregoire, Canadian Blood Services Sophie Chargé, PhD, Canadian Blood Services
Abstract Body
INTRODUCTION: Knowledge mobilization bridges the gap between the creation of
knowledge and its ultimate impact. A key step in this process is the dissemination of
knowledge, or the communication of evidence to those who can benefit from this
knowledge. At Canadian Blood Services, a need to increase dissemination of
research results to those whose work may be impacted (i.e., operational staff) was
identified.DESIGN & METHODS: The Knowledge to Munch On (KTMO) lunch and
learn program was developed as a means to facilitate the dissemination and
exchange of research activities undertaken by Canadian Blood Services. The KTMO
program has two main objectives: 1) to expose staff to key research aligned with the
mandate and needs of the organization, while promoting knowledge exchange
between those doing research at Canadian Blood Services and operational staff;
and 2) to provide opportunities for trainees to develop their presentation skills.
Webinars are organized that allow Canadian Blood Services staff nationally to
attend or present, either with a group at a Canadian Blood Services site or
individually.RESULTS: Since initiation of the program in 2012, 12 KTMO sessions
have been organized. Initially, the KTMO program focused on work presented by
CBS staff at the CSTM and AABB annual conferences, with 2 sessions organized
annually consisting of four 10-minute presentations. In 2015, the program was
expanded to also include sessions that focus on a single topic and feature only one
or two speakers. In total, 37 presentations have been made by 32 individuals from
four provinces; >25% of presentations were made by trainees. Average attendance
at the sessions is 145 CBS staff from across Canada, with attendees from eight
provinces. In 2015-2016, 690 credit hours have been given to attendees. A
significant proportion of the attendees are supply chain and quality and regulatory
affairs staff. Feedback on the content of the sessions has been positive, with
attendees agreeing that the events enhance their knowledge.CONCLUSIONS: The
KTMO program has been well-received and is effective at exposing staff to research
activities undertaken at Canadian Blood Services.
5
CSTM 2016 – Conference Abstracts
2015 Ontario O Rh Negative Red Blood Cell (RBC) Audit
Abstract Title
2015 Ontario O Rh Negative Red Blood Cell (RBC) Audit
Authors/Co-Authors & Affiliations
Scheuermann S, Wendt A, Cameron T. Ontario Regional Blood Coordinating Network
(ORBCoN)
Abstract Body
Background: In 2013/14 ORBCoN facilitated an audit of O Rh negative RBCs to
non-Rh negative recipients within Ontario. Initiatives were recommended to
hospitals to encourage best practices for the use of O Rh negative RBCs after that
audit. ORBCoN repeated the audit in October, November, and December of
2015.Methods: Sites were encouraged to participate in this audit regardless of
whether or not they participated in the 2013/14 audit. A 21 question survey was sent
to the sites at the end of each month for sites to enter their data online. The final
survey included questions relating to policies on maternal age and emergency issue
of O Rh negative RBCs to males. Data for each site was validated.Results: 84 sites
provided ORBCoN with validated audit data for the 3 month period. 89 sites
provided information regarding maternal age policy and policies regarding
emergency issue of O Rh negative RBCs for males.Table 1. Recipients
Total Rh pos due Rh
A Rh
Txd to Massive pos - neg, B
Transfusion due to Rh neg
Protocol
soon to or AB
(MTP)
outdate Rh negunits with
anti- D.
Non O Rh
Non O Rh Non O Rh neg
neg -with neg
recipient
antibodies recipient (without
other
with
antibodies)
antibodies requiring
(CBS
phenotypically
than provided) matched red
anti- D
cells.
Total 5962 89 (1.5%)
ON
2015
863
80
(14.5%) (1.3%)
235 (3.9%) 267 (4.5%) 211 (3.5%)
Total 6601 85 (1.3%)
ON
2014
918
24
(13.9%) (0.3%)
621 (9.4%) 535 (8.1%) 514 (7.8%)
Most commonly reported maternal age cut-off was 45 years (n=38, 42.7%)
and most widely used policy for transfusion in males was, “All males regardless of
age are issued O Rh positive RBC uncrossmatched units for urgent transfusion”
(n=28, 31.3%).Conclusions: Although there has been some improvement in the
use of O Rh negative RBCs, a significant percentage of units near to expire are
used for Rh positive recipients, suggesting that inventory management may still be
improved.Acknowledgements: ORBCoN gratefully acknowledges the sites in
Ontario that took part in the audit, and the MOHLTC for funding.
6
CSTM 2016 – Conference Abstracts
A Clinical Decision Support System for the Use of Intravenous
Immune Globulin
Abstract Title
A Clinical Decision Support System for the Use of Intravenous Immune Globulin
Authors/Co-Authors & Affiliations
Nadine Shehata, MD, Mount Sinai Hospital Mirek Otremba, MD, Mount Sinai Hospital
Samantha Koh, BSc, University of Toronto
Abstract Body
INTRODUCTION
Clinical decision support systems are more frequently used as a means of
optimizing clinical decision making and are increasingly being used. Decision
support systems have not been routinely used for intravenous immune globulin
(IVIg) and potentially can optimize its use.
DESIGN AND METHODS
A manual clinical decision support and a computerized support were developed for
all indications for IVIg. We compared the proportion of requests for IVIg and dosage
requested two years before to two years after implementation to determine whether
this intervention reduced the IVIg utilized.
RESULTS
IVIg was most commonly used for hematological indications, although neurological
indications accounted for the largest utilization by dosage. Before implementation,
there were 152 requests for IVIG, amounting to 32.6kg of IVIG in 118 patients
compared to 25.1kg of IVIG utilized among 97 patients following use of the clinical
decision support, a decline of 23% (7.5kg). This decline was observed across most
clinical indication categories but a difference in the mean dose of IVIG used was not
observed.
CONCLUSIONS
Clinical decision support systems appear to be an effective means of optimizing the
use of blood products including IVIg and represent one intervention method to
educate practitioners and improve transfusion practice.
ACKNOWLEDGEMENTS
We are grateful to the Transfusion Medicine technologists and Nusrat Zaffar at
7
CSTM 2016 – Conference Abstracts
Mount Sinai Hospital for their assistance in obtaining and verifying data for this
study. The Ontario Regional Blood Coordinating Network, Ministry of Health and
Long term Care and IVIG advisory panel developed the manual IVIG request form.
8
CSTM 2016 – Conference Abstracts
A Novel Clot-Dissolving Agent Derived from a Plasma Protein
Abstract Title
A Novel Clot-Dissolving Agent Derived from a Plasma Protein
Authors/Co-Authors & Affiliations
Edward L.G. Pryzdial, Ph.D., Centre for Innovation, Canadian Blood Services; and Centre for
Blood Research; Department of Pathology and Laboratory Medicine, University of British
Columbia Scott C. Meixner, B.Sc., Centre for Innovation, Canadian Blood Services; and
Centre for Blood Research; Department of Pathology and Laboratory Medicine, University of
British Columbia Kimberley Talbot, M.Phil., Centre for Innovation, Canadian Blood Services;
and Centre for Blood Research; Department of Pathology and Laboratory Medicine,
University of British Columbia Louise J. Eltringham-Smith, Centre for Innovation, Canadian
Blood Services; Department of Pathology and Molecular Medicine, McMaster University,
Hamilton James R. Baylis, B.Sc.,Michael Smith Laboratories, and Department of
Biochemistry and Molecular Biology, University of British Columbia, Vancouver Christian J.
Kastrup, Ph.D.,Michael Smith Laboratories, and Department of Biochemistry and Molecular
Biology; Centre for Blood Research, University of British Columbia, Vancouver William P.
Sheffield, Ph.D., Centre for Innovation, Canadian Blood Services; Department of Pathology
and Molecular Medicine, McMaster University, Hamilton
Abstract Body ho
Background: Approximately 25% of all red cell, platelet and plasma units are
utilized for cardiovascular surgery. Thus, therapeutic intervention to minimize
surgical risk is not only beneficial to the patient, but may alleviate blood system
burden. Harmful blood clots frequently cause the need for surgery and drugs that
dissolve these clots have been developed. The favored "clot-buster” is not perfect. It
is based on the natural enzyme, tissue plasmino-gen activator (tPA), which can
cause life-threatening bleeding in up to 6% of patients because of the required high
dose. Unfortunately, global progress to reduce the dose has been disappointing and
puzzling. Objective: We have discovered a novel function for the plasma-derived
clotting enzyme, factor (F) Xa, as an enhancer of tPA activity. Here we will test its
efficacy in pre-clinical studies to improve the safety of tPA. Methods: The novel
function of FXa was chemically stabilized via active-site inhibition, called Xai-K, and
evaluated in vitro by light scattering for plasma clot-dissolution. Xai-K was also
studied in vivo using a murine carotid occlusion model of thrombosis where blood
flow was monitored by Doppler ultrasound. Results: The time for plasma clots to
dissolve was shortened ~8-fold by 1 nM Xai-K, whereas identically modified trypsinK or FVIIa-K had no effect. The tPA variant Tenecteplase (TNKase) injected into the
murine tail vein (17 μg/g) completely restored blood flow by ~30 minutes, which was
reduced to ~14 minutes in the presence of Xai-K (0.5 μg/g). At a sub-therapeutic
dose of TNKase (9 μg/g), complete reperfusion was observed by ~20 minutes when
combined with Xai-K (0.5 μg/g). In the absence of TNKase, a dose-dependent effect
on reperfusion was observed when Xai-K was injected alone (0.5 and 1.1 μg/g),
indicating an effect on endogenous tPA. Western blots of plasma from mice
achieving complete reperfusion showed that unlike TNKase treatment, animals
administered Xai-K alone had no systemic markers of bleeding, possibly due to
localization by Xai-K to the site of the clot. Conclusion: These results suggest that
non-enzymatic Xai-K may improve the safety of therapeutic clot-dissolution by
9
CSTM 2016 – Conference Abstracts
reducing or replacing the dose of the conventional enzymatic clot-buster.
10
CSTM 2016 – Conference Abstracts
A Resource for Nursing Professionals in Transfusion Medicine
Abstract Title
A Resource for Nursing Professionals in Transfusion Medicine
Authors/Co-Authors & Affiliations
Harinder Gill, BSN, BC Provincial Blood Coordinating Office
Abstract Body
The Clinical Transfusion Resource Manual (CTRM) was developed to support
nursing professionals to provide and promote safe and standardized blood
transfusion practices, education, and training. The CTRM includes
recommendations, appendices, and links to reference materials related to
administration and management of blood components/products including transfusion
reactions. The recommendations are in compliance with the Canadian Standards
Association (CSA) and Canadian Society for Transfusion Medicine (CSTM)
standards for blood components/products.Method:The BC Provincial Blood
Coordinating Office (PBCO) facilitated series of face-to-face meetings and teleconferences to provide a forum for nursing experts from each health authority in BC
to discuss and review the 2002 hard copy of Clinical Transfusion Resource
Manual. The group agreed on a new format and plans to not only update and revise
the information but also align it with CSA and CSTM standards for blood
components/products. The CTRM revision underwent final review by a physician
member of the Transfusion Medicine Advisory Group (TMAG). Results:The CTRM is
now available on the PBCO website for nursing experts to use and promote safe
and standardized education and training to help achieve best patient outcomes. The
manual will be revised and updated as new standards and/or information becomes
available. Conclusion: The development of this much needed and anticipated
resource was made possible through the dedication and hard work on a provincial
team of transfusion nursing experts. These individuals supported and contributed to
the development of this manual while balancing competing responsibilities stemming
from their roles in their various health authorities.Acknowledgements:

Nursing Resource Group: Paula Araujo, Jyotika Dutt, Shelley Feenstra,
Jocelyn Hill, Marg Hineman,
Renee Logan, Eileen Macdonald, Donna Miller, Clare O’Reilly, Sarah Oxley,
Allison Sheridan,

Dr. R. Coupland, Transfusion Medicine Advisory Group

11
CSTM 2016 – Conference Abstracts
A REVIEW OF INTERFACILITY BLOOD TRANSPORTATION
BY AMBULANCE TO A REGIONAL TRAUMA CENTRE
Abstract Title
A REVIEW OF INTERFACILITY BLOOD TRANSPORTATION BY AMBULANCE TO A
REGIONAL TRAUMA CENTRE
Authors/Co-Authors & Affiliations
Vito Sanci, MD, PhD, University of Ottawa Yulia Lin, MD, FRCPC, University of Toronto
Jeannie Callum, MD, FRCPC, University of Toronto
Abstract Body
There are no published data on the fate of blood components (BC) sent with patients
transferred from peripheral hospital emergency departments to regional trauma
centres in Canada, unlike in the US or UK. Thus, our goals were to describe the fate
of such BC and to highlight possible areas for utilization improvement.
As a blood bank quality improvement audit, we retrospectively reviewed the
disposition of BC received at a single tertiary care trauma facility, from January 2013
- December 2015.
In total, 141 patients were transported with 357 units of BC over the 3-year period:
317 (89%) were red blood cells (RBC), 37 (10%) were plasma, and 3 (1%) were
platelets. One hundred and twenty-seven units (35%) were transfused en route, 191
(54%) were successfully placed into inventory at the receiving site, and 39 (11%)
were discarded. RBC were discarded if the storage container temperature exceeded
10°C, plasma if thawed but not used, and platelets were discarded if they were
stored in the cooler with the RBC.
More wastage occurred when >1 type of BC was transported, as compared to just
one (16/67 vs. 23/251; Fisher’s Exact Test, p=0.007). Although there was significant
correlation between the number units and the number of types of BC transported
(Spearman’s rho=0.472, p<0.001), >1 BC type remained significantly correlated to
wastage, even after controlling for the number of units (partial correlation, r=0.310,
p<0.001). When comparing >1 type of component to only one type transported, the
odds ratio of wastage was 2.6 and the ROC curve had an area of 0.770 (p=0.001).
Overall, 1 in 10 units was discarded due to improper storage. Given the above
findings, it is recommended that emergency physicians sending BC with a patient to
a referral centre, where possible, limit transfer to RBC unless there is clear evidence
to support the need for multiple components. Appropriate attention to BC packaging
within storage containers by the transferring facility is also critical to mitigate
unnecessary loss. Such a strategy could help reduce the wastage of a limited and
valuable resource.
12
CSTM 2016 – Conference Abstracts
A Simulation Approach to Platelets Contingency Planning and
Inventory Management
Abstract Title
A Simulation Approach to Platelets Contingency Planning and Inventory Management
Authors/Co-Authors & Affiliations
Robert Coupland, MD, Interior Health Authority Cecilia Li, RN, BSN, EMBA, BC Provincial
Blood Coordinating Office Chris Biantoro, Ph.D., BC Provincial Blood Coordinating Office
Sunny Wong, MMOR, BC Provincial Blood Coordinating Office
Abstract Body
Introduction / Objective Platelet units are a perishable product with short shelf-life
needed in both routine hospital procedures and life threatening emergencies,
therefore hospitals must maintain an adequate supply at all times. Through
collaboration with Interior Health Authority (IHA), the BC Provincial Blood
Coordinating Office (PBCO) developed a simulation model to quantify the impact of
a platelet supply shortage for contingency planning and evaluate various ordering
policy to improve inventory management. Methods A simulation model that reflects
the daily operations at the hospital level was developed. The model addressed
platelets inventory based on the following premises: hospital’s ordering policy,
issuing policy following the hospital’s substitution guidelines, incorporates lead time
in receiving platelets from Canadian Blood Services (CBS), and discard of expired
inventory. Historical utilization data from PBCO’s Central Transfusion Registry and
CBS supply data are used to validate the model’s accuracy. This model is able to
simulate the event of a supply shortage and any changes in ordering
policies. Results In the event of a supply shortage at the large hub hospital in IHA,
the model demonstrates a minimal impact on patient care if the shortage lasts within
3 days during regular utilization time periods. However, the hospital would need to
ration platelets after 24 hours during high utilization time periods.With respect to
inventory management, the implementation of dynamic ordering policy yields a
potential reduction of over 20% in expired units or over $100,000 of annual cost
savings. In addition, a centralized inventory scenario of multiple hospitals was
proposed and the model shows a prospective reduction of 45% in expired units
which equates to over $200,000 of savings. Conclusion PBCO and IH have
developed an accurate model that reflects the platelet inventory practice. The model
is able to support hospitals in assessing the impact of a platelet supply shortage for
contingency planning. The model also demonstrated outdate reductions with the
implementation of a dynamic ordering practice and centralized inventory
management. AcknowledgmentsPBCO gratefully acknowledges Interior Health for
their input, collaboration and support throughout the development and testing of the
model.
13
CSTM 2016 – Conference Abstracts
ABO-incompatible kidney transplantation using ABO
Immunoadsorption Column: A single center experience
Abstract Title
ABO-incompatible kidney transplantation using ABO Immunoadsorption Column: A single
center experience
Authors/Co-Authors & Affiliations
Anne-Sophie Lemay, MD, University of Toronto, Toronto, ON, Canada Katerina Pavenski,
MD, St. Michael’s Hospital,Toronto, ON, Canada Jeffrey Zaltzman, MD, St. Michael’s
Hospital, Toronto, ON, Canada Megan Buchholz, RN, St. Michael’s Hospital, Toronto, ON,
Canada Patty Lou Cheatley, RN, St. Michael’s Hospital, Toronto, ON, Canada Elizabeth
Krok, MLT, St. Michael’s Hospital, Toronto, ON, Canada Galo Meliton, RN, St. Michael’s
Hospital, Toronto, ON, Canada Lucy Chen, Pharmacist, St. Michael’s Hospital, Toronto, ON,
Canada
Abstract Body
IntroductionKidney transplantation (KT) is the treatment of choice for end-stage
renal disease. Unfortunately, the demand for organs often exceeds the supply.
Increasing living donation is one of the essential means to increase organ availability
and to reduce wait time. Since ABO incompatibility (ABOi) is one of the major
barriers to living donor KT, desensitization protocols have been developed
combining intense immunosuppression with antibody removal by plasmapheresis or
antigen immunoadsorption. Antigen-specific Immunoadsorption (IA) involve the use
of LMW carbohydrate columns containing A or B antigens linked to a matrix to
adsorb anti-A or anti-B. A major advantage of this method is that it does not require
allogenic blood products. St.Michaels hospital is the only center in Canada using IA
for ABOi KT. We retrospectively reviewed all cases that have been done using ABO
IA Column since its implementation. Design and MethodsAll patients who
underwent IA for consideration of ABOi KT at SMH from July 1st, 2011 to December
1st, 2015 were included. Our primary objectives were graft survival and IA related
complications. Data were collected from electronic patient chart, apheresis paper
charts and titre lab worksheets. Titres were performed by IS for IgM and IAT for
IgG.Results13 patients (77% males) underwent IA for ABOi KT during this period.
Median age was 55. Eight patients were on dialysis at the time of transplant. DonorRecipient ABO incompatibility were as follows: A-O (50%), B-O (25%), AB-A (17%),
AB-B (8%). Pre-transplant median antibody titer was 32 (4-512) and the median IA
procedures in the preoperative setting was 3 per patient (1-5). One patient was
excluded; he underwent two cycles of three IA but ultimately did not go through
transplantation for other reasons. Only three patients needed IA post-operatively. IA
was well tolerated and all patients recovered renal function post-transplant without
any patient experiencing graft rejection or needing dialysis at one year’s follow
up.ConclusionThis retrospective study showed that IA is an efficient way to allow
ABOi living KT, with good graft outcomes at one year and without any associated
severe side effects. Cost is still a major disadvantage at the moment.
14
CSTM 2016 – Conference Abstracts
Antibiotic Neutralization in Cord Blood Sterility Testing Samples
– Plasma and RBC
Abstract Title
Antibiotic Neutralization in Cord Blood Sterility Testing Samples – Plasma and RBC
Authors/Co-Authors & Affiliations
Sandra Ramirez-Arcos, Ph.D., Canadian Blood Services Yuntong Kou, M.Sc., Canadian
Blood Services Heather Perkins, B.Sc.,Canadian Blood Services Mike Halpenny, B.Sc.,
Canadian Blood Services Heidi Elmoazzen, Ph.D., Canadian Blood Services
Abstract Body
Introduction/Objective: Bacterial contamination of cord blood (CB) represents a
transplantation safety risk. CB units manufactured at the Canadian Blood Services’
Cord Blood Bank are tested for sterility by inoculating a mix of CB-derived plasma
and RBC into BacT/ALERT BPA/BPN culture bottles, which lack antimicrobial
neutralization properties. The process is unsuitable for CB containing antibiotics
potentially resulting in false negative results. This study was aimed at developing an
in-house method for neutralizing antibiotics in CB sterility testing samples.
Design and Methods: The study was developed in three phases. In phase 1, six
neutralizers including penicillinase, the resins Amberlite and Lewatit, lecithin+Tween
80, activated charcoal (AC), and a universal neutralizer, were individually tested for
their activity against penicillin or gentamycin using the model organisms
Staphylococcus epidermidis and Klebsiella pneumoniae, respectively. Four tubes,
each containing 3 mL of bacterial culture adjusted to 100 CFU/mL in Müller-Hinton
broth were prepared to test bacterial growth, antibiotic activity, neutralizer toxicity,
and neutralizer activity, respectively. Tubes were incubated overnight at 37oC under
agitation. In phase 2, combinations of penicillinase with either Lewatit or AC were
tested for the simultaneous neutralization of the two antibiotics as described above.
In Phase 3, a combination of penicillinase plus Lewatit was used to neutralize both
antibiotics in CB sterility testing samples (RBC and plasma) using the BacT/ALERT
system. Bacterial growth detected in either the tubes or BacT/ALERT culture bottles
was confirmed by Gram staining and colony morphology. All assays were repeated
three independent times.
Results: In Phase 1, neutralization of penicillin was achieved with penicillinase and
Amberlite, while gentamycin was neutralized by Lewatit and AC. In Phase 2, the two
antibiotics were simultaneously neutralized by the two combinations of neutralizers.
These results were validated in Phase 3 with the effective neutralization of both
antibiotics in CB sterility testing samples by adding penicillinase plus Lewatit.
Conclusions: A proof of principle for antibiotic neutralization in CB samples has
been successfully developed at Canadian Blood Services. Importantly, this in-house
assay applies to any CB sterility screening method and therefore is not limited to
BacT/ALERT testing.
Ackowledgements: CB donors and staff of the CB Bank.
15
CSTM 2016 – Conference Abstracts
Antibodies of undetermined significance in solid-phase
technology, exploring incidence, associated patient factors and
laboratory impact
Abstract Title
Antibodies of undetermined significance in solid-phase technology, exploring incidence,
associated patient factors and laboratory impact
Authors/Co-Authors & Affiliations
Michelle P. Zeller MD FRCPC MHPE, McMaster University and Canadian Blood Services
Rebecca Barty MLT, BA, MSc., McMaster Centre for Transfusion Research, McMaster
University Grace Wang MMath., McMaster Centre for Transfusion Research, McMaster
University Allahna Elahie, BSc(Hons) MLT, Hamilton Regional Laboratory Medicine Program,
Hamilton Health Sciences Meghan Bourque BSc., McMaster Centre for Transfusion
Research, McMaster University Ron Movilla BHSc. IV, McMaster Centre for Transfusion
Research, McMaster University Natalie Ramsay BSc.(Hons), Michael G. DeGroote School of
Medicine, McMaster University Nancy M. Heddle MSc., FCSMLS(D) McMaster Centre for
Transfusion Research, McMaster University
Abstract Body
Introduction: Detection of antibodies of undetermined significance/specificity (AUS)
increases testing time, complexity and resources and can result in delayed
transfusion. AUS are often detected following implementation of solid-phase
technology and may be due to increased sensitivity of this testing platform. There is
a paucity of evidence surrounding AUS incidence, natural history and associated
patient factors. This study aims to determine frequency of AUS and other antibodies
detected using solid phase technology; to report on the number and type of
reflective tests performed by the laboratory to reach a conclusion of AUS; and, to
identify associations between patient factors and positive AUS results.Methods:We
conducted a retrospective review of Transfusion Medicine Laboratory antibody
records at a large academic institute. All patients undergoing an antibody screen
from January 1 2014 until December 31 2014 were included. Data were extracted
from a network of databases and included variables on patient demographics and
laboratory test results. AUS was defined as a positive antibody screen result using
solid phase that was not an antibody whose specificity could be identified, passive
antibody, warm autoantibody, or cold agglutinins. We analyzed AUS results by
patient age and sex. Results: Our study includes a total of 37,382 patients:
23,711(63.4%) female and 13,671(36.3%) male. Mean age was 50.4 years(SD23.5),
female 46.9(SD22.5) and male 56.6(23.9). AUS were detected in 1,956(3.5%) of
54,373 samples. In patients without AUS, an average of 1.07 tests related to
antibody-investigation were conducted compared to 1.55 tests in patient with an
AUS. Of 720 patients with AUS, 513(71.3%) were female and 207(28.7%) male. The
frequency of AUS was significantly higher in female patients (2.2%) compared to
males (1.5%); absolute difference 0.7%, 95% CI(0.4%-0.9%);(p<0.0001). Age did
not show variation in frequency between sexes. Frequency of other alloantibodies
was calculated and the combination of AUS and Anti E was most common. Patients
with an alloantibody were ~7 times more likely to have coexisting AUS compared to
patients without.Conclusions: AUS lead to increased testing and use of resources.
16
CSTM 2016 – Conference Abstracts
They are seen more frequently in females. Additional investigations are required to
better understand related patient factors and elucidate natural history.
17
CSTM 2016 – Conference Abstracts
Antibody-mediated immune suppression to red cells in a
murine model: The role of IgG Glycans in suppression
Abstract Title
Antibody-mediated immune suppression to red cells in a murine model: The role of IgG
Glycans in suppression
Authors/Co-Authors & Affiliations
Danielle Marjoram MSc. candidate, University of Toronto and St. Michael’s Hospital Lan
Ngoc Le Ph.D. candidate, University of Oxford Max Crispin Ph.D., University of Oxford Alan
H. Lazarus Ph.D., Canadian Blood Services, University of Toronto, and St. Michael’s Hospital
Abstract Body
Introduction The ability of plasma-derived anti-D to prevent hemolytic disease of
the fetus and newborn (HDFN) is known as antibody-mediated immune suppression
(AMIS). A recombinant monoclonal antibody to replace polyclonal anti-D is desired,
however, none of the developed therapies have been as effective and some have
led to enhanced immune reactions. We questioned if different AMIS-inducing
abilities between polyclonal and monoclonal antibodies could be explained by
antibody glycosylation. IgG Fc glycans are critical for interactions with inhibitory
receptors including Fcγ receptors, Siglecs, CD22 and other receptors. We analyzed
the requirement for IgG glycans in polyclonal and monoclonal AMIS-inducing
antibodies in a mouse model of red blood cell (RBC) immunization. Design and
MethodsRBCs from HOD mice were injected into mice (C57BL/6) in the presence
versus absence of AMIS-inducing IgG and red cell alloimmunization assessed.
HOD-RBCs express the human Duffy transmembrane protein linked in tandem
sequence to extracellular ovalbumin and hen egg lysozyme (HEL). The resulting
antibody response is directed against the HEL portion of the HOD molecule and the
AMIS-inducing antibodies tested were specific for the HEL portion of the molecule.
The requirement for Fc N-glycans on the AMIS antibody was assessed by removal
of the full glycan structure using the enzyme Peptide-N-Glycosidase F.Results Mice
transfused with HOD-RBCs opsonized with polyclonal anti-HEL displayed virtually
complete AMIS effects. In comparison, HOD-RBCs opsonized with monoclonal antiHEL antibodies gave rise to less complete suppression, even at saturating doses of
antibody. Removal of the Fc glycan from the polyclonal anti-HEL antibody had no
impact on AMIS induction. In contrast, deglycosylation of two anti-HEL monoclonal
antibodies led to significantly reduced AMIS effects at the IgM
level.ConclusionsAntibody glycosylation in the Fc region of polyclonal AMISinducing antibodies was not essential for complete suppression. In contrast,
monoclonal AMIS-inducing antibodies were partially sensitive to removal of the
glycan structure. Whether there is a fundamental difference between polyclonal and
monoclonal antibodies with regards to the Fc glycan is unknown, but these results
help explain the superiority of polyclonal antibodies to monoclonal therapeutics for
AMIS induction and could influence the development of effective therapies to
replace anti-D.
18
CSTM 2016 – Conference Abstracts
Appropriateness of ABO Mismatch Red Blood Cell
Transfusions in a Large Tertiary Care Hospital
Abstract Title
Appropriateness of ABO Mismatch Red Blood Cell Transfusions in a Large Tertiary Care
Hospital
Authors/Co-Authors & Affiliations
Lawrence Sham, Vancouver General Hospital, Pathology and Laboratory Medicine David Pi,
MD., Vancouver General Hospital, Pathology and Laboratory Medicine Luca Rizzetto,
Vancouver General Hospital, Pathology and Laboratory Medicine Monika Hudoba, MD.,
Vancouver General Hospital, Pathology and Laboratory Medicine
Abstract Body
Purpose:ABO mismatch red blood cell (RBC, blood) transfusion in a hospital is a
permissible practice for: (i) Clinical Reason (CR) – addressing ABO compatibility
requirements owing to the patient’s predisposed clinical condition (e.g. emergency
transfusion, serology, or bone-marrow-transplantation (BMT)), and (ii) Inventory
Planning (IP) – coping with group-specific blood shortage, or avoidance of blood unit
expiry. Hospitals with high ABO mismatch rates can conceivably be a tell-tale sign
of blood inventory overstocking. In this study, we examined the ABO mismatch rate
at Vancouver General Hospital (VGH), and analyzed the rationales behind the use
of ABO mismatched blood. The study explores the relationship between ABO
mismatch for IP purposes and the efficiency in blood inventory
management. Methods:A comprehensive list of causal reasons (CR/IP) for ABO
mismatch blood transfusions was developed, and used in a retroactive review of all
ABO mismatch blood transfusions at VGH (Jan-2013 to Oct-2015). In the study
period, a demand-driven-inventory-planning (DDIP) model was implemented in
June-2015. RBC expiry is negligible (1%) at VGH. Results:The overall ABO
mismatch rate in the study period was 12% (8,114/67,464). CR - 4,017 (6.0%) of
ABO mismatches were transfused for CR (Emergency unmatched transfusion 14%, serology - 12%, BMT - 18%, and others - 6%). IP - 2,319 (3.4%) units were
associated with the hospital RBC redistribution program (near-expiry-first-out policy),
compared to 1,778 (2.6%) units from Canadian Blood Services. ABO mismatch
rates showed a significant decline in the IP category following DDIP implementation
(from 7.2% to 5.1%, p<0.001), while the CR rate also decreased (6.2% to
4.8%). Conclusion:For a large tertiary hospital, operating in a complex interconnected environment, the study confirmed that multiple factors can impact the use
of ABO mismatch blood. Crude ABO mismatch rate is therefore of limited value in
the evaluation of blood inventory management practice. In contrast, ABO mismatch
rate for IP sub-category can be used as a good performance indicator for the study
of blood inventory system inefficiency. However, there is a general lack of
benchmarking information available in the medical literature, and the optimal rates
among different categories of hospitals remain unknown.
19
CSTM 2016 – Conference Abstracts
Are You Out There? Ten years of providing distance
transfusion education for physicians in Ontario
Abstract Title
Are You Out There? Ten years of providing distance transfusion education for physicians in
Ontario
Authors/Co-Authors & Affiliations
Wendy Owens, ART, Ontario Regional Blood Coordinating Network Peter Lesley, MD,
Canadian Blood Services Sophie Charge, Ph.D, Canadian Blood Services Denyse Tremblay,
MLT, Canadian Blood Services Tracy Cameron, MLT, Ontario Regional Blood Coordinating
Network Emma Greening, BA, Ontario Regional Blood Coordinating Network Melissa
vanGilst, RN, Canadian Blood Services Elaine Fournier, RN, Canadian Blood Services
Carolyne Killen, MLT, Canadian Blood Services Elianna Saidenberg, MD, The Ottawa
Hospital
Abstract Body
Background: In 2006, in response to requests from community hospitals in Ontario,
Canadian Blood Services (CBS) and the Ontario Regional Blood Coordinating
Network (ORBCoN) initiated a collaboration to provide physicians with transfusion
related education. For the past ten years, an annual education symposium, directed
at health care professionals in community based hospitals, has been delivered. The
goals of the event are to provide up-to-date transfusion practice knowledge and to
reach as many health care professionals as possible across Ontario.
Method: A planning committee was established with members from CBS, ORBCoN
and hospital physicians. The committee identifies relevant themes and learning
objectives and invites experts to deliver lectures. The event has received CME
accreditation since 2007 and is hosted by a different local hospital each year,
broadcast and webcast to other sites via the Ontario Telemedicine Network. Various
methods used to increase event awareness and attendance include brochures and
posters, targeted invitations by physician specialty, funding for catering to hospitals
in Northern and Eastern Ontario and prizes. Attendance is recorded in order for
attendees to obtain a certificate of attendance.
Results: In 2006, 129 professionals (including 10 physicians) at 18 sites participated
compared with, in 2015, 841 professionals (72 physicians) at 77 sites. Webcasting
attendance, in 2015, accounted for 25% of all participants. Physician specialties
attending have included General Practice, Surgery, Anesthesia, Hematology,
Pathology and Emergency Medicine. Event evaluations have been consistently
positive with ratings over 90% in overall satisfaction and with agreement to the
relevance of the knowledge being disseminated. The majority of participants also
consistently state that they are likely to change their practice as a result of attending
the event. The cost of the event remains consistently low at under $20 per
participant.
Conclusion: The use of multiple strategies to increase awareness and participation
has resulted in increasing participation of health care professionals from across
Ontario. Their increased understanding of blood products and their appropriate use
20
CSTM 2016 – Conference Abstracts
should translate to better patient outcomes.
Acknowledgements: The authors gratefully acknowledge both CBS and the Ministry
of Health and Long-Term Care who provide funding for this event.
21
CSTM 2016 – Conference Abstracts
Assessing the impact on redistribution programs in Ontario with
the shift to new CBS shipping containers
Abstract Title
Assessing the impact on redistribution programs in Ontario with the shift to new CBS
shipping containers
Authors/Co-Authors & Affiliations
Tracy Cameron, MLT, Wendy Owens, ART, Laurie Young, MLT, Alison Wendt, MLT, Ontario
Regional Blood Coordinating Network
Abstract Body
Background: The Ontario Regional Blood Coordinating Network (ORBCoN) has
been facilitating the redistribution of blood components and plasma protein products
(PPP) to reduce wastage due to expiry since 2007 and 2014 respectively. These
redistribution programs have been very successful saving millions of dollars’ worth
of products annually. Hospitals that participate in this program use a variety of
shipping containers including those used by Canadian Blood Services (CBS) to
deliver components and PPP. In 2015, CBS announced plans to implement new
shipping containers that hospitals will not have the option of using.Method: To help
assess the impact of this change, ORBCoN developed a survey for hospitals. The
survey included questions for hospitals on their current practice regarding shipping
containers used for redistribution as well as to ship blood with a patient during
transfer to another facility or within their own facility. The survey was sent to 158
hospitals across Ontario.Results: Seventy hospitals responded to the survey. Sixtyeight out of 70 hospitals ship blood with patients transferred to another facility using
CBS shipping containers. Sixty-one out of 70 hospitals reported redistributing blood
to other hospitals to avoid outdating, 37 do so monthly. The majority of hospitals
currently use CBS shipping containers to redistribute. Thirteen hospitals rely on CBS
to demonstrate acceptable performance of shipping containers. Thirty-one hospitals
perform temperature audits annually on containers but not specifically CBS shipping
containers for redistribution. The average number of boxes stored on site to use for
shipping blood components or PPP is 3-4. The majority of hospitals rely on CBS to
recirculate these shipping containers.Conclusion: Over 80% of hospitals in Ontario
participate in redistribution activities and many transfer products with a patient to
other hospitals. The majority of hospitals use the current CBS shipping containers.
As a result of the implementation of new CBS shipping containers, ORBCoN and
Ontario hospitals will need to find alternative solutions to ensure redistribution
programs can continue in a manner that is convenient, cost effective and satisfies
existing regulatory requirements.Acknowledgements: Hospitals participating in this
survey and the Ministry of Health and Long-Term Care provides funding for
ORBCoN
22
CSTM 2016 – Conference Abstracts
Assessment of Automated Capture-R Ready ID Assay for
Antibody Investigation in Pregnant Women
Abstract Title
Assessment of Automated Capture-R Ready ID Assay for Antibody Investigation in Pregnant
Women
Authors/Co-Authors & Affiliations
Authors: L. Ciurcovich, T. Dolnik, G. Clarke - Canadian Blood Services, BC and Yukon
Center, Vancouver BC
Abstract Body
Background:Pregnant women from British Columbia provide routine samples for
perinatal red cell antibody - screening to the CBS Diagnostic Services laboratory in
Vancouver. The Immucor NEO Blood Group Analyzer (NEO) is used for blood
group and antibody screening of 65000 samples annually. Increased numbers of
non- specific antibodies of uncertain clinical significance (AUS) have been noted
since implementation of NEO. The frequency of these AUS is described along with
results of follow-up testing of patients with AUS.Method:NEO performs automated
modified solid phase (SP) antibody identification using a 2 cell antibody screen
(Capture-R Ready Screen I and II), or a 14 cell antibody panel (Capture-R ReadyID). Following an algorithm, new antibodies with no history of previous antibodies or
Rh immune globulin are evaluated by Ready-ID. This assay, in use since October
2014, has decreased manual testing required to complete antibody investigations.
Manual tube testing follows if required for identification or exclusion of antibodies. If
antibody is detected only by SP, monthly follow-up testing is repeated with ReadyID. Data from 2014-10-31 to 2016-02-09 was analyzed.Results:During the study
period, >83,700 antibody screens were performed. Of these, 1459 samples had a
positive screen with the Ready-ID assay, including 202 patients with AUS. These
were tracked with monthly follow-up testing to see if specificity would develop. In 60
patients, the AUS persisted. In one patient a clinically significant antibody was
identified (anti-Jka; titre <1; non-reactive by PEG indirect antiglobulin
testing.)Conclusions:The large number of AUS detected by SP created an
unexpectedly large number of repeat tests, requiring numerous requests for followup. Based on the number that remained AUS on repeat testing, the algorithm was
changed. Repeat testing is done using PEG IAT. Capture R antibody detection
technology has high sensitivity but lower than expected specificity. As PEG IAT is
considered the “gold standard” for red cell antibody investigation this lab will issue
final antibody reports based on PEG IAT results.
23
CSTM 2016 – Conference Abstracts
Assessment of morphological changes due to oxidative stress:
leukodepleted packed red blood cells stored in SAGM
Abstract Title
Assessment of morphological changes due to oxidative stress: leukodepleted packed red
blood cells stored in SAGM
Authors/Co-Authors & Affiliations
Ibrahim Mustafa,PhD, Qatar University Tameem Hadwan, MS, Qatar University Asma Al
Marwani, PhD , Hammad General Hospital, Qatar
Abstract Body
Background:
In blood bank, the storage procedures of packed red blood cell (pRBC) require some
conditions to ensure the maximum storage time for a safe blood supply. pRBC can
be stored up to 42 days in 2-6⁰C, as long as more than 75% red blood cells survive
in the first 24 hours post transfusion. However, pathological consequences can
affect the stored blood, they are termed as storage lesions. Some reversible
changes result from stored blood such as decreased ATP and 2, 3 BPG. Some
other damages are irreversible and includes increased osmotic fragility, small
echinocytic rigid red cells and microvesiculation.
Methods:
In this study, the effect of prolonged storage was assessed through investigating
morphological alteration and evaluating oxidative stress.Samples from
leukodepleted pRBC in SAGM stored at 4◦C for 42 days were withdrawn aseptically
on day 0, day 14, day 28 and day 42. Morphological changes were observed using
scanning electron microscopy and correlated with osmotic fragility and
hematocrit. Oxidative injury was studied through assessing MDA level as a marker
for lipid peroxidation.
Results:
Osmotic fragility test showed that extended storage time caused increase in the
osmotic fragility. Day 42 displayed the highest osmotic fragility by the curve shifting
to right. However, day 0 demonstrated the lowest osmotic fragility by the curve
shifting to the left. The hematocrit increased by 6.6% from day 0 to day 42. The last
2 weeks of storage period revealed alteration in the morphology with the
appearance of echinocytes and spherocytes. Small increase in MDA level was
observed indicating that lipid peroxidation occurred.
Conclusion:
Storage lesions and morphological alterations appeared to affect RBCs during the
storage period. These lesions are caused by oxidative injury, biochemical and
metabolic changes that result in damaged RBCs membrane. Further studies should
be performed to develop strategies that will aid in the improvement of stored RBC
quality and efficiency. For example, the effect of ROS can be reduced by storing the
24
CSTM 2016 – Conference Abstracts
blood bag in anaerobic condition. In addition, oxidative stress can be reduced by
adding antioxidant in the blood bag.
25
CSTM 2016 – Conference Abstracts
Audit of Provincial IVIG Request Forms and Documentation of
Efficacy in Four Tertiary Care Centres
Abstract Title
Audit of Provincial IVIG Request Forms and Documentation of Efficacy in Four Tertiary Care
Centres
Authors/Co-Authors & Affiliations
Andrew W. Shih, MD., BSc., McMaster University Erin Jamula, MSc., McMaster University
Calvin Diep, Western University Yulia Lin, MD., University of Toronto Chantal Armali, BSc.,
University of Toronto Nancy M. Heddle, MSc., McMaster University Aicha Traore, MD.,
McMaster University Jordan Doherty, MD., McMaster University Nishwa Shah, McMaster
University Christopher M. Hillis, MD., MSc., McMaster University
Abstract Body
IntroductionDespite the introduction of a mandatory IVIG Request Form in Ontario
and other provinces to reduce inappropriate use, Canada is the highest per capita
user of IVIG worldwide. We performed a retrospective audit of new IVIG Request
Forms supplemented by chart review to determine the case mix, authenticate the
information provided on request forms, and assess documentation of
efficacy.MethodsThree tertiary care centre sites with passive surveillance programs
and one site with an active surveillance program in Ontario participated.
Consecutive adult patients with a first-time IVIG request between JanuaryDecember 2014 were included. The specialty of the ordering physician, the
completeness of the form, documentation of diagnostic criteria for the medical
condition and indication for IVIG use, and documentation of efficacy were assessed
by manual form and chart review.Results178 patients were assessed. The most
common indications for IVIG use were immune thrombocytopenia (24.2%) and
secondary immune deficiency (20.2%) and the most frequent prescribers were
hematologists (37.6%) and neurologists (10.7%). Other conditions not listed on the
form represented 43 cases (24.2%), with the majority of these not indicated
according to current guidelines. Most patients who received IVIG for a medical
condition not known to respond to IVIG or having no indication for IVIG were at
passive surveillance sites.Only 52.1% of obese patients had IVIG specifically dosed
to ideal body weight and 27.0% of cases had dose verification. 32.6% of cases
lacked verification of diagnostic criteria and 51.7% did not meet criteria for IVIG use,
with documentation of diagnostic criteria and appropriate indications for IVIG higher
in the active surveillance site. 19.1% of all patients had a discrepancy between the
indication written on the form and the diagnosis in the clinical
record. Documentation of efficacy was lacking with 18.7% of clinic notes after IVIG
administration having no mention of efficacy, and only 26.0% denoting any
subjective improvement.ConclusionOur audit demonstrates a lack of compliance
with IVIG Request Form requirements, inappropriate use of IVIG, and lack of
documentation of diagnostic criteria and efficacy. These findings suggest
implementation of the forms and monitoring of IVIG usage needs reassessment.
26
CSTM 2016 – Conference Abstracts
Bacterial Growth During Storage of Thawed Cryoprecipitate at
20-24 oC for 24 Hours
Abstract Title
Bacterial Growth During Storage of Thawed Cryoprecipitate at 20-24 oC for 24 Hours
Authors/Co-Authors & Affiliations
Sandra Ramirez-Arcos, Ph.D., Canadian Blood Services Heather Perkins, B.Sc., Canadian
Blood Services Qi-Long Yi, Ph.D., Canadian Blood Services Craig Jenkins, B.Sc., Canadian
Blood Services William Sheffield, Ph.D., Canadian Blood Services
Abstract Body
Introduction/Objective: Transfusion of plasma components, such as
cryoprecipitate CPD (cryo), is recommended to treat patients with coagulation
abnormalities or massive bleeding. Currently, thawed cryo can only be stored at 20–
24 oC for a maximum of 4h. However, it has been demonstrated that the activity of
coagulation factors in thawed cryo is maintained after 24h of storage at 20–24 oC.
These results provided evidence to propose extending the shelf life of thawed cryo
for up to 24h. Since it was important to demonstrate the safety of the proposed
change, this study was aimed at determining if bacterial growth is significantly
increased in contaminated thawed cryo when stored for up to 24h at 20–24
oC.Design and Methods: Groups of 3 cryo units were used for each experiment
(N≥5). The three units were thawed, tested for sterility and spiked with one of the
following bacteria: Staphylococcus epidermidis, Serratia liquefaciens, Pseudomonas
putida, or Pseudomonas aeruginosa to a concentration of 102-103 CFU/mL. Unit 1
was designated as the control (t0), and was tested immediately for bacterial
concentration. Units 2 and 3, were stored in a platelet incubator to maintain 20–24
oC for 4h (t4) and 24h (t24), respectively. Upon incubation, these units were also
tested for bacterial enumeration. Differences in bacterial counts between storage
times were analyzed using t-test.Results: No differences in bacterial concentration
were observed between cryo control units (t0) and units stored for 4h (t4). When
cryo storage was prolonged to 24h, significant differences in bacterial concentrations
were observed for Gram negative organisms. Titers of S. liquefaciens, P. putida and
P. aeruginosa were significantly higher in t24 than in t4 cryo units (p=0.0016,
p=0.0113 and p=0.0032, respectively). In contrast, the concentration of S.
epidermidis was not significantly different between t4 and t24 units
(0.0938).Conclusions: Extending the shelf life of thawed cryo at 20–24 oC from 4h
to 24h is not recommended as pathogenic Gram negative bacteria are able to
proliferate under these conditions posing a significant safety risk for transfusion
patients.Acknowledgements: Canadian Blood Services Ottawa Site for providing
the cryo units for this study.
27
CSTM 2016 – Conference Abstracts
Best Blood Manitoba; collaboration with multi-organizational
and multi-disciplinary partners to improve Transfusion Medicine
Practice in Manitoba.
Abstract Title
Best Blood Manitoba; collaboration with multi-organizational and multi-disciplinary partners to
improve Transfusion Medicine Practice in Manitoba.
Authors/Co-Authors & Affiliations
Shauna Paul RN BN, Shana Chiborak RN, Brenda Herdman, MLT Best Blood Manitoba
Abstract Body
Introduction
Best Blood Manitoba is an initiative of the Manitoba Provincial Transfusion Practice
Advisory Committee and has been created to improve accessibility of current
relevant information on blood and blood products for patients and health care
providers. Barriers to information sharing identified were incomplete information,
information silos and generational learning needs. A website was designed to meet
the following goals:
1. Provide support for comprehensive vein to vein Transfusion Practice
Services to all Manitobans.
2. Provide an active forum to facilitate communication between multiorganizational, multi-regional and multi-professional membership.
3. Promote the safe and effective use of plasma protein products and blood
components throughout Manitoba.
Design and Methods
A content development team, made up of Transfusion Medicine experts, was formed
to design a multifunctional website that would contain protocols and written
processes for health care professionals as well as educational support with linkage
to evidenced based eLearning courses. Expertise from front line providers (nursing,
medical and laboratory) was utilized to create password protected areas containing
eshare work areas for collaboration and month end inventory input to capture realtime dashboards of quality indicators for Transfusion Medicine. Private access was
initiated one region at a time for data entry and sharing. Public access was granted
in November 2014 which was accompanied by promotional posters and in-services.
Results
28
CSTM 2016 – Conference Abstracts
Google analytics reports demonstrate continued growth in website traffic over time.
Returning visitation composes 38% of traffic suggesting a pleasant and valuable
viewing experience for users. Learning resources represent the most frequented
pages. Patient access areas were among the lowest number of visits and time
spent. Month end inventory data entry has reduced workload with the new
application according to anecdotal evidence.
Conclusions
Collaboration with multidisciplinary teams has provided comprehensive, efficient and
enjoyable information sharing in our region. Best Blood Manitoba is becoming the
corner stone of a modern collaborative community that supports safe and
appropriate transfusion that is current to a large geographical and complex health
care environment. It is recommended that patient access is promoted. Innovative
strategies for this are being considered.
Acknowledgements
WRHA Blood Conservation Service: Susan Kenny, website design and
development, Zhaopeng Fan, data management.
29
CSTM 2016 – Conference Abstracts
Black Women as Blood Donors
Abstract Title
Black Women as Blood Donors
Authors/Co-Authors & Affiliations
André Lebrun, MD., Héma-Québec Naderge Ceneston, RN, Héma-Québec Geneviève
Myhal, Project coordinator, Héma-Québec Jessica Constanzo-Yanez, RT, Héma-Québec
Marie-Claire Chevrier, Director, Ref. Labo, Héma-Québec
Abstract Body
Background: Finding compatible blood among Caucasian donors for sickle cell
anemia patients under red cell exchange program can be quite challenging and at
time source of ethical concerns about the oversolicitation of Rh neg persons. For
this reason we launched in 2009 a program to encourage increased blood donations
among black community members. We observed a good response from both men
and women. But although registered black women equalled men in numbers they
were deferred 15X more often than men because of low hemoglobin (Hb). Two
possible explanations were considered: first a high frequency of iron deficiency
among our black female donor population favoring development of anemia; second,
a more important limiting impact of 125g/L Hb criteria on blood donations for black
women vs Caucasian ones. Previous population studies have indeed revealed
significant Hb mean value differences between the two groups. In order to answer
those questions and eventually support a request to be made to Health Canada
(H.C.) aiming at lowering the Hb qualification criteria to 115g/L for black women we
ran a study to evaluate the impact of the proposed new criteria on these donors’ iron
stores. Globally, 25% of the 88 women were iron deficient before any donation.
When their iron stores levels were analyzed by referring to Hb levels >125 vs 115125g/L, no statistically significant difference was found. H.C. has accepted the
proposed changes combined with an iron supplementation program which will permit
evaluation of its impact on both iron stores and Hb levels. The program was
launched last August. A presentation of its framework and of preliminary results
following its progressive implementation is proposed.
Program projected goals: 1- Find the optimal iron dose and administration
modality aiming at iron store and/or Hb maintenance among black women blood
donors taking into account possible other blood loss sources. 2- Demonstrate that
adequate iron intake supplementation is a sufficient protective measure after blood
donation, so avoiding the burden and cost of ferritin testing.
30
CSTM 2016 – Conference Abstracts
Can we use membrane osmotic parameters to characterize the
red blood cell storage lesion?
Abstract Title
Can we use membrane osmotic parameters to characterize the red blood cell storage lesion?
Authors/Co-Authors & Affiliations
Abdulrahman Alshalani, CLS, University of Alberta Jason Acker, MBA Ph.D., Canadian Blood
Services
Abstract Body
Introduction/Objective: Red blood cell (RBC) have a semipermeable membrane
which controls the movement of water through aquaporins and lipid bilayers to
maintain osmotic equilibrium and allow for cell shrinkage or swelling. During storage
in the blood bank, the red blood cell membrane develops progressive structural and
functional damage. Defining the osmotic behavior of stored RBCs, which is not well
described in the literature, will allow us to assess the quality of the cell membrane
during storage and how it may respond to donor and/or blood component
manufacturing factors. Key membrane osmotic parameters include the hydraulic
conductivity (Lp), osmotically inactive fraction (Vb), and Arrhenius activation energy
(Ea). The objective of this study was to characterize the osmotic properties of RBCs
over the storage period.Design and Methods: A stopped-flow spectrophotometer
was used to determine Lp, Vb and Ea throughout 42 days of storage by monitoring
changes in hemoglobin autofluorescence as RBCs were exposed to anisotonic
solutions. RBCs were collected from age and sex matched units. Experimental
values of Lp were also characterized at three different temperatures (4, 20 and 37
ºC) to determine the Ea. Measures of RBC quality parameters including hemolysis,
osmotic fragility, mean corpuscular hemoglobin concentration(MCHC) and
deformability were also assessed in this study.Results: Results showed that RBCs
had an average hydraulic conductivity of 9.91 (±1.96) um/min/atm on day 3 of
storage which significantly increased within the first 14 days of storage (p<0.001)
until it stabilized after day 21. Similarly, this was associated with a significant
increase in the RBC osmotically inactive volume and the activation energy of RBC
water permeability. RBC quality characteristics showed an increase in hemolysis
(p=0.007) and osmotic fragility (p=0.92), and reduce MCHC (P=0.0002) and
deformability (p=0.02) with the first 14 days of storage. Conclusions: This study
shows that measures of RBC osmotic characteristics change with storage and
correlate with changes in known RBC quality metrics. Monitoring early storage
changes in RBC membrane osmotic parameters may be a good predictor of the
biophysical and chemical changes that affect the quality of RBCs.
31
CSTM 2016 – Conference Abstracts
Canadian Blood Services Implementation of a National
Phenotype Testing Program
Abstract Title
Canadian Blood Services Implementation of a National Phenotype Testing Program
Authors/Co-Authors & Affiliations
Balkar Gill, B.Sc, RT, Canadian Blood Services Gwen Clarke, MD, Canadian Blood Services
Sheila Cleveland, RT, Canadian Blood Services Nancy Angus, ART, Canadian Blood
Services
Abstract Body
Background:
In August 2011 Canadian Blood Services (CBS) consolidated and automated the
process of donor phenotype testing into the two existing Donor Testing Laboratories
in Calgary and Toronto. Previously donor phenotype testing was managed and
performed at eleven CBS production sites.
Method:
To assess the number of phenotyped units required, a survey was completed by
each CBS production site. The results provided the foundation in developing the
National Phenotype Testing Plan. This plan and testing algorithms were developed
to assist in building the Supply Chain national phenotype inventory and provide
antigen negative red cells for distribution to hospitals. The plan included routine
screening of the eleven common antigens (C, E, c, e, K1, Fya, Fyb, Jka, Jkb, S and s)
with provisions to perform testing of additional antigens according to clinical need.
To support customer requests for chronic transfusion recipients screening was
implemented for B Pos K1 negative, low frequency antigens, rare phenotype
requests to support sickle cell patients and other rare antigen combinations. The
process for hospital requests for antigen negative red cells remains unchanged. To
ensure adequate numbers of phenotyped units at each site during the
implementation phase a staggered approach was undertaken to consolidate eleven
sites to two. In addition to consolidation, automation for phenotyping was
implemented. Initial automation in August 2011 included testing of C, E, c, e and K1
on the Immucor Galileo instrument. In April 2015 complete automation of the eleven
common antigens was implemented on the Immucor NEO instrument.
Results:
The two testing sites routinely perform mass screening (initial and confirmatory) and
demand testing. The testing algorithms have significantly increased year over year,
the number of phenotype donors for the eleven common antigens. From January
2012 to December 2015 the total numbers of confirmed R1R1 and R2R2 donors
have increased from 11,031 to 22,797 and 2,554 to 3,971 respectively. With
automation of testing on the NEO the planned testing volumes have increased by
30% with no change to budget.
32
CSTM 2016 – Conference Abstracts
Conclusion:
Consolidating testing, introduction of automation and a national phenotype plan
allowed a cost effective approach to building a national phenotype donor red cell
inventory.
33
CSTM 2016 – Conference Abstracts
Care in the community - Home Transfusion by Community
Care Paramedics
Abstract Title
Care in the community - Home Transfusion by Community Care Paramedics
Authors/Co-Authors & Affiliations
Joanna McCarthy MLT, CLS Julia Hendry MLT, CLS Dr. Shabani-Rad, MD FRCPC, FCAP,
CLS Dr. Davinder Sidhu B.Sc, B.Pharm, LLB/JD, MD, FRCPC, CLS Dana Dalgarno Senior
Quality Analyst EMT-P, AHS Ryan Kozicky B.Sc., EMT-P, MPH, AHS Amy Melnick, RN,
BScN, MN, BA, TBCC, AHS
Abstract Body
Introduction: In 2015 CLS Transfusion Medicine TM, the Community Paramedic
Program (CPP) and the Tom Baker Cancer Centre (TBCC) collaborated to create a
pilot project to provide transfusions to patients in their home environmentDesign:
Through a close partnership and strong communication, TM and CPP worked
together to define eligibility criteria, referral requirements, procedures, protocols,
education, and an evaluation plan. The program allows community paramedics with
transfusion training to perform in-home transfusions for patients with mobility issues,
thereby eliminating the need for patients to travel to acute care sites for their
transfusion. Transport of patients to appointments can be costly and is a stressful
component of the patient’s experience. In home transfusions free up beds at day
treatment clinics and emergency departments, allowing other patients to receive
treatment not currently offered in the community. Results: From Oct 2015 to Feb
2016 the CPP has performed 26 home transfusions on 15 different patients - 43
units of red cells and 9 platelets have been administered. To date, there have been
no adverse reactions reported. Patient interviews were conducted during the pilot
and feedback was overwhelmingly positive. Two broad themes emerged: 1. there
were fewer burdens (physical time, travel, quieter, etc.) on the patient and
caregivers. 2. Patients, family and caregivers were confident in the ability if the
community paramedics and found the CPs friendly, efficient and professional. There
are potential cost considerations for patients and their caregivers; the cost of private
transportation (~$350) and time off work for caregivers although difficult to quantify,
must be considered. The cost of transfusing 2 units of red cells at an Alberta Health
Services Day Medicine unit is ~$400. ~$1300 if the transfusion occurs at TBCC. In
contrast the cost of a CPP transfusion visit is ~ $300.Conclusion: The program has
been successful from a laboratory aspect, the procedures and policies developed by
TM contributed to a patient centered care program. The CPP has been successful at
creating an environment where patients have access to excellent care without the
extra stress and costs associated with a hospital visit.
34
CSTM 2016 – Conference Abstracts
Case Study: Cryopreservation of a Gerbich Null Phenotype
Red Cell Concentrate
Abstract Title
Case Study: Cryopreservation of a Gerbich Null Phenotype Red Cell Concentrate
Authors/Co-Authors & Affiliations
Tracey R. Turner, BMus, MLT, Canadian Blood Services Anita Howell, BScMLT, Canadian
Blood Services Natasha McLaughlin, RN, Canadian Blood Services Eiad Kahwash, MD,
Canadian Blood Services Barbara Hannach, MD, Canadian Blood Services Gwen Clarke,
MD, Canadian Blood Services Robert Skeate, MD, Canadian Blood Services Jason P. Acker,
MBA, Ph.D., Canadian Blood Services
Abstract Body
Introduction: The Gerbich null (Ge-) or Leach phenotype is a rare blood group
associated with RBCs that exhibit elliptocytosis. Our patient required a Ge-, O- red
cell concentrate (RCC) for potential transfusion from a rare donor. During
transportation from a collection site, the whole blood donation underwent a
temperature deviation prior to manufacturing. Despite the deviation, a quality
evaluation was undertaken to evaluate the suitability of the RCC for allogenic
use. When the RCC was not required for transfusion, further studies related to the
effect of cryopreservation on a Ge- RCC were performed. It was not known whether
elliptocytosis affects the ability of RBCs to withstand the physical and chemical
stresses endured during cryopreservation thereby impacting deglycerolized RCC
quality. As Ge- patients are very rare, certainty about quality of RCCs postcryopreservation could impact patient care.Design and Methods: A non-destructive
method was used to obtain a pre-cryopreservation sample. Hemolysis, hematocrit,
ATP, morphology, potassium, and sterility were assessed. Glycerolization and
deglycerolization were performed using standard methods on the COBE
2991. Twenty-four hours post-deglycerolization; hemolysis, hematocrit, indices,
ATP, deformability, morphology, and recovery were assessed. Data was compared
to CBS’s Quality Monitoring Program (QMP) data set.Results: Morphological
examination prior to and following cryopreservation confirmed the presence of
elliptocytosis (39 - 40 %). At day 3 post-collection, the unit met CSA standards for
hemolysis (0.15 %), hematocrit (0.53 L/L), hemoglobin (41 g/unit), and
sterility. Hemolysis was elevated when compared to QMP data (0.08 ±
0.01%). Extracellular potassium (5.2 mmol/L) was below the compared QMP data
(10.2 ± 1.3 mmol/L). Post-cryopreservation, the unit met standards for hemolysis
(0.75 %), hematocrit (0.56 L/L), hemoglobin (37 g/unit), and recovery (97%). ATP
(3.17 μmol/g Hb) and deformability (3.872 EIMax, 0.498 KEI) were also
examined.Conclusions: Use of a non-destructive sampling method allowed sample
collection without causing adverse effects to the RCC thus allowed retention of the
product for patient use. The manufacturing deviation or the presence of elliptocytes
could account for the elevated hemolysis seen at pre-cryopreservation testing but
further evaluation should be pursued. The unit met quality standards for
cryopreserved RCCs at expiry indicating that Ge- RBCs can be successfully
cryopreserved.
35
CSTM 2016 – Conference Abstracts
Case Study: Quality Assessment of a Rare Cryopreserved
Red Cell Concentrate after a Transient Warming Event
Abstract Title
Case Study: Quality Assessment of a Rare Cryopreserved Red Cell Concentrate after a
Transient Warming Event
Authors/Co-Authors & Affiliations
Tracey R. Turner, BMus, MLT, Canadian Blood Services Anita Howell, BScMLT, Canadian
Blood Services Eiad Kahwash, MD, Canadian Blood Services Barbara Hannach, MD,
Canadian Blood Services Jason P. Acker, MBA Ph.D., Canadian Blood Services
Abstract Body
Introduction: A rare cryopreserved red cell concentrate (RCC) with a Jka and Jkb
negative phenotype was transported between Canadian Blood Services sites. Upon
arrival, it was noted that another unit in the same container was leaking post
transport. The rare RCC was placed into quarantine at -20°C, deviating from the
standard storage conditions for cryopreserved RCCs (≤-65°C). After approximately
45 hours, the rare RCC was moved to the correct storage conditions. This deviation
was noted, and the RCC was rejected for patient use, but evaluation of a
cryopreserved RCC with a transient warming event (TWE) was undertaken.Design
and Methods: Glycerolization and deglycerolization were performed using standard
methods on the COBE 2991. Post-deglycerolization samples were drawn at
approximately 24±2 hours post-thaw. Hemolysis, hematocrit, indices, ATP, and
extracellular potassium were assessed. Data was compared to CSA standards and
previously collected cryopreserved RCC data.Results: The RCC met CSA
standards for deglycerolized RCCs for hemolysis (0.54%), hematocrit (0.50 L/L), and
hemoglobin (53 g/unit). Surprisingly, the RBC indices values (MCV 76.5 fL, MCH
21.4 pg, MCHC 280 g/L) suggest microcytic hypochromic RBCs deviating from
previously reported values for cryopreserved RCCs (MCV 105±2 fL, MCH 30±1 pg,
MCHC 286±5 g/L, n=12). Additionally, ATP concentration (1.618 μmol/g Hb) when
compared to previously reported data for cryopreserved RCCs (3.986±0.401 μmol/g
Hb, n=12), is lower than expected.Conclusions: It is unknown if the TWE the
specific RBC phenotype, or other potential donor related factors are responsible for
the changes in RBC post-thaw indices or the decrease seen in ATP concentration
for this RCC. As data on the effect of the specific TWE on a cryopreserved unit with
a normal phenotype was unavailable, we are unable to resolve whether the
observed RBC characteristics were due to the TWE, the rare RBC phenotype, or
other donor factors. Since the glycoproteins of the Kidd blood group system may
play a role in maintaining osmotic stability of RBCs, further investigation should be
undertaken to better characterize the effects of cryopreservation on Jka and Jkb
negative RCCs. Additionally, further evaluation of TWE on cryopreserved RCCs
independent of rare blood groups is warranted.
36
CSTM 2016 – Conference Abstracts
Comparison of bacterial attachment between apheresis and
buffy coat platelet bags
Abstract Title
Comparison of bacterial attachment between apheresis and buffy coat platelet bags
Authors/Co-Authors & Affiliations
Maria Loza-Correa, Ph.D., Canadian Blood Services Miloslav Kalab, Ph.D., Agriculture
Canada Qi-Long Yi, Ph.D., Canadian Blood Services Sandra Ramirez-Arcos, Ph.D.,
Canadian Blood Services
Abstract Body
Introduction/Objective: Platelet concentrates (PCs) are stored in gas-permeable
plastic bags containing a glucose-rich additive solution, at 22±2°C, under agitation.
This environment favors bacterial growth and makes PCs the blood component most
susceptible for contamination. Canadian Blood Services produces four-donor buffy
coat PC pools and single-donor apheresis PCs, which are stored in bags
manufactured by MacoPharma and Terumo, respectively. We have shown that
bacteria attached to PC containers can be missed during PC culture testing. This
study was aimed at comparing bacterial adhesion to the inner surface of
MacoPharma and Terumo bags in the presence or absence of residual PCs.Design
and Methods: Sets of 4 bags were used in each test (N=5). Each set had two bags
obtained after draining one apheresis and one buffy coat PC (“PC-conditioned”
bags), and two sterile (“PC-free”) bags obtained from apheresis and buffy coat
collection kits. Each bag was inoculated with a 200-mL Staphylococcus epidermidis
culture in glucose-supplemented Trypticase Soy Broth, adjusted to 0.5 CFU/mL.
Two S. epidermidis isolates were tested. Culture bags were incubated under platelet
storage conditions for 7 days, emptied, rinsed and dislodged or examined by
scanning electron microscopy (SEM). Bacterial concentrations were determined in
the dislodged solutions with data analyzed using statistical models.Results:
Bacterial adherence in PC-conditioned bags was significantly higher (p<0.0001)
compared to PC-free bags for both manufacturers, which was supported by SEM
images. Although bacterial attachment in PC-conditioned bags was not significantly
different between the two bag types, a significant increase in bacterial adherence
was observed on Terumo bags compared to MacoPharma containers when PC-free
bags were used (p<0.05). No differences in attachment were found between the two
S. epidermidis strains (p>0.05).Conclusions: Differential bacterial adherence
between MacoPharma and Terumo PC-free bags is likely due to the composition
and texture of the biomaterials. Notably, bacterial adherence is enhanced in PCcontaining bags, independently of the PC bag type, and future efforts should be
focused on reducing attachment of PC factors to the inner surface of the bags which
serve as a scaffold for bacterial adhesion. Acknowledgements: netCAD blood
donors and staff for providing PCs for this study.
37
CSTM 2016 – Conference Abstracts
Converting from an Unlicensed RHD Genotyping Test Kit to a
Health Canada Licensed Test in Five Days
Abstract Title
Converting from an Unlicensed RHD Genotyping Test Kit to a Health Canada Licensed Test
in Five Days
Authors/Co-Authors & Affiliations
Kirsten Hannaford, MLT., Canadian Blood Services, Edmonton Leanne To, MLT., Canadian
Blood Services, Edmonton Dr. Judy Hannon, MD., Canadian Blood Services Robert Fallis,
Associate Director, Canadian Blood Services
Abstract Body
Introduction: Performance of RHD genotyping is recommended when a discrepant
serological RhD typing or weak D result is present in females of childbearing age or
patients likely to require chronic transfusions. RHD genotyping aims to decrease
unnecessary injections of RhIG in pregnant women and transfusions of D- red cells
to patients who can safely be managed as D+. Our laboratory implemented RHD
genotyping on June 01, 2014 using a research-use-only (unlicensed) kit. The kit and
proprietary reading system received Health Canada approval as an invitro diagnostic (licensed) test on May 1, 2015. To prevent disruption of
our testing, we created a plan to convert from unlicensed to licensed testing within
one week. Here, we describe our process for the switch-over.Process: Six months
prior to the planned changeover, an in-depth impact analysis was performed
and deliverables were assigned to inter-disciplinary teams. The Validation
department created Installation, Operational (IOQ) and Performance (PQ)
protocols. Quality Assurance (QA) ensured documents were compliant with
standards and the kit's product insert. Decision-makers provided consultation,
direction and document acceptance. Equipment Services maintained records and
equipment details. The subject matter expert created laboratory work instructions
and training materials. Technologists were trained to the validation protocols and
new work instructions. The manufacturer’s technical specialist installed equipment
and provided procedural training. Communication and clear deliverables
were maintained throughout to ensure adherence to tight timelines.Results: The last
unlicensed test run was completed on Friday, January 8, 2016. Conversion to the
licensed system started the following Monday and finished Friday, January 15. On
Day 1, the unlicensed equipment was replaced with the licensed equipment. The
IOQ protocols were also executed and forwarded for QA review. On Day 2, two
technologists completed vendor lead test training. On Day 3, after the IOQ protocol
was accepted by QA, one trained technologist completed the PQ testing, while
a third technologist completed training. On Day 4, two additional technologists were
trained. On Day 5, the PQ documentation was finalized and QA approval was
obtained. Testing with licensed kits became effective on Monday, January 18,
2016.Conclusion: Our laboratory was successful in converting from testing with an
unlicensed to a licensed RHD genotyping test system in five days, preventing
lengthy testing disruptions. Diligent planning, organization and cooperation within
the multi-disciplinary team provided uninterrupted service and a controlled
transition.
38
CSTM 2016 – Conference Abstracts
39
CSTM 2016 – Conference Abstracts
Counting the Colloid: An Audit of Overall and Individual
Allocations of Albumin by Patient Care Area.
Abstract Title
Counting the Colloid: An Audit of Overall and Individual Allocations of Albumin by Patient
Care Area.
Authors/Co-Authors & Affiliations
Shameema Akhter Ferdous, University of Ontario Institute of Technology Brian Marsell,
University Health Network Nayana Sondi, University Health Network Sally Balmer, University
Health Network Lani Lieberman, MD, University of Toronto Jacob Pendergrast, MD,
University of Toronto Christine Cserti-Gazdewich, MD, University of Toronto
Abstract Body
Introduction: The dominant plasma protein (and oncotic pressure determinant) is
albumin, depletions of which may merit replacement. This purified plasma protein is
available in iso-oncotic (5%A) and hyper-oncotic (25%A) formats, typically bottled in
500cc and 100cc volumes respectively. At $37.60CAD/25g, albumin is >30-times
costlier than 500cc of normal saline, the crystalloid comparator in volume
replacement studies. Meanwhile, evidence for albumin’s superiority is not as
marked in each context of use. Albumin may be strongly recommended (in
spontaneous bacterial peritonitis, large volume paracentesis, hepatorenal syndrome,
and apheresis), inconclusively endorsed (in septic shock or adult respiratory distress
syndrome), or discouraged in ungainful situations (general volume resuscitation,
hypoalbuminemia, or circuit primes). At an academic centre, where all indications
occur, we sought to quantify 5%A and 25%A use in meaningful patient care areas.
Methods: Utilization was analyzed over 3 months (01/Jul-30/Sep, 2015) through
dispensations recorded in the laboratory information system (HCLL 4.6.0.2,
Mediware Info Sys Inc, Oakbrook IL), as coded by recipient identifier, date/time,
albumin concentration/volume issued, and location. Data were analyzed by 5%A
and 25%A volumes dispensed to five sorted locations (intensive care [ICU],
operating rooms [OR], apheresis [AP], non-apheresis outpatients [OP], and noncritical inpatients [IP]) and by patients therein.
Results: 3786 patient-use-events occurred, with only 3 unknown locations (0.08%
data loss). >2million mL of 5%A and >360,000mL of 25%A were dispensed (4067
and 3665 bottles respectively), costing >$100,000CAD/mo. Leading users of 5%A
by mL were AP (63%), OR (19%), and ICU (14%). Leading users of 25%A by mL
were ICU (41%), IP (34%), and OP (24%). By summary averages, monthly bottle
counts for 5%A and 25%A given to any given area-user was as follows:
AP
ICU
OR
IP
OP
40
CSTM 2016 – Conference Abstracts
5%A
6.2
0.6
0.8
0.9
0.8
25%A
0.7
1.7
0.4
2.1
1.9
Conclusions: This audit sets the stage for future activity comparisons,
distinguishing a non-modifiable domain (AP) from other potentially curtailed user
groups (ICU, OR, IP, OP).
41
CSTM 2016 – Conference Abstracts
Designing the Ontario Transfusion Quality Improvement Plan
(OTQIP)
Abstract Title
Designing the Ontario Transfusion Quality Improvement Plan (OTQIP)
Authors/Co-Authors & Affiliations
On behalf of the OTQIP Committee: Denise Evanovitch, Regional Manager, Southwest
ORBCoN Yulia Lin, MD, University of Toronto and Sunnybrook Health Sciences Centre John
Freedman, MD, University of Toronto and ONTraC Allison Collins, MD, ORBCoN and
Northumberland Hills Hospital
Abstract Body
Background: The Ontario Regional Blood Coordinating Network (ORBCoN) was
approached in 2013 by the Ontario Blood Advisory Committee (OBAC) to consider
the development of a province wide transfusion quality improvement plan
(QIP). ORBCoN held a “Quality Focus Day” (QFD) in February 2014 to explore
transfusion quality parameters which could be included in this QIP. The main goal is
to reduce patient harm by improving transfusion practice in hospitals. The following
recommendations were made at the QFD:

Select a blood component that most hospitals could monitor

Display progress in a public forum so that hospitals could compare
themselves to peers

Strike an Ontario-wide transfusion QIP committee to develop the plan and
supporting resources
Methods
: The membership of the OTQIP Committee includes representatives from the QFD,
ORBCoN’s three geographic regions, Ontario Transfusion Coordinators (ONTraC),
physicians, technologists, nurses, administrators, clinicians, laboratorians, quality
and risk managers, OBAC, Canadian Blood Services and a patient. The initial
meeting was held in November 2014, followed by teleconferences and another face
to face meeting in February 2016.
Results
: The committee strategized about the framework of the plan, objectives, indicators,
measurement tools, alignment with other quality programs and legislation such as
Ontario’s Excellent Care for All Act (ECFAA), and communication planning. Links
were established with Health Quality Ontario (HQO), the CSTM, Ontario Hospital
Association, OBAC and Choosing Wisely Canada (CWC). The OTQIP is based on
the HQO model for QIPs, which is already familiar to Ontario hospitals. The QIs are:

% of RBC orders with pre-transfusion Hb less than 80 g/L (5-year goal 80%)
42
CSTM 2016 – Conference Abstracts
 % of RBC orders for a single unit only (5-year goal 80%)
An accompanying toolkit is being developed to assist hospitals in implementing the
OTQIP. Communication to hospitals has also occurred through multiple
channels.Conclusions: The OTQIP and toolkit were launched at ORBCoN’s
Transfusion Committee Forum in April 2016. Volunteer hospitals have indicated
their support. It is endorsed formally by OBAC and is being included with the
Choosing Wisely Canada campaign.Acknowledgements ORBCoN gratefully
acknowledges: OTQIP Toolkit working groups, OBAC, ONTraC, OTQIP Committee,
the Ministry of Health and Long-Term Care (MOHLTC)
43
CSTM 2016 – Conference Abstracts
Detection of Hemoglobin C acquired from a donor red blood
cell unit following exchange transfusion
Abstract Title
Detection of Hemoglobin C acquired from a donor red blood cell unit following exchange
transfusion
Authors/Co-Authors & Affiliations
Oksana Prokopchuk-Gauk, MD, University of Alberta; Mireille Lareau, MLT, Calgary
Laboratory Services; Donna Lee-Jones, MLT, Calgary Laboratory Services; Joanna
McCarthy, MLT, Calgary Laboratory Services; Thomas Fourie, MD, Calgary Laboratory
Services and University of Calgary
Abstract Body
Background: Red blood cell (RBC) exchange transfusion is an important treatment
modality for patients with severe symptomatic complications of sickle cell disease
(SCD). Certain hemoglobin (Hb) allele variants, such as HbS and HbC known to
confer protection against malaria infection, are commonly found in persons of
African descent. Here, we present a case of a 37 year old male of African heritage
with SCD who was found to have a new HbC on post-RBC exchange testing, which
was confirmed to be acquired from a donor RBC unit.Methods: We routinely use
high performance liquid chromatography (HPLC) to measure HbS percentages on
samples from patients before and after RBC exchange transfusion. All RBC units
selected are phenotype matched and SickleDex negative. To provide an estimate of
the potential rate of variant Hb transfusion in our automated RBC exchange
recipients, we completed an audit of all RBC units transfused from the inception of
our program in April 2014 through February 2016.Results: The pre-RBC exchange
HPLC results of our patient demonstrated HbS=87.4%, HbF=9.8%, HbA2=2.8% and
HbA=0.0%. Following RBC exchange transfusion with 9 units, his HPLC results
showed HbS=26.5%, HbF=3.3%, HbA2=2.9% and HbA=62.6%, with detection of a
new peak measuring 4.7% at a retention time of 4.46 minutes – the usual position of
HbC. HPLC testing subsequently performed on segments from each RBC unit used
for his exchange found one donor to have a baseline HbA=61.7% and a large peak
at 4.46 minutes measuring 35.0%, confirmed to be HbC by hemoglobin
electrophoresis. A total of 300 RBC units have been used for 35 automated RBC
exchange transfusions in 9 SCD patients to date at our center. Only this one unit
has been confirmed to carry a Hb variant.Discussion: In this case, a small but
clinically insignificant HbC concentration was detected following exchange
transfusion with one RBC unit from a trait carrier. Hb variant presence is not a
criterion for blood donor deferral. Detection of acquired Hb variants may become
more common on post-RBC exchange transfusion testing since SCD patients
routinely receive phenotype matched RBC units that could be from ethnically similar
donors.
44
CSTM 2016 – Conference Abstracts
Determining the quality benchmark metric for appropriate use
of red blood cell transfusion: A quality audit at 10 hospitals
Abstract Title
Determining the quality benchmark metric for appropriate use of red blood cell transfusion: A
quality audit at 10 hospitals
Authors/Co-Authors & Affiliations
Jordan Spradbrow, BSc., Dept. of Clinical Pathology, Sunnybrook Health Sciences Centre,
Toronto, ON Robert Cohen, Dept. of Clinical Pathology, Sunnybrook Health Sciences Centre,
Toronto, ON Yulia Lin, MD., Dept. of Clinical Pathology, Sunnybrook Health Sciences Centre,
Toronto, ON; Dept. of Laboratory Medicine and Pathobiology, University of Toronto, Toronto,
ON Chantal Armali, BSc., Dept. of Clinical Pathology, Sunnybrook Health Sciences Centre,
Toronto, ON, Canada Allison Collins, MD., Dept. of Clinical Pathology, Northumberland Hills
Hospital, Cobourg, ON, Canada Christine Cserti-Gazdewich, MD., Dept. of Clinical
Pathology, University Health Network, Toronto, ON; Dept. of Laboratory Medicine and
Pathobiology, University of Toronto, Toronto, ON Lani Lieberman, MD., Dept. of Clinical
Pathology, University Health Network, Toronto, ON; Dept. of Laboratory Medicine and
Pathobiology, University of Toronto, Toronto, ON Katerina Pavenski, MD., Dept. of
Laboratory Medicine, St. Michael’s Hospital, Toronto, ON; Dept. of Laboratory Medicine and
Pathobiology, University of Toronto, Toronto, ON Jacob Pendergrast, MD., Dept. of Clinical
Pathology, University Health Network, Toronto, ON; Dept. of Laboratory Medicine and
Pathobiology, University of Toronto, Toronto, ON Kathryn Webert, MD., Medical Services and
Innovation, Canadian Blood Services, Ancaster, ON Jeannie Callum, MD., Dept. of Clinical
Pathology, Sunnybrook Health Sciences Centre, Toronto, ON
Abstract Body
Background:Determining appropriateness of red blood cell (RBC) transfusion at an
institution requires labour-intensive medical chart audits and expert
adjudication. We sought to determine if easily obtainable metrics (proportion of
single unit transfusions, RBCs/100 acute inpatient days, proportion of transfusions
with pre-transfusion hemoglobin below 80 g/L or post-transfusion hemoglobin below
90 g/L) could accurately replace chart auditing as a means to evaluate transfusion
appropriateness.
Design and Methods:A retrospective medical chart audit of RBC transfusions at
ten hospitals was performed. Each transfusion event was dually adjudicated using
predetermined criteria for appropriate transfusion. An initial block of thirty RBC units
was adjudicated followed by additional blocks of ten units until the difference
between the cumulative percentage of appropriate RBC units in the preceding block
and final block was below 3%. Linear and multi-variable logistic regression were
used to determine whether the four metrics were associated with
appropriateness. To assess under-transfusion, all inpatients with hemoglobin levels
below 60 g/L during the audit period were reviewed to determine if they received
insufficient transfusion care.
Results:Out of the 498 units audited, 78% were adjudicated as appropriate
(κ=0.9603), with significant variability in appropriateness between institutions (range:
31%-100% of transfusions appropriate). Fifty audits or less were required at nine of
45
CSTM 2016 – Conference Abstracts
the ten institutions. No under-transfusion events were identified. Pre-transfusion
hemoglobin under 80 g/L (OR, 16.41 95% CI, 5.32-60.63) and post-transfusion
hemoglobin under 90 g/L (OR, 4.75 95% CI, 2.00-11.29) were found to significantly
increase odds of appropriateness, however the pre- and post-transfusion
hemoglobin values with the optimal sensitivity and specificity for appropriateness (74
g/L and 84 g/L) misclassified 30% and 38% of transfusions, respectively.
Conclusions:Our results demonstrated that there is marked variability between
institutional rates of appropriate RBC transfusion and overall opportunity to optimize
practice. Additionally, we determined that under-transfusion is currently only a
theoretical concern. Our results suggest that the decision to transfuse is likely too
complicated to pare down to a single factor, such as a hemoglobin threshold, to
determine appropriateness. We recommend a medical chart audit of 50
transfusions with adjudication using robust appropriateness criteria, to obtain an
accurate estimate of RBC transfusion appropriateness for future benchmarking
initiatives.
46
CSTM 2016 – Conference Abstracts
Development and Evaluation of an Online Training Program for
Stem Cell Drive Recruiters
Abstract Title
Development and Evaluation of an Online Training Program for Stem Cell Drive Recruiters
Authors/Co-Authors & Affiliations
Warren Fingrut, MD, Stem Cell Club; University of Toronto
Abstract Body
IntroductionUnrelated stem cell donors are recruited at stem cell drives, at which
recruiters guide registrants to provide informed consent and a tissue sample
(buccal-swab) for HLA-typing. Studies have shown that registrant experience,
including impression of how knowledgeable recruiters are, impacts donor attrition
rates. These studies highlight the need for well-trained, competent recruiters. A
recent World Marrow Donor Association guideline recommends topics to be included
in a training program delivered to volunteers, staff recruiters, and drive supervisors
(Schmidt 2013). However, to date, no recruiter training programs have been
described in the literature. The Stem Cell Club is a federal non-profit in Canada that
works to strengthen Canada's donor-database. This presentation outlines Stem Cell
Club's online training program for recruiters.MethodsA three-module self-directed
online training program was constructed: 1) volunteering at, 2) leading, and 3)
organizing a stem cell drive. These modules feature spiral curricula in: stem cell
donation science, strategies for donor recruitment, informed consent, quality control,
good documentation practices, confidentiality and privacy, recruitment of the mostneeded donors, redirecting non-optimal donors to help in other ways, and drive
supplies and setup. All WMDA recommended training topics for recruiters are
included (Schmidt 2013). The modules are published online at
www.stemcellclub.ca/training. Each module ends with a link to a post-module quiz to
assess successful knowledge transfer.ResultsSince the modules’ publication in
09/2015, 148, 64, and 28 recruiters have completed the first, second, and third
modules and post-module quizzes. Quiz scores are over 90% for each recruiter and
module. In a module evaluation survery including 44, 33, and 24 club members who
had completed the volunteering at, leading, and organizing a stem cell drive
modules, 87.5-97.7% agreed or strongly agreed that the modules prepared them for
their first shifts at a stem cell drive in these roles.ConclusionsThis presentation
showcases a novel strategy to deliver training to stem cell donor recruiters. It is
relevant to any registry looking to build or upgrade their recruiter training program,
and to anyone who organizes stem cell donor recruitment
drives.AcknowledgementsThis work was supported by a 2015 Canadian Blood
Services BloodTechNet Grant
47
CSTM 2016 – Conference Abstracts
Development and Management of Hereditary Angioedema
Recommendations
Abstract Title
Development and Management of Hereditary Angioedema Recommendations
Authors/Co-Authors & Affiliations
Jennifer Danielson, BSc MT, BC Provincial Blood Coordinating Office Dr. Doug Morrison, MD
FRCPC, BC Provincial Blood Coordinating Office Dr. Tanya Petraszko, MD FRCPC,
Canadian Blood Services Dr. Amin Kanani, MD FRCPC, Providence Health Care Dr. Don
Stark, MD FRCPC, Providence Health Care
Abstract Body
Introduction / ObjectiveHereditary Angioedema (HAE) is a rare genetic disorder,
affecting the C1 Esterase enzyme. Patients with HAE experience recurrent acute
attacks of pain and swelling that can require emergency room treatment,
hospitalization and can be life threatening. Quality of life for patients can be
impacted, as attacks occur unpredictably, with varying frequency and severity, and
can be disfiguring and disabling. This condition may be difficult to recognise in an
emergency setting. In order to better support patients and caregivers with consistent
diagnosis and timely treatment, provincial recommendations and treatment plan
templates have been developed. Design and MethodsIn 2010, an International
Consensus document for HAE diagnosis and treatment was published. In 2012, a
Provincial Working Group of Immunologists, supported by the BC Provincial Blood
Coordinating Office, was established to develop diagnostic and treatment
recommendations applicable to British Columbia. In late 2014, a Canadian guideline
was published containing information specific to treatments available in Canada.
The Working Group reconvened and brought in additional expert Transfusion
Medicine Service (TMS) and Health Authority members to review and update the BC
recommendations, as applicable. The group considered additional opportunities to
improve awareness of HAE and treatments in emergency settings. ResultsIn 2012,
the Working Group published BC HAE Diagnostic and Treatment
Recommendations. The recommendations were disseminated provincially to TMS,
Immunologists and Internists treating HAE patients. In 2016, the Working Group
released and disseminated an updated set of provincial treatment recommendations
and sample treatment plan to align with the Canadian Guidelines. ConclusionsA
provincial working group comprised of subject matter experts and regional
champions successfully collaborated to develop provincial recommendations and
templates to support physicians and TMS across regions. Recommendations were
disseminated directly to the treating physicians and facilities throughout the province
as a means to raise awareness and support consistent patient treatment across
facilities. The information is also readily accessible online on the PBCO
website.AcknowledgementsWe are grateful to the 2012 and 2015 Working Group
Members: Dr. Tanya Petraszko, Dr. Doug Morrison, Dr. Amin Kanani , Dr. Don
Stark, Dr. Kingsley Lee, Dr. Brian Berry, Sarah Oxley, Maureen Wyatt, Martha
Elmore.
48
CSTM 2016 – Conference Abstracts
Development of a cord blood thaw protocol based on post thaw
cell viability and potency
Abstract Title
Development of a cord blood thaw protocol based on post thaw cell viability and potency
Authors/Co-Authors & Affiliations
Roya Pasha, Canadian Blood Service Nicolas Pineault, Canadian Blood Service
Abstract Body
Cord blood units (CBU) are stored frozen at Cord Blood Banks until their use at
transplant centres. New regulations require banks to provide a recommended thaw
protocol. This protocol should also be used for potency testing and stability
assessment.The goal of this study was to develop such protocol that maintains high
viability and clonogenic potential of CBUs based partially on practices of Canadian
transplant centres (CTC). Several parameters such as temperature, diluent and
mode of dilution were assessed. Analyses included total nucleated cell recovery and
measure of CD45+ leukocyte and modified ISHAGE CD34+ cell viabilities with
AnnexinV/Sytox staining. Furthermore, we evaluated the effect of two different
diluents, PlasmaLyte-A and Dextran-40 on product stability and potency up to 4 hour
post-thaw.The operating procedures of 4 CTC and 3 international centres were
reviewed. Each differed in regard to the volume of diluent added and concentrations
of Dextran-40 and human serum albumin (HSA). A diluent (5% Dextran-40, 4%
HSA) and a final dilution of 5-fold was selected as consensus. The viability of
leukocytes and CD34+ cells were significantly reduced (-13%, P<0.001) when CBUs
were thawed with cold instead of room temperature (RT) diluent. Increasing dilution
(1 to 6 CBU volumes) of CBUs also tended to decrease cell viability. However,
stepwise addition of diluent with two 15 minutes equilibrium time generated more
viable cells compared to one step addition (P<0.01, n=4). Comparing two clinically
relevant diluents (Dextran-40 vs. PlasmaLyte-A) with the developed thaw protocol
(stepwise dilution with 4 volume of RT diluent) showed significantly higher viabilities
for leukocytes (+12%) and CD34+ cells (+7%) (P<0.05, n=4) and greater numbers of
colony forming unit in a potency assay (+40%, P<0.01, n=2) for CBUs thawed with
PlasmaLyte-A/HSA. The decreased viability obtained with Dextran-40 was the
results of increased necrosis (+63% for CD34+ cells, P<0.01). Finally, viabilities of
CD45+ and CD34+ cells were maintained over the 4 hours of storage at RT.In
conclusion, the protocol satisfies regulatory agencies requirements with respect to
viability, clonogenic potential and product stability. PlasmaLyte A was also confirmed
as an attractive substitute to chronically backordered clinical grade Dextran-40.
49
CSTM 2016 – Conference Abstracts
Development of the Ontario Transfusion Quality Improvement
Plan (OTQIP) Toolkit
Abstract Title
Development of the Ontario Transfusion Quality Improvement Plan (OTQIP) Toolkit
Authors/Co-Authors & Affiliations
Scheuermann S, Evanovitch D, Thompson T, Lin Y, Cameron T, Collins A, Owens W Ontario
Regional Blood Coordinating Network (ORBCoN)
Abstract Body
Background: The OTQIP Committee developed an Ontario-wide QIP plan to
reduce patient harm by improving RBC transfusion practice. The Committee
recognized that hospitals wishing to adopt the OTQIP would benefit from having
some “getting started” information available in the form of a toolkit. Suggested items
to include were:

RBC clinical practice recommendations

Order set template

A strategy and SOP for MLT screening of RBC orders

Communication and measurement strategies
 Tips/education for physician and nurses
Methods: ORBCoN established two working groups: one consisting primarily of
physicians for the RBC recommendations and order set template, and the other
consisting primarily of technologists to establish the resources for prospective
screening of RBC orders by technologists. The meetings were held by
teleconference, and the OTQIP Committee was asked for input and kept apprised of
the progress by email, teleconferences and a face to face meeting. The draft RBC
recommendations were reviewed by a large group of clinician stakeholders.Results:
The recommendations/order set working group decided that platelets and plasma
would be included with RBCs to save hospitals from having to obtain multiple
Transfusion Committee or MAC approvals for different components. The order set
is a template that can be adapted to each hospital’s information system or be paper
based. These documents are based on national (e.g. NAC, Choosing Wisely
Canada, CSTM) and international (e.g. AABB, British Committee for Standards in
Haematology) guidelines, current literature, and expert opinion. The screening tools
for technologists includes an SOP, algorithms, a form for recording the follow up of
apparently inappropriate orders, and a job aid. They were developed with
suggestions from working group members who have implemented prospective
screening at their own hospitals.Conclusions: The OTQIP and toolkit were
launched at ORBCoN’s Transfusion Committee Forum in April 2016. These are
“living documents” that will continue to evolve to meet the quality improvement
50
CSTM 2016 – Conference Abstracts
needs of Ontario hospitals in promoting the uptake of best transfusion
practices.Acknowledgements: ORBCoN gratefully acknowledges the following
groups in developing this toolkit: OTQIP Toolkit working groups, ONTraC, OTQIP
Committee, MOHLTC
51
CSTM 2016 – Conference Abstracts
Does Blood Transfusion Practice in Prairie Mountain Health
Meet AABB Guidelines?
Abstract Title
Does Blood Transfusion Practice in Prairie Mountain Health Meet AABB Guidelines?
Authors/Co-Authors & Affiliations
Danielle Paradis, Medical Student, University of Manitoba Charles Penner, MD, University of
Manitoba Charles Musuka, MD, University of Manitoba/Diagnostic Services Manitoba
Abstract Body
Background: The American Association of Blood Banks (AABB) guidelines on
packed
red blood cell (RBC) transfusion are currently considered best practice. The
purpose of
the guideline is to limit transfusions in order to improve patient safety by reducing
exposure to needless blood products, in addition to reducing unnecessary cost. The
intent of this project is to evaluate whether several community health care centres
within
Prairie Mountain Health Region (PMH) in Manitoba are currently following AABB
guidelines.
Methods: A retrospective study was performed via chart review of an adult
population
hospitalized within PMH (5 centres) between January 2013 and March 2014. During
their hospitalization, patients received at least one transfusion of packed
RBCs. Patients
transfused intra-operatively and those who were actively bleeding at the time of
transfusion were excluded. A total of 400 charts and transfusion orders meeting
criteria
were reviewed.
Results: Of the 400 transfusions assessed, 335 (83.75%) were appropriate, and 65
(16.25%) were inappropriate under liberal interpretation of the AABB guidelines. If a
more strict interpretation of the AABB guidelines was used, the number of
52
CSTM 2016 – Conference Abstracts
appropriate
transfusions decreased to 276 (69%). Two unit transfusions of packed RBCs were
the
most frequent order (246/400). The majority of prescribers ordering packed RBCs
were family
physicians.
Conclusion: This study indicates that PMH is currently following AABB guidelines
the
majority of the time. Increasing the number of single unit transfusions could enhance
utilization of the blood supply, and in this particular study could have reduced the
number
of units transfused by up to 32%. To promote improved transfusion practice, this
information will be shared with providers with prescribing privileges. Future studies
in
this area could be instituted to track or monitor transfusion practices following
dissemination of this information and promotion of single unit transfusions.
53
CSTM 2016 – Conference Abstracts
e-Learning Transfusion Practice Modules: Better Blood
Transfusion
Abstract Title
e-Learning Transfusion Practice Modules: Better Blood Transfusion
Authors/Co-Authors & Affiliations
Clare O'Reilly, R.N.,Graduate Certificate in Transfusion Practice, Universtiy of Melborne
Abstract Body
Background: The Transfusion Safety Nurse Clinician (TSCN) collaborated with the
Learning & Development at a BC Children’s and Women’s hospital to create eLearning Transfusion Practice Educational Modules in response to educational
needs. The hospitals serve a unique patient population with specialized transfusion
requirements; however, there was a lack of specific education for the pediatric and
neonatal patient population. Currently, educators deliver Transfusion Practice
education at each site which ensures that the material covered is specific to the
patient population e.g. neonatal or pediatric, however; the age related practice
variations required make it challenging to ensure consistency for common, critical
areas of practice. We identified a need to create educational materials that would
standardize critical content while also allowing for site-specific practices. E-Learning
modules ensure that transfusion practice resources are accessible and assist staff to
gain competency while enabling fulfillment of accreditation requirements.Method:
The TSNC reviewed e-learning tools and practice guidelines from Canada, UK, and
Australia, before developing a series of presentations. The draft content was
reviewed for standards compliance. Funds from the 2014 BloodTechNet
Competition were used to create a series of videos which demonstrated tasks critical
to patient safety, but poorly standardized, such as patient identification, blood
administration and blood transport. In collaboration with the Media Team short
videos were developed and filmed on site. Educators and other key staff were
engaged to review content and give feedback during development. The modules
include pre-transfusion sample collection, transport of blood products and blood
administration for pediatric, neonatal and adult patients.Results: Three modules are
available on the Provincial Health Services Authority Learning Hub site, a web
based education portal accessible by all staff. New hires will complete the relevant
modules during orientation and we will roll out the modules with current staff over
the next two years.Discussion: We acknowledge that having online education is
one step in providing education to clinicians. A remaining challenge is ensuring that
staff complete the modules and follow hospital procedures. We continue to work
with educators to promote the modules and audit practice for compliance with
procedures.
54
CSTM 2016 – Conference Abstracts
Enhancing the Proinflammatory Immune Response Using
Plasma-Derived miRNA-Based Therapeutics
Abstract Title
Enhancing the Proinflammatory Immune Response Using Plasma-Derived miRNA-Based
Therapeutics
Authors/Co-Authors & Affiliations
Xining Yang, B.S., University of British Columbia and Canadian Blood Services Mark D.
Scott, Ph.D., Canadian Blood Services and University of British Columbia
Abstract Body
Introduction: While many plasma components are well known clinically (e.g., IVIG),
other emerging plasma constituents may prove to be of equal or greater therapeutic
potential. First recognized as biologically functional in 2000, microRNAs (miRNAs)
are small, non-coding RNAs that post-transcriptionally modulate gene expression
and are important regulators of biological responses including the immune response.
However, miRNA regulation is complex and a single miRNA can affect hundreds of
genes and individual genes can be regulated by multiple miRNAs thus the ‘pattern of
miRNA expression’ (encompassing increased, decreased and static levels) of
multiple miRNA must be mimicked to achieve pharmacological effect. Using
bioreactor systems, our laboratory has generated pharmacologically effective
miRNA-based therapeutics capable of producing in vitro and in vivo tolerogenic
(TA1) or inflammatory (IA1) responses. Design and Methods: Unprocessed IA1
(uIA1) was produced using human and murine in vitro bioreactor systems. We
hypothesized that human- and murine-source uIA1 would enhance a
proinflammatory response characterized by proliferation of effector T cells (both
CD8+ and CD4+ Th17 cells) while decreasing T regulatory (CD4+) cells. Mixed
Lymphocyte Reaction (MLR) based bioreactor systems were used to produce uIA1
using either allogenic human peripheral blood mononuclear cells (PBMC) or H-2
disparate murine splenocytes. T cell proliferation (CD3 +, CD8+ and CD4+) was
assessed using CFSE at Day 10. CD4+ Th17 (proinflammatory) and Foxp3+ Treg
(tolerogenic) subsets were also determined at Day 10. Results: Both human- and
murine-sourced uIA1 preparations promoted a proinflammatory responses in resting
lymphocytes. A significant (10-fold) increase of CD3+ T cell proliferation was induced
by uIA1 treatment. Most significantly, uIA1 resulted in an expansion of CD8+
subpopulation (mainly cytotoxic T cells). Within the CD4+ population, uIA1 resulted
in a skewed proliferation toward Th17 cells with a concomitant decrease in Treg
cells resulting in an increase in the Th17:Treg ratio. Conclusion: uIA1
demonstrated significant proinflammatory effects on T cell proliferation and subset
differentiation. Enhancing the proinflammatory state may be useful in treating
diseases such as cancer. Acknowledgements: This work was supported by grants
from the Canadian Institutes of Health Research (Grant No. 123317), Canadian
Blood Services and Health Canada.
55
CSTM 2016 – Conference Abstracts
Enveloped Virus Assimilation of Host Coagulation Factors
Abstract Title
Enveloped Virus Assimilation of Host Coagulation Factors
Authors/Co-Authors & Affiliations
Bryan Lin, B.Sc., Department of Pathology and Laboratory Medicine, Centre for Blood
Research, University of British Columbia Michael Sutherland, Ph.D., Canadian Blood
Services Centre for Innovation, Department of Pathology and Laboratory Medicine, Centre
for Blood Research, University of British Columbia Ed Pryzdial, Ph.D., Canadian Blood
Services Centre for Innovation, Department of Pathology and Laboratory Medicine, Centre
for Blood Research, University of British Columbia
Abstract Body
Introduction: Many transfusion transmissible viruses have an outer envelope
structure composed of a host cell-derived lipid membrane, and host- and virusencoded proteins. As model enveloped viruses, we have studied activation of critical
coagulation enzymes on three Herpesvirus family members. The focus has been on
herpes simplex virus 1 (HSV1), whose envelope acquires the initiating cofactors of
coagulation, tissue factor (TF) and anionic phospholipids (aPL). TF and aPL
accelerate the activation of factor (F) X to FXa by the enzyme factor FVIIa, leading
to thrombin production and clot formation. In addition to explaining links to
cardiovascular disease, we have shown that the virus exploits this process to
facilitate infection. Consequently, through a poorly understood mechanism, HSV1encoded glycoprotein C (gC) has evolved to enhance FVIIa activity. Objective: To
generalize the virus envelope model of coagulation initiation by extending the
Herpesvirus family studies to dengue virus (DENV), a highly transfusion relevant
pathogen of the Flavivirus family, and investigate how gC enhances FX
activation. Design and Methods: Immunogold electron microscopy (IEM) was used
to identify TF and aPL on purified HSV1 or DENV using antibodies or annexin V,
respectively. Virus-encoded markers were simultaneously probed antigenically (gC
or E protein, respectively). TF/aPL function was followed using purified virus as
initiators of FX activation using either purified proteins in FXa-selective chromogenic
assays or plasma clotting assays. Results: IEM revealed that TF is associated with
HSV1 and DENV. Functional TF and aPL on HSV1 were demonstrated by
chromogenic and clotting assays. Furthermore, TF on the surface of a unique gC +//TF+/- panel of HSV1 was essential for enhanced FX activation by gC. Similarly, a
soluble form of gC also increased FX activation in a dose-dependent manner, but
only in the presence of envelope TF. In plasma, gC enhanced TF-dependent clotting
times induced by HSV1, although factor VIII compensated for the absence of gC.
Pilot plasma clotting assays confirmed the presence of functional TF associated with
purified DENV. Conclusion: Hundreds of enveloped virus types infect TF-bearing
cells. These data suggest envelope TF may lead to a broad spectrum understanding
of how numerous enveloped viruses affect clotting enzyme-mediated platelet
integrity in transfusion and pathology.
56
CSTM 2016 – Conference Abstracts
Evaluating the Accuracy and Efficiency of an Anemia Index
Component of a Red Cell Inventory Ordering Algorithm Using
Advanced Statistics and Simulation Methods
Abstract Title
Evaluating the Accuracy and Efficiency of an Anemia Index Component of a Red Cell
Inventory Ordering Algorithm Using Advanced Statistics and Simulation Methods
Authors/Co-Authors & Affiliations
John Blake, Dalhousie University Robert Dumont, Dalhousie University Calvino Cheng,
Dalhousie University Alwyn Gomez, Dalhousie University Andrew Kumar-Misir, Dalhousie
University Stephanie Watson, Dalhousie University Irene Sadek, Dalhousie University Joan
Macleod, Dalhousie University Natalie Chisholm, Dalhousie University
Abstract Body
It is vital that hospital blood banks stock a sufficient quantity of blood inventory to
ensure timely care to those requiring transfusion. Blood, however, is perishable and
if too much is held in inventory costly outdates occur. Thus, blood stocks must be
managed carefully. At the Nova Scotia Health Authority, Central Zone, an algorithm
is used to order red cell inventory. This is based on rearward-looking rolling
averages and a forecasting component called the Anemia Index. The Anemia Index
is used to predict demand for RBC in the next 48 hours, based on a count of
inpatient and emergency ward patients with low hemoglobin levels. This model is
based on Kaplan-Meier modeling of hemoglobins and the predicted probability of
transfusion in various hemoglobin ranges. In this study, we report on the use of
advanced statistical analysis, combined with discrete event simulation methods to
evaluate the accuracy and efficiency of the Anemia Index method. A Bayesian
analysis was conducted to determine the posterior probability of demand, given an
assessed Anemia Index at a particular time. From this data we were able to identify
that the Anemia Index is a conservative estimate of demand and that the overall
forecast demand exhibits a positive bias. We then employ a simulation method to
evaluate the impact of adopting a more aggressive anemia index. We use the
posterior probabilities of demand, given the anemia index, to determine an order
quantity and then determine the net effect of the new policy in terms of product
availability via a simulation method. We conclude that forecasting accuracy can
potentially be improved by treating the Anemia Index as a test value and employing
Bayesian analysis to further refine estimates of required transfusions.
57
CSTM 2016 – Conference Abstracts
Evaluating the Impact of Installing a Gammacell Irradiator
Abstract Title
Evaluating the Impact of Installing a Gammacell Irradiator
Authors/Co-Authors & Affiliations
Kelly Bizovie, RT, Fraser Health Doug Morrison, MD, Fraser Health Darlene Mueller,
MA.,ART, Fraser Health Winn Thomas, RT, Fraser Health
Abstract Body
Introduction/Objective
The only proven method to prevent Transfusion-associated graft-versus-host
disease (TA-GVHD) is to irradiate cellular blood components prior to transfusion.
Recent publications highlight the accumulation of potassium and free hemoglobin in
red cell units irradiated prior to storage. These potentially harmful effects can be
reduced or eliminated by irradiating blood components at the time of issue.
In the context of neonatal transfusion, the practice of irradiating red cell aliquots at
the time of issue facilitates the use of a sterile-docked donor unit until its original
outdate of 42 days. Prior to introduction of a gamma irradiator, neonates at Royal
Columbian Hospital (RCH) were receiving aliquots from donor units pre-irradiated by
Canadian Blood Services. These pre-storage irradiated units were frequently
abandoned following two or three weeks of storage because of unacceptable levels
of visible hemolysis
Additionally, our historical practice of maintaining a pre-storage irradiated red blood
cell inventory, for adult patients, created inventory pressures due to the reduced
shelf life. This resulted in irradiated red blood cells being transfused to patients
without a clinical indication for this modified, arguably inferior, component.
Design and Methods
We compared; the number of units, days post irradiation, and patient indication for
irradiated units transfused pre and post irradiator installation. Neonatal donor
exposure was also compared to see if a reduction in donor exposure, related to
hemolysis or shortened donor unit half-life, improved.
Results
Post irradiator installation, the number of irradiated red blood cells units issued
dropped from 575 to 256 with the percent of units issued to patients with a clinical
indication increasing from 33% to 93%. The average post irradiation age of a donor
unit dropped from 14 days to less than 1 day. The number of events where
neonates where exposed to an additional donor units due to unit hemolysis or unit
expiry dropped from 30 per year to zero.
Conclusions
Although the notion of introducing an onsite gamma irradiator may seem daunting,
the process is not insurmountable and provides the ability to irradiate components at
the time of clinical need thus avoiding the issues related to maintaining an irradiated
58
CSTM 2016 – Conference Abstracts
inventory.
59
CSTM 2016 – Conference Abstracts
Evaluation of Nurses Transfusion Knowledge in the setting of a
Fragmented Educational Strategy; Supporting Comprehensive
and Consistent Transfusion Education within the WRHA
Abstract Title
Evaluation of Nurses Transfusion Knowledge in the setting of a Fragmented Educational
Strategy; Supporting Comprehensive and Consistent Transfusion Education within the
WRHA
Authors/Co-Authors & Affiliations
Shana Chiborak RN Laurel Dyck RNBN Ghameng Khuu RNMN
Abstract Body
IntroductionThe Serious Hazards of Transfusion (SHOT) UK reporting system
identified that patients were more at risk of receiving the wrong transfusion
compared to any other reason for transfusion reaction. The risk of mistransfusion is
a result of clinical errors. The majority of sample errors are related to failures in
following standard procedures. Nurses have a fundamental role in the process of
blood transfusion. Their proficiency in blood knowledge is essential to transfusing
blood safely. Multiple studies have been directed in the assessment of nursing
knowledge and practice of blood transfusion and as a result, mandatory ongoing
blood transfusion education programs for nurses were recommended.Currently,
within the Winnipeg Regional Health Authority (WRHA), the transfusion education
for nurses is fragmented and inconsistent from one site to another. The WRHA
Blood Conservation Service (BCS) has identified the need for standardized blood
education and the development of updated resources.Objective: To further
understand the blood transfusion knowledge deficit nurses who have received
traditional site based transfusion education. To identify key concepts which require
additional learning while developing curriculum for nurses.Design and Methods:
This was a descriptive, cross-sectional pilot study. A questionnaire based on the
Manitoba Transfusion Best Practice Resource for Nursing comprised of 10 multiple
choice questions was developed for this study. The test was administered to new
hires during hospital orientation. Nurses had as little as 1 year experience and as
long as 45+ years’ experience. All nurses tested had some previous blood education
and had experience with administering a blood transfusion.Results:Percentage of
questions scored correctly was 43-52 in community hospitals (26 participants) and
66% in a tertiary care center (surgical with step down unit, 10 participants) indicating
a need for improvement.Conclusion:The preliminary results of this study are
concerning and have prompted early discussions among stakeholders to transform
and defragment the current method of education for nurses. Authors feel that
developing and supporting a consistent, standardized evidenced based education
for transfusion education is needed to improve nursing competence thereby
improving patient safety. Acknowledgements: Shauna Paul RN BN, WRHA Blood
Conservation Service
60
CSTM 2016 – Conference Abstracts
Expansion of Stem Cell Club to Four Medical Schools in
Ontario
Abstract Title
Expansion of Stem Cell Club to Four Medical Schools in Ontario
Authors/Co-Authors & Affiliations
Warren Fingrut, MD, Stem Cell Club; University of Toronto Ari Cuperfain, MSc, Stem Cell
Club; University of Toronto Alexander Tigert, BSc, Stem Cell Club; University of Toronto
Katy Cogger, PhD, Stem Cell Club; McEwen Centre for Regenerative Medicine, University
Health Network Yongjun (George) Wang, B Pharm, Stem Cell Club; Western Thomas
Henderson, BSc, Stem Cell Club; Western Sara Calvert, Stem Cell Club; Western
Christopher Welsh, BSc, Stem Cell Club; University of Ottawa Navot Kantor, BSc, Stem Cell
Club; University of Ottawa Joseph Aziz, BSc, Stem Cell Club; University of Ottawa
Menachem Benzaquen, BSc, Stem Cell Club; University of Ottawa Neha Arora, BSc, Stem
Cell Club; McMaster University Amanda Yaworksi, BSc, Stem Cell Club; McMaster University
Jessica Shanahan, BSc, Stem Cell Club; McMaster University Janice Yu, BSc, Stem Cell
Club; McMaster University David Allan, MD, FRCPC, University of Ottawa; OneMatch Stem
Cell & Marrow Network, Canadian Blood Services; Ottawa Hospital Research Institute; The
Ottawa Hospital Hans Messner, MD, PhD, FRCPC, University of Toronto; Princess Margaret
Cancer Centre, University Health Network
Abstract Body
BackgroundThe Stem Cell Club is a student-run non-profit organization that works to
recruit Canadians as unrelated stem cell donors. We are a community partner of
Canadian Blood Services, and we are accredited through them to run our own stem
cell drives. At these drives, we guide registrants to provide informed consent and a
tissue sample (buccal swab) for HLA typing. Through targeted recruitment of the
most needed donors (ethnically-diverse males), we aim to improve the quality of
membership on Canada’s donor database and improve the chances that patients in
need of an unrelated donor will find a match for transplant.Previously, we outlined
our initiative’s launch at University of British Columbia’s medical school in 2011
(Fingrut, CSTM 2015). Here, we report our expansion to include chapters at four
medical schools in Ontario.MethodsTeams of medical students were recruited to
launch chapters at University of Toronto, University of Ottawa, McMaster University,
and Western. Club leaders underwent Stem Cell Club’s online training program,
which covers how to volunteer at, lead, and organize a stem cell drive. Teams were
connected with Canadian Blood Services territory managers, and equipped with
supplies. Outcomes were obtained from post-event reports, which log number of
registrants recruited as well as their sex and self-reported ethnicity.ResultsFrom
01/10/2015-05/3/2016, 104 Ontario Stem Cell Club leaders completed Stem Cell
Club’s online training program. Ontario chapters ran 10 stem cell drives, recruiting a
total of 871 donors. Of 680 donors recruited at drives for which outcomes are
available at time of publication, 55.7% were male (43.9% non-Caucasian). Stem cell
drive planning is ongoing, with 5 upcoming Ontario drives.ConclusionsWe report the
successful launch of Stem Cell Clubs at four Ontario medical schools. Based on
these results, we estimate that we have established a capacity to sustainably recruit
over 1000 stem cell donors per year in Ontario, of which the majority are ethnicallydiverse males. Our results support Stem Cell Club as a model for stem cell donor
61
CSTM 2016 – Conference Abstracts
recruitment that can be applied to campuses across
Canada.AcknowledgementsThis work was supported by a 2015 Canadian Blood
Services BloodTechNet Grant
62
CSTM 2016 – Conference Abstracts
FREQUENCY OF LIFE THREATENING ALLERGIES AMONG
BLOOD DONORS
Abstract Title
FREQUENCY OF LIFE THREATENING ALLERGIES AMONG BLOOD DONORS
Authors/Co-Authors & Affiliations
Sheila F. O'Brien, Ph.D., Canadian Blood Services Karen Gilmore, M.P.A., Canadian Blood
Services Mindy Goldman, M.D., Canadian Blood Services
Abstract Body
IntroductionThere have been rare cases of passive transfer of food specific
hypersensitivity from donors to recipients leading to anaphylactic reactions. In
Canada in 2006 a plasma recipient developed an anaphylactic reaction after eating
peanut butter two days post- transfusion, the donor had a history of severe peanut
allergy. In a 2008 donor survey, 40% of donors stated they have allergies; 7.7%
stated that they had severe allergies. Recently a recipient developed anaphylactic
reactions to salmon and peanuts in the days post-platelet transfusion, one of the
donors was found to have a history of severe food allergies. This second case
prompted another donor survey to determine if additional questions could identify a
subset of higher risk donors. Design and MethodsAs part of a quarterly on-line
satisfaction survey performed in Oct 2015, 6,233 recent donors were asked if they
had severe (possibly life threatening) allergies. Donors responding affirmatively were
asked to select causes and symptoms from lists, and if they carry and have used an
epi-pen. ResultsOut of the 1,559 responding donors (25% response rate), 5% (82)
stated that they had a possibly life threatening allergy. Common causes (more than
1 possible) were medications (44%), peanut or other nut allergies (27%), shellfish or
other fish (10%), other food allergies (23%), and insect stings (14%). Common
symptoms were swelling (61%), difficulty breathing (53%), itching (53%) and rash
(47%). One third of respondents stating that they have life threatening allergies
carry an epi-pen all or most of the time, with 17% of these reporting ever using
it. ConclusionsSelf-reported serious allergies are common. Severe food allergies
are reported in about 2.7% of donors, correcting for donors with multiple food
allergies. Symptoms reported are consistent with severe reactions. A smaller
segment of donors carry and have used an epi-pen, however this is in part related to
the allergen (not necessary for medication use) and not to the severity of the
reactions. It is difficult to identify a particularly high risk subset of donors without
leading to significant deferral of many safe donors.
63
CSTM 2016 – Conference Abstracts
Genotyping for the Resolution of Pan-Reactive Antibodies
Abstract Title
Genotyping for the Resolution of Pan-Reactive Antibodies
Authors/Co-Authors & Affiliations
J. Morden, MLT, Canadian Blood Services - National Immunohematology Reference
Laboratory J. Cote, MLT, Canadian Blood Services - National Immunohematology
Reference Laboratory S. Pigeau, MLT, Canadian Blood Services - National
Immunohematology Reference Laboratory P. Berardi, MD, PhD, Canadian Blood Services National Immunohematology Reference Laboratory
Abstract Body
Introduction: The investigation of pan-reactive antibodies has previously been time
and labour intensive. Traditional serologic approaches required multiple steps and
the use of limited and often non-licensed reagents. Owing to the growing availability
of red cell genotyping, this workflow can be streamlined by performing genotypingbased assays early in the process of complex antibody investigations. This study
aimed to evaluate the impact of genotyping in these antibody
investigations. Methods: A retrospective review of antibody investigations in
2015 that included genotyping on the Progenika ID-CoreXT (Grifols) was performed.
Genomic DNA was extracted from whole blood using the QIAamp DNA blood mini
kit (Qiagen) and probe-set amplification was done on the GeneAmp PCR system
(ThermoFisher). The ID-CoreXT and accompanying BIDS XT software was used as
per the manufacturers’ recommendations (Grifols/Progenika). The time and labour
requirements of this approach was compared to the laboratory’s approach to
resolving pan-reactive antibodies prior to the implementation of the IDCoreXT. Results: The NIRL laboratory received approximately 430 antibody
investigation requests from January 2015 to December 2015 and genotyped 112 of
these cases. Compared to previous years, genotype testing performed early in the
antibody investigation process resulted in a reduction of the number of panels, rare
red cells and test methods needed to identify antibodies to high prevalence
antigens. This has resulted in a more efficient and stream-lined workflow particularly
when investigating multiple antibodies that may include an antibody to a high
prevalence antigen. Genotyping results also confirmed with a high level of
confidence blood samples with rare phenotypes subsequent to antibody
identification. This is particularly relevant when licensed and/or unlicensed antisera
are not available. Conclusions: This evaluation highlights improved efficiency in
workflow when investigating pan-reactive antibodies using genotyping. Red cell
genotyping is a safe and efficient way to identify or confirm rare donors to support
the transfusion needs of patients with antibodies to high prevalence antigens. As this
testing becomes more readily available, options for the more widespread use of this
technology may serve as a means to reduce costs and improve efficiency when
evaluating pan-reactive antibodies. Acknowledgements: We would like to thank
the CBS administrative support and NIRL staff for their help in the completion of this
study.
64
CSTM 2016 – Conference Abstracts
Hemolytic Disease of the Fetus and Newborn and its
Prevention with Rh Immune Globulin
Abstract Title
Hemolytic Disease of the Fetus and Newborn and its Prevention with Rh Immune Globulin
Authors/Co-Authors & Affiliations
Allison Collins, MD, ORBCoN Leonor De Biasio BScN RN CPN (c), ORBCoN Alison Wendt,
MLT, ORBCoN
Abstract Body
IntroductionThe risk of hemolytic disease of the fetus and newborn (HDFN) due to
maternal anti-D alloantibodies can be reduced by 99.9% by prenatal and postpartum
administration of Rh Immune Globulin (RhIG). The process of administration of RhIG
usually involves a transfusion medical laboratory (TML) providing RhIG to a midwife.
The Resources for Midwives Toolkit was developed to provide all Ontario midwives
with a resource that outlines the rationale and process of RhIG administration, and
includes documents that may be utilized to ensure that national and provincial
standards for blood product handling are met.Design and MethodsThe Ontario
Regional Blood Coordinating Network (ORBCoN) surveyed 128 hospitals in Ontario
on the availability of resources for continuing education for midwives. It was
identified that only four facilities had such resources in place. Ontario university
midwifery programs acknowledged there was limited education on immunogenicity
of D antigens, weak and partial D antigens, and prenatal antibody titration. Some
Ontario transfusion medicine physicians recognized an opportunity for more
education for midwives about the storage of RhIG, documentation and
administration, the meaning and significance of passive anti-D, the significance of
weak D, transfusion terminology, significance of red blood cell (RBC) antibodies
other than anti-D in the etiology of HDFN, and the timing of administration of RhIG.
During the development of the toolkit the Association of Ontario Midwives (AOM)
was involved, including three Ontario midwives.ResultsThe toolkit provides
educational resources for both midwives and clients, and includes frequently asked
questions, articles, and a comprehensive power point presentation encompassing:

HDFN

Prenatal laboratory testing

The use of RhIG

Informed choice
 Weak D blood groups and their significance
ConclusionsThe toolkit may be used in its entirety or may be modified as needed
based on existing protocols and systems already used by midwifery practice groups
and their local hospitals.AcknowledgementsORBCON gratefully acknowledges
65
CSTM 2016 – Conference Abstracts
MOHLTC, Dr. Lani Lieberman, AOM, Thames Valley Midwives, and Seventh
Generation Midwives.
66
CSTM 2016 – Conference Abstracts
Hemorheology of Liposome-Treated Red Blood Cells during
Hypothermic Storage
Abstract Title
Hemorheology of Liposome-Treated Red Blood Cells during Hypothermic Storage
Authors/Co-Authors & Affiliations
Luciana da Silveira Cavalcante, MSc., University of Alberta and Canadian Blood Services
(Graduate Fellow) Jason P Acker, Ph.D, University of Alberta and Canadian Blood Services
Jelena L Holovati, Ph.D, University of Alberta and Canadian Blood Services
Abstract Body
Introduction: It is unknown whether liposomes can be used to mitigate
hemorheological elements of RBC membrane storage lesion; a problem still
unaddressed by current additive solutions. This study aimed to assess the effects of
liposome treatment on RBC deformability and aggregation during storage.Methods:
Unilamellar liposomes were synthesized using an extrusion method to contain a lipid
bilayer (DOPC:cholesterol, 7:3 mol%, 200 nm size). Packed human RBCs (n = 6)
were incubated for 1 hour at 37 °C with either HEPES-NaCl solution (control) or 2
mM DOPC liposomes. RBC deformability and aggregation were assessed by
ektacytometry and syllectometry immediately after liposome treatment, and after
three and six weeks of hypothermic storage (4 °C). Percent hemolysis was
measured using the Drabkin’s method. Results: Ektacytometry analysis showed
no significant effect of liposome treatment on maximum elongation in any of the time
points evaluated. Liposome-treated RBCs showed increased rigidity immediately
after treatment (KEI: 2.08 ± 0.27 vs. 1.84 ± 0.27, p = 0.040), which stabilized after 6
weeks of storage resulting in significantly lower values compared to the control
group (KEI: 2.27 ± 0.33 vs. 2.39 ± 0.23, p = 0.048). Syllectometry analysis showed a
decrease in aggregation half-time of liposome-treated RBCs (3.37 ± 0.43 vs. 3.83 ±
0.42 s, p = 0.046) immediately after treatment. After 6 weeks of storage, aggregation
index (AI) and aggregation amplitude (Amp) were significantly increased in
liposome-treated RBCs (AI: 45.38 ± 1.92 vs. 41.54 ± 4.10%, p = 0.020) (Amp: 16.38
± 2.17 vs. 12.22 ± 3.29 au, p = 0.019) while aggregation half-time was lower when
compared to control (4.93 ± 0.46 vs. 6.05 ± 1.21 s, p = 0.035). Although hemolysis
was significantly lower immediately after treatment in the liposome group (0.15 ±
0.13 vs. 0.18 ± 0.14%, p = 0.010), a significant difference was not detected after 3
and 6 weeks of storage.Conclusions: Liposome treatment decreases rigidity after
hypothermic storage while increasing the percent and extent of RBC aggregation but
reduces aggregation time. Future work will focus on correlating hemorheology
results with other parameters of RBC membrane quality.Acknowledgements:
University of Alberta and Canadian Blood Services.
67
CSTM 2016 – Conference Abstracts
Hemostatic function of stored buffy coat platelet concentrate in
plasma treated with pathogen inactivation system
Abstract Title
Hemostatic function of stored buffy coat platelet concentrate in plasma treated with pathogen
inactivation system
Authors/Co-Authors & Affiliations
Ahmad Arbaeen, Ph.D. candidate, Pathology and Laboratory Medicine, University of British
Columbia Peter Schubert, Clinical Associate Professor, Pathology and Laboratory Medicine,
University of British Columbia Dana Devine, Professor of Pathology and Laboratory
Medicine, University of British Columbia
Abstract Body
BACKGROUND: Pathogen inactivation (PI) systems have been introduced to blood
banking to increase product safety. PI-treatment has been shown to accelerate
platelet storage lesion development possibly affecting the hemostatic functionality of
platelet concentrates (BCPCs). This study investigated the effect of PI by
riboflavin/UV light (Mirasol) on the hemostatic potential of BCPCs produced in
plasma using Thromboelastometry (ROTEM).DESIGN AND METHODS: BCPCs
produced in plasma were pooled-and-split into identical units, one was treated with
riboflavin and UV light and the other one was kept un-treated as control. Samples
were drawn on days 2, 5, 7, and 9 of storage and reconstituted with fresh frozen
plasma to a platelet count of 100 x109/L. To assess the dynamics of the clot
development in the ROTEM system, Kaolin and tissue plasminogen activator were
applied to standardize the clotting time and fibrinolysis resistance. In parallel, Pselectin expression and pH level of these samples were determined.RESULTS: The
illumination of BCPC did not result in a change in the clot forming time between the
two groups. After day 7 of storage, there was a significant decrease in the rate of the
fibrin–platelet interaction expressed by the alpha value in the illuminated BCPC.
Maximum clot formation (MCF) was significantly reduced in the illuminated BCPC
compared to the control BCPC during the storage time (P value: < 0.0001), but was
consistent in both groups. The fibrinolysis resistance was slightly decreased in the
illuminated BCPC, significant after 7 days of storage. The activation level of platelets
was significantly higher in the illuminated BCPC (p < 0.001). The pH value changed
significantly during storage in both groups showing a significant drop in the
illuminated BCPC compared to control BCPC (p < 0.001). However, there was no
correlation between ROTEM profile of the Mirasol treated PC and the parallel in vitro
tests.CONCLUSIONS: This study shows that the illumination of BCPC has an
impact on the platelet functionality but to a lesser degree than the other in vitro tests
showing more deterioration of the platelet.
68
CSTM 2016 – Conference Abstracts
Impact Of Blood Transfusion On Troponin I Levels and Cardiac
Outcomes After Cardiac Surgery; A Cohort Study
Abstract Title
Impact Of Blood Transfusion On Troponin I Levels and Cardiac Outcomes After Cardiac
Surgery; A Cohort Study
Authors/Co-Authors & Affiliations
Arwa Z. Al-Riyami, BSc., MD, FRCPC. Department of Hematology, Sultan Qaboos University
Hospital, Oman Murtadha Al-Khabori, BSc. MD, MSc, FRCPC. Department of Hematology,
Sultan Qaboos University Hospital, Oman Balan Baskaran, MD. Divison of Cardiothoracic
Surgery, Department of Surgery, Sultan Qaboos University Hospital, Oman Hatim Al Lawati,
BSc.,MD, FRCPC, FACC. Division of Cardiology, Department of Medicine, Sultan Qaboos
University Hospital, Oman Mirdavron Mukaddirov, MD, PhD, DSc. Divison of Cardiothoracic
Surgery, Department of Surgery, Sultan Qaboos University Hospital, Oman Hilal Al-Sabti,
BSc. MD, MSc, FRCSC, Divison of Cardiothoracic Surgery, Department of Surgery, Sultan
Qaboos University Hospital, Oman
Abstract Body
Introduction/Objective: Increased cardiac troponin I (TI) has been suggested to be
is a sensitive indicator of intraoperative myocardial injury (MI). Recent data showed
that RBC transfusion is an independent predictor of elevated TI levels on the first
post-operative day following coronary artery bypass graft surgery, and is associated
with a high risk of MI. We aim to investigate the association of RBC transfusion on TI
levels and outcomes in patients undergoing elective cardiac surgeries in our
institution. Design and Methods: Retrospective review of 602 consecutive patients
who underwent cardiac surgery during the period 2008 to 2015 was performed.
Patients who underwent emergency surgeries and with pre-operative TI level of >
6.5 µg/L were excluded. Patients were divided into two groups based on their TI
levels 24 hours post-surgery (TI24) (> 6.5µg/L vs. 6.5µg/L or less). The impact of
transfusion on the TI24 was estimated using logistic regression and adjusted for
using a multivariable model that included cross clamp time (CCT) and pre-operative
ejection fraction (Pre-EF). In addition, the effect of post-operative TI24 on the major
post-operative outcomes was examined.Results: Total of 542 patients fulfilled our
criteria with a mean age of 58 years (SD 11.3). Using uni-variable logistic
regression; RBC transfusion was found to be associated with high TI24 (Odds Ratio
[OR] 2.33, P= 0.007, 95% CI 1.3-4.3). A trend was observed between RBC
transfusion and high TI24 when CCT and Pre-EF were adjusted for (OR= 2.06, P=
0.08, 95% CI 0.9-4.7). An association was found between CCT and high TI24 in the
multivariable model (OR=1.01, P=0.028, 95% CI 1.00-1.02).Ten percent of the
studied cohort developed post-operative MI, while 14 patients died. The patients had
a median in-hospital length of stay of 8 days (interquartile range=7-11). Elevated
TI24 was associated with higher mortality (OR 4.15, P=0.017, 95% CI 1.2913.08), renal failure (OR 2.99, P=0.004, 95% 1.41-6.32) and increased lenght of stay
in hospital (OR 4.5, P=0.020, 95% CI 0.69-8.302). Conclusion:RBC transfusion is
associated with increased post-operative TI24 levels and worse outcomes in elective
cardiac surgery, albeit a confounding effect cannot be excluded. Larger studies are
required to confirm these findings.
69
CSTM 2016 – Conference Abstracts
70
CSTM 2016 – Conference Abstracts
Impact of Holder pasteurisation and high-pressure processing
on human milk components
Abstract Title
Impact of Holder pasteurisation and high-pressure processing on human milk components
Authors/Co-Authors & Affiliations
M. Girard, Héma-Québec, Recherche et Développement, Québec, Qc, Canada N. Dussault,
Héma-Québec, Recherche et Développement, Québec, Qc, Canada M-P Cayer, HémaQuébec, Recherche et Développement, Québec, Qc, Canada MJ de Grandmont, HémaQuébec, Recherche et Développement, Québec, Qc, Canada M-E Couture, Héma-Québec,
Recherche et Développement, Québec, Qc, Canada M. Cloutier, Héma-Québec, Recherche
et Développement, Québec, Qc, Canada C. Lavigne, Centre de développement
Bioalimentaire du Québec, Sainte-Anne-de-la-Pocatière, Qc, Canada L. Thibault, HémaQuébec, Recherche et Développement, Québec, Qc, Canada
Abstract Body
Background: Héma-Québec Public Mothers’ Milk Bank provides human milk to
preterm babies whose mother cannot breastfeed. Because the health of these
babies is rather fragile, donor human milk must be pathogen-free while keeping an
optimal nutritional value. Holder pasteurization, the most used method to inactivate
viruses and bacteria in milk, is actually inefficient in destructing bacterial spores and
is detrimental to the bioactivity of human milk. Studies have demonstrated that
pasteurization by high-pressure processing (HPP) allows the retention of milk
bioactive components while the repetition of pasteurization cycles destroys bacterial
spores.
Objectives: To determine optimal parameters for HPP treatment of human milk and
to compare Holder pasteurization and HPP effects on bacterial load and on
nutritional and immunological components retention.
Methods: Human milk samples were pasteurized either by heating in a bath of
water (62.5°C, 30 minutes) or by HPP (330-425 MPa, 6-10 minutes, 1-4 cycles,
initial milk temperature 4 or 37°C). Bacterial load, nutritional values, lysozyme
activity, and levels of IgA, IgG, IgM, lactoferrin, cytokines, and lipase were analyzed.
Untreated milk samples served as control.
Results: HPP milk treatment at 4°C allows a better elimination of bacteria than
Holder pasteurization; in 37.5% of milk batches, bacterial counts were under the
detection limit after HPP treatment, compared to 12.5% for Holder pasteurization.
With initial heating of samples to 37°C before HPP treatment, inactivation to an
extent under the detection limit was reached in 75% of milk batches. Better retention
of milk bioactive factors is obtained following HPP treatment compared to Holder
pasteurization. At least 82 ± 8% of IgA and 94 ± 7% of lysozyme levels were
maintained after HPP treatment, depending on conditions, compared to 65 ± 12%
and 70 ± 9%, respectively, with Holder pasteurization. Proteins and lipids are
maintained by HPP treatment.
71
CSTM 2016 – Conference Abstracts
Conclusions: HPP is a very good alternative to Holder pasteurization for treatment
of human milk intended to preterm babies. Our results illustrate that HPP treatment
of human milk provides a safer milk without the detrimental effects of Holder
pasteurization on biochemical and immunological milk components.
72
CSTM 2016 – Conference Abstracts
Impact of Phenotype Reagent Antiserum Utilization Following
the Discontinuation of Retyping Red cell Components Labeled
as Antigen Negative by CBS.
Abstract Title
Impact of Phenotype Reagent Antiserum Utilization Following the Discontinuation of Retyping
Red cell Components Labeled as Antigen Negative by CBS.
Authors/Co-Authors & Affiliations
Fallis Robert, A.R.T., Canadian Blood Services-Winnipeg
Abstract Body
Introduction: The CAN/CSA-Z902-10 (February 2010) first defined phenotype
antigen type confirmed in Section 8.2.4 as follows: ”Donor Blood typed for blood
group antigens other than A, B, O and D shall have the two antigen typings from
separate donations performed before the antigen type is considered
confirmed”. Blood components received from Canadian Blood Services (CBS) are
‘End Labeled’ with the phenotype after a donor has been tested twice, on two
separate donations. This provides hospital transfusion services the opportunity not
to reconfirm the antigen phenotype of a red cell component. On 2012-05-28, the
CBS Winnipeg Transfusion Service discontinued the practice of reconfirming antigen
phenotypes on antigen phenotype labeled red cell components. A retrospective
review was undertaken to determine the impact of phenotype reagent antiserum
utilization following the discontinuation of antigen reconfirmation.Method: A
retrospective review was done on the volume of phenotype antiserum reagents
purchased in a three year period in which reconfirming antigen phenotypes was
routine practice and for a three year period after reconfirmation of antigen
phenotypes was discontinued. The review included reagent antiserums purchased
for the 11 common antigens in the Rh, Duffy, Kidd, Kell, and S systems. Each
antiserum reagent is assigned a material master number in the SAP application that
provides the capability to track and manage purchased materials. Purchase orders
for the antiserum reagents were extracted for the years 2009 to 2011 and 2013 to
2015 and the volume of reagent usage compared. The year 2012 was excluded as
this was transitional year to the new practice and did not accurately reflect the full
impact of the change.Results: The average volume of reagent antiserums
purchased from 2013 to 2015 decreased by 52% when compared to the reagent
volumes purchased from 2009 to 2011. The decrease ranged from a low 38% for
Anti-Fya antiserum to a high 71% for Anti-Fyb antiserum. Conclusion: The
discontinuation of reconfirming antigen phenotypes on red cell components end
labeled with antigen types from CBS will significantly decrease the volume of
phenotype antiserum reagents required in a Transfusion Service.Acknowledgement:
Sally Driedger, Senior Administrative Assistant, Canadian Blood Services, Winnipeg.
73
CSTM 2016 – Conference Abstracts
IMPACT OF RECENT CHANGES IN DEFERRAL CRITERIA
AND REMOVAL OF CONFIDENTIAL UNIT EXCLUSION
(CUE)
Abstract Title
IMPACT OF RECENT CHANGES IN DEFERRAL CRITERIA AND REMOVAL OF
CONFIDENTIAL UNIT EXCLUSION (CUE)
Authors/Co-Authors & Affiliations
Mindy Goldman, M.D., Canadian Blood Services Elaine Fournier, R.N., Canadian Blood
Services Qi-Long Yi, Ph.D., Canadian Blood Services Sheila O'Brien, Ph.D., Canadian Blood
Services
Abstract Body
IntroductionBetween June and September, 2015, donor eligibility criteria changes
included removal of the upper age for donation and need for annual medical enquiry
forms for older donors, removal of the 2 day deferral after an inactivated vaccine,
modification of the countries leading to HIV variant risk deferral (2 countries instead
of 7), removal of indefinite deferral for nonhematologic cancers 5 years postcurative treatment, and addition of a stop-date for vCJD risk travel to Western
Europe (travel after 2007 now acceptable). The CUE ballot was removed. We
aimed to assess the impact of these changes. Design and MethodsData from the
National Epidemiology Donor Database was analysed to compare October 1, 2014 –
February 1, 2015 (pre-change) with October 1, 2015 – February 1, 2016 (postchange). The number of deferrals per 1,000 donation attempts was calculated.
Donation attempts were defined as all donations plus all deferrals. Rates were
calculated for all donations, and first-time or repeat donor status. ResultsThe
deferral rate for all of the above reasons combined (excluding CUE) declined from
5.5 to 1.7 per 1,000 donation attempts. Not surprisingly, the decrease in permanent
deferral rates was greatest for first time donors, with a 74% reduction in deferrals for
cancer and an 84% reduction in deferrals for HIV variant risk. Addition of the stop
date for five years of cumulative European travel/residency had little impact; this
would be expected to increase as we get farther away from 2007. Donations lost by
CUE decreased from 1.64 per 1,000 to zero. Over this year, these changes will
result in approximately 3,800 fewer deferrals, and 1,600 donations no longer
destroyed due to CUE. ConclusionsModifications to individual criteria affect only a
small number of donors, but the combined impact is greater with a 1.7% decrease in
non-hemoglobin deferrals. The benefit of changes to permanent deferral criteria
occurs predominantly in new donors, moving forward. Removal of the CUE will save
about 1,600 donations per year. These changes contribute to donor satisfaction and
retention and overall efficiency.
74
CSTM 2016 – Conference Abstracts
Implementation of blood group genotyping as routine testing for
sickle cell patients in a multi-site transfusion medicine
laboratory program
Abstract Title
Implementation of blood group genotyping as routine testing for sickle cell patients in a multisite transfusion medicine laboratory program
Authors/Co-Authors & Affiliations
Allahna Elahie, BSc(Hons), MLT Hamilton Regional Laboratory Medicine Program
Madeleine Verhovsek, MD Hamilton Regional Laboratory Medicine Program Sandra Fazari,
MLT, BSc, MBA Hamilton Regional Laboratory Medicine Program Theodore E. Warkentin,
MD Hamilton Regional Laboratory Medicine Program
Abstract Body
Introduction:Serological phenotyping of red blood cell (RBC) antigens for patients
with sickle cell disease (SCD) is not reliable if patients have been recently
transfused. Subsequent difficulties in RBC antigen matching between donor and
recipient for ongoing transfusion needs lead to increased risk of
alloimmunization. Blood group genotyping (BGG) permits determination of recipient
RBC phenotype irrespective of transfusion history. Furthermore, BGG may have
advantages over serologic methods in accurately predicting phenotype, particularly
in patients with variant RBC antigens. Design and Methods: In 2014, a plan was
developed to implement BGG as routine testing for SCD patients within 5 hospitals
of the Hamilton Regional Laboratory Medicine Program (HRLMP). An SCD
Transfusion Management team comprised of Hematology and Transfusion Medicine
(medical, technical) staff was initiated. Coordination between clinical and laboratory
areas was organized to collect specimens from our SCD patient
population. Creation of a new standard operating procedure, work flow algorithm
and training were completed by Jan 2015. Starting in Feb 2015, BGG specimens
were collected at 5 sites and sent to one central laboratory site to coordinate
shipping of specimens for testing. Specimens were batched and sent weekly to
Canadian Blood Services (CBS) National Immunohematology Reference Laboratory
(NIRL) in Ottawa. BGG results received from CBS NIRL were interpreted by a
technical specialist to determine the RBC-predicted phenotype and the best
matched RBC phenotype for transfusion. These interpretations were reviewed and
approved by our Hemoglobinopathy physician, prior to data entry into the patient’s
internal Transfusion Medicine history file. Results:Within one year, 66 of 96 SCD
patients had BGG performed. We observed improved communication and
coordination between the clinical and laboratory areas for meeting patient
transfusion needs. As a result, a better working rapport between the clinical areas
and transfusion medicine laboratory was achieved. Conclusions:With this new
streamlined process, BGG continues to be part of the routine testing for new SCD
patients seen within HRLMP. It has facilitated RBC antigen matching when
transfused SCD patients have no previous serological phenotyping. An ongoing
quality assurance project is comparing reliability of serological phenotyping and
BGG. AcknowledgementsCanadian Blood Services National Immunohematology
75
CSTM 2016 – Conference Abstracts
Reference Laboratory
76
CSTM 2016 – Conference Abstracts
Implementing and Evaluating Simulation Scenarios Related to
Adverse Transfusion Reactions
Abstract Title
Implementing and Evaluating Simulation Scenarios Related to Adverse Transfusion
Reactions
Authors/Co-Authors & Affiliations
Breanne Lazarenko, B.Sc., University of Alberta Amanda VanSpronsen, M.Sc., University of
Alberta Megan Parrish, B.Sc., Alberta Health Services Rhonda Shea, M.A., Health Quality
Council of Alberta Christina Wong, B.Sc., DynaLIFE Dx Gwen Clarke, M.D. FRCPC,
Canadian Blood Services
Abstract Body
Implementing and Evaluating Simulation Scenarios Related to Adverse
Transfusion Reactions Introduction/Objective Simulation is a technique that can
be used for process improvement and training in rare, high acuity circumstances.
Although simulation has been a component of healthcare training for some time, it is
currently underutilized in the clinical laboratory setting. Our simulation focused on
adverse transfusion events. The scenarios we developed took place in a transfusion
medicine reference lab. The objectives included process review and identification of
barriers to rapid and effective evaluation of transfusion reactions, with the goal of
offering specific recommendations.Methods Two simulation scenarios were
created. Medical Laboratory Technologists (MLTs) carried out the simulated events.
Nurse confederates and transfusion medicine physicians acted in their usual roles.
One scenario focused on interdisciplinary communication with nursing staff. The
second looked at process throughout the investigation. These were in situ
simulations, occurring in the laboratory where the transfusion reaction would
normally be investigated. Staff used available equipment, forms, supplies and the
LIS training environment following receipt of a transfusion reaction notification.
Observations were made by a single researcher. Pre and post surveys were given to
each technologist.Results 24 simulation were carried out. The communication
scenario took an average of 50 minutes. The second scenario took an average of 71
minutes. Following the simulations, the MLTs reported increased comfort and
confidence with each of the procedures. A number of observations on process
emerged including practice variations at several procedural steps. Pre and post
survey results showed agreement that simulation was beneficial to the work
environment and improved overall knowledge when handling transfusion
reactions.Conclusions In addition to allowing staff to practice a high acuity, low
opportunity event, simulation can help identify process issues. We were able to
identify recommended changes to standard operating procedures based on process
observations. We observed practice variation allowing for recommendations around
future training initiatives. Given the increase in comfort and confidence of staff, and
the ability to discover key process issues, we recommend expanding the use of
simulation as a quality improvement tool in transfusion medicine laboratory.
77
CSTM 2016 – Conference Abstracts
Improving Platelet Utilization in a Rural Setting
Abstract Title
Improving Platelet Utilization in a Rural Setting
Authors/Co-Authors & Affiliations
Konra Mueller, BSc. MLT., Alberta Health Services Cathy Davies, MLT., Alberta Health
Services Janet Emerson, MLT., Alberta Health Services Jacquie Hess, BSc. MLT, Alberta
Health Services Kelsey Jakobsen, MLT, Alberta Health Services Renee Tatro, BSc, MLT,
Alberta Health Services D Lyon, MD, Alberta Health Services M O'Connor, MD, Alberta
Health Services
Abstract Body
Introduction
South Zone in Alberta Health Services has two regional referral hospitals: Chinook
Regional Hospital (CRH) and Medicine Hat Regional Hospital (CRH). Each hospital
supports a massive transfusion protocol that requires a unit of platetets to be on
hand at all times. However, usage of platelets at MHRH was low and wastage was
high while CRH had increasing demand. We sought to improve utilization of platelets
in South Zone by implementing a redistribution program from MHRH to CRH. We
also sought to reduce the need for stat delivery of replacement platelets when the
single unit on hand is used. Lack of a direct courier from MHRH to CRH and limited
transport availability from the CBS supplier in Calgary, as well as variable platelet
demand were some of the challenges.
Design and Methods
We established a system where MHRH would send their expiring unit of platelets to
CRH on days when a replacement would be coming with the regular standing order..
We also reviewed historical platelet demand at MHRH and found that 39% of
platelet transfusions occured on a weekend, when a replacement platelet requires a
stat cab. In discussion with CBS, we had an additional unit of platelets delivered on
Fridays to reduce the need for stat replacement on the weekend.
Results
The utlization rate at MHRH has significantly improved, while it has declined at CRH.
However, the overall rates for South Zone have remained approximately constant.
There have been decreased stat cabs on weekends, but increased need for stat
platelet on weekdays. Our results for the first year were significantly affected by a
patient in MHRH who required HLA matched platelets, which could not be included
in the redistribution program and had a significant rate of wastage. Fluctuating
demand at both hospitals also has a significant impact.
Conclusions
We continue to monitor and adjust our standing orders to improve utilization in our
zone. Utlization rates fluctuate significantly due to overall low platelet supply and
variable demand.
78
CSTM 2016 – Conference Abstracts
79
CSTM 2016 – Conference Abstracts
In Vitro Platelet Function of Pathogen Reduced Platelet Using
the INTERCEPT Platelet Processing Set with Dual Storage
Containers
Abstract Title
In Vitro Platelet Function of Pathogen Reduced Platelet Using the INTERCEPT Platelet
Processing Set with Dual Storage Containers
Authors/Co-Authors & Affiliations
A Stassinopoulos, Cerus Corporation H. Löf, F. Knutson, Department of Clinical Immunology
and Transfusion Medicine, Uppsala University
Abstract Body
Background: The INTERCEPT Blood SystemTM (IBS) was developed to prevent
transfusion-transmitted infections by pathogen inactivation (PI) in platelets. The IBS
utilizes amotosalen and low energy UVA light, which crosslink nucleic acids and
prevent replication of pathogens and leukocytes. In order to validate the use of the
IBS
2.1x109/mL), we conducted an in vitro study with both Platelets derived from
Apheresis or BC pools. Extension of the dose range helps blood centers achieve
greater efficiency of PI treatment for double dose (DD) platelet collections.Aim: The
objective of this study was to validate in vitro function over 7 days of controlled
plasma from either an apheresis source or from BC pools, using the INTERCEPT
dual storage kit.Method: A total of 19 replicates were performed, 13 using doubledose or ABO-matched pooled apheresis platelet concentrates (PCs) and 6 using
PCs prepared by pooling buffy coats (BC) derived from ABO-matched whole blood
units. After IBS, the split units were stored under controlled conditions and evaluated
for in vitro platelet function testing over 7 days. Function assays included platelet
dose, pH, swirling, glucose, lactate, pO2, pCO2 and HCO3-. Results: The average
treatment dose and volume prior to split were 8.2 ± 1.0x1011 platelets per unit and
425mL ± 10mL, respectively. The Platelet dose was at 3.9X1011 post-PI for each
individual dose. All stored units met EU guidelines for transfuseable platelet units
based on pH (>7.02) and maintained (++) swirling throughout storage. pO2, pCO2
and HCO3- values indicate normal platelet respiration, are consistent with prior
function studies with platelets doses ≤7.0 x1011, and are comparable to
conventional platelets. Glucose was depleted in some of the apheresis but not the
BC pools with commensurate lactate concentration, while the ATP remained strong
at above 3.95 nmoles/106plateletsConclusion: INTERCEPTTM treated “high dose”
buffy coat and apheresis PCs from DD kits retained adequate in vitro platelet
characteristics over 7 days of controlled storage, supporting the treatment of platelet
doses up to 8 x1011 (2.4x109 PLTS/mL)
80
CSTM 2016 – Conference Abstracts
Inactivation of Zika virus in RBC Components using Amustaline
and GSH
Abstract Title
Inactivation of Zika virus in RBC Components using Amustaline and GSH
Authors/Co-Authors & Affiliations
Andrew Laughhunn, BSc, Felicia Santa Maria, PhD, Raymond Lenhoff, PhD Adonis
Stassinopoulos, PhD, Cerus Corporation, Concord, CA
Abstract Body
BackgroundZIKV caused sporadic cases in Africa and Asia until an outbreak on
Yap Island in 2007. In 2013, a 28,000-case outbreak occurred in French Polynesia,
with nearly 3% of asymptomatic blood donors testing positive for ZIKV RNA using a
research test. In 2015 an outbreak occurred for the first time in the Americas,
beginning in Brazil and spreading across South and Central America and several
Pacific islands. ZIKV infection may be asymptomatic or mild (rash, conjunctivitis,
fever and arthralgia), however the Americas outbreak has associated ZIKV with
neurologic conditions including microcephaly (in babies born to infected mothers)
and Guillain-Barré syndrome in adults. The large number of asymptomatic ZIKV
infections, as well as the potential for sexual transmission, raises the possibility of
ZIKV transfusion-transmitted infection (TTI). Two probable TTI cases have been
reported in Brazil. The risk of ZIKV TTI may be reduced by use of the pathogen
reduction (PR) technologies previously demonstrated to be effective for other
arboviruses (chikungunya virus, West Nile virus, dengue virus). Amotosalen and
UVA has been shown to be effective for the photochemical inactivation of >6.57 log
TCID50/ml ZIKV in human plasma (2). Here we report that the chemical PR method
of S-303 and GSH robustly inactivates ZIKV in red cell concentrates.MethodsPC in
RBC prepared in AS-5, from either leukoreduced or non-leukoreduced WB, were
contaminated with ZIKV (~107pfu/mL). RBC were treated with amustaline and GSH
and incubated at RT for up to 18-24h .ResultsInitial mean ZIKV titers in RBC were
approximately 5 log10 pfu/mL. Following inactivation, Vero cell cultures inoculated
with the treated RBC produced no ZIKV plaques. This resulted in a mean
inactivation of > 5.8 log pfu.ConclusionsAmustaline and GSH pathogen reduction
technology effectively inactivated ZIKV in RBCs prepared in AS5 from
WB. Leukoreduction does not see, to be required for adequate inactivation.The
INTERCEPT Blood System for RBC is not approved for use in Canada.
81
CSTM 2016 – Conference Abstracts
Incidence of Post-Transfusion Screen-Positivity in PreTransfusion Screen-Negative Patients by Disease Population
Abstract Title
Incidence of Post-Transfusion Screen-Positivity in Pre-Transfusion Screen-Negative Patients
by Disease Population
Authors/Co-Authors & Affiliations
Matthew Yan, MD, University of Toronto Brian Marsell, BSc MLT, University Health Network,
Toronto Christine Cserti-Gazdewich MD, University of Toronto
Abstract Body
Introduction:
One of the risks of transfusions is red cell alloimmunization, an undesirable outcome
with ramifications for future transfusions and pregnancies. Alloimmunization occurs
in 1-5% of the general population and can increase to >20% in certain conditions
such as sickle cell disease. Comparative alloimmunization rates for different disease
states within a single institution (where matching practices are policy-standardized)
are needed to ascertain which populations are left most at risk and therefore
warranting prophylactic matching.
Methods:
688 patients registered in the province’s largest hospital transfusion service were
identified as having positive screens over the course of a year (January 1, 2014 to
December 31, 2014) by interrogation of the laboratory information system
(HemoCare LifeLine 4.6.0.2, Mediware Info Sys Inc, Oakbrook IL). Only prior
screen-negative patients with newly positive screens (NPS) for alloantibodies were
included in a detailed chart review.
Results:
Ninety patients (55.6% female) had a NPS, at a median age of 62 years (range 1893). A total of 4142 screen-negative patients received at least one RBC transfusion,
associating with a subsequent NPS frequency of 2.22%. Fifty-four patients (60%)
had major comorbidities which included: 20 (22.2%) myeloid malignancies; 17
(18.9%) solid tumours; 7 (7.8%) autoimmune disorders; 5 (5.6%) lymphoid
malignancies; and 5 (5.6%) hemoglobinopathies. The sensitizing context was
unknown in 30 patients (33.3%), but was possibly related to transfusions for
hematologic malignancy in 24 patients (26.7%), hemorrhage in 19 patients (21.1%),
solid tumours in 10 patients (11.1%), hemoglobinopathy in 4 patients (4.4%) and
iron deficiency in 2 patients (2.2%). The median number of transfusions received
prior to a positive screen was 3 (0-799), with the most frequent antibodies being:
17.6% E, 15.7% unidentified, 11.1% Bg, 10.2% K, 7.4% Jk a, 6.5% c, and 6.5% C.
Conclusions:
Although five alloimmunization events occurred in the hemoglobinopathy population,
the frequency may have been much higher without the pre-existing matching
82
CSTM 2016 – Conference Abstracts
strategies. The largest (routinely matched) subgroup with a NPS consisted of those
with myeloid disorders at 1 in 5 of responders. Whether or not this high transfusion
burden population can feasibly be addressed by (and benefit from) a prophylactic
matching strategy justifies further study.
83
CSTM 2016 – Conference Abstracts
Installation of Ortho Vision™ Analyzer at Surrey Memorial
Hospital
Abstract Title
Installation of Ortho Vision™ Analyzer at Surrey Memorial Hospital
Authors/Co-Authors & Affiliations
Paula Courtney, Technical Coordinator FH Transfusion Medicine Laboratory Darlene Mueller,
Technical Practice Lead, FH Transfusion Medicine Laboratory
Abstract Body
Introduction/Objective
The Transfusion Medicine Laboratory at Surrey Memorial Hospital purchased an
Ortho Vision™ automated analyzer to replace an existing Ortho ProVue® analyzer.
This poster will describe the process and our experiences with validation and
installation.
Design and Methods
Our installation process included performance validation, security and privacy
assessments, interface validation with the Laboratory Information System (LIS) and
staff training. For performance validation, we compared results between three
methods; our reference method (tube for ABO/D and manual gel for Screen),
ORTHO ProVue® and ORTHO Vision™ for 50 donor groupings and 50 patient
group and screens. Security and privacy assessments were evaluated through
Software Assessment Form (SAF) by the Information Technology (IT/IM)
department. The Privacy Office through Security Threat Risk Assessment (STRA)
and Privacy Impact Assessment (PIA) evaluated identified risks. Once SAF, STRA
and PIA were all approved, the LIS validation of the Vision™ interface with Meditech
was initiated. Our last step in the implementation of the ORTHO Vision™ analyzer in
our workflow is to train approximately thirty staff members.
Results
The performance validation did not identify significant differences between results
obtained from the three methodologies. The analyzer operates as described by the
manufacturer with improved turn around times and increased capabilities of the
analyzer software including audit trails, instrument maintenance documentation and
reporting options. The SAF, STRA and PIA processes were lengthy, total time was
close to six months. LIS validation is currently underway and will inform operational
processes. Staff training is in the development phase with plans to roll out and
complete by end of April.
Conclusions
Although there have been hurdles along the way, the overall benefit of the ORTHO
Vision™, analyzer will be realized once it is fully operational in the regular workflow
of the laboratory.
84
CSTM 2016 – Conference Abstracts
Introduction Of a 7-Day Shelf Life For Platelet Concentrates:
Challenges For Inventory Management To Meet No Outdating
And Client Satisfaction
Abstract Title
Introduction Of a 7-Day Shelf Life For Platelet Concentrates: Challenges For Inventory
Management To Meet No Outdating And Client Satisfaction
Authors/Co-Authors & Affiliations
Claudia Mireille Pigeon Bs, Héma-Québec Sylvie Thibault TM, Héma-Québec Lysiane Lee
Sock Tsane, Héma-Québec Louis-Philippe Gagné, Héma-Québec
Abstract Body
Background and objectives: In October 2015, the deadline for achieving bacterial
contamination of platelet concentrates (PC) with the BacT/ALERT has been
increased from 24 to 48 hours and an additional 12-hour period has also been
added to increase product safety. This improved bacterial contaminations detection
has also allowed to increase the shelf life of PC from 5 to 7 days. In this report, we
describe how the logistics of PC inventory was redesigned to reduce product
loss.Materials and methods: Hospitals were informed of the extension of the PC
shelf life and of the new guidelines for ordering products. During the first week,
conference calls were held to inform hospital blood bank responsible and secure
inventory with needs. To ensure an adequate inventory, PC collection planning was
revised daily. Provincial recommendations regarding CMV seronegative products as
well as a tight management of ABO compatible substitution, including blood group O
PCs with low titers of anti-A / anti-B were applied. Tight management of RhDnegative PC allowed us to prioritize these products for newborns. At last, a unique
single first-in, first out (FIFO) approach was implemented to manage apheresis and
buffy coat pooled PCs.Results: From October 26th to February 28th , 14 317 PC
were delivered to hospital. Our ability to fulfill PC orders for transfusion slightly
increased from 97,0% to 97,6% and reach as high as 100% during 4 months. The
most effective inventory management helped reducing the provincial rate of wastage
from 4.7% to 3.4% which represent a saving in the range of $
878 147,20.Conclusion: Implemented in partnership with hospitals of the province
of Quebec, this project has not only reduced the risk associated with microbiological
contaminations, but has also allowed us to optimize PC inventory management
thereby reducing wastage and corresponding cost savings for the provincial health
system.
85
CSTM 2016 – Conference Abstracts
Is there a higher rate of transfusion reaction in chronically
transfused patients?
Abstract Title
Is there a higher rate of transfusion reaction in chronically transfused patients?
Authors/Co-Authors & Affiliations
Abigail Dering - University of Alberta Heather Blain - Alberta Health Services Hanan GergesAlberta Health Services and University of Alberta Gwen Clarke - University of Alberta Susan
Nahirniak - Alberta Health Services and University of Alberta
Abstract Body
Introduction: Chronically transfused (CT) patients are defined as having received a
red cell (RBC) transfusion at least once every two months for a minimum of six
months. It is a perception that the frequency of transfusion reactions is more
common in this group. Our aim was to determine transfusion reaction (TRXN) rates
in our cohort of CT patients and compare that to our general (G)
population. Method: A retrospective study was performed using data collected from
the laboratory information system (LIS), Sunquest, to determine the number of units
and transfusion episodes. CT patients from January to December 2015 were
extracted into an EXCEL spreadsheet. Patient demographics, primary diagnoses,
units transfused and TRXN details were obtained from the LIS and electronic
medical record (NetCare). Data was then compared to 2015 transfusion and TRXN
data of our general population. Results: 212 CT patients with 3548 transfusion
episodes involving 7909 red cell (RBC) and 1597 platelet (PLT) units were identified.
Thirty patients experienced 47 TRXN for a rate of 2.4 and 17.5 per 1000 units RBC
and PLT transfused respectively compared to the G TRXN rates of 3.3 and 9.8
(p=0.11). 15 CT patients had a total of 21 plt rxns - 4 to Apheresis PLT (APLT) and
17 to Buffy Coat Platelet (BPLT). There were 60 G plt rxns - 45 to BPLT and 15 to
APLT. There was no difference in percentages of febrile non hemolytic, minor
allergic (MA), generalized allergic or TACO reactions (p=0.93) to red
cells. However, the percentage of MA reactions to platelets is significantly higher in
the CT group (1.5% vs 0.36%, p = 0.004) but not for other TRXN
categories. Conclusions: This study has confirmed the suspicion of higher
reaction rates in CT patients. However, this is restricted to platelets and minor
allergic reactions and not red cells or other types of reactions. The role of higher
buffy coat reactions needs further evaluation since the impact of donor plasma
protein exposure should be the same. The lower rate of red cell reactions may
reflect patient tolerance.
86
CSTM 2016 – Conference Abstracts
Life in Kell: The challenges of providing Kell negative RBC
units in a multi-facility health region
Abstract Title
Life in Kell: The challenges of providing Kell negative RBC units in a multi-facility health
region
Authors/Co-Authors & Affiliations
Lawrence R, MLT, Rogheisler S, MLT, Forsberg J, MLT; Regina Qu'Appelle Health Region
Eurich B, MLT, Clarke G, MD, Alport EA, MD; Canadian Blood Services
Abstract Body
Background: Prenatal testing in Western Canada is currently conducted by CBS
Prenatal Program. As Rh immunoglobulin has been effective in decreasing Rh Drelated HDFN, attention has turned to additional clinically significant
antibodies. Annual CBS data show that anti-E and anti-Kell are the most common
clinically significant prenatal antibodies (2015: anti-E 277, anti-K 178).Issues related
to anti-K include:

Tends to cause more severe disease than other alloantibodies due to the
combined actions of hemolysis and decreased erythropoiesis.

Clinically significant disease can occur with low titre.

Previous transfusion is a common cause of sensitization – approximately
30%.

The frequency of the Kell antigen in the general population is low (9% in
Caucasians, 2% in black population).

National standards in several European countries specify use of Kell
matching for females of child-bearing age.

Automated technology has allowed CBS to prospectively Kell phenotype a
significant percent of the national inventory.
Given the above, it now appeared possible in Canada to reduce the risk Kell related
HDN by introducing a policy of transfusing Kell-negative blood to females of childbearing age.
Effective October 1, 2015, RQHR implemented this policy. The purpose of this
study was to work with CBS to look at the practical issues associated with
implementation.
Findings:

RQHR estimate of RBC units issued to females <50 to be 8% of total units
transfused.
87
CSTM 2016 – Conference Abstracts

There is significant variation in the percent of Kell phenotyped units received
from CBS (a preponderance of phenotyped units are O).

With rare exceptions (ie. occasional AB- patient) Kell negative blood could
be provided to the selected population with minimal effect on workload and
inventory.

For smaller sites, the policy was implemented by providing pretested Kell
negative inventory.
Conclusions:

RQHR was able to provide Kell negative units to the selected population in
>99% of cases.

Challenge providing Kell negative inventory for smaller sites (additional
phenotyping).

With the trend to more extended genotype/phenotype testing of recipient
populations and extended phenotyping of CBS units, this experience will be
helpful in understanding the practical implications of providing antigen
negative units to other selected patient populations.

Additional studies (some currently in progress) are recommended.
88
CSTM 2016 – Conference Abstracts
Mandatory Transfusion Reaction Reporting in British Columbia:
A Seven Year Review
Abstract Title
Mandatory Transfusion Reaction Reporting in British Columbia: A Seven Year Review
Authors/Co-Authors & Affiliations
Susanna Darnel, ART, BC Provincial Blood Coordinating Office Jennifer Danielson, BSc,
MLT, BC Provincial Blood Coordinating Office Cecilia Li, EMBA, BC Provincial Blood
Coordinating Office
Abstract Body
Background Through the Public Health Agency of Canada (PHAC), Canadian
facilities support a voluntary national hemovigilance system known as the
Transfusion Transmitted Injuries Surveillance System (TTISS). This work is
dependent on provincial coordination of the reporting process. In British Columbia
(BC), the BC Provincial Blood Coordinating Office (PBCO) has provided this
coordination and support for facilities in BC and the Yukon Territory since 2001.
Although the national reporting system is voluntary, BC’s transfusion medicine
leaders decided in 2010 that all facilities in BC will report their transfusion reactions
to PBCO. Methods Concluded transfusion reaction reports are submitted from
facilities to PBCO. Reports are reviewed and entered into one of the modules of the
PBCO’s Central Transfusion Registry (CTR), a provincial transfusion disposition
database. This data is then linked to CTR’s transfusion data, providing transfusion
reaction, recipient and transfusion data to provide meaningful transfusion incident
information back to stakeholders at provincial, regional and facility levels. A nonnominal subset of the data is sent to PHAC quarterly for analysis at the national
level. Results Data summaries provide counts and ratios of transfusion reactions by
blood product, reaction type and recipient. Supplemental reports detail the severity,
location and reaction types aligned with national classifications. Over the last 7
years, BC reported 790-915 transfusion reactions annually, which are associated
with approximately 650-800 recipients.Conclusion Through strong collaborative
processes, BC has developed a means to support a comprehensive hemovigilence
monitoring program. Providing data back to reporting facilities enables them to act
on and accurately monitor evidence-based quality improvement initiatives and
actively support quality of patient care in their regions. Acknowledgments The
PBCO gratefully acknowledges the BC medical, clinical and technical transfusion
community for their input, collaboration and support of this valuable program. This
work is supported by the Public Health Agency of Canada.
89
CSTM 2016 – Conference Abstracts
McMaster Data Driven Research Program: an integrated
database network tool driving education and research forward
Abstract Title
McMaster Data Driven Research Program: an integrated database network tool driving
education and research forward
Authors/Co-Authors & Affiliations
Michelle P. Zeller, MD FRCPC MHPE, Department of Medicine, McMaster University and
Canadian Blood Services Rebecca Barty, MLT BA, MSc., McMaster Centre for Transfusion
Research, McMaster University Emma Iserman, BA(Hons) Health Information Research Unit,
McMaster University Yang Liu, MMath, McMaster Centre for Transfusion Research,
McMaster University Grace Wang, MMath, McMaster Centre for Transfusion Research,
McMaster University Lillian Vasilic, BScEE MSc eHealth, Hamilton Health Sciences, Regional
Integrated Decision Support Wendy Gerrie, B. Admin CPA CMA, Hamilton Health Sciences,
Integrated Decision Support Mark Crowther, MD MSc FRCPC, Department of Pathology and
Molecular Medicine, McMaster University Donald M. Arnold, MD FRCPC MSc, Department of
Medicine, McMaster University and Canadian Blood Services Nancy M. Heddle, MSc
FCSMLS(D), McMaster Centre for Transfusion Research, McMaster University Alfonso Iorio,
MD PhD FRCPC, Department of Clinical Epidemiology and Biostatistics, Health Information
Research Unit
Abstract Body
Introduction: The McMaster Data Driven Research Program (MDDRP) is a
program being developed to enable access to an integrated network of databases
containing both administrative and health information to facilitate different types of
research: health outcomes and promotion of best clinical practice; knowledge
translation and continuing medical education; audit and resource utilization;
vigilance and patient safety; and, documentation of clinical education achievements.
Data accessible via this tool originate from the Laboratory Information System,
Discharge Abstraction Data, physician rosters, diagnostic imaging and pharmacy
databases housing health and administrative information for a large academic
institute. MDDRP builds on an established network of databases, which has been or
is currently supporting 34 studies, originating 23 abstracts and 9 publications as of
November 2015. This study was conducted to validate accuracy and completeness
of the extended datasets available via MDDRP.Methods: Three aspects of MDDRP
were selected for validation against independent, redundant source datasets:
transfusion, physician roster and pharmacy. Selected variables were extracted to
compare MDDRP data with identified external sources of data.Results: Comparing
transfusion data from 2014 house in MDDRP to inventory lists generated by
Canadian Blood Services (CBS), the sole supplier of blood and blood products to
this institute, demonstrated the match rate for units of cryoprecipitate and plasma of
100%, red blood cells 99.8% and platelets 99.9%. A total of 56,258 product records
from CBS were included in the analysis, 56227 matched MDDRP data yielding a
99.9% overall match rate. Physician roster data compared to the most responsible
physician listed in MDDRP for 4168 patients admitted to internal medicine inpatient
wards at two site from January-June 2014 matched in 96% of cases. Pharmacy
records for 2053 atorvastatin prescriptions dispensed by inpatient pharmacy from
January 1 to June 30th 2014 showed a 95% match. Records on 462 inpatient orders
90
CSTM 2016 – Conference Abstracts
for intravenous iron from 2010-2015 had a match rate of 90%.Conclusion: Data
validation of MDDRP against external datasets has shown excellent concordance.
This demonstrated accuracy and completeness for variables tested supports use of
MDDRP for research and knowledge translation activities though on going validation
will be important.
91
CSTM 2016 – Conference Abstracts
Meeting Health Canada Blood Regulations Requirements: A
Collaboration between British Columbia’s Transfusion Medicine
Services and Patient Safety & Learning System.
Abstract Title
Meeting Health Canada Blood Regulations Requirements: A Collaboration between British
Columbia’s Transfusion Medicine Services and Patient Safety & Learning System.
Authors/Co-Authors & Affiliations
Susanna Darnel, ART, British Columbia Provincial Blood Coordinating Office Jennifer
Danielson, BSc, MLT, British Columbia Provincial Blood Coordinating Office Aimee
Beauchamp, BComm, British Columbia Provincial Blood Coordinating Office
Abstract Body
Introduction:In October 2014, Health Canada released Blood Regulations for all
organizations that import, process, distribute, transform or transfuse human blood or
blood components. Organizations are now legally required to identify, document,
investigate and report on all adverse events involving these activities. Method: A
working group (WG) of transfusion medicine technical leaders from each jurisdiction
in British Columbia was established to address the Blood Regulations in a
coordinated and collaborative approach to avoid duplication of efforts. These efforts
included developing a comprehensive, streamlined electronic event reporting
process related to the Provincial Red Blood Cell (RBC) Redistribution Program. The
WG proposed using the established BC Patient Safety & Learning System (BC
PSLS) to capture these events, as BC PSLS was already being used to capture
events related to blood products across the province. The BC PSLS is a web-based
patient safety event reporting, learning and management tool used by care providers
across all healthcare organizations in BC. Much of the blood redistributed in the
province crosses jurisdictional boundaries, and this posed a major obstacle: there
was no existing process of cross jurisdiction reporting in BC PSLS.Results:The BC
Provincial Blood Coordinating Office (PBCO) and BC PSLS collaborated to create a
process by which events that are captured in one jurisdiction and originated in
another jurisdiction could be reported. PBCO now acts as the facilitator, receiving an
alert when an event is reported by a discovering site, and essentially assigning the
event to the originating site.. In order to address jurisdictional variation, procedures
were developed to be provincially standardized yet adaptable for regional or facility
specific activities.Conclusion:To date, all seven jurisdictions in the province are
participating and there have been 55 Provincial RBC Redistribution Program events
reported since April 1, 2015. This established new reporting process can be applied
to other health care activities that also cross jurisdictions.Acknowledgements:The
PBCO gratefully acknowledges Anne Marie Taylor, Executive Director of the BC
Patient Safety Learning System and the BC Technical Leaders of the Health
Canada Blood Regulations Working Group for their input, collaboration and support
of this valuable project.
92
CSTM 2016 – Conference Abstracts
Modelling disruptions in blood distribution network with a
generic simulation framework
Abstract Title
Modelling disruptions in blood distribution network with a generic simulation framework
Authors/Co-Authors & Affiliations
John Blake, Ph.D., Dalhousie University and Canadian Blood Services
Abstract Body
Since 2010, Canadian Blood Services has been engaged in a program of
modernizing its facility infrastructure. It has replaced, or will replace, 14 existing
local production and testing centres with two national testing laboratories, three
regional production and distribution centres, and four local sites in remote
locations. This plan calls for three local production sites in the Prairie region to be
consolidated into a single regional hub by 2019.
Consolidation of facilities allows for economies of scale, increased process
standardization, and improved productivity. In the Prairie Region, production and
distribution functions in Calgary, Edmonton, and Regina will be amalgamated into a
single production facility to be located in Calgary, supported by a regional redistribution hub in Regina to service hospitals in the Province of
Saskatchewan. Some Saskatchewan stakeholders, however, have expressed
concern about the timeliness of deliveries to facilities to certain areas of the province
and have questioned whether a need exists for extra stock holding units to cover for
failures in the transportation network.
In this talk we describe the design, development, testing, and results of a simulation
based study to evaluate the impact of network changes in a regional blood
distribution network in the Prairies under the assumption of periodic delivery
failures. The work is similar in nature to our previous work in Atlantic Canada
(Blake, 2012). However, rather than using a bespoke simulation model, a generic
network simulation framework originally developed for regional blood networks
(Blake & Hardy, 2014) was adapted for the study. The resulting simulation model
was used to evaluate system wide outdates and shortages, under varying road
closures with and without additional stock holding units. Results suggest that a
secondary stock holding unit is likely to have little practical impact, given the
assumed magnitude and frequency of logistic network failure.
93
CSTM 2016 – Conference Abstracts
Molecular Heterogeneity of the JK-null Phenotype
Abstract Title
Molecular Heterogeneity of the JK-null Phenotype
Authors/Co-Authors & Affiliations
J. Cote, MLT, Canadian Blood Services - National Immunohematology Reference Laboratory
J. Morden, MLT, Canadian Blood Services - National Immunohematology Reference
Laboratory P. Berardi , MD, PhD, Canadian Blood Services - National Immunohematology
Reference Laboratory
Abstract Body
Introduction: The Kidd blood group system on the human
urea transporter B protein has 3 significant antigens, Jka
(JK1), Jkb (JK2) and the high incidence Jk3 (JK3). By using
antibody-based detection methods and genetic testing there
are now >35 JK alleles with weak, partial or silenced antigen
expression described. Undetected variant alleles can result
in unexpected antibody formation and typing discrepancies
in patients and donors respectively. Antibodies to the high
incidence Jk3 antigen have facilitated identification of Jk(ab-) donors and occasionally resulted in challenging antibody
investigations. Here we report the reference
laboratory experience with variant Kidd alleles and highlight
challenges that may arise when investigating these
discrepancies. Methods: This was a retrospective analysis
of all variant Kidd alleles identified since upgrading to the
Progenika ID-CoreXT (Grifols) platform in February 2014.
Genomic DNA was extracted from whole blood using the
QIAamp DNA blood mini kit (Qiagen) and probe-set
amplification was done on the GeneAmp PCR system
(ThermoFisher). The ID-CoreXT and accompanying BIDS
XT software (Progenika) was used as per the
manufacturers’ recommendations. In the Kidd system, the
most common single nucleotide polymorphisms (SNP) are
interrogated using 3 probe sets and include those predicting
the JK*A and JK*B phenotypes. The Kidd-null phenotypes
assessed are the JK*B null(871C) and JK*B null(IVS5-1a).
Complimentary testing methods include the 2M urea lysis
94
CSTM 2016 – Conference Abstracts
test and gene sequencing. Results: Since upgrading to the
ID-CoreXT genotyping platform, NIRL has performed 1,053
genotyping assays and encountered 8 samples that
phenotyped Jk(a-b-) with an associated anti-Jk3. Seven
samples genotyped as JK*B null(IVS5-1a) and 1 genotyped
as JK*B, JK*B null(IVS5-1a) with a predicted phenotype
Jk(a-b+). The latter case was referred for Sanger
sequencing to determine if there was a null allele not
interrogated by the assay. The direct urea lysis test can also
be used to confirm that these cells are resistant to lysis by
2M urea. Conclusions: The ID-CoreXT assay confirmed
the presence of a variant allele in the Kidd system in the
majority of cases analyzed. However, not all cases were
confirmed using this approach which highlights the role of
additional testing including the 2M urea lysis test and gene
sequencing in resolving discrepancies and to identify
variants not interrogated by the assay.
95
CSTM 2016 – Conference Abstracts
Optimal conditions for the performance of a monocyte
monolayer assay
Abstract Title
Optimal conditions for the performance of a monocyte monolayer assay
Authors/Co-Authors & Affiliations
Tik Nga Tong, B.Sc., Laboratory Medicine and Pathobiology, University of Toronto and
Canadian Blood Services Darinka Sakac, M. Sc., Canadian Blood Services Emeralda BurkeMurphy, B.Sc., Canadian Blood Services Jacob Pendergrast, MD, University Health Network
Christine Cserti-Gazdewich, MD, University Health Network Vincent Laroche, MD, CHU de
Québec - Université Laval Donald R. Branch, Ph.D, Canadian Blood Services, University of
Toronto, University Health Network
Abstract Body
(1) Background: The monocyte monolayer assay (MMA) is an in vitro assay that is
used to evaluate monocyte Fc receptor-mediated phagocytosis of antibodyopsonized red blood cells (RBCs). It has been used for over 35 years to predict and
assess the clinical significance of anti-RBC antibodies that might be involved in
hemolytic transfusion reactions. Although some researchers suggest the use of
autologous patient blood in the MMA, geographical distance between site of blood
draw and testing laboratories poses practical issues. However, whether whole blood
can be stored for the purpose of MMA has never been adequately examined.(2)
Hypothesis: Conditions can be found whereby whole blood can be stored while
maintaining monocyte function for the purpose of using autologous monocytes in the
MMA.(3) Methods/Results: Monocytes from peripheral blood mononuclear cells
(PBMCs) from consented healthy donors and anti-D opsonized R2R2 RBCs were
used to evaluate the phagocytic abilities of the monocytes in the MMA. Four storage
conditions were examined: i) whole blood stored at room temperature (RT) or ii) 4°C,
iii) the overnight cultivation of PBMC, and iv) the effect of different anticoagulants
used for blood draw. When compared to whole blood stored at RT, whole blood
storage at 4°C consistently led to a decrease in PBMC yield and the overnight
cultivation of PBMC led to significantly depressed monocyte phagocytosis.
Anticoagulant acid-citrate-dextrose (ACD) best preserved monocyte function for up
to 36-hrs with minimal RBC lesions. Such observations were reproduced using
clinical samples, where patient MMA results, from overnight RT stored whole blood
in ACD, correlated with clinical outcomes of hemolysis. One of the samples was
shipped over 800km by overnight courier. Tested in parallel with storage matched
whole blood from healthy controls, the differences in MMA results emphasized the
importance of using autologous patient blood for prediction of clinical relevance
using the MMA.(4) Conclusion: Whole blood collected in ACD can be stored at RT
for up to 36-hours without compromising monocyte phagocytic abilities. This would
permit the shipping and testing of distantly drawn patient blood samples.
96
CSTM 2016 – Conference Abstracts
Optimizing Blood Inventory in Northern Alberta Hospitals
Abstract Title
Optimizing Blood Inventory in Northern Alberta Hospitals
Authors/Co-Authors & Affiliations
C Laliberte1, A Maguire2, J Stepien3, S Nahirniak1,2, J Hannon1,3, G Clarke1,3; 1.
University of Alberta, 2. Alberta Health Services, 3. Canadian Blood Services
Abstract Body
Introduction / ObjectiveAs blood is a scarce resource, managing inventory
effectively is a priority to ensure a sustainable supply. Rural hospitals face unique
challenges in providing access to blood products due to remote locations and
increased distance from blood suppliers. This project aims to optimize target red
blood cell (RBC) inventory for rural hospitals in northern Alberta to meet patient
transfusion needs safely and use blood products efficiently.Design and
MethodsUtilization data for RBC use in 30 hospitals was gathered for a 1 year
period. An inventory calculator was used to obtain standard inventory estimates for
each. The inventory estimates were adjusted to determine minimum and maximum
inventory levels based on rate of outdating or redistribution of RBC, turn- around
time and number of routine and STAT requests for RBC, distance from blood
supplier, and type of clinical services offered (surgical, obstetrical, medical,
emergency, endoscopy).ResultsOn average, the inventory calculator
underestimated the current stock level. Comparing the optimized inventory numbers
with current stock levels supported the existing inventory levels for approximately
33% of hospitals, however indicated a need for adjustment with others (67%).
Among the hospitals evaluated, a range of 0-103 units comprised the RBC
inventory. Discard rates ranged from 0 to 29 units per month. The discard rate was
correlated with the amount of inventory held but not with the distance from the blood
supplier. Availability of on- site blood bank testing along with obstetrical, surgical,
and medical services were associated with increased blood use, whereas the
presence of endoscopy did not impact blood use.ConclusionsThe evaluation
suggested both increases and decreases in RBC inventory depending on the
hospital evaluated. A minimum baseline inventory for emergency use is required at
most hospitals. Some hospitals utilization indicated that a minimum RBC inventory
should be on hand when currently no RBC stock is on hand. Reviewing blood
utilization can define ideal inventory levels. A baseline inventory plan should be
reviewed regularly or when hospitals experience service changes to ensure
maximum efficiency in use of blood products.AcknowledgementsOntario Regional
Blood Coordinating Network (ORBCoN) inventory calculator
http://transfusionontario.org/en/cmdownloads/categories/inventorymanagement-toolkits/
97
CSTM 2016 – Conference Abstracts
Optimizing Inventory: Integration of a Hub Model in Northern
BC.
Abstract Title
Optimizing Inventory: Integration of a Hub Model in Northern BC.
Authors/Co-Authors & Affiliations
Canadian Blood Services - BC/YT Provincial Blood Coordinating Office (BC)
Abstract Body
Background A concerted effort to optimize red cell inventory in BC hospitals has
been a joint mandate by the Provincial Blood Coordinating Office (PBCO) and
Canadian Blood Services (CBS). Sites within BC’s Health Authorities investigated
areas for improvement and invested time in new initiatives. A model that has been
proven successful in Northern Interior and Fraser Health is the distribution and
redistribution of red cells through a hub site. Process When an abrupt cancellation
of courier services forced a reallocation of resources, a small regional hospital in
Northern BC was converted into a hub for blood and blood component distribution.
Red cells from the provincial CBS distribution center are shipped to Prince George
and funnelled to its outlying sites in Burns Lake, Fort St. James, McBride, and
Vanderhoof. On a biweekly basis, fresh blood is shipped to these sites and older
units are redistributed to Prince George. Basic comparative calculations were
performed on pre-conversion and post-conversion inventory and redistribution data
to measure the success of this initiative.Results Initial results show a modest
decrease in the total number of CBS shipments for these sites. Additionally, there
has been a reduction in the number of units redistributed through the provincial
redistribution program. Conclusion Conversion of a small regional hospital into a
hub model for blood and blood component distribution has proven beneficial in terms
of CBS resources, inventory management, shared intra-hospital resources, and
necessity for redistribution.
98
CSTM 2016 – Conference Abstracts
Osteoblasts release factors that promotes the survival and
expansion of progenitors with platelet engraftment activity
Abstract Title
Osteoblasts release factors that promotes the survival and expansion of progenitors with
platelet engraftment activity
Authors/Co-Authors & Affiliations
Ahmad Abu-Khader, PhD, Canadian Blood Service Roya Pasha, Canadian Blood Service
Nicolas Pineault, Canadian Blood Service
Abstract Body
There is great interest in stem cell expansion technologies since several trials have
demonstrated clear benefits to cord blood (CB) engraftment. However,
thrombocytopenia remains extended partially due to lower doses of hematopoietic
stem and progenitor cells (HSPC) with platelet engraftment activity (PEA) in CB
graft. We previously reported that osteoblasts conditioned medium (OCM) raises
expansion of HSPCs and improves subsequent platelets engraftment in a
transplantation model.The objectives of this study were to measure the actual
expansion of HSPC with PEA induced by OCM and, investigate the mechanisms
responsible for the growth promoting activity of OCM. CB CD34+ cells were
expanded in OCM or in control serum-free medium (SFM) and decreased doses of
expanded cells were transplanted into immunodefficient mice.The short-term (ST)
and long-term (LT) median levels of human platelets were 2.5- (p˃0.05) and 4.0-fold
(p=0.0027) higher in M-OST recipients. Consistent with this, the frequencies of
HSPC with PEA were superior in OCM cultures (ST; 1/2254 vs. 1/3686, p=0.209; LT
1/1690 vs. 1/3665, p=0.019). Consequently, the net production of HSPC with ST and
LT PEA were 4.0±1.9 (range 1.9-5.5) and 7.8±7.3 fold (3.5-16.3, n=3) greater in
OCM cultures vs. SFM, respectively. Interestingly, the increase in PEA in OCM
cultures was not the results of increased expansion of LT engrafting bone marrow
cells.Next, we sought to better characterize OCM’ growth promoting activities on CB
HSPC. The latter was found to be the results of individual and strong synergistic
activities between factors released by M-OST and exogenously added cytokines.
Moreover, viability analyses revealed that OCM promoted the survival of CB cells in
culture. Filtration (0.2 µM) significantly decreases OCM growth promoting activity. In
line with this, unknown cell-based elements secreted by M-OST and retained in 0.2
µM filters (i.e. retentate) raised expansion of CB cells (1.6-fold, P˂0.01), CD34+
cells (1.4-fold, p=0.14) and CD34+CD38-45RA- cells (P˂0.05) when added to SFM.
The composition of the retentate remains to be characterized.In summary, OCM
contains both growth- and survival promoting factors that synergises with common
cytokines to promote the expansion of CB HSPC with increased PEA.
99
CSTM 2016 – Conference Abstracts
Pathogen inactivation by riboflavin and ultraviolet light
treatment influences the indices of erythrocyte storage lesion
and programmed cell death
Abstract Title
Pathogen inactivation by riboflavin and ultraviolet light treatment influences the indices of
erythrocyte storage lesion and programmed cell death
Authors/Co-Authors & Affiliations
Syed M. Qadri, MD, Ph.D., (1) Centre for Innovation, Canadian Blood Services, Hamilton,
ON, Canada. (2) Department of Pathology and Molecular Medicine, Hamilton, McMaster
University, ON, Canada. Peter Schubert, Ph.D., (1) Centre for Innovation, Canadian Blood
Services, Vancouver, BC, Canada. (2) Centre for Blood Research, University of British
Columbia, Vancouver, BC, Canada. (3) Department of Pathology and Laboratory Medicine,
University of British Columbia, Vancouver, BC, Canada. Deborah Chen, BMLSc, (1) Centre
for Innovation, Canadian Blood Services, Vancouver, BC, Canada. (2) Centre for Blood
Research, University of British Columbia, Vancouver, BC, Canada. (3) Department of
Pathology and Laboratory Medicine, University of British Columbia, Vancouver, BC, Canada.
Varsha Bhakta, B.Sc., (1) Centre for Innovation, Canadian Blood Services, Hamilton, ON,
Canada. Dana V. Devine, Ph.D., (1) Centre for Innovation, Canadian Blood Services,
Vancouver, BC, Canada. (2) Centre for Blood Research, University of British Columbia,
Vancouver, BC, Canada. (3) Department of Pathology and Laboratory Medicine, University of
British Columbia, Vancouver, BC, Canada. William P. Sheffield, Ph.D., (1) Centre for
Innovation, Canadian Blood Services, Hamilton, ON, Canada. (2) Department of Pathology
and Molecular Medicine, Hamilton, McMaster University, ON, Canada.
Abstract Body
Introduction: Pathogen reduction treatments (PRTs) are reliable and effective
strategies in reducing the risk of transfusion-transmitted infections. However, unlike
platelets and plasma products, there is currently insufficient data to validate their
application for erythrocytes. During storage, erythrocytes undergo a wide array of
biochemical and morphological changes that are associated with enhanced
susceptibility to programmed cell death or eryptosis. The eryptosis machinery is
orchestrated by Ca2+-dependent signaling that provokes phosphatidylserine (PS)
externalization as well as cell shrinkage. In the present study, we examined the
impact of riboflavin and ultraviolet light (Mirasol®) PRT on erythrocyte storage lesion
and eryptosis. Design and Methods: In a “pool-and-split” approach, erythrocytes,
derived from Mirasol-treated or untreated whole blood, were examined for different
parameters of storage lesion including hemolysis, microvesiculation, cellular K+, ATP
and 2,3-DPG following 4, 21 and 42 days of storage, respectively. Flow cytometry
analysis was used to determine erythrocyte PS exposure (annexin V fluorescence),
cell volume (forward scatter), cytosolic Ca2+ activity (Fluo3 fluorescence) and
sphingomyelinase activation (ceramide-dependent fluorescence). Results: In
comparison to untreated erythrocytes, Mirasol-treated erythrocytes showed
significantly enhanced hemolysis and microvesiculation as well as significantly
reduced cellular K+, ATP and 2,3-DPG. Mirasol PRT significantly increased PS
exposure following 42 days, but not following 4 and 21 days, of storage as
compared to untreated erythrocytes. Contrary to cell shrinkage typically observed in
100
CSTM 2016 – Conference Abstracts
eryptotic erythrocytes, the cell volume was significantly larger in Mirasol-treated
erythrocytes (4−42 days of storage) as compared to untreated erythrocytes. Both
cytosolic Ca2+ activity and ceramide abundance were significantly upregulated in
Mirasol-treated erythrocytes. PS exposure and cytosolic Ca2+ activity were
significantly more pronounced in Mirasol-treated erythrocytes (4−42 days of storage)
following energy depletion, a pathophysiological cell stressor. Conclusions: Mirasol
treatment accelerates the deterioration of erythrocytes during storage under blood
bank conditions while enhancing their susceptibility to stress-induced eryptosis,
thus, having a negative impact on erythrocyte quality. Acknowledgements: This
research was supported by the Centre for Innovation of Canadian Blood Services,
using resources provided in part by Health Canada, a Department of the Federal
Government of Canada, to DVD and WPS. SMQ was supported by a CBS
postdoctoral fellowship award.
101
CSTM 2016 – Conference Abstracts
Patients with Rare Blood Types Identified by an Automated
Platform for Blood Group Genotyping
Abstract Title
Patients with Rare Blood Types Identified by an Automated Platform for Blood Group
Genotyping
Authors/Co-Authors & Affiliations
Nadia Baillargeon(1), Jessica Constanzo Yanez(2), Carole Éthier(1) and Marie-Claire
Chevrier(2); (1)Immunohematology Reference Laboratory, Héma-Québec, Québec, QC,
Canada (2)Héma-Québec, Montréal, QC, Canada
Abstract Body
Introduction / ObjectiveExtended phenotyping of blood recipient and the use of
phenotype-matched blood units for transfusion have been useful in lowering alloimmunization in chronically transfused patients. However, phenotyping cannot be
performed in certain situations. The discovery of the molecular bases behind most of
the clinically important blood group antigens has prompted the development of
genotyping platforms which has been shown to be an extremely effective technique
that allow greater characterization of antigen profiles and variants.Design and
MethodsIn February 2015, the Immunohematology Reference Laboratory
implemented the ID CORE XT platform (Progenika, Grifols ) to genotype patients.
This test is a qualitative, bead array-based assay that type 37 antigens in the Rh,
Kell, Kidd, Duffy, MNS, Diego, Dombrock, Colton, Cartwright, and Lutheran blood
groups utilizing Luminex xMAP® technology. From February 2015 to February 2016,
400 patients were tested using the ID Core XT. The turn-around time to analyse up
to 48 samples is about 7 hours.ResultsNumerous patients where identified with rare
phenotypes. Among the tested patients, 4 Yt(a-), 1 Lu(b-), 2 k-, 1 U-, 1 U var, 7 Fy*x
and 1 hrB- were found. Many patients with variants were also identified (table):
Table Genotyping results
Number of samples
Genotype
Phenotype
2
RHCE*Ce,RHCE*ce[733G,1006T] Partial c
1
RHCE*ceAR,RHCE*ce[733G]
Partials c and e
1
RHCE*ce[733G], RHD*r´sRHCE*ce[733G, 1006T]
Weak partial C,
partial e
and hrB+w/-
1
RHCE*ce[733G], RHD*r'sRHCE*ce[733G, 1006T]
Partial C
2
RHCE*ce[733G]
Partial c, partial
e and hrB +w/-
1
RHCE*ce, RHCE*ce[733G]
Partial or weak e
and hrB+w/-
1
RHCE*ce[733G],RHCE*CeCW
Partial c
1
RHCE*ce[733G]
Partial c, partial
or weak e and
hrB+w/-
102
CSTM 2016 – Conference Abstracts
1
RHCE*cE,RHCE*CeCw
Weak C+
ConclusionsAutomated genotyping offers great advantages over serological tests.
It reduces error risk, offers more test capacity and easy data managing, saves time
and reduces turn-around time. Ultimately, it also generates reliable results which
help in the identification of rare blood type in order to lower and even avoid alloimmunization events.
103
CSTM 2016 – Conference Abstracts
Plasma Component Factor Xa is Modulated by Direct Oral
Anticoagulants to Enhance Clot Dissolution
Abstract Title
Plasma Component Factor Xa is Modulated by Direct Oral Anticoagulants to Enhance Clot
Dissolution
Authors/Co-Authors & Affiliations
Rolinda L.R. Carter, BSc, Department of Pathology and Laboratory Medicine; Centre for
Blood Research, University of British Columbia Kimberley Talbot, MSc, Canadian Blood
Services, Centre for Innovation; Department of Pathology and Laboratory Medicine; Centre
for Blood Research, University of British Columbia Tyler Smith, MD MHSc FRCPC,
Department of Medicine, Division of Hematology, University of British Columbia Agnes Y.
Lee, MD, MSc, FRCPC, Centre for Blood Research, University of British Columbia;
Department of Medicine, Division of Hematology, University of British Columbia Edward L.G.
Pryzdial, Ph.D., Canadian Blood Services, Centre for Innovation; Department of Pathology
and Laboratory Medicine; Centre for Blood Research, University of British Columbia
Abstract Body
Introduction: The balance between clot formation and dissolution is vital for the
prevention of hemorrhage and clot-induced heart attacks and strokes. When clotting
is favored, aberrant clots block the flow of blood leading to cardio- and
cerebrovascular diseases, major causes of death worldwide. To dissolve these clots,
the endogenous clot-busting enzyme tissue plasminogen activator (tPA) was
developed as a therapeutic agent. Unfortunately, tPA must be given at high doses,
increasing the risk of hemorrhagic complications. As an alternative, we have
identified that the plasma derivative clotting factor Xa (FXa) accelerates the ability of
low dose tPA to dissolve clots. This new function is improved when the active site of
FXa is blocked. Rivaroxaban and apixaban, new FXa-targeted direct oral
anticoagulants (DOACs), also block the active site of FXa. While rivaroxaban has
been shown to enhance clot dissolution by reducing thrombin generation and thus
altering clot structure, their effects on the novel clot-busting function of FXa is
unknown. Objective: Here we investigated the effects of DOACS on clot dissolution
when in situ thrombin generation was carefully controlled.Design and Methods:
Thrombin-induced clots were formed in the presence or absence of DOACs. The
extent of clot formation and dissolution were monitored in normal plasma and FXdeficient plasma ± purified human FX. Plasmin generation, FXa fragmentation, and
clot structure were evaluated. FXa fragmentation was also analyzed in plasma from
patients being treated with rivaroxaban. Results: Both DOACs enhanced plasma
clot lysis in a FX-dependent manner. This enhancement was linked to an altered
FXa fragmentation profile known to favor increased plasmin generation, but not to
carboxypeptidase activity. Similar fragmentations were seen in patient plasma
samples. Scanning electron microscopy showed no difference in clot structure due
to the anticoagulants.Conclusions: This study highlights a novel function of plasma
constituent FXa after modulation by DOACs. Further investigations are warranted to
determine if this mechanism contributes to the risk of bleeding seen in certain
patients treated with DOACs. This unforeseen side effect may also provide an
additional avenue for treating post thrombotic syndrome, a common long-term
morbidity in patients with deep vein thrombosis caused by ineffective clot
104
CSTM 2016 – Conference Abstracts
dissolution.
105
CSTM 2016 – Conference Abstracts
Polymer-Mediated Immunocamouflage of Allogeneic
Lymphocytes Induces Tolerance via Generation of Functional
Regulatory T Cells and a Decrease in CD8+ T cells
Abstract Title
Polymer-Mediated Immunocamouflage of Allogeneic Lymphocytes Induces Tolerance via
Generation of Functional Regulatory T Cells and a Decrease in CD8+ T cells
Authors/Co-Authors & Affiliations
Ning Kang, Ph.D., Canadian Blood Services and University of British Columbia Mark D.
Scott, Ph.D., Canadian Blood Services and University of British Columbia
Abstract Body
Introduction: T cell-mediated immune rejection remains a barrier to
successful transplantation. One possible solution is to attenuate
immune recognition by the covalent grafting of methoxypoly(ethylene
glycol) polymers (PEGylation) to the donor cells or tissues (i.e.,
immunocamouflage). Design and Methods: Succinimidyl valerate
activated methoxypoly(ethylene glycol) [SVA-mPEG; 0-2 mM grafting
concentration of 5 and 20 kDa chains] was used for murine splenocyte
PEGylation. The polymer-mediated immunocamouflage of cell surface
receptors was measured via flow cytometry. The immune activation of
the PEGylated splenocytes was assessed in anti-CD3 (in the
presence of anti-CD28) and allorecognition (mixed lymphocyte
reactions; MLR) models by CFSE dilution assay. Immunocamouflageinduced regulatory T cells (CD4+ CD25+ Foxp3+; Treg) were purified
and functionally tested in MLR model. Results: SVA-mPEG
demonstrated size- and concentration-dependent immunocamouflage
of MHC class I, MHC class II, TCR and CD3. In the anti-CD3
activation model, the weak immune signal transduction arising from
CD3 immunocamouflage favored Treg differentiation. Similarly, in the
more complex allorecognition MLR model in which one donor
splenocyte population was PEGylated (mPEG-MLR), Treg
differentiation was also observed. Concurrent with the production of
Treg, immunocamouflage resulted in the abrogation of CD8 + T cell
proliferation. Of note, increased Tregs were found in both the
proliferative and non-proliferative populations of both the PEGylated
(C57BL/6) and the nonPEGylated (BALB/c) splenocyte populations;
although the BALB/c cells accounted for the majority of Tregs. Most
importantly, Treg purified from mPEG-MLR showed significant
suppressive activity on allogeneic CD8+ T cell proliferation.
Conclusions: These results suggest that immunocamouflage106
CSTM 2016 – Conference Abstracts
mediated attenuation of alloantigen-TCR recognition can prevent
allogeneic CD8+ T cell response, both directly, and indirectly through
the generation/differentiation of functional Treg. Immunocamouflage
induced tolerance can be clinically valuable in preventing blood
transfusion reaction and organ transplant rejection.
Acknowledgements: This work was supported by grants from the
Canadian Institutes of Health Research (Grant No. 123317; MDS),
Canadian Blood Services (MDS) and Health Canada (MDS).
107
CSTM 2016 – Conference Abstracts
Pooling Components for Exchange Transfusion
Abstract Title
Pooling Components for Exchange Transfusion
Authors/Co-Authors & Affiliations
Suzanne Cho, Canadian Blood Services Robert Fallis, Canadian Blood Services Debra Lane,
MD., Canadian Blood Services Gwen Clarke, MD., Canadian Blood Services
Abstract Body
Introduction:Exchange Transfusion is used to treat severe hemolytic disease of the
fetus and newborn. Red cell components reconstituted with plasma (O cells
suspended in AB plasma) are prepared. The process involves centrifugation of a red
cell component, extraction of the plasma/SAGM additive solution and reconstitution
with plasma to a defined hematocrit range of 0.45-0.60 L/L. Under the new Blood
Regulations effective October 2014, facilities that prepare pooled products (other
than cryoprecipitate) are required to register with Health Canada. Section 97 of the
Blood Regulations requires documented evidence that demonstrates operating
procedures and process consistently meet the expected results. Although the
Canadian Blood Services-Winnipeg Transfusion Service had been preparing
components for exchange transfusion for many years, a complete revalidation was
conducted to document compliance. Design and Methods:Three distinct activities
were planned. Phase one included validation of Thermo Fisher Scientific RC 3BP+
centrifuge and the Thermogenesis plasma thawing device. Phase two was an
assessment to determine the correct centrifugation speed/time required and the
amount of residual plasma/SAGM additive on in the red cell component to obtain a
HCT of 0.70 – 0.85 L/L. Thirty components were tested in phase three to ensure the
process would consistently meet predetermined component specifications (HCT
0.45 – 060 L/L after reconstitution, no growth in aerobic and anaerobic sterility
testing). Suitability and adhesion properties of in-house labels used were also
assessed to ensure minimal flagging of the label (less than ¼ inch) and no
smudging.Results:Validation activities demonstrated leaving behind 1.3 – 2.5 cm of
plasma/SAGM additive following centrifugation of red cell component at a RCF of
7000 x g for 4 minutes consistently provided the desired HCT of 0.70 – 0.85
L/L. This value was used to calculate the volume of plasma to be added to the red
cells for a final HCT of 0.45 – 0.60 L/L. All components tested demonstrated no
growth in sterility testing with minimal label flagging and no
smudging.Conclusions:The successful completion of the validation activities meet
the new Blood Regulations and ensures pooled red cell components prepared for
Neonate Exchange Transfusion consistently meet the required component
specifications.
108
CSTM 2016 – Conference Abstracts
Process-Induced Hemolysis: A comparative analysis of
gamma-irradiated and pathogen-inactivated red cell
concentrates
Abstract Title
Process-Induced Hemolysis: A comparative analysis of gamma-irradiated and pathogeninactivated red cell concentrates
Authors/Co-Authors & Affiliations
Deb Chen, BMSLc., University of British Columbia Peter Schubert, PhD., University of British
Columbia and Canadian Blood Services Dana V. Devine, PhD., University of British
Columbia and Canadian Blood Services
Abstract Body
Introduction: Post-collection manipulations (PCMs) are aimed to further improve
product safety, especially for vulnerable transfusion recipients. However, these
PCMs of red cell concentrates (RCCs) often improve safety at a cost of product
quality. One of the biggest challenges for blood banks lies in the balancing product
safety and quality, warranting further investigation into the biochemical changes
induced by PCMs. This comparative study aims to catalogue differences in
various in vitro quality parameters and to identify changes in membrane protein
profiles between standard-issue, gamma-irradiated, and pathogeninactivated (PI) RCCs. Design and Methods: Three ABO-matched whole blood
(WB) units were pooled and split into three identical units. One WB unit was PItreated with riboflavin and UV illumination prior to RCC production. The other two
WB units were produced into RCCs, with one subjected to gamma-irradiation, while
the other was left untreated as control. Samples were analyzed on days 5, 14, 21,
28 and 42 of storage. Hemolysis levels were obtained by
the Harboe method. Microvesicles (MV) were enumerated using
flow cytometry. Osmotic fragility was determined using a series of saline dilutions
and the sodium chloride concentration that produced 50% hemolysis was reported
as mean corpuscular fragility (MCF). Membrane protein profiles between standardissue, gamma-irradiated, and PI RCCs were assessed using a quantitative
proteomics approach based on iTRAQ. Group means were compared using two-way
ANOVA with repeated measures.Results: PI-treated RCC exhibited significantly
higher hemolysis than gamma-irradiated and standard-issue RCCs at each time
point measured (p<0.0001). MV release displayed a similar trend as a function of
both storage and PCMs (p<0.0001). MCF increased with gamma-irradiation and was
significantly more pronounced with PI-treatment (p<0.0001).Conclusions: Overall,
the in vitro quality parameters indicated that PI-treatment impacts RBC quality more
severely compared to gamma-irradiation. iTRAQ proteomic analysis will identify
membrane protein changes induced by PCMs, which will be placed in the context of
more conventional in vitro quality parameters. These protein profiles can be used to
generate mechanistic models of process-induced RBC damage, which may inform
future blood banking practices in order to
improve RCC quality.Acknowledgements: We thank the staff at the Canadian
Blood Services NetCAD facility and acknowledge the generous contributions of the
109
CSTM 2016 – Conference Abstracts
blood donors who made this study possible.
110
CSTM 2016 – Conference Abstracts
Promoting Choosing Wisely Canada’s Recommendations to
Transfuse Safely; An interprofessional, multi organizational
awareness campaign by Best Blood Manitoba
Abstract Title
Promoting Choosing Wisely Canada’s Recommendations to Transfuse Safely; An
interprofessional, multi organizational awareness campaign by Best Blood Manitoba
Authors/Co-Authors & Affiliations
Shauna Paul RN BN, Winnipeg Regional Health Authority
Brenda Herdman MLT, Diagnostic Services of Manitoba
Abstract Body
Introduction
Transfusion audits have identified that current guidelines are often not implemented
in practice. The objective of the Transfuse Safely Campaign is to increase
awareness of recommendations recently promulgated by Choosing Wisely Canada
(CWC) and AABB in a simplified visual format that can be distributed to multiple
health care organizations.
Design/Methods
The creation of a simplified evidenced based poster was completed by transfusion
medicine expertise and distributed to all clinical areas. Some areas received
additional introduction to the concepts within the poster. A survey was conducted to
evaluate the effectiveness and relevance of the Transfuse Safely Poster. Medical,
Nursing and Laboratory staff were invited to participate in an online survey about
their knowledge of the poster, the guidelines outlined within, and the influence it has
had or may have on practice.
Results
100 people from 7 sites responded. Participation was correlated with the size of the
site and 80% were nurses. Anesthesiologist and Clinical Assistants made up 20%.
76% of respondents had never seen the poster. Of all the respondents, 45% felt that
it represented new information, while 24% did not know; the remaining felt that it
was old information. The most influential item was when not to transfuse and how
pre-existing conditions affect recommendations to transfuse. For those not having
seen the poster, 61% said that it would influence their practice by questioning orders
and seeking more information. 83% stated that they would like to see more
information presented this way.
Conclusions
Based on these results, we can conclude that simplified presentation of
recommendations in the form of a poster is appealing and facilitates awareness.
111
CSTM 2016 – Conference Abstracts
Distribution of posters to multiple sites is challenging and needs to be improved as
well as the acceptance of posters by stakeholders. It is speculated that the reason
for so many respondents having never seen the poster is that it was poorly
distributed at the site level. For future similar initiatives a more consistent and
inclusive distribution strategy needs to be devised. Overall, posters can favorably
enhance awareness in our region.
Acknowledgements
WRHA Blood Conservation Service Nurses, Surgery Program Leadership, Regional
and Provincial TPC’s.
112
CSTM 2016 – Conference Abstracts
Prophylactic antigen-matched donor blood for patients with
warm-reactive IgG autoantibodies: an evaluation of safety and
efficacy
Abstract Title
Prophylactic antigen-matched donor blood for patients with warm-reactive IgG
autoantibodies: an evaluation of safety and efficacy
Authors/Co-Authors & Affiliations
Hamish Nicolson, M.D., University of British Columbia Lawrence Sham, Vancouver Coastal
Health Kristine Roland, M.D., FRCPC, Vancouver Coastal Health
Abstract Body
Introduction / Objective: Warm-reactive IgG autoantibodies (WAA) are well-known
to complicate pretransfusion testing and the provision of compatible red blood cells
(RBCs) for transfusion. Various laboratory methods exist to investigate for
underlying alloantibodies; in addition some authors recommend extended
phenotyping of recipients with provision of prophylactic phenotype-matched
blood. When a new diagnosis of warm autoantibody is made at our institution, the
policy is to provide Rhesus(Rh)/Kell matched RBCs, and to re-investigate for new
alloantibodies on a monthly basis. We set out to review 7 years of this practice to
evaluate safety and efficacy.Design and Methods: This was a retrospective review
of all patients with a WAA detected by our transfusion medicine service from
January 1, 2008 to present. The electronic patient record was used to identify
all patients with a WAA designation and their corresponding diagnoses, laboratory
parameters, RBC transfusions, alloantibodies and timing of alloantibody
formation.Results:A total of 480 patients were designated as having WAA during
the study period. Thirty-six patients developed new alloantibodies after the
designation of WAA was made. Despite our policy of issuing Rh and Kell-matched
RBCs, 24 of the 43 new alloantibodies that formed were Rh or Kell. Of these 36
patients, 6 had a known history of autoimmune hemolytic anemia and 3 of the 6 had
laboratory evidence of hemolysis. Conclusions::A policy of providing
prophylactically matched RBCs to patients with active WAA does not completely
prevent the formation of new alloantibodies. Despite the formation of these
new alloantibodies, the incidence of hemolysis in the setting of WAA is low.
113
CSTM 2016 – Conference Abstracts
Prothrombin Complex Concentrates (PCCs) – Dosing
Implications
Abstract Title
Prothrombin Complex Concentrates (PCCs) – Dosing Implications
Authors/Co-Authors & Affiliations
Zerrish Malik - University of Alberta Heather Blain - Alberta Health Services Hanan Gerges Alberta Health Services and University of Alberta Susan Nahirniak - Alberta Health Services
and University of Alberta
Abstract Body
Introduction: Initial NAC recommendations on PCCs in 2008 advocated for a
standard dose of 40 mL or 1000 IU independent of the international normalized ratio
(INR) and weight. Following administration of this standard dose, INR was evaluated
and a second dose warranted if a target of 1.5 was not met. A subsequent revisions
of NAC recommendations in 2011 changed the recommendation to INR based
dosing but then in 2014 it was revised again to allow jurisdictions to choose their
own dosing policies. Our jurisdiction maintained the 2011 recommendations. This
retrospective quality assurance project compared the 2008 and 2011 NAC
recommendations on the use of PCCs to determine the impact of dosing on INR
correction and adverse outcomes.Method. An extract from the transfusion service's
PCC Access Database and Lab Information System (LIS) containing the PCC
volume administered, pre and post INR, other blood product requirements, and
incidence of 30 day mortality or thromboembolic outcomes from October 2008 to
November 2015 was entered into Microsoft® Excel for data and statistical
analysis.Results: There were 588 PCC episodes in the October 2008 to November
2011 standard dose group and 1599 in the INR based group. There were no
significant differences between the sex, mean age or mean weight in the two
groups. In the standard dose group, 26 of the 588 ( 4.4%) received multiple doses of
PCC compared to 63 out of 1599 (3.9%) in the INR group. One limiting factor is that
not all patients had post INR values available.
Standard 40 mL
dose
(n=588)
INR based
(n=1599
)
Two-tailed Ttest
P-value
Mean Total Dose 40 (range20-80)
60 (range20-200)
<0.0001
Pre-INR
3.8 (1.2-10.0)
3.4(0.9-10.0)
<0.0001
Post-INR
1.6 (0.8-5.5)
1.4 (0.7-4.9)
<0.0001
(n=567)
Post-Patients
316 (56%)
Reaching Target
Adverse events
22 (3.7%)
(n=1458)
1090 (75%)
53 (3.3%)
<0.0001
0.64
Conclusion: Since there is no signficant increase in adverse events, the decision to
continue with the INR based protocol in 2014 is supported by the significant
114
CSTM 2016 – Conference Abstracts
difference in the proportion acheiving their target INR.
115
CSTM 2016 – Conference Abstracts
Prothrombin is the key component in a reconstructed
prothrombin complex concentrate effective in reducing bleeding
in coagulopathic mice
Abstract Title
Prothrombin is the key component in a reconstructed prothrombin complex concentrate
effective in reducing bleeding in coagulopathic mice
Authors/Co-Authors & Affiliations
William P. Sheffield, Ph.D., (1) Centre for Innovation, Canadian Blood Services, Hamilton,
ON, Canada. (2) Department of Pathology and Molecular Medicine, McMaster University,
Hamilton,ON, Canada. Louise J. Eltringham-Smith, B.Sc., (1) Department of Pathology and
Molecular Medicine, McMaster University, Hamilton,ON, Canada. Syed M. Qadri, MD., Ph.D.,
(1) Centre for Innovation, Canadian Blood Services, Hamilton, ON, Canada. (2) Department
of Pathology and Molecular Medicine, McMaster University, Hamilton, ON, Canada. Yiming
Wang, Ph.D., (1) Centre for Innovation, Canadian Blood Services, Toronto, ON, Canada. (2)
Department of Laboratory Medicine, University of Toronto and Keenan Research Centre for
Biomedical Science of St. Michael's Hospital, Toronto, Canada Varsha Bhakta, B.Sc., (1)
Centre for Innovation, Canadian Blood Services, Hamilton, ON, Canada. Edward L.G.
Pryzdial, Ph.D., (1) Centre for Innovation, Canadian Blood Services, Vancouver, BC,
Canada. (2) Centre for Blood Research, University of British Columbia, Vancouver, BC,
Canada. (3) Department of Pathology and Laboratory Medicine, University of British
Columbia, Vancouver, BC, Canada. Heyu Ni, MD, PhD., (1) Centre for Innovation, Canadian
Blood Services, Toronto, ON, Canada. (2) Department of Laboratory Medicine, University of
Toronto and Keenan Research Centre for Biomedical Science of St. Michael's Hospital,
Toronto, Canada
Abstract Body
Introduction: Prothrombin complex concentrates (PCC) are plasma fractionation
products enriched in vitamin K-dependent proteins, including coagulation factors FII
(prothrombin), FVII, FIX, and FX. PCC are currently employed for rapid reversal of
warfarin anticoagulation. Here, we compared commercial PCC or modified PCC
(mPCC, mixtures of purified FII, FVII, FIX, and FX), to murine normal pooled plasma
(mNPP) as bleeding treatments in the Blood Exchange-induced Coagulopathy
Approach (BECA) mouse model. BECA mice undergo four sequential exchanges of
whole blood for washed erythrocytes to create pan-coagulation factor
deficiency. Design and Methods: BECA mice (n=15) received vehicle or 12 ml/kg
treatment solution immediately prior to one of three challenges: tail vein transection;
intravascular laser injury; or liver transection. Blood loss, thrombus size, and clot
weight were determined in each setting. Diluted human normal pooled plasma
(hNPP) was combined with the treatment solutions to mimic the plasma of treated
mice, and prothrombin times (PT) were determined. Results: Both PCC (14.3 IU/kg)
and four factor mPCC (4F-mPCC-3X, 3X average plasma concentration of factors)
reduced tail blood loss indistinguishably compared to mNPP, by 4- to 6-fold versus
vehicle. Three factor mPCCs (3F-mPCC-3X) were as effective as 4F-mPCC-3X,
unless FII was omitted; mice treated with the latter fluid lost 150 ± 60 µl of blood
versus 50 ± 30 µl (p<0.01) for those treated with 4F-mPCC-3X. Mice with laserinjured arterioles formed thrombi larger than vehicle-treated animals, following
116
CSTM 2016 – Conference Abstracts
treatment with PCC or 4F-mPCC or 3F-mPCC (No FII). 14.3 IU/kg PCC significantly
reduced shed blood clot weights from transected mouse livers by 2.25-fold versus
vehicle. PTs of 20% hNPP were reduced equivalently by PCC or 4F-mPCC
supplementation, but not by 3F-mPCC (No FII). Conclusions: Combined factors FII,
FVII, FIX, and FX recreate the anti-hemorrhagic effects of PCC observed in BECA
mice. Prothrombin is the limiting component of PCC in several settings. These
findings may be generalizable given the mirroring of the murine data with diluted
human plasma in vitro. Acknowledgements: Funding for the study was provided by
Canadian Blood Services (CBS) and Health Canada (grant to HN, ELGP, and
WPS). SMQ was supported by a CBS postdoctoral fellowship award.
117
CSTM 2016 – Conference Abstracts
Quality Improvement Through Reporting and Collaboration
Abstract Title
Quality Improvement Through Reporting and Collaboration
Authors/Co-Authors & Affiliations
Barclay, C., ART, Calgary Laboratory Services Malcolm, H., BSc MLS, Calgary Laboratory
Services Van Oyen, E., ART, Calgary Laboratory Services
Abstract Body
Introduction/Objective
Rejected specimens are the most frequently reported non-conformance event for
Transfusion Medicine. The objective of this improvement project was to decrease
the number of pretransfusion testing specimens received in the TM laboratory that
do not meet acceptance criteria.
Rejected specimens are reported through the Alberta Health Services on-line
Reporting and Learning System (RLS). Both the laboratory and patient care units
(PCUs) have access to the reports and cumulative data.
The Regional Transfusion Service Identification System (RTSIS) is a form with a
unique alpha-numeric number that is used in conjunction with on-line orders. It
provides a link between the patient, their specimen, and donor units crossmatched
for them. The unique number is attached to the patient using a banding system at
the time of collection.
Design and Methods
Since the RLS reports are reviewed by PCUs, the Emergency Departments (ED)
were aware of the frequency of these events. The ED at one of the sites
approached TM with ideas for redesign of the RTSIS form. Using their suggestions,
the form was revised. Along with educational sessions, the revised form was trialed
in the ED for three months. Although there was no significant reduction in the
number of specimens being rejected, a survey of both ED and TM staff indicated
that the revised form was preferred. Also, RLS data revealed that the reason for
rejections had shifted. Further revision to form was done to address the shift, and
the revised form was printed and distributed more broadly in June of 2015.
Results
Although the revised form has only been in place for 7 months, the number of
rejected specimens has been reduced by about 30% between 2014 and 2015.
Conclusions
The success of the project indicates that:

Reporting non-conforming events can be effective in stimulating
improvement initiatives.
118
CSTM 2016 – Conference Abstracts

Collaboration between the laboratory and its stakeholders was effective in
addressing the problem.
 Further work is still needed if further improvements are to be realized.
Acknowledgements

Dawn McKevitt, Trauma Coordinator, Alberta Health Services

Amanda Raven, Human Factors Safety Specialist, Alberta Health Services

Devika Kashyap, QI Consultant, Alberta Health Services
119
CSTM 2016 – Conference Abstracts
Real Time Inventory Reporting to Support British Columbia
Blood Contingency Preparedness
Abstract Title
Real Time Inventory Reporting to Support British Columbia Blood Contingency Preparedness
Authors/Co-Authors & Affiliations
Douglas M Morrison, MD. FRCPC, Fraser Health Authority and BC Provincial Blood
Coordinating Office Cecilia Li, RN, BSN, EMBA(Health Care), BC Provincial Blood
Coordinating Office Jack Michaan, BSc Engineering, BC Provincial Blood Coordinating Office
Chris Biantoro, Ph.D., BC Provincial Blood Coordinating Office Sandy Pan, MMOR, BC
Provincial Blood Coordinating Office Ronnie Tang, BC Provincial Blood Coordinating Office
Abstract Body
Background:BC Transfusion Medicine Advisory Group, Health Authorities,
Canadian Blood Services (CBS) and the BC Provincial Blood Coordinating Office
(PBCO) developed the Transparent Blood Inventory System (TBI) to support
contingency preparedness for the 2010 Winter Olympics. TBI allows stakeholders to
access the inventory information for red blood cells and platelets of 20 high user
hospitals using a weekly snapshot reporting tool. Limitations include the timeliness
of the inventory data and the absence of data from other hospitals. Ministry of Health
commissioned PBCO to conduct a feasibility study of real time inventory reporting
system to support BC Blood Contingency Preparedness.Design and
Methods:PBCO has collaborated with Fraser Health and Northern Health in
assessing the feasibility of real time inventory system. Every two hours the health
authorities electronically extract their hospital inventory data from their Laboratory
Information System and automatically uploaded them to the system via various data
sharing platforms. Data is processed with underlying algorithms to provide latest
inventory information and historical trend. Health authorities can access inventory
data via a web-based platform and dashboard format for easy to understand visual
data representation. Results:Two dashboard prototypes were created to facilitate
contingency planning and daily operation. The contingency planning dashboard
includes provincial inventory information from CBS and health authorities. The
hospital information is updated every 2 hours and presented in graphical formats
displaying the latest product count, days to expiry and days on hand by product,
blood type, region and hospital, and a fully interactive map to identify the exact
hospital location with its inventory information. The detailed dashboard caters to
health authority’s daily operations and includes extra information on the historical
trend of red blood cells and platelets counts.ConclusionPBCO has demonstrated
the feasibility of developing a real time inventory reporting tool that reflects an
accurate picture of hospital inventory levels and days to expiry. The information is
useful for contingency planning and inventory
management.Acknowledgements:PBCO gratefully acknowledges the Ministry of
Health, Fraser Health, Northern Health, PHSA and HSSBC for their collaboration of
this project.
120
CSTM 2016 – Conference Abstracts
Red Blood Cell Microparticle Content with Dynamic Light
Scattering – A check for quality
Abstract Title
Red Blood Cell Microparticle Content with Dynamic Light Scattering – A check for quality
Authors/Co-Authors & Affiliations
Daniel Millar, BASc, LightIntegra Technology Inc. Elisabeth Maurer-Spurej, Ph.D., University
of British Columbia, Canadian Blood Services, LightIntegra Technology Inc.
Abstract Body
Introduction:
Quality control (QC) of Red Blood Cell concentrates (RCC) is currently performed on
expired product to avoid losing inventory. Hemolysis, determined by the levels of
free hemoglobin in a product, is a measure of product quality. Testing RCC
supernatants for Red Blood Cell (RBC) derived microparticles (MP) would provide
an additional RCC quality indicator. Monitoring MP can illuminate the impact of
processing and handling on product quality, as well as, identify misleading
hemolysis results derived from variable preparation techniques. This study
evaluated a dynamic light scattering microparticle assay, (ThromboLUX, LightIntegra
Technology Inc., Vancouver, Canada), for QC testing of RCC. Specifically, the
ThromboLUX output called MP Content, which is proportional to MP concentration,
was tested as an indicator of RCC quality.
Methods:
The supernatant of one RCC was tested on days 1, 5, 14, 21, and 43 for MP
Content and indicators of the level of residual RBC. Additionally, on days 14, 21, and
43 six 10 mL aliquots from the unit were tested. The following metrics were
analysed: changes in MP Content over time, variation between samples, and
residual RBC levels.
Results:
MP Content increased with storage time indicating loss of RBC quality with storage.
For days 14, 21 and 43, these increases were consistent and statistically significant
(p<0.001). The residual RBC levels varied significantly in supernatant samples; this
variability did not affect the MP Content measurements which were consistent
across the 6 aliquots at each time point. The aliquots had slight, but statistically
higher MP Content than the original unit on day 21. By day 43 the difference
became much more distinct.
Conclusions:
MP Content shows promise as a measure of RCC quality based on its increase with
storage length and tolerance to residual RBC. MP Content should be compared to
different measures of hemolysis in future studies. Based on MP Content, small
aliquots appear to contain representative samples of the original unit with
121
CSTM 2016 – Conference Abstracts
comparable aging characteristics. It is expected that the impact of residual RBC
levels measured by ThromboLUX can explain differences in hemolysis measures of
total or free hemoglobin.
Acknowledgements:
Centre for Innovation, Canadian Blood Services
122
CSTM 2016 – Conference Abstracts
Red Cell Antigen Genotyping Compared To Serological
Phenotyping In Sickle Cell Disease Patients in Canada:
Potential For Reducing Alloimmunization
Abstract Title
Red Cell Antigen Genotyping Compared To Serological Phenotyping In Sickle Cell Disease
Patients in Canada: Potential For Reducing Alloimmunization
Authors/Co-Authors & Affiliations
Khalid Al-Habsi, Andrew Wei-Yeh Shih, Rebecca Barty, Grace Wang, Allahna Elahie, Mona
Azzam, Reda Siddiqui, Michael Parvizian, Nancy M. Heddle, Uma Athale, Mindy Goldman,
Madeleine Verhovsek
Abstract Body
Introduction
Red blood cell (RBC) transfusions are part of the management in many patients
with sickle cell disease (SCD). However, RBC transfusion can be complicated by
alloimmunization and hemolytic transfusion reactions (HTRs) in this population
despite providing extended phenotype-matched RBC transfusions, due to unique
variant RBC antigen mutations. We evaluated the level of discrepancy between
RBC antigen genotyping and traditional phenotyping methods and their impact on
the development of outcomes at our centre in Canada.
Methods
Commencing in January 2015, RBC antigen genotyping has been standard of care
for patients with SCD treated at our academic teaching hospital in Ontario, Canada.
RBC antigen phenotyping was performed locally using both tube and automated
solid phase assays. Patients are transfused blood that is phenotype-matched for Rh
and Kell, until an alloantibody is formed where additional matching for Kidd, Duffy,
Ss, and the antigen for which the alloantibody has specificity occurs. Patient blood
samples are sent to a reference laboratory to perform genotyping of Rh (excluding
RhD), Kell, Kidd, Duffy, and MNSs antigens. Clinical data, demographic, and
transfusion-related data were obtained from a local transfusion registry database
and thorough clinical chart reviews. Local research ethics board approval was
obtained.
Results
To date, RBC antigen genotyping has been performed on 69/90 SCD patients
treated at our centre. The mean age of these patients was 25 ± 20, 57% were
females, 65% were HbSS, and 29% were HbSC. Overall, 56/69 (81%) of patients had
variant mutations or a discrepancy between phenotyping and genotyping. The
GATA mutation was detected in 33 patients (48%). Rh variant mutations were
observed in 20 (29%) patients, all having the GATA mutation except one. The
largest discrepancy was seen in the Rh system, with the e antigen having a kappa of
0.19 and the c antigen having a kappa of 0.49.
Alloantibodies were found in 5/20 (25%) patients with variant mutations; and
123
CSTM 2016 – Conference Abstracts
10/49 (20%) patients with a GATA mutation or no variant mutations. If a genotypematched (or extended-phenotype matched) strategy was utilized at our centre,
40% of patients with alloimmunization could have been potentially prevented.
HTRs occurred in 4 (27%) alloimmunized patients.
Conclusion
Our results showed a high frequency of variant mutations and significant
discrepancies between genotyping and phenotyping methods, most notably in the
Rh antigen system. Genotyping SCD patients before transfusion may prevent
alloimmunization and HTRs and knowledge of the GATA mutation will allow blood
banks to increase the feasibility of finding compatible blood.
124
CSTM 2016 – Conference Abstracts
Red cell alloimmunization rates in allogeneic hematopoietic
stem cell transplant recipients
Abstract Title
Red cell alloimmunization rates in allogeneic hematopoietic stem cell transplant recipients
Authors/Co-Authors & Affiliations
Oksana Prokopchuk-Gauk, MD, University of Alberta
Nicole Prokopishyn, PhD, Calgary Laboratory Services
Joanna McCarthy, MLT, Calgary Laboratory Services
Meer-Taher Shabani-Rad, MD, Calgary Laboratory Services and University of Calgary
Abstract Body
Background: Donor selection for allogeneic hematopoietic stem cell transplant
(allo-HSCT) is dependent on matching with the intended recipient HLA allele profile,
but not blood group compatibility. Red blood cell (RBC) phenotype matching is not
considered, even if recipient alloantibodies are present pre-HSCT. Historically, up to
3.7% of allo-HSCT recipients have been found to develop new RBC alloantibodies
following allo-HSCT.
Objective: We sought to define the rate of red cell alloimmunization in allogeneic
HSCT recipients at our center, and evaluate the impact of this RBC alloantibody
presence on donor marrow engraftment.
Methods: A retrospective review including all allogeneic HSCT recipients between
January 1, 2008-January 1, 2015 was performed. Data was obtained from review of
cellular therapy laboratory electronic records, with red cell alloantibody information
extracted manually from the transfusion medicine laboratory information system.
Results: A total of 606 patients underwent 626 allo-HSCT procedures (536
peripheral blood, 38 marrow, 52 cord blood). The mean HSCT recipient age was 46
(range 0-66) and most common HSCT indication was acute myeloid leukemia.
Nearly all allo-HSCT recipients were given myeloablative conditioning with 77% of
recipients receiving fully HLA matched grafts. Rh mismatches were found in 150
(24%) of donor-recipient pairs. A total of 43 recipients (7.1%), including 3 pediatric
and 40 adult patients, were identified to have RBC alloantibodies pre-HSCT, the
most common of which was anti-E. Antibody screen results available at or following
HSCT for 40 of these demonstrated that alloantibodies disappeared in 24 (60%) and
were persistently detectable in 13 (33%). New post-HSCT RBC alloantibodies
developed in only 3 adult recipients, with an overall rate of 0.5%. One Rh positive
recipient of an Rh negative graft formed an anti-D. Thus, the calculated overall rate
of anti-D development in Rh mismatched HSCT recipients was 0.7%. There was no
observed impact on neutrophil and platelet engraftment comparing adult allo-HSCT
recipients who did and did not have pre-HSCT RBC alloantibodies.
Conclusion: The risk of post-HSCT RBC alloantibody development is very low,
even in Rh mismatched donor-recipient pairs. Pre-existing alloantibodies may
disappear after myeloablative conditioning. The presence of RBC alloantibodies preHSCT does not appear to impact donor marrow engraftment.
125
CSTM 2016 – Conference Abstracts
Reducing Transfusion In Cardiac Surgery Using Red Blood
Cell Utilization As A Quality Indicator
Abstract Title
Reducing Transfusion In Cardiac Surgery Using Red Blood Cell Utilization As A Quality
Indicator
Authors/Co-Authors & Affiliations
Doug Morrison, FRCPC, British Columbia Provincial Blood Coordinating Office Susanna
Darnel, ART, British Columbia Provincial Blood Coordinating Office Jennifer Danielson, BSC,
MLT, British Columbia Provincial Blood Coordinating Office Chris Biantro, PhD, British
Columbia Provincial Blood Coordinating Office Cecilia Li, EMBA, British Columbia Provincial
Blood Coordinating Office
Abstract Body
Introduction The British Columbia (BC) Provincial Blood Coordinating Office
(PBCO) is a program which assists the BC Ministry of Health with leadership and
coordination of blood-related issues and activities. The BC PBCO operates the
Central Transfusion Registry (CTR). This database contains records of blood, and
blood product recipients in the province of BC and Yukon Territory. BC on average
transfuses 135 000 units of red blood cells (RBC) per year. The PBCO and its
provincial stakeholders use the information from the CTR to support transfusion
medicine quality and safety initiatives. Cardiac physicians had expressed a strong
interest in evaluating the transfusion of RBC’s in their patients, as literature has
shown that blood transfusion rate post cardiac procedures is a useful indicator to
assess quality of care. Cardiac Services British Columbia (CSBC) collects cardiac
services data via its Heart Information System (HEARTis). MethodCSBC and the
PBCO linked the two data registries to obtain the baseline picture of the RBC
cardiac surgical transfusion rate in BC. Data was presented at the annual CSBC
meeting which included representation from transfusion medicine and cardiac
physicians from across the province. ResultsThe data presented at the 2009 CSBC
meeting showed that approximately 6% of red blood cells used in BC were for
cardiac surgery. A reduction in RBC transfusion was noted following the
presentation. From 2009 to 2014, there has been a visible reduction in variation of
cardiac surgeons’ usage of RBC’s as well a reduction in median RBC utilization
rate. ConclusionsA behavioral and cultural change relating to RBC utilization within
cardiac surgery was evident when surgeons were empowered with information
about their transfusion practices. Linking transfusion registries and providing timely
data on transfusion rate resulted in lower transfusion rates year after year. Linking
and analyzing information from established registries has the potential to provide
new insights for planning, optimization of service delivery models, developing
guidelines for treatment and improving patient
outcomes. AcknowledgementsCardiac Services BC; Cardiac Programs at Fraser
Health, Interior Health, Island Health, Providence Health Care ,Vancouver Coastal
Health; and the BC Transfusion Medicine Advisory Group.
126
CSTM 2016 – Conference Abstracts
127
CSTM 2016 – Conference Abstracts
Resolution of Questionable ABO Blood Grouping in the Setting
of Solid Organ Transplantation
Abstract Title
Resolution of Questionable ABO Blood Grouping in the Setting of Solid Organ
Transplantation
Authors/Co-Authors & Affiliations
Hanan Gerges, MD, University of Alberta
Abstract Body
A 52 year-old male admitted to our hospital for a penetrating chest trauma. As per
our policy, a massive hemorrhage protocol (MHP) was activated to expedite
laboratory results and providing blood products. On arrival, no identity or age
known, 2 units of unmatched group O, Rh positive red cells were issued while
preparing an unmatched MHP pack (usually contains 6 units of group O, Rh positive
red cells, 2 units of AB plasma +/- one unit of platelets). No specimen submitted for
type & screen as the patient was bleeding profusely. Despite multiple requests, we
continued to provide blood products, a sample was provided only after transfusing
24 packed red cells, 2 units of plasma and 1 unit of pooled platelets. Both forward
and reverse grouping showed mixed field reactions and interpreted as questionable
ABO. Rh typing was positive. The patient continued to be supported during surgery
with group O red cells and AB plasma. Unfortunately, he was declared braindead. Family agreed to donate his organs, necessitating accurate determination of
blood group. An attempt was performed using a marrow specimen (based on a local
project showing >95% concordance). The reverse typing suggested group A but
forward typing was negative, likely due to scarcity of erythroid precursors. A salivary
specimen was obtained hoping he would be secretor. Luckily, he was secretor and
group A was confirmed. Subsequently, liver and the kidneys were used for
transplantation but heart and lungs were damaged and unsalvageable.
Conclusion:
Massive transfusions are frequently encountered in trauma patients. It is important
to collaborate with the transfusion medicine physicians with early, clear
communication. Uncontrollable bleeding patients can cause chaos, no question that
the clinical team focus on urgent blood products. However, it’s important to send a
specimen to blood bank to help providing group specific products and better manage
their inventory. Although venous specimens are preferred, in setting of an MHP with
compromised venous access, alternate specimens for ABO determination can also
include shed blood or intraosseous specimens with proper labelling to reflect the
specimen type.
128
CSTM 2016 – Conference Abstracts
Review of the Prenatal Anti-M Testing Algorithm Results and
Associated Neonatal Outcomes
Abstract Title
Review of the Prenatal Anti-M Testing Algorithm Results and Associated Neonatal Outcomes
Authors/Co-Authors & Affiliations
Chantale Pambrun, MD., Dalhousie University, IWK Health Centre Catherine McAuley, MLT,
IWK Health Centre
Abstract Body
Objective: Review the data results from a new prenatal
anti-M testing algorithm which included dithiothreitol (DTT)
treatments, as well as review of the neonatal
outcomes.Methods:Retrospective data collection from the
laboratory information system at the IWK Health Centre over
the past 2 years.Results:Between January 2014 and
January 2016, anti-M was detected in 45 pregnancies,
representing a prevalence of 0.25%(45/14,711). Sixteen
(36%) were found to have IAT reaction strength great than
or equal to 2+ and were therefore eligible to be treated with
DTT. DTT testing revealed 8-IgM subtypes, 3-IgG subtypes
and 5 inconclusive results. Cord testing results were only
available in 25 (56%) newborns. Nine cords were M antigen
positive and 3 were found to have positive cord DATs
secondary to the maternal anti-M; these were the same
patients in which DTT testing detected the IgG
subtype. One of those cases had mild hemolytic disease of
the newborn. Neonatal anemia or reticulocytopenia were not
found.Conclusion: As a gel testing site, our solution to
identifying the clinically significant anti-M alloantibodies in
pregnancy was to introduce DTT treatments and specific
cord testing in 2014. Inconclusive DTT results in 5 patients
was due to the loss of reactivity post-DTT treatment, likely
related to the dilution of the antibody. Lack of cord testing
results in 20 newborns is related to the deliveries occurring
outside of the IWK Health Centre.The new algorithm
brought awareness to the clinical team about the potential
129
CSTM 2016 – Conference Abstracts
impact of anti-M in pregnancy. Over the last two years, we
have not had any reports of serious hemolytic disease of the
fetus and newborn, nor have we seen severe neonatal
anemia with reticulocytopenia secondary to anti-M inhibition
of the erythroid precursors.
130
CSTM 2016 – Conference Abstracts
SCIG vs. IVIG for recurrent infection in patients with secondary
immunodeficiency due to chronic lymphocytic leukemia.
Abstract Title
SCIG vs. IVIG for recurrent infection in patients with secondary immunodeficiency due to
chronic lymphocytic leukemia.
Authors/Co-Authors & Affiliations
Peter Ip Fung Chun M.D., University of Toronto Lani Lieberman M.D., University of Toronto
Jason K. Lee M.D.
Abstract Body
Introduction:Secondary immunodeficiency is an acquired condition occurring in
patients following treatment of hematologic malignancies, such as primarily chronic
lymphocytic leukemia (CLL). These patients are at increased risk of infection
secondary to hypogammaglobinemia. In North America, these patients are treated
with IVIG, while in Europe subcutaneous administration of immunoglobulin (SCIG) is
an extensively utilized treatment modality. Studies comparing the efficacy between
SCIG and IVIG for patients with secondary immunodeficiency has not been
performed. The objective of this study was to compare the rates of infection for
secondary immunodeficiency patients receiving SCIG and IVIG.Methods:A
retrospective study assessing patients with CLL with secondary immunodeficiency
was performed at a tertiary care hospital. CLL patients who had at least one year of
continuous IVIG and SCIG from 2007-2014 were identified from a database of
patients. Clinic notes for a one-year period while the patient was on immunoglobulin
treatment were reviewed. Data collected included demographic information including
age, and gender, as well as chemotherapy treatment received during treatment, and
number of infections requiring antibiotics. Pre-immunoglobulin treatment IgG levels
and treatment IgG levels were obtained when availableResults:Over the one-year
period, seven patients with CLL were receiving SCIG and were compared to seven
CLL patients receiving IVIG. Groups were similar with respect to chemotherapy
while on immunoglobulin treatment. Mean immunoglobulin trough levels while on
treatment were 7.94 g/L for SCIG and 8.11 g/L for IVIG which were not significantly
different with p> 0.05. Pre-treatment IgG trough levels between groups were also
not significant, mean SCIG level was 3.32 g/L and IVIG 2.65 g/L. As anticipated
pre-treatment and treatment IgG levels within groups were significant p <0.05. Mean
number of infections in the SCIG group was 1.71 and IVIG group was 1. Infection
rates were compared using t-test method and were found to be non-significant
(P>0.05).Conclusion:This small pilot study demonstrated similar rates of infection for
CLL patients receiving IVIG and SCIG. SCIG may be an attractive alternative to
IVIG with respect to economic health utilization cost and patient preferred. Further
prospective studies to demonstrate the benefits of this route of administration would
be welcome.
131
CSTM 2016 – Conference Abstracts
Screening for HDFN: to titrate or not, that is the question
Abstract Title
Screening for HDFN: to titrate or not, that is the question
Authors/Co-Authors & Affiliations
Melanie Tokessy, MLT, Eastern Ontario Regional Laboratory Association, The Ottawa
Hospital Alyaa Saeed Alrefai, MBBS, SB-OG, The Ottawa Hospital Doris Neurath,
BScPharm, ART, MBA, Eastern Ontario Regional Laboratory Association, The Ottawa
Hospital Heather Maddison, MLT, Eastern Ontario Regional Laboratory Association, The
Ottawa Hospital Phillip Berardi, MD, PhD, FRCPC, Eastern Ontario Regional Laboratory
Association, The Ottawa Hospital Karen Fung-Kee-Fung, MD FRCS, MHPE, The Ottawa
Hospital
Abstract Body
Objective: Serial antibody titration until delivery is a common laboratory practice in
alloimmunized prenatal patients at risk of HDFN. A critical antibody titer (excluding
anti-Kell), has been cited to be either >/= 16 to 32 or a two-fold increase from
baseline. Historically, the titer endpoint has determined when invasive monitoring
was required. With the introduction of non-invasive Middle Cerebral Artery (MCA)
Doppler ultrasound for detection of fetal anemia, we sought to redefine a critical titer
threshold above which serial antibody titration was no longer useful and at which we
could safely convert HDFN screening from the bench to the
bedside. Methods: Prenatal titers on antibodies from alloimmunized women
presenting in 2014-2015 to our regional tertiary care prenatal unit were
retrospectively examined. Results were correlated with the MCA Doppler findings
performed within 2 days of serological testing and fetal/neonatal outcomes by
electronic medical record review. Pregnancies delivering above 20 weeks gestation
were included. Two groups were compared: 1. Fetuses requiring antenatal/neonatal
intervention (n=5); 2. Unaffected infants not requiring treatment (n=51). Exclusions:
patients with history of HDFN in previous pregnancies and patients repatriated for
delivery in community hospitals due to low titers and/or negative paternal antigen
status. Results: Seventy-four red cell antibodies were detected in 56 prenatal
patients. Anti-D (22) and anti-E (19) were the most frequent antibodies identified. Of
55 live births, 4 infants who underwent intrauterine transfusion were admitted to
NICU for hyperbilirubinemia; all had titers of >32 at the time fetal anemia was
suspected on MCA Doppler. Despite titers as high as 256, unaffected
infants exhibited normal MCA Doppler. Conclusions: MCA Doppler correctly
identified significant fetal anemia requiring fetal/neonatal therapy when the titer was
>/= 16. Serological determination of antibody titers is of limited usefulness in
screening for HDFN once a critical titer of 32 has been reached and should be
supplanted by MCA Doppler. Conversion of laboratory antibody titration for HDFN to
clinical screening with MCA Doppler ultrasound will improve efficiency in the
detection of affected fetuses while ensuring prudent use of laboratory resources.
132
CSTM 2016 – Conference Abstracts
Selection and characterization of a DNA aptamer inhibiting
coagulation factor XIa
Abstract Title
Selection and characterization of a DNA aptamer inhibiting coagulation factor XIa
Authors/Co-Authors & Affiliations
David A. Donkor, Ph.D., (1) Centre for Innovation, Canadian Blood Services, Hamilton, ON,
Canada. (2) Department of Pathology and Molecular Medicine, Hamilton, McMaster
University, ON, Canada. Varsha Bhakta, B.Sc., (1) Centre for Innovation, Canadian Blood
Services, Hamilton, ON, Canada. William P. Sheffield, Ph.D., (1) Centre for Innovation,
Canadian Blood Services, Hamilton, ON, Canada. (2) Department of Pathology and
Molecular Medicine, Hamilton, McMaster University, ON, Canada.
Abstract Body
Introduction: Coagulation factor XI (FXI) is activated either by FXIIa of the contact
pathway, or by thrombin; FXIa then activates FIX. Both humans and mice deficient
in FXI appear to be protected from thrombosis, with only a mild to moderate
bleeding tendency. FXI is therefore an attractive target for antithrombotic agent
development. DNA aptamer libraries are large arrays of DNA molecules which inhibit
targets by virtue of their unique shapes. Using a combinatorial DNA library and in
vitro selection, we sought to isolate an aptamer binding specifically to the active site
of FXIa. Design and Methods: A 78 nucleotide aptamer library was constructed,
comprised of single stranded DNA with a central hypervariable region: 5’GAATTCTAATACGACTCACTATA(N40)GCGTCCAACACATCG-3’.The library was
screened using positive selection with FXIa and negative selection with active siteblocked FXIa. One positive and one negative selection were performed per round,
and ten rounds in total. Selected sequences were regenerated by PCR and
rendered single-stranded using asymmetric PCR after each round. The selected
DNA populations were deep sequenced at the Farncombe Metagenomics Facility
(McMaster). Specific aptamers were tested for inhibition of FXIa activity using
chromogenic substrate S2366 or activation of macromolecular substrate
FIX. Results: Of 1.2 X 1024 theoretical candidates, 289 different aptamers were
detected after round 4 by deep sequencing, and 89 after round 10. Round 10
candidates were individually synthesized, in order of abundance, in groups of 5. The
eighth candidate, FELIAP-8, but none of the other nine candidates, inhibited FXIa
amidolytic activity, at µM concentrations. Similarly, FELIAP-8 reduced peak thrombin
in thrombin generation assays initiated with APTT reagent. Candidates with high
sequence homology to FELIAP-8 among the remaining 79 selected aptamers were
synthesized but did not exhibit higher inhibitory potency in all cases. Conclusions:
FELIAP-8 is a “lead compound” DNA aptamer that inhibits both FXIa-catalyzed
amidolytic and procoagulant activities, suggesting that it likely binds the active site of
the enzyme. Future work will focus on shortening the aptamer to facilitate in vivo
testing. Acknowledgements: Funding was provided by the Heart and Stroke
Foundation of Canada (to WPS). DD was supported by a postdoctoral fellowship
award from Canadian Blood Services.
133
CSTM 2016 – Conference Abstracts
Simulation for Process Improvement in Testing Laboratories
Abstract Title
Simulation for Process Improvement in Testing Laboratories
Authors/Co-Authors & Affiliations
Tanya McKelvey, BSc MLT, Canadian Blood Services Gwen Clarke, MD. FRCPC, Canadian
Blood Services and University of Alberta Judith Hannon, MD. FRCPC, Canadian Blood
Services and University of Alberta Leanne To, BSc MLT, Canadian Blood Services
Abstract Body
Background: With simulation emerging as a valuable training modality in clinical
healthcare settings, applicability to laboratory environments and benefit to process
improvement are being examined closely. Current financial restraints and
increasing workloads necessitate efficient procedures that maintain high standards
of patient care. To promote staff engagement in process improvement, Canadian
Blood Services Diagnostic Services frontline staff participated in simulations to help
isolate process issues and identify focused solutions related to a specific
process.Process: Two rounds of simulations were performed by frontline staff over
a two month period. The operating procedure (COP) was evaluated during and
following these simulations to identify process gaps and highlight changes required
for efficient and accurate performance. Analyzing observed issues identified three
major changes to be made to the process. These included: 1) filling procedural
gaps and adjusting format in the COP; 2) addressing knowledge gaps through staff
training; and 3) adjusting test requirements. COP length will be significantly reduced
producing a more concise document that mitigates procedural
misinterpretation. Expected reduction in time from request to results will ease
workload stress, save dollars in technologist time, and improve patient
care. Training sessions will be held to reinforce knowledge gaps identified through
simulation. Policy will change from testing all received specimens, to testing only
those specimens that meet required indications. Post-implementation simulations
will be held to quantify the time and dollar value savings associated with simulation
led improvements, and will offer continued process improvement. Simulations will
be expanded to include additional procedures.Conclusion: Staff participation in lab
simulations is an important means to identify process improvement opportunities,
which translate to cost savings, increased efficiencies, and improved patient
care. Use of simulations, throughout testing laboratories offers a unique process
improvement opportunity which can be measured by repeated assessments
throughout the process change initiatives.
134
CSTM 2016 – Conference Abstracts
Solvent-Detergent Plasma for the Treatment of Thrombotic
Microangiopathies: A Canadian Tertiary Care Centre
Experience
Abstract Title
Solvent-Detergent Plasma for the Treatment of Thrombotic Microangiopathies: A Canadian
Tertiary Care Centre Experience
Authors/Co-Authors & Affiliations
Lauren Lee, MD, Division of Hematology, University of British Columbia, Vancouver BC
Kristine Roland, MD, Department of Pathology and Laboratory Medicine, Vancouver General
Hospital, Vancouver BC Gayatri Sreenivasan, MD, Division of Hematology, Department of
Medicine, Vancouver General Hospital, Vancouver BC Leslie Zypchen, MD, Division of
Hematology, Department of Medicine, Vancouver General Hospital, Vancouver BC Kimberley
Ambler, MD, Division of Hematology, Department of Medicine, Vancouver General Hospital,
Vancouver BC Paul Yenson, MD, Division of Hematology, Department of Medicine,
Vancouver General Hospital, Vancouver BC
Abstract Body
Introduction/Objective: Solvent detergent-treated plasma (SDP) is a pathogeninactivated plasma, which in comparison to frozen plasma, is associated with lower
rates of allergic reaction, TRALI, and potentially viral transmission but possibly
higher risk of thrombosis. SDP has been available in Canada since 2012 for use in
thrombotic thrombocytopenic purpura (TTP), atypical hemolytic uremic syndrome
(aHUS) and rare inherited bleeding disorders (RIBD). However, experience with
SDP in North America and evidence of efficacy and safety is limited. The study
objective was to review the indications, efficacy, and safety of SDP at Vancouver
General Hospital (VGH), the major thrombotic microangiopathy (TMA) referral centre
for the province of British Columbia.
Design and Methods: Subjects who received SDP during plasma exchange (PLEX)
from April 1, 2012 to September 30, 2015 at VGH were retrospectively reviewed.
SDP treatment details, response, adverse events, and mortality were reported.
Results: Eighteen subjects received 4462 units of SDP. Treatment indications
included: TTP (n=5), aHUS (n=8), secondary TMA (n=2), antibody-mediated lung
transplant rejection (n=1), C3 glomerulonephritis (n=2). The primary reason for
switching to SDP was allergic reaction (n=16). Of the 17 subjects evaluable for
response, 16 improved or had stable disease. One aHUS patient developed
worsening thrombocytopenia without any other identifiable cause with SDP
replacement, thus prompting a switch back to cryosupernatant plasma. There was
one mortality in a subject with malignancy-associated TMA who developed
progressive disease. Adverse events included urticaria (n=4), localized pruritus
(n=1) and a seizure (n=1), the latter deemed unrelated to SDP. One subject had a
distal lower extremity DVT 4 days after completion of PLEX with SDP for C3
glomerulonephritis with no other provoking factors. One subject with aHUS and
known coronary artery disease had an NSTEMI after the first PLEX with SDP. Data
on transmissible viral infections was not available.
135
CSTM 2016 – Conference Abstracts
Conclusions: SDP was well tolerated in this cohort with a low rate of allergic
reaction and no episodes of TRALI. Two thrombotic events were noted, though the
relation to SDP is unclear. Efficacy was good with a notable exception in one subject
with aHUS, emphasizing the need for further efficacy data in this rare patient
group.
136
CSTM 2016 – Conference Abstracts
Spontaneous Intracranial Haemorrhage in Paediatric Oncology
Patients
Abstract Title
Spontaneous Intracranial Haemorrhage in Paediatric Oncology Patients
Authors/Co-Authors & Affiliations
Laura Betcherman*, MD(c), University of Toronto Jason D. Pole, Ph.D. Paediatric Oncology
Group of Ontario, Toronto Lise Estcourt, MD., University of Oxford Simon Stanworth, MD.,
University of Oxford Lillian Sung, MD., Ph.D., Hospital for Sick Children, Toronto Lani
Lieberman, MD., University Health Network, Hospital for Sick Children, Toronto
Abstract Body
Background: Intracranial haemorrhage (ICH) is a rare but serious complication in
paediatric oncology patients. ICH risk factors differ between the general population
and those with cancer. In adults, several factors have been shown to increase the
risk of ICH, including sepsis. Few studies have examined these risk factors in the
paediatric oncology population.
Objectives:
1. Assess risk factors for the development of ICH in this population
2. Assess morbidity and mortality 24 hours and 30 days following the event
Methods: A retrospective chart review of paediatric oncology patients treated
between 1995-2014 at a tertiary care center was performed. Patients were identified
from the Paediatric Oncology Group of Ontario database and the ICD-9 and ICD-10
codes for ICH. Cases of surgical or traumatic bleeding episodes were
excluded. Data regarding demographics, cancer diagnosis and treatment, risk
factors, clinical outcome post-ICH, laboratory data and infection criteria were
collected. An assessment of the systemic inflammatory response syndrome (SIRS)
and sepsis was based on a validated score specific to the paediatric population.
Results: 39 patients with 43 bleeding episodes were identified. The most common
diagnosis was acute leukemia (54%). 56% of bleeding episodes occurred in the
setting of SIRS, with 42% being blood culture positive. 68% were preceded by
suspected or proven infection. 77% required IV beta lactams and 33% were
administered IV antifungals. Of those with available platelet data, 5% had counts
below 10x109/L, 5% were between 10-20x109/L, and 26% were between 20-50
x109/L. At 48 hours post-ICH, outcomes included: blood product transfusion (70%),
ICU transfer (68%), surgical intervention (14%), and death (16%). At 30 days postICH, 26% remained in hospital (7% in ICU), 14% experienced neurological sequelae
and an additional 30% died.
Conclusions & Future Directions: This study examined risk factors for
development of ICH in paediatric oncology patients. Most bleeds were preceded by
a suspected or proven infection. Surprisingly, severe thrombocytopenia prior to the
event was uncommon. Mortality rates were lower than those reported in adults.
Logistic regression models will be used to assess risk factors for ICH by comparing
137
CSTM 2016 – Conference Abstracts
cases with their control admissions.
138
CSTM 2016 – Conference Abstracts
Standard Blood Transfusion Indices and the Efficiency of Blood
Utilization
Abstract Title
Standard Blood Transfusion Indices and the Efficiency of Blood Utilization
Authors/Co-Authors & Affiliations
Hessah Alsulami, MD, MSc, PhD
Abstract Body
Introduction:
A number of indices are used to determine the efficiency of blood ordering and
utilization system. Boral Henry was the first that suggested the use of crossmatch to
transfusion ratio (C/T ratio) in 1975. Ideally, this ratio should be 1.0, but a ratio of 2.5
and below was suggested to be indicative of efficient blood usage. The probability of
a transfusion for a given procedure is denoted by %T and was suggested by Mead
et al. in 1980. A value of 30% and above has been suggested as appropriate. The
average number of units used per patient crossmatch is indicated by the transfusion
index (TI) and signifies the appropriateness of number of units crossmatched. A
value of 0.5 or more is indicative of efficient blood usage. The aim of this study is to
assess the efficacy of blood transfusion indices and the efficiency of blood
utilization.
Methods:
In this cross-sectional study, 349 patients were studied over 9 months in 2015 for
whom blood supply was requested in different wards of IAFH. Patients’ demographic
data, hospitalization ward, blood group, hemoglobin, the number of requested and
crossmatched blood units, the number of transfused blood units were collected.
Standard indices of blood transfusion including C/T, TI and T% were calculated.
Result:
In this study, of 623 blood units requested, 48% of units were transfused. 61% of the
transfused patients have Hemoglobin (Hb) level over 10g/dl. Blood transfusion
indices C/T, T% and TI, were 2.02, 39.8% and 0.85, respectively, all within accepted
range. However, more than half of the transfused patients have Hb level over 10g/dl
and only two of those patients have cardiac or pulmonary disease.
Conclusion:
Given the obtained blood transfusion indices together with fact that 61% of the
transfused patients have Hb level above 10g/dl, means that normal transfusion
indices values do not indicate appropriate use of blood and other factors should be
looked at to assess the quality of blood utilization.
139
CSTM 2016 – Conference Abstracts
STAT and ASAP Delivery Study in Canadian Blood Services'
Brampton Catchment
Abstract Title
STAT and ASAP Delivery Study in Canadian Blood Services' Brampton Catchment
Authors/Co-Authors & Affiliations
Denise Evanovitch, Regional Manager, Ontario Regional Blood Coordinating Network
(ORBCoN), SW
Abstract Body
Background: In 2012, Canadian Blood Services (CBS) consolidated three
production/distribution services in southern Ontario to a single site in Brampton.
CBS piloted a delivery model and paid for all deliveries: routine, ASAP and
STAT. The CBS Hospital Liaison Specialists advise hospitals on their rates of
routine vs. on-demand deliveries (ODDs) at the annual site visits. There were
concerns that some hospitals were using too many ODDs, potentially jeopardizing
the delivery model. Delivery target suggestions were offered, but no set standards
established. ORBCoN investigated the possibility of setting targets or benchmarks
for hospitals receiving blood orders from the Brampton centre.Methods: 12 hospitals
of varying sizes and services from September 1 – October 3, 2014 submitted the
following data:
3. Number of routine deliveries
4. Distance to the Brampton site
5. Number of ODDs
6. Rationale for the ODDs
7. Cost of ODD to each hospital
8. Cost of outdated platelets (apheresis and pooled product)
9. Size of the transfusion service based on number of RBCs transfused
10. Inventory levels
Results
: Factors that did NOT influence ODDs were:

Distance: More distant hospitals had lower ODD rates

Hospital type: High and low ODD users were found in teaching and
140
CSTM 2016 – Conference Abstracts
community hospitals
 RBCs: Not the primary reason for most ODDs
Factors that did influence ODDs:

Scheduled deliveries: the lower the number of scheduled deliveries, the
more ODDs were requested
 Platelets: most ODD orders contained platelets
Hospitals having the highest platelet outdate rates had low ODD rates. This may
indicate possible “over stocking” to minimize ODDs. A cost analysis was performed.
The cost of outdating platelets far surpassed the cost of ODDs. More cost savings
may be realized if more routine or ODDs are added.Conclusions: When guiding
the wise use of blood resources, it is important to balance all cost
factors.Acknowledgements: ORBCoN gratefully acknowledges the participating
hospitals, McMaster Transfusion Research Program, Hossein Abouee Mehrizi, the
Ministry of Health and Long-Term Care (MOHLTC)
141
CSTM 2016 – Conference Abstracts
Stem Cell Club Training Resources: A Needs Assessment
Abstract Title
Stem Cell Club Training Resources: A Needs Assessment
Authors/Co-Authors & Affiliations
Warren Fingrut, MD, Stem Cell Club; University of Toronto
Abstract Body
BackgroundThe Stem Cell Club is a federal non-profit founded in 2011 in Canada,
aiming to improve the quantity and quality of membership on Canada’s stem cell
donor database. In total, we have recruited 4680 potential donors at our nine
chapters at university campuses across Canada. We have trained over 500 medical,
nursing, and undergraduate students as volunteers and leaders for our stem cell
drives. Our training resources include checklists for use at donor drives and a selfdirected online training program featuring three modules: volunteering at, leading,
and organizing a stem cell drive (available at www.stemcellclub.ca/training). It is
unclear how our trainees perceive these resources, and whether there are unmet
training needs. Methods:A needs assessment survey was performed to determine
whether existing Stem Cell Club training resources (checklists, online training
modules) have been utilized, and whether additional resources are needed. All
questions employed a five-point Likert scale. Stem Cell Club chapter presidents
invited their teams to complete the survey. Results52 Stem Cell Club members
completed the needs assessment survey: 20 from BC and 32 from Ontario. 52% had
volunteered at ≥2 stem cell drives organized by Stem Cell Club. With respect to
existing training resources, 87.5-97.7% of respondents who completed the online
training modules agreed that completion prepared them for drives. 85.4% of
respondents reported that checklists were available at drives; 70.2% personally
used them in this setting, 95.9% agreed they were an important resource, and
93.9% felt that they should be used at all stem cell drives. Regarding unmet training
needs, 90.3% agreed that a video series covering all aspects of stem cell drive
operations would be helpful, and 92.3-94.2% felt they would personally use this
resource and that it would be used to review material prior to a drive. 88.3% felt that
development of a practical workshop (mock stem cell drive) would improve training,
and 88.5% would personally use this resource if available. ConclusionThis
assessment clarifies Stem Cell Club training resource utilization, and guides
development of additional resources to fill unmet needs. AcknowledgementThis
work was supported by a 2015 Canadian Blood Services BloodTechNet Grant
142
CSTM 2016 – Conference Abstracts
Stem Cell Drive Materials
Abstract Title
Stem Cell Drive Materials
Authors/Co-Authors & Affiliations
Warren Fingrut, MD, Stem Cell Club; University of Toronto
Abstract Body
BackgroundUnrelated stem cell donors can be recruited online or at stem cell drives,
where they provide informed consent and a tissue sample (buccal-swab) for HLAtyping. Previously, we described the first published model of stem cell drive design
(Fingrut, CSTM 2015), which includes five stations: Prescreening, Informed
Consent, Registration, Swabbing, and Reconciliation. However, to date, no
resources exist which outline materials needed to run a drive. In this presentation,
we outline stem cell drive supplies. MethodsA stem cell drive supplies diagram was
developed, with materials sorted according to the station at which they are used.
Swab kits, barcode-labels, and registration forms are obtained from OneMatch Stem
Cell and Marrow Network of the Candian Blood Services. All posters, forms,
diagrams, and checklists, and a complete list of materials are published online by
the Canadian non-profit Stem Cell Club
(http://stemcellclub.ca/supplies.html). ResultsEach station employs checklists that
outline, as applicable: OneMatch donor eligibility requirements, World Marrow Donor
Association procedures for informed consent, our evidence-based approach to
recruitment of most-needed donors, and guidance to implement good
documentation practices and ensure quality control. Supplies needed at
Prescreening include: posters targeting the most-needed donor groups; “What are
Stem Cells?” diagrams, and a Stem Cell Club infographic on redirecting non-optimal
and ineligible donors. The Informed Consent station features OneMatch “New
Registrant” pamphlets, Stem Cell Club donation risks chart, and Stem Cell Club
informed consent procedure diagrams (graphically illustrated, explained with
accompanying text understandable to the lay-person, and featuring ethnically
diverse young-adult males). Registration requires OneMatch registration forms,
pens, and clipboards. Swabbing station materials are OneMatch swab kits (four
wrapped, sterile, plastic-handle cotton-swabs in a sealable envelope with a
cardboard cotton-swab holder), barcode-labels, staplers, hand-sanitizer, and black
garbage bags. Supplies at Reconciliation are reconciliation and shipping forms,
confidentiality stickers, rubber bands for bundling completed kits, and clear plastic
bags for shipping. ConclusionsThis presentation outlines all materials needed to run
a stem cell drive. It equips Canadian Blood Services staff and community partners
with a resource to guide stem cell drive organization. AcknowledgementThis work
was supported by a 2015 Canadian Blood Services BloodTechNet Grant
143
CSTM 2016 – Conference Abstracts
Successful Allogeneic Bone Marrow Transplantation in Acute
Myeloid Leukemia with incidental resolution of concomitant
Celiac disease, IgA Deficiency, and Platelet Refractoriness
Abstract Title
Successful Allogeneic Bone Marrow Transplantation in Acute Myeloid Leukemia with
incidental resolution of concomitant Celiac disease, IgA Deficiency, and Platelet
Refractoriness
Authors/Co-Authors & Affiliations
Solaf Kanfar, Jacob Pendergrast, Jeffrey Lipton, Christine Cserti-Gazdewich
Abstract Body
Introduction: Allogeneic bone marrow transplantation (ABMT) is the treatment of
choice for multiple hematological malignancies, but it can also be considered for
non-malignant conditions such as autoimmune disease and immunodeficiency. Due
to its high-risk nature, it is reserved for severe therapy-refractory conditions. Preexisting IgA deficiency and HLA sensitization additionally challenge the capacity to
offer supportive transfusion care, while the odds of the persistence of pre-transplant
Celiac disease is not clear. There are only a few published descriptions of ABMT
performed in each of these contexts. We report a case of ABMT in a patient who
possessed all three incidental conditions.
Method: A group A+ female patient presented with CMML transformation to
AML. An ABO-identical, matched sibling donor served in the myeloablative regimen.
IgA deficiency was marked serologically by undetectable IgA with anti–IgA IgG, and
well-documented transfusion reactions (as well as >2 decades of Celiac
enteropathy). Platelet refractoriness was clinically apparent by poor increments one
hour after ABO-identical platelets, and high-breadth calculated panel reactive
antibodies (cPRA). A multidisciplinary transfusion plan was implemented, with
double-washes for cellular products to mitigate anaphylaxis, and sourcing of HLAmatched platelets to bypass immunologic decrements. Serologies were followed in
the post-ABMT period.
Results: During the pre-engraftment days, only 9 products (RBC and Platelets) were
transfused, versus 21 products post-induction. No transfusion reactions were
reported. One in five platelet products were not HLA matched, with associated
increment failures. Engraftment was successfully achieved on day 29. Five years
after ABMT, the patient remains in remission with concomitant correction of IgA
deficiency as well as the abrogation of HLA antibodies, anti-IgA IgG, and reactivities
to tissue transglutaminase or gliadin.
Conclusion: ABMT with risk-mitigated transfusion is feasible in IgA deficiency
coupled with HLA-specific platelet refractoriness, the combination of which might
have been considered prohibitive barriers to care. Furthermore, ABMT may cure
more than the malignant indication itself, with resolution of these
immunopathologies, as well as Celiac enteropathy. Through advances in supportive
care, optimized ABMT outcomes may open consideration for this intervention after
(or instead of) autologous stem cell transplant for a wider range of immune disorders
144
CSTM 2016 – Conference Abstracts
in their own right.
145
CSTM 2016 – Conference Abstracts
Successful Reduction in Institutional IVIG Utilization by
Effective Implementation of Provincial Guidelines
Abstract Title
Successful Reduction in Institutional IVIG Utilization by Effective Implementation of Provincial
Guidelines
Authors/Co-Authors & Affiliations
Lisa Richards Irene Skinner Yulia Lin Jeannie Callum Christine Cserti-Gazdewich Jacob
Pendergrast Lani Lieberman
Abstract Body
Objective: In Canada, Intravenous Immune Globulin (IVIG) use continues to rise
despite strategies implemented by the Ministry of Health and Long Term Care
(MOHLTC). The objective of our initiative was to comply with MOHLTC guidelines
while ensuring patients receive optimal treatment.
Methods: An IVIG oversight program began in January 2013 at a large community
based hospital. Hospital IVIG Guidelines based on the MOHLTC guidelines were
developed and approved. Mandatory technologist education sessions were held
highlighting the importance of the screening process and detailed instructions for
complete order review. All IVIG orders are screened prospectively for indication,
correct dose (using the dose calculator) and duration. Any orders outside of
guidelines that cannot be resolved with the ordering physician are reviewed by the
Transfusion Medicine Director (TMD) before product release. Each case is
reassessed when a new IVIG request form is required. If possible, outcomes are
assessed (IgG levels, infection rates, platelet counts), communication with ordering
physician initiated and dose adjustments suggested to ensure that patient receive
the lowest possible effective dose.
Results: Total grams of IVIG use has decreased consistently since initiation of IVIG
oversight program. Total grams infused in 2012/13 was 41,030g, 36,450g in 2013/14
and 32,930g in 2014/15. Dosing errors are found during screening and
corrected. Treatment efficacy is reviewed at time of IVIG request for renewal. No
adverse effects due to dose adjustments have been reported. Outcome assessment
has increased the awareness and reporting of adverse events including hemolysis
and aseptic meningitis. Conclusions: A comprehensive IVIG oversight program
ensured that patients receive appropriately indicated and optimal effective dose of
IVIG. Despite a provincial increase in IVIG usage of 8-10% annually from 2012/13
to 2014/15, our hospital decreased IVIG use by 19% and decreased our percentage
of Ontario’s IVIG use from 2.5% to 1.7% while maintaining optimal patient care
through evidence based treatment.
146
CSTM 2016 – Conference Abstracts
The Development and Evolution of a Massive Bleeding Policy
in a Tertiary Care Pediatric Center – a Quality Improvement
Initiative
Abstract Title
The Development and Evolution of a Massive Bleeding Policy in a Tertiary Care Pediatric
Center – a Quality Improvement Initiative
Authors/Co-Authors & Affiliations
Roxane Labelle, MLT., Eastern Ontario Regional Laboratory Association Christina Toppozini,
RN, BSCN, MPH., Children’s Hospital of Eastern Ontario Gail Macartney, RN(EC), PhD.,
Children’s Hospital of Eastern Ontario Elaine Leung MD, FRCP(C)., Children’s Hospital of
Eastern Ontario Kimmo Murto MD, FRCP(C)., Children’s Hospital of Eastern Ontario
Abstract Body
Introduction / ObjectiveThe Children’s Hospital of Eastern Ontario (CHEO)
recognized the need to formalize a hospital-wide approach to the management of
massive bleeding (MB) situations. The policy development was intended to improve
the early recognition of a MB situation, to clearly identify roles and responsibilities of
the healthcare teams, and to streamline management and communication
pathways.Design and MethodsThe policy was created by CHEO’s Transfusion
Medicine and Infusion Therapy committee (TMIT). An integrated laboratory protocol
was developed simultaneously by the Transfusion Medicine Laboratory (TML) and
both were implemented in July 2013 after hospital-wide targeted educational
sessions. The policy includes: 1) A detailed algorithm that outlines steps to
recognize a MB situation, blood product management, and required laboratory
testing; 2) Communication pathways; 3) An audit tool to be filled out by involved
staff; 4) The requirement that each activation be followed by a short debriefing
session with the team involved.ResultsThere have been 13 activations of the MB
code between July 2013 and March 2016. The age of the patients ranged from 3
days to 17 years. Recurrent issues raised in the audits/debriefs were: 1) Staff was
often unaware of the MB policy and/or the details contained within the policy; 2) The
need for better interdisciplinary communication; 3) The need for better
communication amongst staff and defining roles more clearly; 4) Access to adequate
resources (staffing, blood products, equipment) were challenging, especially for
after-hours activations.ConclusionResults of the on-going audit and review process
have been useful to direct modifications to the original MB hospital policy, as well as
to identify knowledge gaps for both clinical and laboratory staff. The hospital has
established a program for interdisciplinary trauma simulations, which involves both
clinical and laboratory areas. Since these simulation sessions have been added to
the educational curriculum, knowledge transfer has improved for our infrequent MB
events resulting in better awareness and interdisciplinary communication. CHEO’s
simulation team is in an expansion phase due to excellent staff
uptake. AcknowledgementsCHEO Simulation TeamTransfusion Medicine
Laboratory
147
CSTM 2016 – Conference Abstracts
The impact of gamma irradiation on quality parameters and
function during a 9-day storage of platelets prepared with the
new REVEOS system
Abstract Title
The impact of gamma irradiation on quality parameters and function during a 9-day storage
of platelets prepared with the new REVEOS system
Authors/Co-Authors & Affiliations
M. Girard1, M-P Cayer1, MJ de Grandmont1, J. Dion2, and L. Thibault1 1Héma-Québec,
Recherche et Développement, Québec, Qc, Canada 2 Héma-Québec, Qualité et affaires
réglementaires, Québec, Qc, Canada
Abstract Body
Background: Gamma irradiation is currently the only recommended method to
prevent transfusion-associated graft-versus-host disease. About half of platelet
concentrates (PCs) delivered to hospitals by Héma-Québec are irradiated to destroy
immune white blood cells (WBCs) remaining in the product. In the scientific
community, mixed opinions are being held concerning the impact of irradiation on
platelet in vitro properties. The objective of this study was to investigate the in vitro
quality parameters of gamma-irradiated PCs prepared using the new REVEOS
automated blood processing system (TerumoBCT) during 9 days of storage.
Methods: Whole blood from 32 healthy donors was collected in REVEOS blood
collection sets and 8 PCs were prepared by pooling 4 interim platelet units. On day
2, the 8 PCs were paired, pooled and split into two equal units: one unit was used as
a non-irradiated control, whereas the second was gamma-irradiated (25Gy). PCs
were stored at 20-24°C with agitation and sampled on days 2, 5, 7, and 9 of storage
to measure pH, platelet surface markers (CD41, CD62p, apoptosis marker
phosphatidylserine), metabolite concentrations (glucose, lactate, sodium,
potassium), pO2, pCO2, hypotonic shock response (HSR), ATP levels, agonist (ADP)
response capacity, and quantity of mitochondrial DNA.
Results: No significant differences were observed in the in vitro characteristics and
biochemical functions of irradiated versus non-irradiated platelets. HSR seems to be
slightly increased in irradiated PCs immediately after irradiation (73 ± 7%) compared
to control PCs (63 ± 9%). pO2 values in irradiated PCs appears lower on the day of
irradiation (77 ± 6 mmHg vs 90 ± 6 mmHg) but returns within the control range on
day 5. Irradiated platelet capacity to respond to ADP at the end of storage was
similar to non-irradiated platelets (16.8 ± 5.1% versus 15.8 ± 3.8%). Mitochondrial
DNA levels remained low (from 0.7 to 7.1 ng/mL) during the 9-day storage period in
all products.
Conclusions: Even if this study is limited by its small sample size (n = 4), REVEOS
platelets subjected to gamma irradiation demonstrated no significant adverse effects
as measured by standard in vitro quality parameters.
148
CSTM 2016 – Conference Abstracts
The impact of pathogen inactivation treatment on selected
platelet mRNA transcripts
Abstract Title
The impact of pathogen inactivation treatment on selected platelet mRNA transcripts
Authors/Co-Authors & Affiliations
Christa Klein-Bosgoed, University of British Columbia Peter Schubert, Ph.D., University of
British Columbia and Canadian Blood Services Dana V. Devine, Ph.D, University of British
Columbia and Canadian Blood Services
Abstract Body
Introduction: Pathogen inactivation treatments (PIs) use UV-light with or without a
photosensitive agent to modify viral and bacterial RNA and DNA. Even though
platelets are anucleate, it has been demonstrated that they can synthesize proteins
using RNA and the ribosomal machinery derived from megakaryocytes. Pathogeninactivated platelet concentrates show signs of accelerated storage lesion, but the
effect of PI on platelet mRNA and subsequent protein synthesis remains unclear. In
this study we determined to what extent platelet mRNA is affected by PI.Design and
methods: Apheresis PCs were collected from healthy volunteer donors. In a pool
and split design (N ≥ 3), one unit was PI treated while the other remained untreated.
Total RNA was extracted and normalized by platelet count, followed by DNase
treatment and cDNA synthesis. The transcripts selected for assessment were the
glycoproteins (GP)IIIa, GPIIb and GPIb, the alpha-granule proteins platelet factor 4
(PF4), osteonectin, thrombospondin (TSP) and glyceraldehyde 3-phosphate
dehydrogenase (GAPDH). Quantitative polymerase chain reaction with primers
specific for the selected transcripts was used to determine the relative mRNA
amounts.Results: After treatment all analyzed mRNAs were significantly reduced (P
< 0.05), but to different degrees. For GAPDH and PF4, transcripts appeared less
susceptible to the treatment, with 70% remaining one hour after UV illumination. For
GPIIIa and TSP, less than 15% remained after treatment. There was a correlation
(R2 = 0.85) between transcript length and amount of mRNA remaining one hour after
treatment. All transcripts, except PF4 mRNA, demonstrated an increase in mRNA
half-life post-treatment. Total RNA demonstrated a life span equal to the platelet life
span of 10 – 11 days.Conclusions: Treatment of platelets with riboflavin and UV
illumination has detrimental effects on platelet mRNA. Although all mRNA present in
platelets appears to be affected by the treatment, the extent of the effect varies
among transcripts. This observation can in part be explained by a correlation to the
length of the mRNA transcript.Acknowledgment: We would like to acknowledge the
volunteer donors and the NetCAD blood collection facility, Vancouver BC for
providing blood products and Canadian Blood Services and Health Canada for
funding.
149
CSTM 2016 – Conference Abstracts
Thromboembolic events after on-label and off-label use of
Recombinant Activated Factor VII (rFVIIa) at a tertiary care
hospital.
Abstract Title
Thromboembolic events after on-label and off-label use of Recombinant Activated Factor VII
(rFVIIa) at a tertiary care hospital.
Authors/Co-Authors & Affiliations
Anne-Marie Madden, B.Sc., MD., University of British Columbia Tyler Smith, MD, FRCPC,
Vancouver Coastal Health Kristine Roland MD., FRCPC, Vancouver Coastal Health
Abstract Body
Introduction / Objective
Recombinant activated factor VII (rFVIIa) is approved for bleeding patients with
Hemophilia A or B who have inhibitors against factor VIII or IX. Off-label use of
rFVIIa may include admnistration during massive tranfusions or in the settng of
refractory bleeding associated with trauma or cardiothoracic operations. Concerns
regarding adverse events such as increased mortality, thromboembolism, stroke and
renal injury led the Canadian National Advisory Committe (NAC) to advise against
the off-label use of rFVIIa. Despite this position statement, rFVIIa continues to be
used at our institution for off-label indications. We performed a quality assurance
review of rFVIIa use at Vancouver General Hospital (VGH).
Design and Methods
This study was a retrospective electronic chart review of patients receiving rFVIIa at
VGH between January 1, 2010 and December 31, 2014. The indication for
administration, dose, mortality and thromboembolic events within 30 days of
administration were recorded.
Results
One hundred and twenty patients received rFVIIa during the study period. Nine
patients had on-label indications (7.5%) and 111 patients had off-label indications
(92.5%). The mean number of doses per patient was higher for on-label (30.9)
versus off-label (1.3) administration (p < 0.0001). Off-label rFVIIa was administered
in the following surgeries: cardiac (48.7%), aortic dissection repair (27.9%), general
surgery (8.1%), lung transplant (5.4%), trauma (4.5%), vascular (3.6%) and other
(1.8%). The mortality rate was 26.7% in all patients receiving rFVIIa. Ten patients
(8.3%) had evidence of thrombosis. This was further classified as arterial thrombosis
(3.3%) or venous thrombosis (5%). The rate of thrombosis in patients receiving onlabel administration (11.1%) versus off-label administration (8.1%) was not
statistically different (p = 0.5559).Conclusions
Review of rFVIIa administration at VGH indicates that the majority of patients are
prescribed the product for off-label indications. The rates of thrombosis after rFVIIa
administration in this review are comparable to previously published reports. There
was no difference in thrombosis rates between on-label and off-label use despite
150
CSTM 2016 – Conference Abstracts
higher mean doses per patient in on-label use.
151
CSTM 2016 – Conference Abstracts
Transfusion Premedication Practices among Pediatric Health
Care Practitioners in Canada: Results of a National Survey
Abstract Title
Transfusion Premedication Practices among Pediatric Health Care Practitioners in Canada:
Results of a National Survey
Authors/Co-Authors & Affiliations
Ziad Solh, MD MSc FRCPC FAAP, McMaster University
Abstract Body
Background: Though not supported by strong evidence, premedication (pretransfusion medication) is commonly prescribed to patients who have had a
transfusion reaction. Research questions: 1) What are Canadian pediatric
practitioners’ views and practices regarding premedication; 2) What are barriers to
reducing premedication overuse in pediatrics?
Study Design and Methods: An online survey targeted hematology/oncology,
emergency medicine, general surgery, intensive care, and cardiac intensive care
practitioners in all 16 Canadian pediatric tertiary hospitals. The survey included four
sections: demographic, clinical, future directions, and organizational questions.
Results: 55 individuals from 15/16 pediatric tertiary care sites completed the survey:
53 physicians; and 2 nurse practitioners. Over half of the respondents (55%; 30/55)
were pediatric hematology/oncology providers, and 35% (19/55) were Directors of
their respective divisions. 87% of respondents estimated that they premedicate up to
25% of red blood cell transfusions (RBCTx), and 13% premedicate 26-50% RBCTx.
Proportions were similar for platelet transfusions. Most respondents reported that
trainees are involved in transfusion and premedication order decisions. 7% believe
their hospital does not use leukoreduction and 27% are not sure. 65% of
respondents were not aware of a clinical practice guideline (CPG) or a standard
order set (SOS) at their institution: 51% are interested in having both available.
Factors influencing the decision to premedicate and barriers to change were
identified.
Conclusion: Premedication practices are variable in Canadian pediatric academic
hospitals. Evidence-based premedication clinical practice guidelines and SOS could
be explored as a way to standardize practices. There were perceived educational
and institutional barriers to practice change.
152
CSTM 2016 – Conference Abstracts
UNCHARTED TERRITORY: The experience of being among
the first wave of ORTHO VISION Analyzer customers. Real life
successes and limitations associated with implementation of
emerging technology in a medium-sized acute care setting.
Abstract Title
UNCHARTED TERRITORY: The experience of being among the first wave of ORTHO
VISION Analyzer customers. Real life successes and limitations associated with
implementation of emerging technology in a medium-sized acute care setting.
Authors/Co-Authors & Affiliations
Colleen Chan, RT, Technologist I, St. Paul's Hospital, Vancouver, BC Tina Jacobucci, RT,
Technical Coordinator, St. Paul's Hospital, Vancouver, BC
Abstract Body
Background: St. Paul’s Hospital has been using automation in the Transfusion
Medicine Laboratory (TML) since the early 2000’s. Our medium-sized acute care
hospital is located in downtown Vancouver. Our TML supports a level 3 trauma
facility, the provincial hemoglobinopathy and hemophilia programs, and many worldclass medical and surgical programs. As a result of testing complexity, limited
resources and a demand to improve patient services, there is a need to manage
time more efficiently. Therefore, streamlining workflow, improving technologist
utilization, and pursuing more efficient processes are always at the forefront of our
operational goals. The ORTHO ProVue® has been the sole automated instrument
in use for over a decade in our department, handling the bulk of about 1000 Group
and Screen tests per month. In 2015, two ORTHO VISION™ Analyzers were
delivered to replace the ORTHO ProVue® to better prepare us for the future needs
of transfusion medicine. The Experience:We have set out to detail our real life
experiences during the implementation of a new platform in automated testing. We
discuss notable improvements and identify the single most critical consideration
affecting implementation that we encountered from the perspective of the bench
technologist. The introduction of new ideas, procedures, and especially emerging
technologies, while facilitating increased efficiency and productivity, is invariably met
with challenges - and sometimes resistance - from end-users. Results and
Discussion:We review our original implementation plan; indicate where we could
have improved and what factors/circumstances were beyond our control. We also
mention possible future test profiles that can be assigned to the ORTHO VISION™
Analyzer to adapt to the changing workload in an increasingly demanding field. Our
hope is that our observations will serve to assist fellow Transfusion Medicine
Laboratories during their own instrument upgrades.
153
CSTM 2016 – Conference Abstracts
Understanding intravenous iron ordering practices for
inpatients and outpatients at a large academic institution
Abstract Title
Understanding intravenous iron ordering practices for inpatients and outpatients at a large
academic institution
Authors/Co-Authors & Affiliations
Michelle P. Zeller MD FRCPC MHPE, Department of Medicine, McMaster University and
Canadian Blood Services
Rebecca Barty MLT, BA, MSc., McMaster Centre for Transfusion Research, McMaster
University
Yang Liu MMath, McMaster Centre for Transfusion Research, McMaster University
Grace Wang MMath., McMaster Centre for Transfusion Research, McMaster University
Natalie Ramsay BSc.(Hons), Michael G. DeGroote School of Medicine, McMaster University
Donald M. Arnold, MD FRCPC M.Sc., Department of Medicine, McMaster University and
Canadian Blood Services
Alfonso Iorio MD PhD FRCPC Department of Clinical Epidemiology and Biostatistics, Health
Information Research Unit
Nancy M. Heddle MSc., FCSMLS(D) McMaster Centre for Transfusion Research, McMaster
University
Abstract Body
Introduction: Iron deficiency anemia (IDA) affects billions of individuals worldwide
and can result in decreased quality of life, epithelial tissue injury, fatigue and
decreased cognitive function. Treatment includes identifying etiology and iron
repletion. Intravenous iron is considered in patients refractory to oral iron
supplementation. Though randomized control trials and guideline are beginning to
emerge for certain populations, there remains of paucity of evidence around IV iron
use in everyday practice. A retrospective analysis of IV iron practice across a large
academic institute was conducted to explore patterns of use.
Methods: We conducted a retrospective review of all IV orders between September
1 2010 to September 30 2014 for patients ≥18 years. Data were extracted from a
network of databases and included: patient demographic, laboratory tests, ordering
physician specialty/location, drug/dose/frequency and total amount. Chart review
confirmed diagnoses in selected patient populations and contributed data on
premedication-use and drug reactions.
Results: A total of 285 inpatients (53.2% female) received 456 orders for IV iron.
Average age was 59.2 years (SD20.1) for females and 64.9 years (SD15.4) for
males. Median dose dispensed was 100mg(IQR100-200) with median total
300mg(IQR200-500). IV iron was prescribed to patients admitted under
internists(38.2%), cardiovascular surgeons(12.3%) and cardiologists(6.6%). Of 163
154
CSTM 2016 – Conference Abstracts
patients with available ferritin levels pre-initial IV iron dose, median was
133µg/L(IQR26-340) and increased to 399µg/L(IQR154-967) following the most
recent infusion in the study period. Median hemoglobin level pre-initial dose was
89g/L(IQR80-96) in 271 patients and 93g/L(IQR85-102) following the most recent
infusion in 220 patients. A chart review of 117 patients identified GI bleeding as the
most common reason for receiving IV iron (22.2%). Premedication was used in
~18.8% of patients. Six reactions were reported.
402 outpatients (77.6% female) received 1814 orders for IV iron. Average age was
50.1(SD15.9) for females and 54.1(SD19.1) for males. Median dose dispensed was
250mg (IQR 200-500), median total 800mg(300-1700), prescribed by
haematologists (61.8%), internists (18.2%) and gastroenterologists (10.0%). The
closest median pre-ferritin level was 13µg/L(IQR7-48) with a hemoglobin of
99g/L(IQR86-110); post ferritin was median 102µg/L(IQR41-204).
Conclusion: IV iron practice patterns vary in outpatients compared to inpatients by
sex, age and dose administered.
155
CSTM 2016 – Conference Abstracts
Unnecessary Use of Intravenous Albumin at a Large
Community Hospital
Abstract Title
Unnecessary Use of Intravenous Albumin at a Large Community Hospital
Authors/Co-Authors & Affiliations
Mariya Hiy, University of Toronto Jeannie Callum, MD FRCPC, University of Toronto,
Sunnybrook Health Science Center Christine Cserti-Gazdewich, MD FRCPC, University of
Toronto, University Health Network Yulia Lin, MD FRCPC, University of Toronto, Sunnybrook
Health Science Center Jacob Pendergast, MD FRCPC, University of Toronto, University
Health Network Wendy Rammler, RN, Lakeridge Health Hospitals Lani Lieberman, MD
FRCPC, University of Toronto, University Health Network
Abstract Body
BackgroundIntravenous albumin comes in two forms, 5% and 25%, and is often
used as a resuscitative agent in a variety of clinical conditions. Literature related to
effective use is extensive for some indications and limited for others. The Ontario
Regional Blood Coordinating Network (ORBCON) developed guidelines for the use
of albumin. The objective of this study was to assess the indications and
appropriateness of intravenous albumin orders at a large community
hospital. Method This retrospective study was performed between September and
October 2015. Requisitions for all inpatient albumin orders were identified by the
transfusion laboratory and reviewed. Data collected included patient demographics,
type and amount of albumin ordered (5% vs. 25%), indication for use, patient
comorbidties as well as information regarding the specialty of the ordering physician
and patient location at the time of the order. The Ontario Regional Blood
Coordinating Network guidelines for albumin use were used to adjudicate
appropriate use. ResultsForty-eight patients received 217 bottles of albumin based
on 146 transfusion orders. The median age of the patients was 61 years old (range:
25-94 years) and males constituted 73% of patients. Twenty-five percent albumin
accounted for the majority of the orders (97%). The top three physician groups
ordering albumin were intensivists (34%), hospitalists (24%) and emergency
medicine physicians (18%). Albumin was ordered appropriately 43% of the time.
Appropriate indications for albumin included large volume paracentesis of more than
5L (59%), hepatorenal syndrome (29%), and spontaneous bacterial peritonitis
(11%). The most common reasons for inappropriate albumin orders included
bacterial sepsis (28%), hypoalbuminemia (23%), hypovolemia (18%), and facilitating
fluid shifting for patients with edema (8%).ConclusionsOver a two month period,
albumin orders were adjudicated as unnecessary more than half of the
time. Albumin is a fractionated blood product, and although relatively safe from
serious transfusion complications, it is associated with a significant cost to our
national blood system. In 2013-2014, Canada spent $900,000 on intravenous
albumin. This pilot study highlights the need for the implementation of evidence
based guidelines and knowledge translation to clinicians that commonly prescribe
this product.
156
CSTM 2016 – Conference Abstracts
Use of intravenous immunoglobulin in neonates at a tertiary
academic hospital: One third of use is inappropriate
Abstract Title
Use of intravenous immunoglobulin in neonates at a tertiary academic hospital: One third of
use is inappropriate
Authors/Co-Authors & Affiliations
Lani Lieberman, MD., Department of Clinical Pathology, University Health Network, Toronto,
ON, Canada; Department of Clinical Pathology, Sunnybrook Health Sciences Centre,
Toronto, ON; Department of Laboratory Medicine & Pathobiology, University of Toronto,
Toronto, ON, Canada; Department of Newborn and Developmental Paediatrics, Sunnybrook
Health Sciences Centre, Toronto, ON, Canada Jordan Spradbrow, BSc., Department of
Clinical Pathology, Sunnybrook Health Sciences Centre, Toronto, ON, Canada Amy Keir,
MD., Robinson Research Institute, School of Medicine, University of Adelaide, SA, Australia
Michael Dunn, MD., Department of Newborn and Developmental Paediatrics, Sunnybrook
Health Sciences Centre, Toronto, ON, Canada Yulia Lin, MD., Department of Clinical
Pathology, Sunnybrook Health Sciences Centre, Toronto, ON, Canada; Department of
Laboratory Medicine & Pathobiology, University of Toronto, Toronto, ON, Canada Jeannie
Callum, MD., Department of Clinical Pathology, Sunnybrook Health Sciences Centre,
Toronto, ON, Canada; Department of Laboratory Medicine & Pathobiology, University of
Toronto, Toronto, ON, Canada
Abstract Body
Introduction/Objective:Intravenous immunoglobulin (IVIG) is used in neonatal
intensive care units (NICUs) to treat a wide range of diseases including hemolytic
disease of the newborn (HDN), sepsis and necrotizing enterocolitis. Efficacy data is
limited for most indications in neonates. IVIG is a blood product with known side
effects, particularly hemolysis from ABO-hemolysins. While audits related to
appropriate use have been performed in adults, few studies have assessed rates of
appropriate utilization in neonatal patients. The primary objective of this study was to
describe the usage pattern of IVIG in the NICU over an eleven-year period. The
secondary objective was to assess appropriateness of IVIG use.
Design and Methods:A retrospective chart review was performed of all neonates
who received IVIG in the NICU of a large tertiary care centre from January 2003 to
December 2013. IVIG utilization was considered appropriate if it was prescribed for
neonates with immune mediated hemolysis secondary to HDN. HDN neonates were
defined as those who met the following criteria: presence of a clinically significant
alloantibody, unconjugated hyperbilirubinemia, a positive direct anti-globulin test and
evidence of hemolysis.
Results:Thirty-seven neonates received IVIG and 62% (23/37) of IVIG orders were
deemed appropriate. Seventy-seven percent (10/14) of inappropriate orders were
for septic neonates, 14% (2/14) for neonates with a clinically significant alloantibody
but without evidence of hemolysis and 14% (2/14) for neonates with G6PD
deficiency. Hemolytic tests performed prior to IVIG issue included complete blood
count (100%), direct antiglobulin test (29/37; 78%), blood film (28/37; 76%),
reticulocyte count (11/37; 30%) and lactate dehydrogenase (1/37; 3%). Abnormal
157
CSTM 2016 – Conference Abstracts
laboratory results were found more often for HDN neonates, consistently across all
hemolytic tests. There was no documentation of any adverse events following IVIG
receipt, including hemolysis. There were six deaths and all occurred in the septic
neonate group.
Conclusions:This novel assessment of IVIG utilization in the NICU revealed IVIG is
sometimes ordered inappropriately, particularly for septic neonates. This study also
found that key diagnostic tests needed to confirm an immune etiology for idiopathic
jaundice are not performed routinely, prior to IVIG receipt. Guidelines are needed to
ensure IVIG is utilized appropriately in the neonatal population.
158
CSTM 2016 – Conference Abstracts
Utilization, Quality and Safety of Amniotic Membrane
Transplant Allografts
Abstract Title
Utilization, Quality and Safety of Amniotic Membrane Transplant Allografts
Authors/Co-Authors & Affiliations
H. Manhani, University of Alberta H. Jiao, Alberta Health Services T. Mokoena, Alberta
Health Services K. Worton, Alberta Health Services M. Bentley, Alberta Health Services
G.Dowling, MD, Alberta Health Services J. L. Holovati, PhD, University of Alberta and Alberta
Health Services
Abstract Body
INTRODUCTION: Amniotic membrane (AM) is the innermost layer of the placenta,
consisting of cuboidal epithelia monolayer, thick basement membrane and avascular
stromal matrix. Its transparency, elasticity, tensile strength and anti-fibrotic
properties make AM a popular transplant allograft for ocular surface reconstruction
and burn management.
OBJECTIVE: The aim of this study was to evaluate utilization, quality and safety of
AM transplant allografts processed and distributed by the Comprehensive Tissue
Centre (CTC) in Edmonton, Alberta, for regional and national ophthalmological and
dermatological transplant applications between January 2012 to December 2015.
DESIGN AND METHODS: AM was obtained from Caesarean-section placenta,
processed into allograft pieces of different sizes and cryopreserved in 10% dimethyl
sulfoxide using non-linear controlled rate freezing. AM sections were cultured for
bacterial and fungal growth after recovery from placenta and after the antibiotic
decontamination step. AM allograft quality was evaluated using histological tissue
morphology assessment of H&E-stained sections pre- and post-cryopreservation.
CTC database was used to extract information on AM tissue banking program
activity. Cell Tissue Organ Surveillance System (CTOSS) reports provided
information on post-transplant AM quality and safety from surgical end-users.
RESULTS: Between 2012 and 2015, 1186 AM allograft pieces from 25 donors were
processed. Out of 865 AM allograft pieces released for transplant during that time,
majority were small pieces (69 % and 22 % for 3cmx3cm and 1.5x1.5cm allograft
sizes, respectively). While 38 % of AMs showed positive bacterial culture results
upon recovery, with 56 % of positive culture due to Propionibacterium sp, 99 % of
cultures were negative after the antibiotic decontamination (n=24). Histological
assessment of AM allografts revealed no significant difference in microscopic tissue
morphology pre- and post-cryopreservation step of AM processing. CTOSS
feedback indicated 99 % of post-AM transplant outcome as satisfactory, with no
allograft-associated adverse reactions reported (n=741).
CONCLUSIONS: The CTC takes great pride in providing safe AM transplant
allografts of high quality, through excellence in practice and leadership in research.
159
CSTM 2016 – Conference Abstracts
160
CSTM 2016 – Conference Abstracts
When is a Positive Truly So? Defining a New Cut-Off in a
Precautionary Approach to D Typing in Child-Bearing Age
Female Individuals.
Abstract Title
When is a Positive Truly So? Defining a New Cut-Off in a Precautionary Approach to D
Typing in Child-Bearing Age Female Individuals.
Authors/Co-Authors & Affiliations
Lisa Richards, Lakeridge Health Sciences Irene Skinner, Lakeridge Health Sciences Allan
Lupish, Lakeridge Health Sciences Grant Johnson, Lakeridge Health Sciences Sally Balmer,
University Health Network Lani Lieberman, MD, University of Toronto Yulia Lin, MD,
University of Toronto Jeannie Callum, MD, University of Toronto Jacob Pendergrast, MD,
University of Toronto Christine Cserti-Gazdewich, MD, University of Toronto
Abstract Body
Purpose: RHD typing in child bearing age females (CBAF) dictates who warrants
Rh immunoprophylaxis and restriction to D- cellular products. “D+” has been
defined as >2+ reactivity (irrespective of test modality) and assumes wildtype
configuration/D tolerance. However, inter-reagent discrepancies may suggest
sensitization-vulnerable variants. We sought to determine our rate of modalityrelated D-discrepancies, as defined by >2+ gel results despite weak or negative tube
reads, and their correlative genotypic/clinical meaning.
Methods: Routine RHD grouping uses automated geltubes (ORTHO ProVue®) with
monoclonal human IgM anti-D (MS-201), (MTS Inc). Between 01/08/15-18/11/15,
samples from 1000 consecutive, (≥2+) D+ CBAF individuals (<45 years) were tubetested (D1: monoclonal human IgM [MAD2] + polyclonal human serum IgG; D2:
monoclonal IgM D7B8 + monoclonal IgG H1121G6/LORIFA), both BioClone®
(OrthoClinical Diagnostics). Dissimilar tube results were followed by genotyping
(Immucor RHD BeadChipTM kit) to determine D classification (weak, partial, dual
weak/partial, or inferentially non-variant RHD). Results which led to changed
recommendations were also noted.
Results: Of 1000 D+ gel samples, 5 were 2+, 63 were 3+, and the remainder (932)
were 4+. Of 63 at 3+, 3 were ≤2+ by tube, and all 3 were D-variant, as were all 5/5
at 2+. Weak D type 1 & 2 dominated at 62.5% (4/5 at 2+ [1 type 1, 3 type 2]; 1/3 at
3+ [1 type 1]), although DAR (weak/partial) was found in 2 (1/5 at 2+ and 1/3 at 3+),
and type 4.1 was found in 1 (1/3 at 3+). An at-risk (alloimmunizable) genotype
occurred 37.5% of non-4+ D+ gel (and tube ≤2+) samples.
Conclusions: 7% of D+ CBAF are 2+/3+ in gel, 12% of whom are ≤2+ in
tube. Genotyping of this 1% of inconsistent-D-reactive CBAF discovers a potential
for D sensitization in 37.5% of cases. An unconditional >2+ definition of D+ is
perilously misleading, as 3 CBAF would have missed immunoprophylaxis in our
cohort. Strong (4+) unequivocal agglutination in gel more assuredly identifies RHD+
CBAF not requiring further testing/prophylaxis, whereas <3+ reactions warrant
scrutiny. Discrepant (<3+) tube reactions despite gel positivity justify genotyping
and/or D-precautions until evidence of D-tolerant molecular types (wildtype or weak
161
CSTM 2016 – Conference Abstracts
type 1-3) are identified.
162
CSTM 2016 – Conference Abstracts
Who’s your daddy? Weakened KEL2 antigen (Cellano)
expression responsible for apparent paternal exclusion: a case
study
Abstract Title
Who’s your daddy? Weakened KEL2 antigen (Cellano) expression responsible for apparent
paternal exclusion: a case study
Authors/Co-Authors & Affiliations
Samantha Friday, MLT, Diagnostic Services, Canadian Blood Services - BC & Yukon
Lhevinne Ciurcovich, Technical Supervisor, Diagnostic Services, Canadian Blood Services BC & Yukon Vivian Stephens, Supervisor, Diagnostic Services, Canadian Blood Services BC & Yukon Gwen Clarke, MD., FRCPC, Associate Medical Director, Clinical Services,
Canadian Blood Services Nicholas Au, MD., FRCPC, Medical Director, Transfusion Medicine
Laboratory, Deptartment of Pathology and Laboratory Medicine, BC Children's and Women's
Hospital
Abstract Body
Anti-Kell antibody can cause severe Hemolytic Disease of the Fetus and Newborn
(HDFN). Fetal Kell phenotyping may be performed on blood following a
cordocentesis or cord blood post-delivery, to determine the likely clinical significance
of the maternal anti-Kell antibodies. We report a Kell typing discrepancy, on a
cordocentesis sample from the fetus of a 29-year-old female with anti-Kell, and the
alleged father, which appeared at first as a paternity exclusion. The mother’s
serological phenotype was negative for the KEL1 antigen (KEL:-1,2). The father’s
historical Kell phenotype was homozygous for Kell (KEL:1,-2) . Unexpectedly, the
fetal cordocentesis sample also typed KEL1 negative (KEL:-1,2). A Direct
Antiglobulin Test (DAT) was also performed on the fetal sample and resulted as
negative. A new sample was collected from the father and repeat serological Kell
typing was performed. The new sample tested positive for the KEL1 antigen but
also tested very weak for the KEL2 antigen, indicating paternal Kell heterozygosity
(KEL:1,2) and not homozygosity as was originally thought. Kpa effect and Gerbich
related modification to the Kell phenotype were both ruled out as possible reasons
for the discrepancy. Samples were sent for genotyping, which confirmed that the
father was positive for KEL*1 (K) and KEL*2 (k) alleles. This supported the
phenotype results. In conclusion, the father was in fact heterozygous for Kell, as
confirmed by genotyping and weak serological KEL2 typing results. This explained
the fetal KEL1 negative status with fetal inheritance of KEL2 from both mother and
father. The reason for the weakened KEL2 antigen expression is unknown, but
likely due to some mutation possibly of the KEL*2 allele. Similar reports are found in
the literature of weak or negative serological KEL2 antigen typing in the presence of
a KEL*2 mod allele. There are also a number of associated red cell antigen genes
that can be co-inherited and can contribute to weakened expression of the KEL2
antigen.
163
CSTM 2016 – Conference Abstracts
Zika virus: Risk Assessment and Rapid Response to an
Emerging Threat
Abstract Title
Zika virus: Risk Assessment and Rapid Response to an Emerging Threat
Authors/Co-Authors & Affiliations
Elaine Fournier, R.N., Canadian Blood Services Mindy Goldman M.D., Canadian Blood
Services Mark Bigham M.D., Canadian Blood Services Sheila O'Brien Ph.D., Canadian Blood
Services Dana Devine Ph.D., Canadian Blood Services
Abstract Body
Introduction: Zika virus is a mosquito borne flavivirus closely related to West Nile,
dengue and yellow fever viruses. It causes outbreaks of generally, mild illness in
Asia and Africa and most recently in Latin America with spread into the
Caribbean. Although risk to the blood supply is unclear, 2.8% of asymptomatic
blood donors tested RNA positive during an outbreak in French Polynesia in 2013.
Therefore it was considered prudent to implement measures to prevent Zika
transfusion transmission, from travelling donors, while maintaining an adequate
blood supply.Methods: A risk assessment for transfusion transmission of Zika virus
in the Canadian donor population was performed, using information about the
incubation period, viremic period, percentage of asymptomatic cases, and number of
donors likely to return to donate during the viremic period following travel to a risk
area. The results of a 2014 travel survey of Canadian Blood Services donors were
used to assess the impact of 21 and 28 day post-travel deferrals on
collections.Results: The estimated risk of transfusion-transmitted Zika virus without
deferral was 1 in 380,000 donations; with a 21 day deferral, 1 in 38 million
donations; and with a 28 day deferral, 1 in 380 million donations. A 21 day deferral
would affect 3% of all donors, and a 28 day deferral, 4.6%. On February 5, 2016,
Canadian Blood Services (CBS) implemented a 21 day donor deferral following
travel outside of Canada, the continental U.S. and Europe. An early impact
assessment revealed that the deferral resulted in 581 Zika risk deferrals, applied at
the National Call Centre, and 476 deferrals applied in-clinic up to February 21st,
2016, representing approximately 2.5% of collections.
Conclusions: Although
to-date, Zika virus infection has been rare in returning Canadian travelers,
implementation of a post-travel blood donor deferral also mitigates potential risk
from other, blood-borne, viral infections such as dengue and chikungunya which
affect similar geographic areas. It is essential to balance such risk reduction
strategies with the corresponding impact on availability of blood products to
patients.
164