Download Bacterial DNA - Skills Commons

Lecture 3
January 6, 2016
Biotech 3
Restriction Enzyme Digest
Discovery:
• Late 1960s
• Werner Arber at the University of Basel, Switzerland
- Showed that some E. coli strains restricted viral infection using an
enzyme; called that enzyme a “restriction enzyme”.
• Concurrently Hamilton Smith discovered HindII
• Dan Nathans at Johns Hopkins University, Baltimore MD showed cleavage of
Simian virus 40 using a restriction enzyme.
• Received the Nobel Prize in Physiology or Medicine 1978
Restriction Enzymes as a Natural Defense
• Bacteria use restriction enzymes as a defense mechanism to protect against infectious pathogens such as
viruses called bacteriophage
Bacterial DNA:
Bacterial DNA is methylated
CH3
5’---CTAGAAGAATTCGGCAAGCT---3’
3’---GATTCTTCTTAAGCCGTTCGA---5’
CH3
•
•
Methyl groups will sterically hinder restriction sites,
preventing their digestion by restriction enzymes
Enzymes Dam and Dcm methylate DNA
Restriction Enzymes Cutting
5’…ACCTTGTCCCGGGTAGGCAT…3’
3’…TGGAACAGGGCCCATCCGTA…5’
5’…ACCTTGTCCC…3’
3’…TGGAACAGGG…5’
5’…GGGTAGGCAT…3’
3’…CCCATCCGTA…5’
Blunt end cut
5’…ACCTTGTCTGCAGTAGGCAT…3’
3’…TGGAACAGACGTCATCCGTA…5’
5’…ACCTTGTCTGCA…3’
5’… GTAGGCAT…3’
3’…TGGAACAG…5'
3’…ACGTCATCCGTA…5’
Sticky end cut
Restriction Enzyme Examples
Restriction Enzyme
Organism
EcoRI
Escherichia coli RY13
HindIII
Haemphilus influenza Rd
PstI
Providencia stuartii
Recognition sequence
Restriction Enzyme Digests
• One unit is defined as the amount of enzyme required to digest 1 μg of λ DNA
in 1 hour at 37°C in a total reaction volume of 50 μl
• Supplied in “units”
• There are various manufacturers and vendors of restriction enzymes
• Popular manufacturer is New England Biolabs®, Inc.
• The NEB web site has several tools that may be helpful in analyzing a DNA
sequence for restriction sites and designing restriction enzyme digest.
NEB Web cutter
NEB Web Cutter
NEB Web cutter
NEB Web Cutter
NEB Web Cutter
NEB Web Cutter
pET3a Plasmid
Two Fragments:
4128 bp
512 bp
Double Digest with BamHI and EcoRI
Double Digest Link
Additional considerations
Star Activity: Under non-standard reaction conditions, some restriction enzymes are capable of cleaving sequences which are
similar, but not identical, to their defined recognition sequence. This altered specificity has been termed “star activity".
Conditions that Contribute to Star Activity
High glycerol concentration (> 5% v/v)
High concentration of enzyme/µg of DNA ratio (varies
with each enzyme, usually 100 units/µg)
Non-optimal buffer
Steps that can be Taken to Inhibit Star Activity
Restriction enzymes are stored in 50% glycerol, therefore the amount of
enzyme added should not exceed 10% of the total reaction volume. Use the
standard 50 µl reaction volume to reduce evaporation during incubation.
Use the fewest units possible to achieve digestion. This avoids
overdigestion and reduces the final glycerol concentration in the reaction.
Whenever possible, set up reactions in the recommended buffer. Buffers
with differing ionic strength and pH may contribute to star activity.
Prolonged reaction time
Use the minimum reaction time required for complete digestion. Prolonged
incubation may result in increased star activity, as well as evaporation.
Presence of organic solvents [DMSO, ethanol (4),
ethylene glycol, dimethylacetamide,
dimethylformamide, sulphalane
Make sure the reaction is free of any organic solvents, such as alcohols,
which might be present in the DNA preparation.
Substitution of Mg2+ with other divalent cations (Mn2+,
Cu2+, Co2+, Zn2+)
Use Mg as the divalent cation. Other divalent cations may not fit
correctly into the active site of the restriction enzyme, possibly
interfering with proper recognition.
2+
Gel electrophoresis buffers