Download PDF hosted at the Radboud Repository of the Radboud University

PDF hosted at the Radboud Repository of the Radboud University
Nijmegen
The following full text is a publisher's version.
For additional information about this publication click this link.
http://hdl.handle.net/2066/156495
Please be advised that this information was generated on 2017-06-12 and may be subject to
change.
Autosomal recessive
hearing impairment
Hearing of & listening to patients
Anne M.M. Oonk
Autosomal recessive
hearing impairment
Hearing of & listening to patients
Anne M.M. Oonk
2016
ISBN
978-90-9029535-0
Design/lay-out
Promotie In Zicht, Arnhem
Print
Ipskamp Printing, Enschede
© Anne M.M. Oonk, the Netherlands, 2016
All rights reserved. No parts of this thesis may be reproduced or transmitted in any form
or by any means, electronically, mechanically, by print of otherwise, without prior written
permission of the author.
The research presented in this thesis was performed at the department of
Otorhinolaryngology and the department of Human Genetics of the Radboud
University Medical Center, Nijmegen, the Netherlands with financial support
of ZonMW
Financial support for the publication of this thesis was provided by: ABN Amro,
Daleco Pharma b.v., DOS medical/ kno-winkel.nl, EmID audiologische apparatuur,
Specsavers, Meda Pharma, Meditop Medical Products, Cochlear, Phonak,
Olympus Nederland B.V., ZEISS, Tramedico.
Autosomal recessive
hearing impairment
Hearing of & listening to patients
Proefschrift
ter verkrijging van de graad van doctor
aan de Radboud Universiteit Nijmegen
op gezag van de rector magnificus,
volgens besluit van het college van decanen
in het openbaar te verdedigen op donderdag 14 april 2016
om 12.30 uur precies
door
Anne Marthe Maria Oonk
geboren op 3 mei 1987
te Haarlem
Promotor
Prof. Dr. J.M.J. Kremer
Copromotor
Dr. R.J.E. Pennings
Manuscriptcommissie
Prof. dr. F.P.M. Cremers (voorzitter)
Prof. dr. P. van Dijk (Universitair Medisch Centrum Groningen)
Dr. V. Topsakal (Universitair Medisch Centrum Utrecht)
Contents
Chapter 1 Introduction
1.1 General introduction
1.2 Features of autosomal recessive nonsyndromic hearing
impairment; a review to serve as a reference
Chapter 2 Novel genotype-phenotype correlations
7
9
29
71
2.1 Similar phenotypes caused by mutations in OTOG and OTOGL
73
2.2 Nonsyndromic hearing loss caused by USH1G mutations:
widening the USH1G disease spectrum
93
2.3 Progressive hearing loss and vestibular dysfunction caused
by a homozygous nonsense mutation in CLIC5
Chapter 3 Expanding a genotype-phenotype correlation
3.1 Vestibular function and temporal bone imaging in DFNB1
Chapter 4 Psychosocial impact of a genetic diagnosis
4.1 Psychological impact of a genetic diagnosis on hearing
impairment - an exploratory study
109
133
135
157
159
Chapter 5 Discussion and conclusion
175
Chapter 6 Summary / Samenvatting
193
6.1 English summary
195
6.2 Nederlandse samenvatting
201
Chapter 7 Dankwoord
207
Chapter 8 Curriculum Vitae
213
Chapter 9 List of publications
217
Chapter 10 List of abbreviations
223
1
Introduction
1.1
General Introduction
Introduction
| 11
Sounds
Hearing is the ability to perceive sound. Sounds can be simple, like beeps or pure
tones, but sounds can also be more complex like, for example, speech. Hearing,
therefore, is an important aspect of communication. Besides sound detection and
speech recognition, sound localization is another important feature of hearing.
These three components are important in another function of hearing: detection
of danger.
Sounds are, basically, waves in a medium. These waves can be described by means
of three characteristics: frequency, amplitude and propagation velocity. Humans
are capable of hearing frequencies between 20 and 20,000 Hz. The most important
sound source for humans is the human voice. Sounds are usually consisting of
a combination of frequencies, a frequency spectrum. For speech reception, this
frequency spectrum is around 2000 Hz 1.
Figure 1 Frequency and intensity of sounds. Decibel Hearing Level (dB HL) Hertz
(Hz). This image has been copied by courtesy of Phonak.
12 | Chapter 1
Sound pressure, or the amplitude of the wave, is perceived as loudness of sound.
This loudness is defined in decibels (dB) or pascal (Pa). The hearing threshold of a
normal hearing individual is 0 dB HL (decibel hearing level (20 µPa)) and the pain
threshold is about 130 dB HL (20Pa).
Propagation velocity depends on the medium. In the external auditory canal and
middle ear this medium is air, in the cochlea this is fluid (endolymph and
perilymph). However, sound can also be conducted through a solid medium, like
bone. The different characteristics of sound waves are detected and processed by
the ear.
Anatomy and physiology of the ear
The ear can be divided in three parts:
1. External ear
2. Middle ear
3. Inner ear
The external ear comprises the auricle and the external auditory canal (EAC).
The EAC directs sounds from the auricle to the tympanic membrane. The external
ear alters sound wave amplitudes and therewith, provides a mechanism for
amplification of different sounds within the frequencies of human speech.
The middle ear consists of the tympanic membrane, tympanic cavity, ossicles and
associated muscles. The middle ear cavity is connected to the mastoid air-cell system.
The malleus, incus and stapes are consecutively located between the tympanic
membrane and the cochlea. These three ossicles conduct sound from the tympanic
membrane towards the cochlea. The middle ear is especially important in
transforming sounds, also known as impedance matching. It converses vibration
of air into vibration of fluid. When sound travels from air to fluid, it is partially
reflected and a lot of sound energy is lost. Due to two features of the middle ear
this loss of energy is restricted:
1. The difference of surface size between the tympanic membrane and the stapes
foot plate. The sound, in other words, the pressure, applied to the tympanic
membrane is transferred to a surface 17 times as small.
2. Lever mechanism of the ossicles. The malleus - incus construction is a lever,
which contributes a factor 1.3 to the transmission of sound 2.
Sound enters the cochlea through the mobile footplate of the stapes located in the
oval window. The cochlea is shaped like a snail shell. This shell consists of three
scalae: the scala vestibuli, scala media and scala tympani. These three scalae are
separated by Reissner’s membrane and the basilar membrane.
Introduction
| 13
Organ of corti
Located on the basilar membrane is the organ of Corti. It contains the sensory hair
cells of the cochlea, which convert the mechanical stimulus of the travelling
sound wave through the cochlea into an electric potential. These sensory cells are
organized in one row of inner hair cells and three rows of outer hair cells and are
surrounded by supporting cells. The tectorial membrane is a gelatinous membrane
covering the apical side of the hair cells. At the basal end of the hair cells the
synapses of the afferent and efferent neurons are located. In the modiolus of the
cochlea, the spiral ganglion that contains the cell bodies of the auditory neurons
is found. These auditory neurons are part of the auditory nerve.
At the apical side of the hair cells the hair bundle is located. The bundle is formed
by stereocilia that are arrayed in rows of increasing height. The stereocilia are
connected by means of links.
Both the inner and outer hair cells are so-called mechanoelectric transductor
(MET) cells. A minimal deflection (1-100 nm) of the stereocilia is transmitted via
stereociliary tip links to open the MET channels 3. By opening these MET channels,
a positive current of potassium ions flows into the hair cells that subsequently
depolarize. Depolarization opens the voltage gated calcium channels, which
induces calcium influx. This influx of calcium ions is necessary for the release of
glutamate, a neurotransmitter that stimulates the ends of the auditory nerve
fibers 4.
Figure 2 Organ of corti. This image has been copied by courtesy of J. Brigande and
S. Heller 5.
14 | Chapter 1
The deflection of stereocilia of the outer hair cells occurs via direct contact of the
hair bundle by the tectorial membrane. The hair bundles of the inner hair cells are
thought to be deflected by the fluid movement in the subtectorial space 6. Inner
hair cells are responsible for the transduction of sound into a neural signal with
high spatial and temporal resolution. Outer hair cells are the cochlear amplifiers
and by electromotility enhance the sensitivity, tuning and dynamic range 7.
Tonotopy
The relation between detection of sounds of specific frequencies and position in the
cochlea is called tonotopic organization of the cochlea 8, 9. This tonotopic organization
is retained up to the auditory cortex, which enables frequency identification.
Due to decreasing stiffness in the basilar membrane, the velocity of the wave
decreases, while the amplitude increases, as the sound wave travels through the
cochlea. At the point where the amplitude reaches its maximum, the sliding
motion between the basilar and tectorial membrane will be the largest. At this
position in the cochlea, hair cells will be stimulated. The stiffness of the basilar
membrane is the largest at the base (the oval window) and decreases exponentially
towards the apex. The hair cells and the associated stereocilia also differ in length
from the base to the apex. This difference in height enhances the efficiency of
flexoelectricity.
The vestibule
The vestibular organ is, besides the cochlea, also part of the labyrinth. The vestibular
organ consists of three semicircular canals, and two satellite organs: the utricle
and saccule. The horizontal, superior and inferior semicircular canals detect angular
accelerations and the utricle and saccule detect linear accelerations in the vertical
and horizontal plane, respectively 10.
Each part of the vestibular organ has its own neuroepithelial area. In the sacculus
and utriculus this neuroepithelial areas are called the macula sacculi and macula
utriculi, respectively. The neuroepithelial area in each semicircular canal is called
crista ampullaris and is located in the ampulla, the dilated end of the semicircular
canal. Similar to the cochlea, the neuroepithelium consists of hair cells and
supporting cells. At the apex of each hair cell are several stereocilia and one
kinocilium located. The stereocilia are arranged evenly in rows of increasing
height. Next to the tallest row of stereocilia, the kinocilium is located. The
stereocilia are connected by tip-links. When the stereocilia bend, these tip-links
open (or close) transduction channels, which results in a change of receptor potential.
The stereocilia and kinocilia of the maculae protrude in a gelatinous membrane,
which is covered by statoconia (calcium carbonate crystals). Movement of these
statoconia causes the stereocilia and kinocilia to bend. The stereocilia and kinocilia in
Introduction
| 15
the crista ampullaris are also covered by a gelatinous mass which is called the cupula.
Angular accelerations of the head cause the cupula to bend, which causes depolarization
or hyperpolarization of the hair cells, depending on whether the direction of the
deflection is away from or towards the kinocilium. 11. The vestibular organ only
detects motion of the head, therefore it is also important to have appropriate
information about the orientation of the head in respect to the body. This
information comes from proprioceptors in the neck and body. Besides this, visual
information is also important in the maintenance of balance 10-12.
Figure 3 Human vestibular organ; psc, posterior semicircular canal; hsc, horizontal
semicircular canal; asc, ascending semicircular canal; um, utrical macula;
pa, posterior ampula. This image has been copied and adjusted by courtesy
of Büki et al 13.
Hearing impairment
Causes of hearing impairment can be divided into conductive and/or sensorineural.
A conductive hearing impairment indicates that sound cannot be conducted properly
towards the cochlea. In sensorineural hearing impairment the defect is located in
the cochlea, the auditory nerve or the further auditory system. Conductive as well
as sensorineural hearing impairment can be hereditary or acquired. Of all early
onset sensorineural cases of hearing impairment, about half is due to environmental
factors and the other half is due to inherited factors 14.
The most common cause of acquired early onset hearing impairment is a congenital
cytomegalovirus (CMV) infection, which is the causative agent in 10-20% of hearing
impaired children. Of all children with a congenital CMV infection, 12.6% will
develop hearing impairment 15. Hearing loss may present with a delayed onset, and
can be unstable, with fluctuations and progression. Other causes of acquired hearing
impairment are trauma, prematurity and ototoxic medication.
16 | Chapter 1
When sensorineural hearing impairment is not acquired, it is inherited. Currently,
over 75 genes are known to be expressed in the cochlea and to cause hearing
impairment, when mutated 16. Since different genes are known to function in
different structures in the cochlea, mutations can cause different types of loss of
function of the cochlea.
Hereditary hearing impairment
When hearing impairment is associated with other distinct features it is called
syndromic hearing impairment. These features can change physical appearance,
as is for example the case in Treacher Collins, Stickler, Waardenburg or Branchiooto- renal syndrome. These features can also be less obvious or occur at later age
and therefore be missed in first respect. Examples of the latter are a prolonged
QT-syndrome in Jervell- Lange Nielsen syndrome, retinitis pigmentosa in Usher
syndrome or renal failure in Alport syndrome. These syndromes can exhibit all
known mendelian, as well as mitochondrial inheritance patterns 17. In the cases of
early onset hereditary hearing impairment about 30% is estimated to be syndromic.
In these cases, the mutated gene has a significant impact on the function of the ear
and another organ or organs 18.
Nonsyndromic hearing impairment can present with different inheritance patterns:
autosomal recessive (70-80%), autosomal dominant (20-30%), X-linked (<1%),
mitochondrial (<1%) or Y-linked (rare) 19, 20. The different genetic loci associated
with nonsyndromic sensorineural hearing impairment are defined by DFN
(DeaFNess). The inheritance pattern determines the next character; an A for
autosomal dominant - DFNA, B for autosomal recessive – DFNB, X for X-linked –
DFNX and Y for Y-linked – DFNY. Every locus for hearing impairment is numbered
chronologically in order of discovery.
Several mutated genes can be causative for syndromic as well as non-syndromic
hearing impairment. Good examples are the genes mutated in Usher syndrome
type I. MYO7A, CDH23, USH1C, PCDH15, USH1G and CIB2 are all also associated with
non-syndromic hearing impairment.
Mutations in several specific deafness- associated genes may lead to autosomal
dominantly as well as autosomal recessively inherited hearing impairment. This
is, amongst others, seen in DFNB7/11 and DFNA36, which are both caused by
mutations in TMC1 16. The differences in syndromic/ non-syndromic or autosomal
dominant/ recessive inheritance depend on the affected protein domain and the
type of mutation 21, 22. In general, mutations can cause:
loss of function.
gain of function.
a dominant negative effect: the product of the mutant gene interferes with the
product of the wild type copy of the gene 23.
Introduction
| 17
Clinical characteristics
All but one (MIR9624) of the known deafness- associated genes encode a protein.
These proteins may have different functions in the cochlea. The phenotypes associated
with different mutated genes may, therefore, also differ. To display these differences
correctly, phenotypes are described by means of several characteristics. These
features are summarized in table 1.
Genetic testing
In order to find the genetic defect that underlies hearing impairment one can
follow several strategies.
Homozygosity mapping
In order to identify the region in which the genetic defect is located, one can apply
homozygosity mapping. This method is based on the fact that an affected
individual, from a consanguineous family, inherits two copies of a disease allele
from a common ancestor of father and mother. These copies are therefore
homozygous. Since small chromosomal regions intend to inherit as a whole, the
nearby marker loci will also inherit in the same way. A marker is a specific DNA
sequence with a known location on a chromosome. These homozygous regions
will be mapped by means of a single nucleotide polymorphism (SNP) array 26. One
can compare the genotypes of two or more family members, and herewith identify
regions shared by affected family members.
Linkage analysis
Linkage analysis is measuring the cosegregation of any DNA sequence variant
with a disease. This is also based on the tendency of two or more genetic loci to be
transmitted together during meiosis because they are physically close on the
chromosome 27. Whether loci are linked or not can be identified by means of
polymorphisms, such as single nucleotide polymorphisms (SNPs) 28. It can be used to
reject or to prove whether a specific (gene) locus segregates with the disease in a
family.
Mutation analysis
When a gene is suspected to be mutated, one can examine this gene by mutation
analysis, e.g. by Sanger sequencing 29. The obtained sequence is compared to the DNA
sequence of an unaffected individual 30. Whether a variant is a known common
or rare variant can be evaluated in public databases, e.g. the Exome Variant Server 31.
The impact of a nucleotide change on gene function can be predicted by different
prediction programs, e.g. Mutation Taster 32.
18 | Chapter 1
Table 1 Characteristics to describe hearing impairment
Characteristics25
Type of hearing impairment
Conductive
Sensorineural
Mixed
Severity
(based on the best hearing ear, averaged
over 0.5, 1, 2 and 4 kHz)
Mild
Audiometric configuration
Low ascending
Moderate
Severe
Profound
Mid frequency (U-shaped)
High descending (gently downsloping)
High descending (steeply downsloping)
Flat
Frequency ranges
Low
Mid
High
Extended high
Symmetry
Unilateral - asymmetric
Bilateral - symmetric
Age of onset
Congenital
Prelingual
Postlingual
Progression
Variability
Interfamilial
Intrafamilial
Introduction
| 19
Associated to disease or deformity of outer/middle ear.
Characterized by normal bone-conduction thresholds (<20 dB HL) and an air-bone gap
>15 dB HL averaged over 0.5, 1 and 2 kHz.
Associated to disease or deformity of the inner ear/auditory nerve
Characterized with an air/bone gap < 15 dB HL averaged over 0.5, 1 and 2 kHz.
Associated to combined involvement of the outer/middle ear and the inner ear/auditory
nerve. Audiometrically >20 dB HL in the bone conduction threshold together with
>15 dB HL air-bone gap averaged over 0.5, 1 and 2 kHz.
20-40 dB HL
41-70 dB HL
71-95 dB HL
>95 dB HL
>15 dB HL difference between the poorer 0.25 and 0.5 kHz thresholds and those at 1, 2,
4 and 8 kHz.
>15 dB HL difference between the poorest thresholds of 1 and 2 kHz, and those at 4 and
8 kHz and 0.25 and 0.5 kHz.
15-29 dB HL difference between the mean of 0.5 and 1 kHz and the mean of 4 and 8 kHz.
>30 dB HL difference between the mean of 0.5 and 1 kHz and the mean of 4 and 8 kHz.
<15 dB HL difference between the mean of 0.25, 0.5 kHz thresholds, the mean of 1 and
2 kHz and the mean of 4 and 8 kHz.
≤ 0.5 kHz
>0.5 kHz ≤ 2 kHz
>2 kHz ≤ 8 kHz
> 8 kHz
> 10 dB HL difference between the ears in at least two frequencies.
< 10 dB HL difference between the ears in all frequencies.
Present at birth
Before language development
After language development
Deterioration of >15 dB HL in the average over the frequencies of 0.5, 1, and 2 kHz within
a 10-year period.
Differences in above mentioned characteristics between families with hearing impairment
based on the same genetic defect.
Differences in above mentioned characteristics between family members with hearing
impairment based on the same genetic defect.
20 | Chapter 1
Whole exome sequencing
Successively sequencing single genes is laborious and time-consuming. Since the
beginning of this century novel techniques were introduced that can determine
the sequence of all exons (expressed region) by one test: whole exome sequencing
(WES) 23. The efficacy of these techniques has been improving gradually. WES has
become more cost-effective and result interpretation has been enhanced (i.e.
discrimination between a benign variants and causative mutations) over time 33.
Novel deafness- associated genes have already been discovered by WES, however,
single gene tests are still of practical significance to confirm the causative mutation 34.
The aforementioned method of Sanger sequencing seems to become outdated with
WES as replacement. However, Sanger sequencing is useful to determine which
variant is likely to be causative, and segregates with the disease in the family, or
whether a variant is inherited or de novo 27. One can also focus on a specific set of
genes via next generation sequencing; this is called targeted next generation
sequencing.
In 31-60% of the cases of hereditary hearing impairment, the causative mutation is
found by targeted next generation sequencing 35.
Main goals of otogenetic research
There are two main reasons to conduct otogenetic research. The first goal is to be
able to counsel a patient and its family on prognosis e.g. progression of the hearing
impairment and possible involvement of other organs. The second goal of
otogenetic research is to gain insight into the pathophysiological effects of a
mutated gene in the cochlea, which might eventually lead to a therapy for specific
types of hereditary hearing impairment. Gaining insight in pathophysiological
effects is mainly achieved by studying the protein function in the cochlea of
mouse and mouse mutants 36. Gaining insight into the function of a protein in the
human cochlea is supported by describing a genotype- phenotype correlation,
according to the characteristics of table 1. For example, age of onset and progression
can provide clues whether a protein is involved in developing a structure or in
maintenance of this structure. And by means of vestibular function tests the
involvement in the vestibular organ can be determined 37.
In order to better categorize hearing impairment and to evaluate cochlear function
in detail, de Leenheer et al. introduced the extensive psychophysical test battery
from Nijmegen38.
Introduction
| 21
Psychophysical tests
Psychophysical tests evaluate loudness perception, and spectral and temporal
processing.
Loudness perception is examined by means of loudness scaling. A stimulus is
presented with different intensities and the individual is asked to classify these
intensities from inaudible to unbearable loud. This test is based on the Würzburger
Hörfeld Skalierung developed by Moser 39.
Temporal processing is evaluated by means of gap detection. Stimuli are presented
randomly with a pause of variable lengths. The test individuals have to report
whether a pause is present within the stimulus 40, 41. Spectral processing is estimated
by means of a difference limen for frequency test. A stimulus is presented with
fluctuation of frequencies. The test person has to indicate whether the fluctuation
is present or not 40. These tests are combined with standard pure tone, speech and
speech in noise audiometry.
Schuknecht and Gacek introduced a categorization of hearing impairment 42. They
stated that there are four types of hearing impairment, each correlated to specific
structures of the inner ear. These four types are sensory, strial, neural and cochlear
conductive. Loss of hair cells would cause a sensory hearing impairment. A strial
hearing impairment would be caused by strial atrophy, while loss of cochlear
neurons would be the base of a neural hearing impairment. Cochlear conductive
hearing impairment is speculated to be caused by alteration in the physical aspects
of the cochlear duct 42.
Two of these four types have been identified by psychophysical testing. Patients with
Usher syndrome type 2a have been subjected to these psychophysical tests. When
compared to individuals with sensory hearing loss, comparable results were observed.
A sensory type of hearing impairment would be expected since USH2A is part of the
Usher interactome, which is essential for the morphogenesis of the hair bundle 43.
In patients with mutations in TECTA (DFNA8/12), a cochlear conductive hearing
impairment has been demonstrated. A parallel shift of the curves during loudness
scaling was seen, combined with normal ranged results of gap detection, difference
limen for frequency and speech reception in noise. DFNA8/12 patients perform
comparable to patients with DFNA13 (caused by mutations in COL11A2) 38, 44. Both
TECTA and COL11A2 are expressed in the tectorial membrane. Impaired protein
function can cause tectorial membrane dysfunction 45. These results are also seen
in patients with a conductive hearing loss where processing is not affected but
transduction of sound is.
These examples demonstrate the pathological effect of a mutated gene on the specific
structures in the cochlea. This knowledge can be important in the application of
different types of rehabilitation.
22 | Chapter 1
Counseling
When the genetic defect has been identified, the patient needs adequate counseling.
Genetic counseling is needed in order to communicate information about the
nature of the disease, inheritance mode and implications for possible mutation
carriers in the family 46. The nature of the disease includes the degree of hearing
impairment, prognosis and expectations on rehabilitation options 47, but also
possible additional symptoms. In this process, one should take cultural aspects,
socials needs and educational level into account 46. The nature of the disease is
important because it not only influences rehabilitation but also occupational
choices. In patients with syndromic hearing impairment counseling on early
detection and possible treatment of additional symptoms is necessary. In addition,
prevention or slowing down the progression of hearing loss might be possible, for
example in patients with an enlarged vestibular aqueduct or with an elevated
susceptibility for aminoglycoside induced hearing impairment 48.
Not much research has been done on the, mainly psychosocial, consequences of
genetic testing for hereditary hearing impairment 49. A recent evaluation, however,
suggests an increase in psychosocial well being after counseling on a positive
genetic test 50.
When hearing loss has been diagnosed and examined, rehabilitation options have to
be considered. Rehabilitation options for hereditary hearing impairment in general
vary from FM (frequency modulation) equipment for mild types of impairment,
hearing aids for mild to severe hearing losses and cochlear implantation for severe
to profound types of hearing impairment.
Different studies have focused on the results of rehabilitation in hereditary
hearing impairment. These studies are mainly evaluating cochlear implantation.
The results are difficult to interpret because the postoperative performance in
patients after cochlear implantation is influenced by many factors. DFNB1 is,
because of its high prevalence, the most commonly studied type of hereditary
hearing impairment with regard to results of cochlear implantation. Compared to
non-DFNB1 patients, patients with DFNB1 present with similar or better
performance results after cochlear implantation 51.
Eppsteiner et al. state that genetic defects that affect the spiral ganglion may result
in worse performance after cochlear implantation. This is supported by results of
two patients with mutations in TMPRSS3 52. However, Weegerink et al. reported seven
patients with fairly good speech recognition scores one year after implantation 53.
When such good results are achieved, Eppsteiner et al. hypothesize that the initial
good performance will diminish over time 52. The conclusion of this spiral ganglion
hypothesis can only be confirmed when larger numbers of patients are available,
including an extensive follow up.
Introduction
| 23
In general, the first results of cochlear implantation appear to be good in patients
with hereditary hearing impairment. However, more research needs to be done to
second this 54. The results of these studies are, amongst others, important for
counseling a patient on its expectations on performance after cochlear implantation.
Additionally, the right type and early start of rehabilitation is important for an
adequate speech and language development, but in general also for cognitive and
psycho-affective development 55. Research on the different rehabilitation options
in hereditary hearing impairment therefore deserves more attention.
Aim of this thesis
This thesis is aimed to contribute to the expanding knowledge on effects of
mutated deafness genes on hearing. As a result, this expansion of knowledge will
improve counseling on hereditary hearing impairment. The research described in
this thesis is focused on providing an overview of several types of currently known
autosomal recessive hereditary nonsyndromic types of hearing impairment. In
addition, novel genotype-phenotype correlations of autosomal recessive hearing
impairment types are described. This thesis also contributes to expanding an
already known genotype-phenotype correlation, that of DFNB1. Since the
knowledge on hereditary hearing impairment is expanding, the psychosocial
impact of an otogenetic diagnosis was evaluated as well.
Thesis outline
1.2 An overview of all, currently known autosomal recessive types of hereditary
hearing impairment.
2.1 OTOG and OTOGL are two deafness- associated genes that show large similarities
in expression and structures of the encoded protein. The audiometric characteristics of several families with mutations in either of these two genes are
evaluated and compared. In addition, psychophysical tests were performed to
evaluate the effect of mutations in these genes on the function of the cochlea.
2.2 A novel deafness- associated gene, CLIC5, which is expressed in several organs,
is found to be associated with autosomal recessive hearing impairment. In
this chapter, phenotypic and genotypic features of mutations in CLIC5 are
delineated.
2.3 USH1G is one of the genes known to cause Usher syndrome type I, when
mutated. All other genes involved in Usher syndrome type 1 are also known to
be involved in nonsyndromic hearing impairment. The audiometric, vestibular
24 | Chapter 1
3.
4.
5.
and ophthalmologic characteristics of an autosomal recessive nonsyndromic
form of hearing impairment caused by mutations in USH1G are described.
DFNB1 is the most common type of autosomal recessively inherited hearing
impairment. This type of hearing impairment is, therefore, extensively
studied. Inconsistent results on vestibular function and imaging characteristics in DFNB1 are described in literature. In this chapter, vestibular function
in combination with temporal bone imaging in DFNB1 patients are evaluated.
Knowledge on different types of hereditary hearing impairment is expanding,
however, knowledge on the impact of an otogenetic diagnosis lags behind.
This chapter focuses on the psychosocial impact of an otogenetic diagnosis on
patients with hearing impairment.
General discussion
Introduction
| 25
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
Taselaar M. Over binaurale selectieve versterking en de verstaanbaarheid van spraak 1959 [[31-12-2014].
Available from: http://www.audiologieboek.nl.
Guyton AC, Hall JE. The Sense of Hearing. Textbook of medical physiology. 112006. p. 651-62.
Fettiplace R, Kim KX. The physiology of mechanoelectrical transduction channels in hearing.
Physiological reviews. 2014;94(3):951-86.
Hudspeth AJ. Integrating the active process of hair cells with cochlear function. Nature reviews
Neuroscience. 2014;15(9):600-14.
Brigande JV, Heller S. Quo vadis, hair cell regeneration? Nature neuroscience. 2009;12(6):679-85.
Richardson GP, de Monvel JB, Petit C. How the genetics of deafness illuminates auditory physiology.
Annual review of physiology. 2011;73:311-34.
Jahan I, Pan N, Kersigo J, et al. Beyond generalized hair cells: molecular cues for hair cell types.
Hearing research. 2013;297:30-41.
Grote JJ, Frijns JHM. Anatomie en fysiologie van het oor. In: Huizing EH, Snow GB, editors. Leerboek
keel-, neus- en oorheelkunde. Houten: Bohn Stafleu van Loghum; 2005. p. 1-18.
Breneman KD, Brownell WE, Rabbitt RD. Hair cell bundles: flexoelectric motors of the inner ear. PloS
one. 2009;4(4):e5201.
Kingma H, Stokroos R, Manni JJ. Anatomie, fysiologie en onderzoek van het vestibulaire systeem. In:
Huizing EH, Snow GB, editors. Leerboek keel-, neus- en oorheelkunde. Houten: Bohn Stafleu van
Loghum; 2005.
Anniko M, Takumida M. Functional morphology of the normal peripheral vestibular system. In: Jahn
AF, Stantos- Sacchi J, editors. Physiology of the ear2001. p. 481-513.
Guyton AC, Hall JE. Cortical and brain stem controle of motor function. Textbook of medical
physiology. 112006. p. 685-97.
Buki B, Simon L, Garab S, et al. Sitting-up vertigo and trunk retropulsion in patients with benign
positional vertigo but without positional nystagmus. Journal of neurology, neurosurgery, and
psychiatry. 2011;82(1):98-104.
Morton CC, Nance WE. Newborn hearing screening--a silent revolution. The New England journal of
medicine. 2006;354(20):2151-64.
Goderis J, De Leenheer E, Smets K, et al. Hearing Loss and Congenital CMV Infection: A Systematic
Review. Pediatrics. 2014;134(5):972-82.
Van Camp G, Smith R. Hereditary Hearing Loss Homepage. 2014 [4-12-2014]. Available from: http://
hereditaryhearingloss.org
Kochhar A, Hildebrand MS, Smith RJ. Clinical aspects of hereditary hearing loss. Genetics in medicine
: official journal of the American College of Medical Genetics. 2007;9(7):393-408.
Smith RJH, Shearer AE, Hildebrand MS, et al. Deafness and Hereditary Hearing Loss Overview. In:
Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, et al., editors. GeneReviews(R).
Seattle (WA): University of Washington, Seattle. All rights reserved.; 1993.
Morton NE. Genetic epidemiology of hearing impairment. Annals of the New York Academy of
Sciences. 1991;630:16-31.
Wang Q, Xue Y, Zhang Y, et al. Genetic basis of Y-linked hearing impairment. American journal of
human genetics. 2013;92(2):301-6.
de Heer AM, Collin RW, Huygen PL, et al. Progressive sensorineural hearing loss and normal vestibular
function in a Dutch DFNB7/11 family with a novel mutation in TMC1. Audiology & neuro-otology.
2011;16(2):93-105.
Riazuddin S, Nazli S, Ahmed ZM, et al. Mutation spectrum of MYO7A and evaluation of a novel
nonsyndromic deafness DFNB2 allele with residual function. Human mutation. 2008;29(4):502-11.
Strachan T, Read A. Human Molecular Genetics. New York: Garland Science; 2011.
Solda G, Robusto M, Primignani P, et al. A novel mutation within the MIR96 gene causes non-syndromic
inherited hearing loss in an Italian family by altering pre-miRNA processing. Human molecular
genetics. 2012;21(3):577-85.
26 | Chapter 1
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
Mazzoli M, van Camp G, Newton V, et al. Recommendations for the description of genetic and
audiological data for families with nonsyndromic hereditary hearing impairment. available at http://
hereditaryhearinglossorg/. Accessed december 2014.
Génin E, Todorov AA. Homozygosity Mapping. eLS: John Wiley & Sons, Ltd; 2001.
Bailey-Wilson JE, Wilson AF. Linkage analysis in the next-generation sequencing era. Human heredity.
2011;72(4):228-36.
Mueller RF, Young ID. Emery’s Elements of Medical Genetics: Harcourt Publishers Limited; 2001.
Sanger F, Coulson AR. A rapid method for determining sequences in DNA by primed synthesis with
DNA polymerase. Journal of molecular biology. 1975;94(3):441-8.
Jorde LB, Carey JC, Bamshad MJ, et al. Medical Genetics: Mosby; 2003.
(ESP) NESP. Exome Variant Server 2015. Available from: http://evs.gs.washington.edu/EVS/.
Schuelke M, Schwarz JM, Seelow D. Mutation Taster. Available from: http://www.mutationtaster.org.
Neveling K, Feenstra I, Gilissen C, et al. A Post-Hoc Comparison of the Utility of Sanger Sequencing
and Exome Sequencing for the Diagnosis of Heterogeneous Diseases. Human mutation. 2013;34(12):
1721-6.
Diaz-Horta O, Duman D, Foster J, 2nd, et al. Whole-exome sequencing efficiently detects rare
mutations in autosomal recessive nonsyndromic hearing loss. PloS one. 2012;7(11):e50628.
Atik T, Bademci G, Diaz-Horta O, et al. Whole-exome sequencing and its impact in hereditary hearing
loss. Genetics research. 2015;97:e4.
Friedman LM, Dror AA, Avraham KB. Mouse models to study inner ear development and hereditary
hearing loss. The International journal of developmental biology. 2007;51(6-7):609-31.
Schraders M, Oostrik J, Huygen PL, et al. Mutations in PTPRQ are a cause of autosomal-recessive
nonsyndromic hearing impairment DFNB84 and associated with vestibular dysfunction. American
journal of human genetics. 2010;86(4):604-10.
De Leenheer EM, Bosman AJ, Kunst HP, et al. Audiological characteristics of some affected members
of a Dutch DFNA13/COL11A2 family. The Annals of otology, rhinology, and laryngology. 2004;113(11):
922-9.
Moser MM. Das Würzburger Hörfeld, ein Test für prothetische Audiometrie. HNO. 1987;35:318-21.
Oonk AM, Leijendeckers JM, Huygen PL, et al. Similar phenotypes caused by mutations in OTOG and
OTOGL. Ear and hearing. 2014;35(3):e84-91.
Moore BC. Temporal analysis in normal and impaired hearing. Annals of the New York Academy of
Sciences. 1993;682:119-36.
Schuknecht HF, Gacek MR. Cochlear pathology in presbycusis. The Annals of otology, rhinology, and
laryngology. 1993;102(1 Pt 2):1-16.
Leijendeckers JM, Pennings RJ, Snik AF, et al. Audiometric characteristics of USH2a patients.
Audiology & neuro-otology. 2009;14(4):223-31.
Plantinga RF, Cremers CW, Huygen PL, et al. Audiological evaluation of affected members from a
Dutch DFNA8/12 (TECTA) family. Journal of the Association for Research in Otolaryngology: JARO.
2007;8(1):1-7.
Legan PK, Lukashkina VA, Goodyear RJ, et al. A deafness mutation isolates a second role for the
tectorial membrane in hearing. Nature neuroscience. 2005;8(8):1035-42.
ACMG. Genetics Evaluation Guidelines for the Etiologic Diagnosis of Congenital Hearing Loss. Genetic
Evaluation of Congenital Hearing Loss Expert Panel. ACMG statement. Genetics in medicine : official
journal of the American College of Medical Genetics. 2002;4(3):162-71.
Wu CC, Liu TC, Wang SH, et al. Genetic characteristics in children with cochlear implants and the
corresponding auditory performance. The Laryngoscope. 2011;121(6):1287-93.
Matsunaga T. Value of genetic testing in the otological approach for sensorineural hearing loss. The
Keio journal of medicine. 2009;58(4):216-22.
Broadstock M, Michie S, Marteau T. Psychological consequences of predictive genetic testing: a
systematic review. European journal of human genetics : EJHG. 2000;8(10):731-8.
Palmer CG, Boudreault P, Baldwin EE, et al. Deaf genetic testing and psychological well-being in deaf
adults. Journal of genetic counseling. 2013;22(4):492-507.
Introduction
51.
52.
53.
54.
55.
| 27
Varga L, Kabatova Z, Masindova I, et al. Is deafness etiology important for prediction of functional
outcomes in pediatric cochlear implantation? Acta oto-laryngologica. 2014;134(6):571-8.
Eppsteiner RW, Shearer AE, Hildebrand MS, et al. Prediction of cochlear implant performance by
genetic mutation: the spiral ganglion hypothesis. Hearing research. 2012;292(1-2):51-8.
Weegerink NJ, Schraders M, Oostrik J, et al. Genotype-phenotype correlation in DFNB8/10 families
with TMPRSS3 mutations. Journal of the Association for Research in Otolaryngology: JARO. 2011;
12(6):753-66.
Vivero RJ, Fan K, Angeli S, et al. Cochlear implantation in common forms of genetic deafness.
International journal of pediatric otorhinolaryngology. 2010;74(10):1107-12.
Tomblin JB, Oleson JJ, Ambrose SE, et al. The influence of hearing aids on the speech and language
development of children with hearing loss. JAMA otolaryngology-- head & neck surgery. 2014;140(5):
403-9.
1.2
Features of autosomal recessive
nonsyndromic hearing impairment;
a review to serve as a reference
A.M.M. Oonk
P.L.M. Huygen
H.P.M. Kunst
H. Kremer
R.J.E. Pennings
Clinical Otolaryngology, Epub ahead of print
30 | Chapter 1
Abstract
Nonsyndromic sensorineural hearing impairment is inherited in an autosomal
recessive fashion in 75-85% of cases. To date, 61 genes with this type of inheritance
have been identified as related to hearing impairment, and the genetic
heterogeneity is accompanied by a large variety of clinical characteristics.
Adequate counseling on a patient’s hearing prognosis and rehabilitation is part of
the diagnosis on the genetic cause of hearing impairment and, in addition, is
important for the psychological well-being of the patient.
All articles describing clinical characteristics of the audiovestibular phenotypes of
identified genes and related loci have been reviewed.
This review aims to serve as a summary and a reference for counseling purposes
when a causative gene has been identified in a patient with a nonsyndromic
autosomal recessively inherited sensorineural hearing impairment.
Introduction
| 31
Prevalence and causes of hearing impairment
Hearing impairment is the most prevalent sensorineural disorder in developed
countries and also the most common birth defect. Approximately one out of every
1,000 newborns is born profoundly deaf and one out of every 300 newborns has a
permanent mild-to-profound congenital hearing impairment. In addition, for every
ten congenitally hearing impaired children, five to nine children will develop a
similar hearing loss before adulthood1-3. Globally, 360 million people have a
hearing impairment, which is defined as a hearing loss greater than 40 dB HL 4.
Hearing impairment can be acquired or inherited. In about half of early-onset
cases, it is inherited. Noise exposure is the most common environmental factor
that contributes to acquired hearing loss in adults. An individual’s susceptibility
to hearing loss caused by noise exposure is, in addition, a good example of gene-environment interaction 1.
Hereditary hearing impairment
More than half of prelingual hearing impairment cases occur due to genetic
factors. In 30% of cases, the hearing impairment is syndromic and accompanied by
other symptoms, and in 70% of cases it is nonsyndromic. The latter group of
hearing impairments can be divided by the mode of inheritance. Nonsyndromic
hearing impairments are autosomal recessively inherited in 75-85% of cases and
autosomal dominantly inherited in 15-24% of cases. The remaining 1-2%
demonstrate mitochondrial or X- or Y-linked inheritance. Currently, over 80 genes
and over 140 loci have been identified for nonsyndromic hearing impairment 5.
The loci are defined by the mode of inheritance and are designated by the letters
DFN (DeaFNess). DFN is followed by an A for autosomal dominant inheritance
(DFNA) and a B for autosomal recessive inheritance (DFNB). Both loci are affixed
with a number based on their order of identification/publication. Hereditary
hearing impairments with an X-linked inheritance are designated DFNX 2, 5-7. So
far, 61 genes have been identified for autosomal recessively inherited nonsyndromic
hearing impairment (arNSHI) 5. arNSHI is therefore highly heterogeneous, making
it difficult to give an overview of all of the related phenotypes.
32 | Chapter 1
Obtaining a genetic diagnosis of hereditary
hearing impairment
A genetic diagnosis of hereditary hearing impairment is currently much easier
established in the out-patient setting than it was a decade ago. An increasing
number of genes can now be sequenced on a regular basis, and high-throughput
techniques, such as massive parallel sequencing (e.g. Affymetrix array), are being
introduced in the clinic and will lead to easier identification of causative genes in
the near future. This is especially important for the identification of autosomal
recessive sensorineural hearing impairment in isolated cases and is therefore an
important step forward in obtaining a genetic diagnosis on hearing impairment
in these cases. In the Western world, most families are small and most cases,
therefore, are isolated. In these cases, other causes appear to be more obvious and
it is difficult to identify underlying genetic defects. Discovery of the genetic causes
of hearing impairment and subsequent counseling of patients has been shown to
improve scores on the scale of perceived personal control, depression and anxiety.
In other words, these patients experience an increase in their degree of psychological
well-being 8. It is important to know the genetic diagnosis if one wants to counsel
patients on, for example, prognosis of hearing impairment (“will my hearing loss
progress or not?”) on the outcomes of rehabilitation with, for example, cochlear
implantation and on the consequences for potential progeny 9.
Purpose of this review
This review presents a summary of the clinical characteristics of all currently known
nonsyndromic autosomal recessively inherited types of sensorineural hearing
impairment. For this purpose, all articles describing clinical characteristics of the
audiovestibular phenotype of identified genes and related loci have been reviewed.
This paper can be used for counseling purposes with patients in whom the causative
gene for autosomal recessive sensorineural hearing impairment has been identified.
The focus of this review is only on this type of hearing impairment. Other types,
such as dominant types, syndromic types and mixed hearing impairment are
outside its scope. However, it should be kept in mind that syndromic hearing
impairment can present at first with hearing impairment as its only feature.
Each type of arNSHI will be described by its age of onset, severity, progression,
audiogram configuration and associated vestibular function. The severity, affected
frequencies and audiogram configurations will be described according to GENDEAF
recommendations, which are described in Tables 1, 2 and 3, respectively 10.
Introduction
Table 1 Severity of hearing impairment
| 33
Table 2 Frequency ranges
Severity
Pure Tone Average
Frequencies
Mild
20-40 dB HL
Low
≤ 0.5 kHz
Moderate
41-70 dB HL
Mid
>0.5 ≤ 2 kHz
Severe
71-95 dB HL
High
>2 ≤ 8 kHz
Profound
>95 dB HL
Extended high
>8 kHz
Severity of hearing impairment (table 1) and frequency ranges (table 2) according to GENDEAF
recommendations 9.
Table 3 Audiogram configurations
Configuration
Low frequency ascending
>15 dB HL difference between the (poorer) lower frequencies
to the higher frequencies
Mid frequency U-shaped
(or cookie bite)
>15 dB HL difference between the (poorer) mid frequencies
and the lower and higher frequencies
Gently downsloping
15-29 db HL difference between the mean of 0.5 and 1 kHz
and the (poorer) mean of 4 and 8 kHz
Steeply downsloping
>30 dB HL difference between the mean of 0.5 and 1 kHz
and the (poorer) mean of 4 and 8 kHz
Flat
<15 dB HL difference between the mean of 0.25 and 0.5 kHz,
the mean of 1 and 2 kHz and the mean of 4 and 8 kHz.
Definition of different audiogram configurations according to GENDEAF recommendations 9.
First, the most common type of arNSHI, DFNB1, will be described. This will be
followed by a description of the most prevalent phenotype of arNSHI: prelingual
profound hearing impairment. The remaining phenotypes, with different, more
specific characteristics, will then be described and, finally, two auditory neuropathy spectrum disorders with autosomal recessive inheritance will be described.
GJB2/GJB6 (DFNB1)
DFNB1 is caused by mutations in GJB2 and/or GJB6. Both genes are found at the same
locus, and mutations in both genes can cause hearing impairment. It was suggested
that DFNB1 may have a digenic inheritance pattern; however, the data of Wilch
et al. indicate that it does not 11. DFNB1 is known for its high prevalence around
the world. The percentage of hereditary hearing impairments caused by mutations
in GJB2/GJB6 varies by geographical location. A range of 18-41% has been reported
34 | Chapter 1
for Europe, Northern America, Australia, the Middle East and East Asia. In Southern
Europe, GJB2 mutations are found more frequently than in Northern or Central
Europe (where carrier frequencies are 1:35 and 1:79, respectively). The latter
correlates with the prevalences found in North America and Australia 12. DFNB1 is
encountered less frequently in Iran and India (15%), and even less so in Pakistan
(6%) 13,14. The high carrier prevalence has led different studies to recommend
sequencing of GJB2 and screening for deletions in GJB6 as a first step in cases of
suspected autosomal recessive inheritance or in isolated cases of congenital or
prelingual nonsyndromic hearing impairment 15, 16. This strategy has a sensitivity
of over 98%. Therefore, when no mutations are found with this strategy, other
genetic causes are highly likely 17.
DFNB1 has most often a congenital and prelingual onset. In most cases, hearing
impairment in DFNB1 is congenital and is reported to be stable or only slightly
progressive. However, when the onset is not congenital, hearing impairment can
be very progressive. The audiogram configuration is flat to downsloping, though
this is not pathognomonic. There is a large variability in severity that is reported
to range from mild to profound 14. Snoeckx et al. 18 concluded that truncating
mutations are associated with a higher degree of hearing impairment than
non-truncating mutations in a large multicenter study of 1,531 DFNB1 patients. In
addition, the authors also stated that the pathogenicity of missense mutations
depends on the position and nature of the substitution. This is one of the possible
explanations for the substantial phenotypic variability among cases with different
mutations in the same gene, which is not only applicable to DFNB1. Due to the
large variability in phenotypes, it may be difficult to give prognostic information
regarding hearing impairments 19. Such information should only be provided to
the DFNB1 patient who carries a specific combination of GJB2/GJB6 mutations for
which reliable evidence regarding the genotype-phenotype correlation is available.
The most prevalent and important mutation combinations have been explored in
this respect in the multicenter study by Snoeckx et al. 18. The predominant
phenotype was associated with homozygous 35delG mutations: the audiometric
configuration was fairly similar to the one shown in Fig. 2D for CDH23 mutations.
So far, only limited research on vestibular function in DFNB1 patients has been
published, which is remarkable considering its high prevalence. There is no
consensus in the literature on vestibular function in DFNB1 20-22. Further evaluation
of vestibular function in larger numbers of DFNB1 patients is clearly needed to
reach a more definitive conclusion on vestibular function in DFNB1.
Introduction
| 35
Severe to profound hearing impairment
Aside from GJB2/GJB6 (DFNB1), 31 other genes have been identified that can be
associated with prelingual severe to profound sensorineural hearing impairments.
Supplemental Table 1 describes the phenotypes of these genes when they have
mutations. Because all of these phenotypes are described as severe to profound
hearing impairments, it is difficult to clinically differentiate between them. In
addition, the manner in which the severity of each hearing impairment was
assessed is often not clearly described, and audiograms are also frequently missing
in articles reporting on the identification of novel deafness– associated genes.
Some of these genes will be discussed briefly here due to their relatively high
prevalence of mutations, reported variable onset of the hearing impairment and
associated vestibular dysfunction.
MYO15A (DFNB3)
MYO15A (DFNB3) is, after GJB2/GJB6, the gene that has been found to be mutated
most often in patients with prelingual, severe to profound sensorineural arNSHI
without vestibular dysfunction. So far, approximately 28 different mutations of
this gene have been reported in more than 50 families 6.
TMC1 (DFNB7/11)
Another frequent cause of prelingual or postlingual severe to profound sensorineural
arNSHI are mutations in TMC1 (DFNB7/11)23. Thus far, approximately 21 different
mutations have been reported and over 50 families with prelingual severe to profound
hearing impairments due to DFNB7/11 have been described. This is similar to the
phenotype seen in TMC1 knockout mice 24. DFNB7/11 can also present with postlingual
hearing impairment, as described by de Heer et al. (Supplemental table 1). The
hearing impairment in this specific family occurs after 4 years of age in the high
frequencies and progresses rapidly in the first 3 decades to a profound hearing
impairment. The authors suggest that this may be related to mutations that do not
completely abolish normal splicing of TMC1 mRNA or to a truncated protein that
still has some residual function 25.
MYO7A (DFNB2)
It has been reported that severe-to-profound sensorineural hearing impairment
due to DFNB2 can have a congenital onset but can also go unnoticed until up to 16
years of age. Balance problems and vestibular dysfunction on caloric testing have
been described 26. DFNB2 has only been described in seven families and not in the
Caucasian population 27. In addition to DFNB2, mutations in MYO7A can also cause
Usher syndrome type 1b, a congenital form of deafblindness with profound deafness,
36 | Chapter 1
vestibular areflexia and retinitis pigmentosa as characteristic features. Riazuddin
et al. stated that DFNB2 is associated with residual protein function of myosin
VIIA, whereas mutations in MYO7A that cause Usher syndrome type 1b lead to no
residual function of the mutated protein 28.
ESPN (DFNB36) and MYO6 (DFNB37)
Mutations in ESPN and MYO6 result in a phenotype with severe to profound prelingual
sensorineural hearing loss and variable vestibular function, ranging from normal
to complete vestibular areflexia. In addition to this, mutations in MYO6 are also
reported to cause mild, not further specified, facial dysmorphic features. Defects
in MYO6 have only been reported to cause arNSHI in 3 Pakistani families. DFNB36
has only been described in three families from Pakistan and Morocco 29-31.
Autosomal recessive hearing impairment with
characteristic features (Figure 1A-D).
STRC (DFNB16)
Patients with hearing impairment caused by mutations in STRC generally have a
mild to moderate, gently downsloping audiogram. The hearing impairment has an
early childhood onset and remains stable over time. It can, however, also be more
severe (up to profound). Vestibular abnormalities are not reported 32. Francey et al.
suggest that STRC mutations might greatly contribute to mild to moderate hearing
impairments in the pediatric population worldwide, because the prevalence of
STRC deletions in a GJB2 negative cohort was approximately 5.5% 33. Thus far, 20
families with DFNB16 have been identified.
GRXCR2 (DFNB101)
DFNB101 is another recently discovered type of arNSHI that presents with moderate
hearing loss and a gently downsloping audiogram configuration. The hearing
impairment is usually diagnosed at the age of two years and is reported as being
progressive. Balance problems have not been observed 34.
OTOGL (DFNB84B)
Mutations in OTOGL cause a prelingual hearing impairment; one patient failed the
neonatal hearing screening and his siblings were subsequently diagnosed with
hearing loss at 2 and 3 years of age. The hearing impairment is mild to moderate
and stable, and has a flat to gently downsloping configuration. Vestibular hypofunction is seen in DFNB84B patients, resulting in delayed motor milestones 35.
DFNB84B is phenotypically similar to DFNB18B.
Introduction
| 37
OTOG (DFNB18B)
DFNB18B presents with a prelingual sensorineural hearing impairment that
causes delayed speech development. The hearing impairment begins as mild to
moderate but can be slightly progressive after the second decade 35. The audiogram
configuration is flat to gently downsloping. Delayed motor milestones have been
reported and bilateral weakness has been observed during caloric testing. The
resemblance between DFNB18B and DFNB84B is probably a result of similarities in
the structure and expression of otogelin and otogelin-like, the protein products of
OTOG and OTOGL, respectively, in the inner ear.
GJB3
GJB3 is reported to be primarily seen in non-consanguineous Chinese families.
The related hearing impairment occurs prelingually or in early childhood and is
moderate in severity with a flat audiogram configuration. Vestibular problems have
not been reported 36.
A
dB
-10
0
CABP2
CDH23
GIPC3
GJB3
GRXCR1
OTOG
OTOGL
PJVK
PTPRQ
SERPINB6
TECTA
20
40
60
80
100
120
140
.25
20
CABP2
GIPC3
TECTA
40
60
80
100
120
140
.5
1
2
4
CDH23
CLIC5
GIPC3
GRXCR1
GRXCR2
LOXHD1
MYO3A
OTOG
OTOGL
PJVK
SERPINB6
SLC26A4
STRC
USH1G
20
40
60
80
100
120
140
.5
1
2
4
.25
8 kHz
C
dB
-10
0
.25
B
dB
-10
0
8 kHz
.5
1
2
4
8 kHz
D
dB
-10
0
20
40
60
80
100
CLIC5
SERPINB6
TMPRSS3
120
140
.25
.5
1
2
4
8 kHz
Figure 1 A-D Examples of audiogram configurations. The Y-axis indicates hearing
thresholds (dB HL). On the right, the genes that, when mutated, can present with
that type of audiogram configuration are listed. The X-axis indicates thefrequencies
(kHz). A. Flat. B. U-shape. C. Gently downsloping. D. Steeply downsloping in the
high frequencies.
38 | Chapter 1
GRXCR1 (DFNB25)
In DFNB25, patients have a moderate to severe hearing impairment with a flat to
gently downsloping audiogram configuration. This can progress until the hearing
impairment is profound. This hearing impairment is defined as congenital because
the patients failed their neonatal hearing screenings or had delayed speech
development. The hearing thresholds of patients with DFNB25 are displayed in
figure 2A. Vestibular dysfunction is noted in some DFNB25 patients, who had
normal motor milestones with later difficulties in motor development or abnormal
rotatory chair test results 37.
USH1G
A downsloping audiogram configuration is also seen in patients with hearing
impairment due to mutations in USH1G. One Dutch family with two affected siblings
presented with a nonsyndromic, moderate hearing impairment with an onset at
around 4 years of age. A mild progression in hearing thresholds, especially in the
higher frequencies, was found. Electronystagmography showed normal vestibular
responses to rotatory and caloric stimulation. An ophthalmologic examination
found no abnormalities, and, specifically, no signs of retinitis pigmentosa 38.
LOXHD1 (DFNB77)
When LOXHD1 is the causative gene for hearing impairment, the audiogram shows
a flat configuration in all frequencies or a downsloping configuration in the lower
frequencies and flat configuration in the mid and high frequencies. The hearing
impairment is reported to be congenital as well as postlingual (at 7-8 years of age),
and its level is moderate but can progress to a profound hearing impairment. Age
Related Typical Audiograms (ARTA) for DFNB77 are shown in figure 2B. DFNB77
has, so far, only been reported in 6 families, including two Ashkenazi Jewish
families 39-42.
TECTA (DFNB21)
When TECTA is mutated, a prelingual moderate to severe hearing impairment is
reported. DFNB21 presents with a distinct U-shaped audiogram configuration and
is stable 43. It has been reported to present unilaterally in one DFNB21 patient 44.
CAPB2 (DFNB93)
A flat to U-shaped audiogram can also be seen in patients with DFNB93. The level
of the hearing impairment is moderate to severe, and it is stable and reported to
have a prelingual onset 45, 46.
Introduction
A
dB
-10
0
B
dB
-10
0
GRXCR1
C
dB
-10
0
LOXHD1
ATD 1.1-1.7 (n.s.)
20
20
20
40
40
40
60
60
80
80
100
100
120
120
140
140
.25
.5
1
2
4
8 kHz
120
.5
1
2
4
8 kHz
.25
20
40
40
40
60
60
60
80
80
80
100
100
120
120
140
140
2
4
.25
8 kHz
4
.5
1
8 kHz
MYO3A
ATD 0.9-1.2
S 0.5, 8 kHz
30
40
50
60
70
2
4
8 kHz
120
140
.25
.5
1
2
4
8 kHz
H
dB
-10
0
SERPINB6
ATD 0.1-1.7 (n.s.)
20
2
100
10
20
30
G
dB
-10
0
1
F
dB
-10
0
20
1
.5
E
SLC26A4
20
.5
10
20
30
40
50
60
80
100
140
.25
dB
-10
0
CDH23
.25
PTPRQ
ATD 0.9-1.3 (all S)
60
20
30
40
50
60
D
dB
-10
0
| 39
40
60
60
25
35
45
55
100
120
ATD 0.1-1.6
S 2-4 kHz
20
40
80
PJVK
140
5
15
25
80
100
120
140
.25
.5
1
2
4
8 kHz
.25
.5
1
2
4
8 kHz
Figure 2 A. Mean thresholds and standard deviations of all known patients with
DFNB25 (GRXCR1), age ranges from 10-25 years. B. Age Related Typical Audiograms
(ARTA) for DFNB77 (LOXHD1). C. ARTA for DFNB84A (PTPRQ). Significant Annual
Threshold Deterioration (ATD, in dB per year) is shown in the graph. D. Mean thresholds
and standard deviations for all known patients with DFNB12 (CDH23). E. ARTA for
DFNB4 (SLC26A4). F. ARTA for DFNB30 (MYO3A), significant ATD at 0.5 and 8 kHz. G. ARTA
for DFNB91 (SERPINB6); ATD is not significant. H. ARTA for DFNB59 (PJVK) with
significant ATD at 2 and 4 kHz.
40 | Chapter 1
GIPC3 (DFNB15/72/95)
Mutations in GIPC3 cause an early onset (3-11 months of age) hearing impairment
that can present with several audiogram configurations, including flat, gently
downsloping and U-shaped. The hearing impairment is reported to be stable. The
level of the hearing impairment is generally severe to profound, but moderate
levels have also been observed. Vestibular problems have not been reported 47.
TMPRSS3 (DFNB8/10)
Mutations in TMPRSS3 can present with a very characteristic steeply sloping or
ski-slope audiogram configuration (figure 1D). In our clinic, approximately 25% of
arNSHI that display a ski slope audiogram configuration can be explained by
mutations in TMPRSS3 [unpublished data]. The hearing impairment is progressive
and eventually leads to a flat profound hearing loss. It is designated as DFNB8
when the onset of the hearing impairment is postlingual (5-12 years) and DFNB10
when the onset is prelingual (0-1.5 years). The severity of mutations in TMPRSS3
predicts how the hearing impairment will present. When mutations cause a greater
change within the protein, patients can present with a prelingual severe to profound
hearing impairment without the characteristic audiogram configuration. Balance
problems have not been reported. Although Weegerink et al. observed vestibular
hyporeflexia and hyperreflexia during electronystagmography in some cases, the
overall prevalence was not above chance level 48.
PTPRQ (DFNB84A)
DFNB84A is characterized by a congenital, moderate hearing impairment with a
flat configuration that deteriorates over time to a profound hearing impairment
(figure 2C). Normal motor milestone are reported; however, vestibular dysfunction
(hyporeflexia or areflexia) may occur. Another feature is that variation is seen in
the severity of hearing impairments and vestibular problems between affected
family members within one family 49, 50.
CLIC5 (DFNB102)
Mutations in CLIC5 present with an early onset hearing impairment; patients
passed the neonatal hearing screening but failed otoacoustic emissions (OAEs)
testing after 4 months. The hearing impairment is initially mild and progresses
within the first decade to severe to profound levels. The audiogram configuration
is gently to steeply downsloping. The vestibular phenotype is probably also progressive
because motor milestones were not delayed, however later in life balance problems
occurred. Electronystagmography showed complete vestibular areflexia and associated
balance problems with increasing age. In addition, signs of a mild subclinical
nephropathy were seen in one patient 51.
Introduction
| 41
SYN4 (DFNB76)
DFNB76 presents with an early onset (congenital- 6 years of age), progressive hearing
impairment. The audiogram is configuration is steeply sloping. DFNB76 has been
reported in two Iraqi Jew families52.
CDH23 (DFNB12)
Another type of arNSHI that may present with a progressive hearing impairment,
though without vestibular problems, is DFNB12. DFNB12 is a prelingual hearing
impairment that mainly affects the high frequencies, but the audiogram
configuration can range from flat to downsloping. The hearing impairment may
progress from moderate to profound (figure 2D); however, the hearing impairment
can also be stable and severe to profound 53. Miyagawa et al. reported that the onset
of the hearing impairment can occur at a later age (2-60 years of age) in addition to
a prelingual onset 54. Vestibular problems were not reported 55. Because CDH23 is
also involved in Usher syndrome type 1D, an ophthalmologic evaluation should be
considered. Pennings et al. reported abnormal fundoscopic findings in two DFNB12
patients who were not typical for retinitis pigmentosa, and the patients had
normal vision 53. Mutations in CDH23 have been described frequently in arNSHI
patients and in the Caucasian population 6.
SLC26A4 (DFNB4)
Worldwide, DFNB4 is, like DFNB1, a common cause of deafness 6. It is usually characterized
by an enlarged vestibular aqueduct (EVA) or an incomplete partition type II (classic
Mondini dysplasia). These temporal bone abnormalities may occur unilaterally or
bilaterally 56, 57 and cause progressive, fluctuating or stable hearing impairments
that may present at birth. Hearing impairments range from mild to profound and
may be purely sensorineural or mixed in nature (figure 2E). The latter occurs in
combination with a normal tympanogram 58. Head trauma, even if mild, can lead
to a sudden loss of hearing 59. Vestibular symptoms, such as vertigo, may also occur.
Mutations in SLC26A4 can also cause Pendred syndrome, which is marked by the
presence of thyroid dysfunction and/or possible development of goiter. Differentiating
between DFNB4 and Pendred syndrome can be difficult at young ages because the
thyroid dysfunction usually appears in the second decade 58, 60, 61.
MYO3A (DFNB30)
One consanguineous Iraqi family has been reported to have DFNB30. The hearing
impairment often presented in the second decade, but the age of onset varied between
family members. A moderate hearing impairment that progressed to a profound
hearing impairment, with a downsloping audiogram configuration, was observed
(figure 2F). No vestibular problems were reported 62.
42 | Chapter 1
BDP1 (DFNB49)
A consanguineous family from Qatar was described to have a post-lingual, moderate
to severe, mildly progressive hearing impairment. The audiogram demonstrated
a gently downsloping configuration 63.
SERPINB6 (DFNB91)
DFNB91 is reported to have an onset at over 20 years of age. The hearing impairment
is moderate to severe, and flat or gently to steeply downsloping audiogram
configurations have been observed. This hearing impairment is progressive (figure 2G)
and vestibular symptoms have not been reported. Thus far, this type has only been
found in one consanguineous Turkish family 64.
Autosomal recessive auditory neuropathy
spectrum disorder
An auditory neuropathy is characterized by absent auditory brainstem responses
and intact OAEs and/ or cochlear microphonics 65. These OAEs may disappear at
later age 66. One should be aware that children with an auditory neuropathy
spectrum disorder (ANSD) may be missed at neonatal hearing screenings because,
in many countries, screening is performed using OAEs 66, 67. Currently, mutations
in two genes are known to cause ANSD with prelingual mild to profound hearing
impairments (Supplemental Table 3).
DFNB9 (OTOF) occurs as a prelingual (<2 years) mild to profound hearing
impairment 66, 68. Mutations in OTOF are frequently found in autosomal recessive
hearing impairments 6. Although one would be inclined to expect unfavorable
results with cochlear implantation in patients with ANSD, good post-implant
results have been reported for patients with DFNB9 69, 70. Mutations in OTOF can also
cause temperature-sensitive nonsyndromic ANSD. Patients with this type of ANSD
have normal hearing or a mild hearing impairment when afebrile. When febrile,
hearing levels are reduced to a severe or profound level and return to normal when
the fever diminishes 71.
Another gene that is involved in ANSD is PJVK (DFNB59). DFNB59 is known for
causing a prelingual moderate to profound sensorineural hearing impairment.
The hearing impairment can be stable or progress over time. The audiogram
configuration is flat to gently downsloping (figure 2H). DFNB59 does not always
present as ANSD. Delmaghani et al. have, in fact, been the only researchers to
report that OAEs were present 72. Vestibular dysfunction is not commonly noted in
patients with PJVK mutations, but central vestibular dysfunction was reported by
Ebermann et al. 73.
Introduction
| 43
Vestibular phenotypes
In addition to the various hearing characteristics, a vestibular phenotype can also
be a characteristic of a genetic dysfunction. Mutations in ten genes are known to
cause vestibular problems in addition to hearing impairments, all of which have
been described above. For severe prelingual hearing impairments, vestibular
problems have been reported for DFNB2 (MYO7A) 27, DFNB36 (ESPN) 30 and DFNB37
(MYO6) 29. For progressive hearing impairments, hyporeflexia and areflexia were
found in DFNB84A (PTPRQ) 49 and DFNB102 (CLIC5) 51. Flat to downsloping audiogram
configurations can be accompanied by vestibular dysfunction in DFNB18B (OTOG),
DFNB84B (OTOGL) and DFNB25 (GRXCR1) 35, 37. In DFNB4 (SLC26A4), taking into account the
anatomical abnormalities, vestibular dysfunction can be expected to occur 58, 60, and
for auditory neuropathies, central vestibular dysfunction is reported in DFNB59
(PJVK) 73.
Essence of genotype- phenotype correlations
Many novel deafness- associated genes have been described in the literature, but
the articles often lack important additional information, particularly those characteristics that are essential to providing proper counseling to patients regarding
future expectations for their hearing impairment when the causative genetic defects
are identified. Therefore, we advocate for the inclusion of a thorough phenotype
description in all articles about the genetics of hearing loss. Such a description
should include the age of onset, severity, progression of hearing impairment,
audiogram configuration and vestibular function according to GENDEAF recommendations. The latter, especially, can be a distinctive feature. One should keep in
mind that vestibular problems are not always reported by patients, who often
compensate well for vestibular dysfunction 74. Extensive vestibular examination
including vHIT, caloric testing, and otolith function tests should, therefore, be
routinely performed for a number of patients in genotype-phenotype correlation
descriptions.
44 | Chapter 1
Conclusion
Counseling of patients with hereditary hearing impairment is important because
it informs them about the prognosis of their hearing loss, and on the implications
for their progeny. This review of different types of autosomal recessively inherited
nonsyndromic hearing impairment can serve as a reference for this purpose.
Many articles on the identification of novel deafness- associated genes often lack
exact and thorough data on clinical features. Therefore, we recommend a thorough
genotype-phenotype description be included in such articles.
Introduction
| 45
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Kochhar A, Hildebrand MS, Smith RJ. Clinical aspects of hereditary hearing loss. Genetics in medicine:
official journal of the American College of Medical Genetics. 2007;9(7):393-408.
Van Camp G, Willems PJ, Smith RJ. Nonsyndromic hearing impairment: unparalleled heterogeneity.
American journal of human genetics. 1997;60(4):758-64.
Morton CC, Nance WE. Newborn hearing screening--a silent revolution. The New England journal of
medicine. 2006;354(20):2151-64.
WHO. Deafness and hearing loss 2013 [updated february 2013; cited 2013 11 september 2013].
N300:[Available from: http://www.who.int/mediacentre/factsheets/fs300/en/.
Van Camp G, Smith RJ. Hereditary Hearing Loss homepage 2015 [updated May 13th, 2015]. Available
from: http://hereditaryhearingloss.org/.
Hilgert N, Smith RJ, Van Camp G. Forty-six genes causing nonsyndromic hearing impairment: which
ones should be analyzed in DNA diagnostics? Mutat Res. 2009;681:189-96.
Shearer AE, Hildebrand MS, Sloan CM, et al. Deafness in the genomics era. Hear Res. 2011;282(1-2):1-9.
Palmer CG, Boudreault P, Baldwin EE, et al. Deaf genetic testing and psychological well-being in deaf
adults. Journal of genetic counseling. 2013;22(4):492-507.
Wu CC, Liu TC, Wang SH, et al. Genetic characteristics in children with cochlear implants and the
corresponding auditory performance. The Laryngoscope. 2011;121(6):1287-93.
Mazzoli M, van Camp G, Newton V, et al. GENDEAF recommendation; Recommendations for the
description of genetic and audiological data for families with nonsyndromic hereditary hearing
impairment 2003. Available from: http://hereditaryhearingloss.org/main.aspx?c=.HHH&n=86638&ct=
79051&e=235141.
Wilch E, Zhu M, Burkhart KB, et al. Expression of GJB2 and GJB6 is reduced in a novel DFNB1 allele.
American journal of human genetics. 2006;79(1):174-9.
Kemperman MH, Hoefsloot LH, Cremers CW. Hearing loss and connexin 26. Journal of the Royal
Society of Medicine. 2002;95(4):171-7.
Kenneson A, Van Naarden Braun K, Boyle C. GJB2 (connexin 26) variants and nonsyndromic
sensorineural hearing loss: a HuGE review. Genetics in medicine : official journal of the American
College of Medical Genetics. 2002;4(4):258-74.
del Castillo FJ, del Castillo I. The DFNB1 subtype of autosomal recessive non-syndromic hearing
impairment. Frontiers in bioscience : a journal and virtual library. 2011;16:3252-74.
Pandya A, Arnos KS, Xia XJ, et al. Frequency and distribution of GJB2 (connexin 26) and GJB6 (connexin
30) mutations in a large North American repository of deaf probands. Genetics in medicine : official
journal of the American College of Medical Genetics. 2003;5(4):295-303.
Ardle BM, Bitner-Glindzicz M. Investigation of the child with permanent hearing impairment.
Archives of disease in childhood Education and practice edition. 2010;95(1):14-23.
Hoefsloot LH, Roux AF, Bitner-Glindzicz M. EMQN Best Practice guidelines for diagnostic testing of
mutations causing non-syndromic hearing impairment at the DFNB1 locus. European journal of
human genetics : EJHG. 2013.
Snoeckx RL, Huygen PL, Feldmann D, et al. GJB2 mutations and degree of hearing loss: a multicenter
study. American journal of human genetics. 2005;77(6):945-57.
Angeli SI. Phenotype/genotype correlations in a DFNB1 cohort with ethnical diversity. The
Laryngoscope. 2008;118(11):2014-23.
Todt I, Hennies HC, Basta D, et al. Vestibular dysfunction of patients with mutations of Connexin 26.
Neuroreport. 2005;16(11):1179-81.
Dodson KM, Blanton SH, Welch KO, et al. Vestibular dysfunction in DFNB1 deafness. American journal
of medical genetics Part A. 2011;155A(5):993-1000.
Kasai M, Hayashi C, Iizuka T, et al. Vestibular function of patients with profound deafness related to
GJB2 mutation. Acta oto-laryngologica. 2010;130(9):990-5.
46 | Chapter 1
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
Hildebrand MS, Kahrizi K, Bromhead CJ, et al. Mutations in TMC1 are a common cause of DFNB7/11
hearing loss in the Iranian population. The Annals of otology, rhinology, and laryngology. 2010;
119(12):830-5.
Lin X. Perception of sound and gravity by TMC1 and TMC2. The Journal of clinical investigation.
2011;121(12):4633-6.
de Heer AM, Collin RW, Huygen PL, et al. Progressive sensorineural hearing loss and normal vestibular
function in a Dutch DFNB7/11 family with a novel mutation in TMC1. Audiology & neuro-otology.
2011;16(2):93-105.
Zina ZB, Masmoudi S, Ayadi H, et al. From DFNB2 to Usher syndrome: variable expressivity of the same
disease. American journal of medical genetics. 2001;101(2):181-3.
Hildebrand MS, Thorne NP, Bromhead CJ, et al. Variable hearing impairment in a DFNB2 family with
a novel MYO7A missense mutation. Clinical genetics. 2010;77(6):563-71.
Riazuddin S, Nazli S, Ahmed ZM, et al. Mutation spectrum of MYO7A and evaluation of a novel
nonsyndromic deafness DFNB2 allele with residual function. Human mutation. 2008;29(4):502-11.
Ahmed ZM, Morell RJ, Riazuddin S, et al. Mutations of MYO6 are associated with recessive deafness,
DFNB37. American journal of human genetics. 2003;72(5):1315-22.
Naz S, Griffith AJ, Riazuddin S, et al. Mutations of ESPN cause autosomal recessive deafness and
vestibular dysfunction. Journal of medical genetics. 2004;41(8):591-5.
Boulouiz R, Li Y, Soualhine H, et al. A novel mutation in the Espin gene causes autosomal recessive
nonsyndromic hearing loss but no apparent vestibular dysfunction in a Moroccan family. American
journal of medical genetics Part A. 2008;146A(23):3086-9.
Villamar M, del Castillo I, Valle N, et al. Deafness locus DFNB16 is located on chromosome 15q13-q21
within a 5-cM interval flanked by markers D15S994 and D15S132. American journal of human
genetics. 1999;64(4):1238-41.
Francey LJ, Conlin LK, Kadesch HE, et al. Genome-wide SNP genotyping identifies the Stereocilin
(STRC) gene as a major contributor to pediatric bilateral sensorineural hearing impairment. American
journal of medical genetics Part A. 2012;158A(2):298-308.
Imtiaz A, Kohrman DC, Naz S. A Frameshift Mutation in GRXCR2 Causes Recessively Inherited
Hearing Loss. Human mutation. 2014;35(5):618-24.
Oonk AM, Leijendeckers JM, Huygen PL, et al. Similar phenotypes caused by mutations in OTOG and
OTOGL. Ear Hear. 2014;35(3):e84-91.
Liu XZ, Xia XJ, Xu LR, et al. Mutations in connexin31 underlie recessive as well as dominant
non-syndromic hearing loss. Human molecular genetics. 2000;9(1):63-7.
Schraders M, Lee K, Oostrik J, et al. Homozygosity mapping reveals mutations of GRXCR1 as a cause of
autosomal-recessive nonsyndromic hearing impairment. American journal of human genetics.
2010;86(2):138-47.
Oonk AM, van Huet RA, Leijendeckers JM, et al. Nonsyndromic hearing loss caused by USH1G
mutations: widening the USH1G disease spectrum. Ear Hear. 2015;36(2):205-11.
Diaz-Horta O, Duman D, Foster J, 2nd, et al. Whole-exome sequencing efficiently detects rare
mutations in autosomal recessive nonsyndromic hearing loss. PloS one. 2012;7(11):e50628.
Grillet N, Schwander M, Hildebrand MS, et al. Mutations in LOXHD1, an evolutionarily conserved
stereociliary protein, disrupt hair cell function in mice and cause progressive hearing loss in humans.
American journal of human genetics. 2009;85(3):328-37.
Edvardson S, Jalas C, Shaag A, et al. A deleterious mutation in the LOXHD1 gene causes autosomal
recessive hearing loss in Ashkenazi Jews. American journal of medical genetics Part A.
2011;155A(5):1170-2.
Vozzi D, Morgan A, Vuckovic D, et al. Hereditary hearing loss: a 96 gene targeted sequencing protocol
reveals novel alleles in a series of Italian and Qatari patients. Gene. 2014;542(2):209-16.
Meyer NC, Alasti F, Nishimura CJ, et al. Identification of three novel TECTA mutations in Iranian
families with autosomal recessive nonsyndromic hearing impairment at the DFNB21 locus. American
journal of medical genetics Part A. 2007;143A(14):1623-9.
Introduction
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
| 47
Dodson KM, Georgolios A, Barr N, et al. Etiology of unilateral hearing loss in a national hereditary
deafness repository. American journal of otolaryngology. 2012;33(5):590-4.
Schrauwen I, Helfmann S, Inagaki A, et al. A mutation in CABP2, expressed in cochlear hair cells,
causes autosomal-recessive hearing impairment. American journal of human genetics. 2012;91(4):636-45.
Tabatabaiefar MA, Alasti F, Shariati L, et al. DFNB93, a novel locus for autosomal recessive moderate-to-severe hearing impairment. Clinical genetics. 2011;79(6):594-8.
Charizopoulou N, Lelli A, Schraders M, et al. Gipc3 mutations associated with audiogenic seizures
and sensorineural hearing loss in mouse and human. Nature communications. 2011;2:201.
Weegerink NJ, Schraders M, Oostrik J, et al. Genotype-phenotype correlation in DFNB8/10 families
with TMPRSS3 mutations. Journal of the Association for Research in Otolaryngology : JARO.
2011;12(6):753-66.
Schraders M, Oostrik J, Huygen PL, et al. Mutations in PTPRQ are a cause of autosomal-recessive
nonsyndromic hearing impairment DFNB84 and associated with vestibular dysfunction. American
journal of human genetics. 2010;86(4):604-10.
Shahin H, Rahil M, Abu Rayan A, et al. Nonsense mutation of the stereociliar membrane protein gene
PTPRQ in human hearing loss DFNB84. Journal of medical genetics. 2010;47(9):643-5.
Seco CZ, Oonk AM, Dominguez-Ruiz M, et al. Progressive hearing loss and vestibular dysfunction
caused by a homozygous nonsense mutation in CLIC5. European journal of human genetics : EJHG.
2014.
Horn HF, Brownstein Z, Lenz DR, et al. The LINC complex is essential for hearing. The Journal of
clinical investigation. 2013;123(2):740-50.
Pennings RJ, Topsakal V, Astuto L, et al. Variable clinical features in patients with CDH23 mutations
(USH1D-DFNB12). Otology & neurotology : official publication of the American Otological Society,
American Neurotology Society [and] European Academy of Otology and Neurotology. 2004;25(5):699-706.
Miyagawa M, Nishio SY, Usami S. Prevalence and clinical features of hearing loss patients with CDH23
mutations: a large cohort study. PloS one. 2012;7(8):e40366.
Astuto LM, Bork JM, Weston MD, et al. CDH23 mutation and phenotype heterogeneity: a profile of 107
diverse families with Usher syndrome and nonsyndromic deafness. American journal of human
genetics. 2002;71(2):262-75.
Sennaroglu L, Saatci I. A new classification for cochleovestibular malformations. The Laryngoscope.
2002;112(12):2230-41.
Chattaraj P, Reimold FR, Muskett JA, et al. Use of SLC26A4 Mutation Testing for Unilateral Enlargement
of the Vestibular Aqueduct. JAMA otolaryngology-- head & neck surgery. 2013;139(9):907-13.
Busi M, Castiglione A, Taddei Masieri M, et al. Novel mutations in the SLC26A4 gene. International
journal of pediatric otorhinolaryngology. 2012;76(9):1249-54.
de Wolf MJ, Honings J, Joosten FB, et al. Two siblings with progressive, fluctuating hearing loss after
head trauma, treated with cochlear implantation. The Journal of laryngology and otology.
2010;124(1):86-9.
Albert S, Blons H, Jonard L, et al. SLC26A4 gene is frequently involved in nonsyndromic hearing
impairment with enlarged vestibular aqueduct in Caucasian populations. European journal of
human genetics : EJHG. 2006;14(6):773-9.
Miyagawa M, Nishio SY, Usami S, et al. Mutation spectrum and genotype-phenotype correlation of
hearing loss patients caused by SLC26A4 mutations in the Japanese: a large cohort study. Journal of
human genetics. 2014;59(5):262-8.
Walsh T, Walsh V, Vreugde S, et al. From flies’ eyes to our ears: mutations in a human class III myosin
cause progressive nonsyndromic hearing loss DFNB30. Proceedings of the National Academy of
Sciences of the United States of America. 2002;99(11):7518-23.
Girotto G, Mezzavilla M, Abdulhadi K, et al. Consanguinity and hereditary hearing loss in Qatar.
Human heredity. 2014;77(1-4):175-82.
Sirmaci A, Erbek S, Price J, et al. A truncating mutation in SERPINB6 is associated with autosomalrecessive nonsyndromic sensorineural hearing loss. American journal of human genetics. 2010;86(5):
797-804.
48 | Chapter 1
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
Santarelli R, Arslan E. Electrocochleography in auditory neuropathy. Hear Res. 2002;170(1-2):32-47.
Rodriguez-Ballesteros M, del Castillo FJ, Martin Y, et al. Auditory neuropathy in patients carrying
mutations in the otoferlin gene (OTOF). Human mutation. 2003;22(6):451-6.
Varga R, Avenarius MR, Kelley PM, et al. OTOF mutations revealed by genetic analysis of hearing loss
families including a potential temperature sensitive auditory neuropathy allele. Journal of medical
genetics. 2006;43(7):576-81.
Varga R, Kelley PM, Keats BJ, et al. Non-syndromic recessive auditory neuropathy is the result of
mutations in the otoferlin (OTOF) gene. Journal of medical genetics. 2003;40(1):45-50.
Rouillon I, Marcolla A, Roux I, et al. Results of cochlear implantation in two children with mutations
in the OTOF gene. International journal of pediatric otorhinolaryngology. 2006;70(4):689-96.
Zhang LP, Chai YC, Yang T, et al. Identification of novel OTOF compound heterozygous mutations by
targeted next-generation sequencing in a Chinese patient with auditory neuropathy spectrum
disorder. International journal of pediatric otorhinolaryngology. 2013;77(10):1749-52.
Marlin S, Feldmann D, Nguyen Y, et al. Temperature-sensitive auditory neuropathy associated with an
otoferlin mutation: Deafening fever! Biochemical and biophysical research communications.
2010;394(3):737-42.
Delmaghani S, del Castillo FJ, Michel V, et al. Mutations in the gene encoding pejvakin, a newly identified
protein of the afferent auditory pathway, cause DFNB59 auditory neuropathy. Nature genetics. 2006;
38(7):770-8.
Ebermann I, Walger M, Scholl HP, et al. Truncating mutation of the DFNB59 gene causes cochlear
hearing impairment and central vestibular dysfunction. Human mutation. 2007;28(6):571-7.
Street VA, Kallman JC, Strombom PD, et al. Vestibular function in families with inherited autosomal
dominant hearing loss. J Vestib Res-Equilib Orientat. 2008;18(1):51-8.
Introduction
| 49
50 | Chapter 1
Supplemental table 1 Phenotype characteristics of prelingual, severe to profound
autosomal recessive hearing impairment.
Locus
Gene
Onset
DFNB2
[1-5]
MYO7A
Variable (congenital – 16 years) Severe-profound
Severity
Flat
Audiogram configuration
DFNB3
[6-17]
MYO15A
Congenital
Severe-profound
Downsloping
DFNB6
[18-22]
TMIE
Congenital/ prelingual
Severe-profound
All frequencies
DFNB7/11 TMC1
[23-34]
Congenital,
1 postlingual [35]
Severe-profound
Flat- U shaped - downsloping
DFNB18A USH1C
[36-38]
Prelingual
Severe-profound
DFNB22
[39-42]
OTOA
Prelingual
Severe-profound
DFNB23
[43-45]
PCDH15
Prelingual
Severe-profound
DFNB24
[46-48]
RDX
Congenital, prelingual
Severe-profound
Flat- shallow U shape
DFNB28
[49-51]
TRIOBP
Congenital/ prelingual
Profound
All frequencies
DFNB29
[52-57]
CLDN14
Congenital, prelingual
Severe-profound
Flat- gently downsloping
DFNB31
[58-60]
WHRN
Congenital, prelingual
Profound
DFNB35
[61-65]
ESRRB
Prelingual
Severe-profound
Flat
DFNB36
[66, 67]
ESPN
Prelingual
Profound
Flat
DFNB37
[68]
MYO6
Congenital
Profound
DFNB39
[69, 70]
HGF
Prelingual
Severe-profound
Downsloping
DFNB42
[71, 72]
ILDR2
Congenital, prelingual
Severe-profound
Flat- steeply downsloping
DFNB48
[73, 74]
CIB2
Congenital
Severe-profound
Flat
DFNB49
[75-78]
MARVELD2
Congenital
Severe-profound
Flat-downsloping
Flat
Introduction
| 51
Vestibular involvement
Geographic occurrence
Additional information
Variable (some do have
vestibular dysfunction).
Pakistan, Tunisia, Iran, China
Atypical Usher is also reported
(mild retinitis pigmentosa, clinically
no problems).
No vestibular problems.
Indonesia, India, Pakistan, Turkey,
Iran, Brazil, Tunisia, Qatar, the
Netherlands*
Can be moderate in the low
frequencies.
1 family delayed motor
milestones. Further NA
India, Pakistan, Jordan, Turkey,
Taiwan
No vestibular problems.
The Netherlands, Greece, Turkey,
Tunisia, Lebanon, Jordan, India,
Pakistan, China, Sudan, Iran
NA
India, China
NA
Palestine, Pakistan
NA
Pakistan, New Foundland (Canada)
NA
Pakistan, Iran, India
NA
Turkey, India, Palestine, Pakistan
NA
Pakistan, Morocco, Greece
Progressive in family with post
lingual onset
Variability intrafamiliar. Can be
moderate in the low frequencies
Palestine, Tunisia
NA
Pakistan, Tunisia, Czech, Turkey
1/3 families shows areflexia Pakistan, Morocco
during caloric testing
Abnormal (2/9), others not
tested
Pakistan
NA
Pakistan, India
NA
Pakistan, Iran, the Netherlands*
Variable other findings
Not progressive
Can be moderate in the low
frequencies
Pakistan, Curacao*
NA
Pakistan, Czech (Roma)
Progressive from severe to profound
52 | Chapter 1
Supplemental table 1 Continued.
Locus
Gene
Onset
Severity
Audiogram configuration
DFNB53
[79]
COL11A2
Prelingual
Profound
Flat
DFNB61
[80]
SLC26A5
Congenital
Severe-profound
Flat
DFNB63
[81-86]
COMT2
Congenital
Severe-profound
Gently- steeply downsloping
DFNB67
[40, 87,
88]
LHFPL5/
LRTOMT
Congenital, prelingual
Severe- profound
DFNB66
[89]
DCDC2
Congenital
Profound
DFNB70
[90]
PNPT1
Prelingual
Severe-profound
DFNB73
[91]
BSND
DFNB74
[92, 93]
MSRB3
DFNB79
[94-97]
Severe-profound
Flat
Prelingual
Profound
Flat
TPRN
Prelingual
Severe- profound
Flat-steeply downsloping
DFNB82
[98, 99]
GPSM2
Prelingual
Severe- profound
Gently downsloping
DFNB86
[100, 101]
TBC1D24
Prelingual
Profound
DFNB89 KARS
[102, 103]
Prelingual
Moderateprofound
DFNB94
[104]
NARS2
Prelingual, congenital
Profound
DFNB97
[105]
MET
Prelingual
Severe- profound
DFNB98
[106]
TSPEAR
Prelingual
Profound
DFNB99
[107]
TMEM132E
Prelingual
Severe- profound
DFNB102 EPS8
[108]
Congenital
Profound
[109]
Congenital
Profound
FAM65B
*marks the origin of a family where mutations are found, but which is not published
Flat-gently downsloping
Flat
Introduction
Vestibular involvement
Geographic occurrence
NA
Iran
NA
Caucasian (USA)
NA
Iran, Turkey, Pakistan, Morocco,
Tunisia
NA
Turkey, Palestine, India, Pakistan
NA
Tunisia
NA
Morocco
NA
Pakistan
NA
Pakistan
NA
The Netherlands, Morocco,
Pakistan
NA
Palestine, Turkey
NA
Pakistan
NA
Pakistan
No vestibular problems
Pakistan
No vestibular problems
Pakistan
Iran
No vestibular problems
China
NA
Algeria
No vestibular problems
Turkey
| 53
Additional information
Can be moderate in the low
frequencies
Subclinical renal metabolic changes
Progression reported
54 | Chapter 1
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Hildebrand MS, Thorne NP, Bromhead CJ, et al. Variable hearing impairment in a DFNB2 family with
a novel MYO7A missense mutation. Clinical genetics. 2010;77(6):563-71.
Liu XZ. The clinical presentation of DFNB2. Advances in oto-rhino-laryngology. 2002;61:120-3.
Riazuddin S, Nazli S, Ahmed ZM, et al. Mutation spectrum of MYO7A and evaluation of a novel
nonsyndromic deafness DFNB2 allele with residual function. Human mutation. 2008;29(4):502-11.
Weil D, Kussel P, Blanchard S, et al. The autosomal recessive isolated deafness, DFNB2, and the Usher
1B syndrome are allelic defects of the myosin-VIIA gene. Nature genetics. 1997;16(2):191-3.
Ben-Salem S, Rehm HL, Willems PJ, et al. Analysis of two Arab families reveals additional support for
a DFNB2 nonsyndromic phenotype of MYO7A. Molecular biology reports. 2014;41(1):193-200.
Winata S, Arhya IN, Moeljopawiro S, et al. Congenital non-syndromal autosomal recessive deafness in
Bengkala, an isolated Balinese village. Journal of medical genetics. 1995;32(5):336-43.
Friedman TB, Liang Y, Weber JL, et al. A gene for congenital, recessive deafness DFNB3 maps to the
pericentromeric region of chromosome 17. Nature genetics. 1995;9(1):86-91.
Liang Y, Wang A, Probst FJ, et al. Genetic mapping refines DFNB3 to 17p11.2, suggests multiple alleles
of DFNB3, and supports homology to the mouse model shaker-2. American journal of human genetics.
1998;62(4):904-15.
Liburd N, Ghosh M, Riazuddin S, et al. Novel mutations of MYO15A associated with profound deafness
in consanguineous families and moderately severe hearing loss in a patient with Smith-Magenis
syndrome. Human genetics. 2001;109(5):535-41.
Kalay E, Uzumcu A, Krieger E, et al. MYO15A (DFNB3) mutations in Turkish hearing loss families and
functional modeling of a novel motor domain mutation. American journal of medical genetics Part
A. 2007;143A(20):2382-9.
Nal N, Ahmed ZM, Erkal E, et al. Mutational spectrum of MYO15A: the large N-terminal extension of
myosin XVA is required for hearing. Human mutation. 2007;28(10):1014-9.
Lezirovitz K, Pardono E, de Mello Auricchio MT, et al. Unexpected genetic heterogeneity in a large
consanguineous Brazilian pedigree presenting deafness. European journal of human genetics : EJHG.
2008;16(1):89-96.
Belguith H, Aifa-Hmani M, Dhouib H, et al. Screening of the DFNB3 locus: identification of three novel
mutations of MYO15A associated with hearing loss and further suggestion for two distinctive genes
on this locus. Genet Test Mol Biomarkers. 2009;13(1):147-51.
Cengiz FB, Duman D, Sirmaci A, et al. Recurrent and private MYO15A mutations are associated with
deafness in the Turkish population. Genet Test Mol Biomarkers. 2010;14(4):543-50.
Fattahi Z, Shearer AE, Babanejad M, et al. Screening for MYO15A gene mutations in autosomal
recessive nonsyndromic, GJB2 negative Iranian deaf population. American journal of medical
genetics Part A. 2012;158A(8):1857-64.
Bashir R, Fatima A, Naz S. Prioritized sequencing of the second exon of MYO15A reveals a new
mutation segregating in a Pakistani family with moderate to severe hearing loss. European journal of
medical genetics. 2012;55(2):99-102.
Vozzi D, Morgan A, Vuckovic D, et al. Hereditary hearing loss: a 96 gene targeted sequencing protocol
reveals novel alleles in a series of Italian and Qatari patients. Gene. 2014;542(2):209-16.
Fukushima K, Ramesh A, Srisailapathy CR, et al. An autosomal recessive nonsyndromic form of
sensorineural hearing loss maps to 3p-DFNB6. Genome research. 1995;5(3):305-8.
Naz S, Giguere CM, Kohrman DC, et al. Mutations in a novel gene, TMIE, are associated with hearing
loss linked to the DFNB6 locus. American journal of human genetics. 2002;71(3):632-6.
Santos RL, El-Shanti H, Sikandar S, et al. Novel sequence variants in the TMIE gene in families with
autosomal recessive nonsyndromic hearing impairment. Journal of molecular medicine (Berlin,
Germany). 2006;84(3):226-31.
Sirmaci A, Ozturkmen-Akay H, Erbek S, et al. A founder TMIE mutation is a frequent cause of hearing
loss in southeastern Anatolia. Clinical genetics. 2009;75(6):562-7.
Yang JJ, Su MC, Chien KH, et al. Identification of novel variants in the TMIE gene of patients with
nonsyndromic hearing loss. International journal of pediatric otorhinolaryngology. 2010;74(5):489-93.
Introduction
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
| 55
Kurima K, Peters LM, Yang Y, et al. Dominant and recessive deafness caused by mutations of a novel
gene, TMC1, required for cochlear hair-cell function. Nature genetics. 2002;30(3):277-84.
Meyer CG, Gasmelseed NM, Mergani A, et al. Novel TMC1 structural and splice variants associated
with congenital nonsyndromic deafness in a Sudanese pedigree. Human mutation. 2005;25(1):100.
Kalay E, Karaguzel A, Caylan R, et al. Four novel TMC1 (DFNB7/DFNB11) mutations in Turkish patients
with congenital autosomal recessive nonsyndromic hearing loss. Human mutation. 2005;26(6):591.
Santos RL, Wajid M, Khan MN, et al. Novel sequence variants in the TMC1 gene in Pakistani families
with autosomal recessive hearing impairment. Human mutation. 2005;26(4):396.
Kitajiri SI, McNamara R, Makishima T, et al. Identities, frequencies and origins of TMC1 mutations
causing DFNB7/B11 deafness in Pakistan. Clinical genetics. 2007;72(6):546-50.
Hilgert N, Alasti F, Dieltjens N, et al. Mutation analysis of TMC1 identifies four new mutations and
suggests an additional deafness gene at loci DFNA36 and DFNB7/11. Clinical genetics. 2008;74(3):223-32.
Tlili A, Rebeh IB, Aifa-Hmani M, et al. TMC1 but not TMC2 is responsible for autosomal recessive
nonsyndromic hearing impairment in Tunisian families. Audiology & neuro-otology. 2008;13(4):213-8.
Sirmaci A, Duman D, Ozturkmen-Akay H, et al. Mutations in TMC1 contribute significantly to
nonsyndromic autosomal recessive sensorineural hearing loss: a report of five novel mutations.
International journal of pediatric otorhinolaryngology. 2009;73(5):699-705.
Hildebrand MS, Kahrizi K, Bromhead CJ, et al. Mutations in TMC1 are a common cause of DFNB7/11
hearing loss in the Iranian population. The Annals of otology, rhinology, and laryngology. 2010;
119(12):830-5.
Searle C, Mavrogiannis LA, Bennett CP, et al. The common TMC1 mutation c.100C>T (p.Arg34X) is not
a significant cause of deafness in British Asians. Genet Test Mol Biomarkers. 2012;16(5):453-5.
Gao X, Su Y, Guan LP, et al. Novel compound heterozygous TMC1 mutations associated with autosomal
recessive hearing loss in a Chinese family. PloS one. 2013;8(5):e63026.
Davoudi-Dehaghani E, Zeinali S, Mahdieh N, et al. A transversion mutation in non-coding exon 3 of
the TMC1 gene in two ethnically related Iranian deaf families from different geographical regions;
evidence for founder effect. International journal of pediatric otorhinolaryngology. 2013;77(5):821-6.
de Heer AM, Collin RW, Huygen PL, et al. Progressive sensorineural hearing loss and normal vestibular
function in a Dutch DFNB7/11 family with a novel mutation in TMC1. Audiology & neuro-otology.
2011;16(2):93-105.
Jain PK, Lalwani AK, Li XC, et al. A gene for recessive nonsyndromic sensorineural deafness (DFNB18)
maps to the chromosomal region 11p14-p15.1 containing the Usher syndrome type 1C gene. Genomics.
1998;50(2):290-2.
Ahmed ZM, Smith TN, Riazuddin S, et al. Nonsyndromic recessive deafness DFNB18 and Usher
syndrome type IC are allelic mutations of USHIC. Human genetics. 2002;110(6):527-31.
Ouyang XM, Xia XJ, Verpy E, et al. Mutations in the alternatively spliced exons of USH1C cause
non-syndromic recessive deafness. Human genetics. 2002;111(1):26-30.
Zwaenepoel I, Mustapha M, Leibovici M, et al. Otoancorin, an inner ear protein restricted to the
interface between the apical surface of sensory epithelia and their overlying acellular gels, is defective
in autosomal recessive deafness DFNB22. Proceedings of the National Academy of Sciences of the
United States of America. 2002;99(9):6240-5.
Shahin H, Walsh T, Rayyan AA, et al. Five novel loci for inherited hearing loss mapped by SNP-based
homozygosity profiles in Palestinian families. European journal of human genetics: EJHG. 2010;18(4): 407-13.
Lee K, Chiu I, Santos-Cortez R, et al. Novel OTOA mutations cause autosomal recessive non-syndromic
hearing impairment in Pakistani families. Clinical genetics. 2012.
Walsh T, Abu Rayan A, Abu Sa’ed J, et al. Genomic analysis of a heterogeneous Mendelian phenotype:
multiple novel alleles for inherited hearing loss in the Palestinian population. Human genomics.
2006;2(4):203-11.
Ahmed ZM, Riazuddin S, Ahmad J, et al. PCDH15 is expressed in the neurosensory epithelium of the
eye and ear and mutant alleles are responsible for both USH1F and DFNB23. Human molecular
genetics. 2003;12(24):3215-23.
56 | Chapter 1
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
Ahmed ZM, Riazuddin S, Aye S, et al. Gene structure and mutant alleles of PCDH15: nonsyndromic
deafness DFNB23 and type 1 Usher syndrome. Human genetics. 2008;124(3):215-23.
Doucette L, Merner ND, Cooke S, et al. Profound, prelingual nonsyndromic deafness maps to
chromosome 10q21 and is caused by a novel missense mutation in the Usher syndrome type IF gene
PCDH15. European journal of human genetics : EJHG. 2009;17(5):554-64.
Khan SY, Ahmed ZM, Shabbir MI, et al. Mutations of the RDX gene cause nonsyndromic hearing loss
at the DFNB24 locus. Human mutation. 2007;28(5):417-23.
Shearer AE, Hildebrand MS, Bromhead CJ, et al. A novel splice site mutation in the RDX gene causes
DFNB24 hearing loss in an Iranian family. American journal of medical genetics Part A.
2009;149A(3):555-8.
Lee K, Amin Ud Din M, Ansar M, et al. Autosomal Recessive Nonsyndromic Hearing Impairment due
to a Novel Deletion in the RDX Gene. Genetics research international. 2011;2011:294675.
Riazuddin S, Khan SN, Ahmed ZM, et al. Mutations in TRIOBP, which encodes a putative cytoskeletal-organizing protein, are associated with nonsyndromic recessive deafness. American journal of
human genetics. 2006;78(1):137-43.
Shahin H, Walsh T, Sobe T, et al. Mutations in a novel isoform of TRIOBP that encodes a filamentous-actin binding protein are responsible for DFNB28 recessive nonsyndromic hearing loss. American
journal of human genetics. 2006;78(1):144-52.
Diaz-Horta O, Duman D, Foster J, 2nd, et al. Whole-exome sequencing efficiently detects rare
mutations in autosomal recessive nonsyndromic hearing loss. PloS one. 2012;7(11):e50628.
Wilcox ER, Burton QL, Naz S, et al. Mutations in the gene encoding tight junction claudin-14 cause
autosomal recessive deafness DFNB29. Cell. 2001;104(1):165-72.
Ahmed ZM, Riazuddin S, Friedman TB, et al. Clinical manifestations of DFNB29 deafness. Advances
in oto-rhino-laryngology. 2002;61:156-60.
Wattenhofer M, Reymond A, Falciola V, et al. Different mechanisms preclude mutant CLDN14 proteins
from forming tight junctions in vitro. Human mutation. 2005;25(6):543-9.
Lee K, Ansar M, Andrade PB, et al. Novel CLDN14 mutations in Pakistani families with autosomal
recessive non-syndromic hearing loss. American journal of medical genetics Part A. 2012;158A(2):315-21.
Bashir ZE, Latief N, Belyantseva IA, et al. Phenotypic variability of CLDN14 mutations causing DFNB29
hearing loss in the Pakistani population. Journal of human genetics. 2013;58(2):102-8.
Charif M, Bakhchane A, Abidi O, et al. Analysis of CLDN14 gene in deaf Moroccan patients with
non-syndromic hearing loss. Gene. 2013;523(1):103-5.
Mustapha M, Chouery E, Chardenoux S, et al. DFNB31, a recessive form of sensorineural hearing loss,
maps to chromosome 9q32-34. European journal of human genetics : EJHG. 2002;10(3):210-2.
Mburu P, Mustapha M, Varela A, et al. Defects in whirlin, a PDZ domain molecule involved in
stereocilia elongation, cause deafness in the whirler mouse and families with DFNB31. Nature
genetics. 2003;34(4):421-8.
Tlili A, Charfedine I, Lahmar I, et al. Identification of a novel frameshift mutation in the DFNB31/
WHRN gene in a Tunisian consanguineous family with hereditary non-syndromic recessive hearing
loss. Human mutation. 2005;25(5):503.
Ansar M, Din MA, Arshad M, et al. A novel autosomal recessive non-syndromic deafness locus
(DFNB35) maps to 14q24.1-14q24.3 in large consanguineous kindred from Pakistan. European journal
of human genetics : EJHG. 2003;11(1):77-80.
Collin RW, Kalay E, Tariq M, et al. Mutations of ESRRB encoding estrogen-related receptor beta cause
autosomal-recessive nonsyndromic hearing impairment DFNB35. American journal of human
genetics. 2008;82(1):125-38.
Ben Said M, Ayedi L, Mnejja M, et al. A novel missense mutation in the ESRRB gene causes DFNB35
hearing loss in a Tunisian family. European journal of medical genetics. 2011;54(6):e535-41.
Lee K, Khan S, Ansar M, et al. A Novel ESRRB Deletion Is a Rare Cause of Autosomal Recessive
Nonsyndromic Hearing Impairment among Pakistani Families. Genetics research international.
2011;2011:368915.
Introduction
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
| 57
Safka Brozkova D, Lastuvkova J, Machalova E, et al. DFNB35 due to a novel mutation in the ESRRB
gene in a Czech consanguineous family. International journal of pediatric otorhinolaryngology.
2012;76(11):1681-4.
Naz S, Griffith AJ, Riazuddin S, et al. Mutations of ESPN cause autosomal recessive deafness and
vestibular dysfunction. Journal of medical genetics. 2004;41(8):591-5.
Boulouiz R, Li Y, Soualhine H, et al. A novel mutation in the Espin gene causes autosomal recessive
nonsyndromic hearing loss but no apparent vestibular dysfunction in a Moroccan family. American
journal of medical genetics Part A. 2008;146A(23):3086-9.
Ahmed ZM, Morell RJ, Riazuddin S, et al. Mutations of MYO6 are associated with recessive deafness,
DFNB37. American journal of human genetics. 2003;72(5):1315-22.
Wajid M, Abbasi AA, Ansar M, et al. DFNB39, a recessive form of sensorineural hearing impairment,
maps to chromosome 7q11.22-q21.12. European journal of human genetics : EJHG. 2003;11(10):812-5.
Schultz JM, Khan SN, Ahmed ZM, et al. Noncoding mutations of HGF are associated with nonsyndromic
hearing loss, DFNB39. American journal of human genetics. 2009;85(1):25-39.
Borck G, Ur Rehman A, Lee K, et al. Loss-of-function mutations of ILDR1 cause autosomal-recessive
hearing impairment DFNB42. American journal of human genetics. 2011;88(2):127-37.
Aslam M, Wajid M, Chahrour MH, et al. A novel autosomal recessive nonsyndromic hearing
impairment locus (DFNB42) maps to chromosome 3q13.31-q22.3. American journal of medical
genetics Part A. 2005;133A(1):18-22.
Ahmad J, Khan SN, Khan SY, et al. DFNB48, a new nonsyndromic recessive deafness locus, maps to
chromosome 15q23-q25.1. Human genetics. 2005;116(5):407-12.
Riazuddin S, Belyantseva IA, Giese AP, et al. Alterations of the CIB2 calcium- and integrin-binding
protein cause Usher syndrome type 1J and nonsyndromic deafness DFNB48. Nature genetics.
2012;44(11):1265-71.
Ramzan K, Shaikh RS, Ahmad J, et al. A new locus for nonsyndromic deafness DFNB49 maps to
chromosome 5q12.3-q14.1. Human genetics. 2005;116(1-2):17-22.
Riazuddin S, Ahmed ZM, Fanning AS, et al. Tricellulin is a tight-junction protein necessary for
hearing. American journal of human genetics. 2006;79(6):1040-51.
Chishti MS, Bhatti A, Tamim S, et al. Splice-site mutations in the TRIC gene underlie autosomal recessive
nonsyndromic hearing impairment in Pakistani families. Journal of human genetics. 2008;53(2):101-5.
Safka Brozkova D, Lastuvkova J, Stepankova H, et al. DFNB49 is an important cause of non-syndromic
deafness in Czech Roma patients but not in the general Czech population. Clinical genetics.
2012;82(6):579-82.
Chen W, Kahrizi K, Meyer NC, et al. Mutation of COL11A2 causes autosomal recessive non-syndromic
hearing loss at the DFNB53 locus. Journal of medical genetics. 2005;42(10):e61.
Liu XZ, Ouyang XM, Xia XJ, et al. Prestin, a cochlear motor protein, is defective in non-syndromic
hearing loss. Human molecular genetics. 2003;12(10):1155-62.
Kalay E, Caylan R, Kiroglu AF, et al. A novel locus for autosomal recessive nonsyndromic hearing
impairment, DFNB63, maps to chromosome 11q13.2-q13.4. Journal of molecular medicine (Berlin,
Germany). 2007;85(4):397-404.
Khan SY, Riazuddin S, Tariq M, et al. Autosomal recessive nonsyndromic deafness locus DFNB63 at
chromosome 11q13.2-q13.3. Human genetics. 2007;120(6):789-93.
Tlili A, Masmoudi S, Dhouib H, et al. Localization of a novel autosomal recessive non-syndromic
hearing impairment locus DFNB63 to chromosome 11q13.3-q13.4. Annals of human genetics.
2007;71(Pt 2):271-5.
Du X, Schwander M, Moresco EM, et al. A catechol-O-methyltransferase that is essential for auditory
function in mice and humans. Proceedings of the National Academy of Sciences of the United States
of America. 2008;105(38):14609-14.
Vanwesemael M, Schrauwen I, Ceuppens R, et al. A 1 bp deletion in the dual reading frame deafness
gene LRTOMT causes a frameshift from the first into the second reading frame. American journal of
medical genetics Part A. 2011;155A(8):2021-3.
58 | Chapter 1
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
Charif M, Bounaceur S, Abidi O, et al. The c.242G>A mutation in LRTOMT gene is responsible for a high
prevalence of deafness in the Moroccan population. Molecular biology reports. 2012;39(12):11011-6.
Shabbir MI, Ahmed ZM, Khan SY, et al. Mutations of human TMHS cause recessively inherited
non-syndromic hearing loss. Journal of medical genetics. 2006;43(8):634-40.
Kalay E, Li Y, Uzumcu A, et al. Mutations in the lipoma HMGIC fusion partner-like 5 (LHFPL5) gene
cause autosomal recessive nonsyndromic hearing loss. Human mutation. 2006;27(7):633-9.
Grati M, Chakchouk I, Ma Q, et al. A missense mutation in DCDC2 causes human recessive deafness
DFNB66, likely by interfering with sensory hair cell and supporting cell cilia length regulation.
Human molecular genetics. 2015;24(9):2482-91.
von Ameln S, Wang G, Boulouiz R, et al. A mutation in PNPT1, encoding mitochondrial-RNA-import
protein PNPase, causes hereditary hearing loss. American journal of human genetics. 2012;91(5):919-27.
Riazuddin S, Anwar S, Fischer M, et al. Molecular basis of DFNB73: mutations of BSND can cause
nonsyndromic deafness or Bartter syndrome. American journal of human genetics. 2009;85(2):273-80.
Ahmed ZM, Yousaf R, Lee BC, et al. Functional null mutations of MSRB3 encoding methionine
sulfoxide reductase are associated with human deafness DFNB74. American journal of human
genetics. 2011;88(1):19-29.
Waryah AM, Rehman A, Ahmed ZM, et al. DFNB74, a novel autosomal recessive nonsyndromic
hearing impairment locus on chromosome 12q14.2-q15. Clinical genetics. 2009;76(3):270-5.
Bashir R, Imtiaz A, Fatima A, et al. The c.42_52del11 mutation in TPRN and progressive hearing loss
in a family from Pakistan. Biochemical genetics. 2013;51(5-6):350-7.
Khan SY, Riazuddin S, Shahzad M, et al. DFNB79: reincarnation of a nonsyndromic deafness locus on
chromosome 9q34.3. European journal of human genetics : EJHG. 2010;18(1):125-9.
Li Y, Pohl E, Boulouiz R, et al. Mutations in TPRN cause a progressive form of autosomal-recessive
nonsyndromic hearing loss. American journal of human genetics. 2010;86(3):479-84.
Rehman AU, Morell RJ, Belyantseva IA, et al. Targeted capture and next-generation sequencing
identifies C9orf75, encoding taperin, as the mutated gene in nonsyndromic deafness DFNB79.
American journal of human genetics. 2010;86(3):378-88.
Walsh T, Shahin H, Elkan-Miller T, et al. Whole exome sequencing and homozygosity mapping
identify mutation in the cell polarity protein GPSM2 as the cause of nonsyndromic hearing loss
DFNB82. American journal of human genetics. 2010;87(1):90-4.
Yariz KO, Walsh T, Akay H, et al. A truncating mutation in GPSM2 is associated with recessive
non-syndromic hearing loss. Clinical genetics. 2012;81(3):289-93.
Rehman AU, Santos-Cortez RL, Morell RJ, et al. Mutations in TBC1D24, a gene associated with epilepsy,
also cause nonsyndromic deafness DFNB86. American journal of human genetics. 2014;94(1):144-52.
Ali RA, Rehman AU, Khan SN, et al. DFNB86, a novel autosomal recessive non-syndromic deafness
locus on chromosome 16p13.3. Clinical genetics. 2012;81(5):498-500.
Basit S, Lee K, Habib R, et al. DFNB89, a novel autosomal recessive nonsyndromic hearing impairment
locus on chromosome 16q21-q23.2. Human genetics. 2011;129(4):379-85.
Santos-Cortez RL, Lee K, Azeem Z, et al. Mutations in KARS, Encoding Lysyl-tRNA Synthetase, Cause
Autosomal-Recessive Nonsyndromic Hearing Impairment DFNB89. American journal of human
genetics. 2013.
Simon M, Richard EM, Wang X, et al. Mutations of human NARS2, encoding the mitochondrial asparaginyl-tRNA synthetase, cause nonsyndromic deafness and Leigh syndrome. PLoS genetics.
2015;11(3):e1005097.
Mujtaba G, Schultz JM, Imtiaz A, et al. A mutation of MET, encoding hepatocyte growth factor
receptor, is associated with human DFNB97 hearing loss. Journal of medical genetics. 2015.
Delmaghani S, Aghaie A, Michalski N, et al. Defect in the gene encoding the EAR/EPTP domain-containing protein TSPEAR causes DFNB98 profound deafness. Human molecular genetics.
2012;21(17):3835-44.
Li J, Zhao X, Xin Q, et al. Whole-exome sequencing identifies a variant in TMEM132E causing autosomal-recessive nonsyndromic hearing loss DFNB99. Human mutation. 2015;36(1):98-105.
Introduction
| 59
108. Behlouli A, Bonnet C, Abdi S, et al. EPS8, encoding an actin-binding protein of cochlear hair cell
stereocilia, is a new causal gene for autosomal recessive profound deafness. Orphanet journal of rare
diseases. 2014;9(1):55.
109. Diaz-Horta O, Subasioglu-Uzak A, Grati M, et al. FAM65B is a membrane-associated protein of hair cell
stereocilia required for hearing. Proceedings of the National Academy of Sciences of the United States
of America. 2014;111(27):9864-8.
60 | Chapter 1
Supplemental table 2 Autosomal recessive types of hearing impairment with
specific phenotypes characteristics.
Locus
Gene
Onset
Severity
Audiogram
configuration
DFNB1
GJB2/GJB6
Congenital, prelingual
Mild-profound
(variable)
Flat- downsloping
(variable)
DFNB4
[1-5]
SLC26A4
Mostly prelingual
Mild- profound
DFNB8/10
[6-18]
TMPRSS3
Prelingual (DFNB10) and
postlingual (DFNB8)
Moderateprofound
Steeply downsloping,
progression until flat
DFNB12
[19-27]
CDH23
Congenital, prelingual
Moderateprofound
Flat- steeply downsloping
DFNB15/72/95 GIPC3
[28-33]
Prelingual
Moderateprofound
Flat- U shaped- gently
downsloping
DFNB16
[34-37]
STRC
Early childhood
Mostly mildDownsloping
moderate, can be
severe - profound
DFNB18B
[38, 39]
OTOG
Prelingual
Mild- moderate
Flat-gently downsloping
DFNB21
[40-46]
TECTA
Prelingual
Moderate- severe
Flat- shallow U shape
DFNB25 [47]
GRXCR1
Congenital
Moderateprofound
Flat- gently downsloping
DFNB30 [48]
MYO3A
Second decade
Moderate- severe
Downsloping
DFNB49 [49]
BDP1
Post lingual
Moderate- severe
Gently downsloping
DFNB76 [50]
SYN4
Early onset (congenital – 6
years)
Severe by
adulthood
(initial level is
not reported)
Steeply downsloping
DFNB77
[18, 51, 52]
LOXHD1
Reported prelingual and post
lingual
Moderateprofound
Steeply sloping in low
frequencies, flat in mid
and high frequencies
Introduction
| 61
Vestibular
involvement
Number of Geographic occurrence
families in
literature
Additional information
No consensus
>100
Most common form of ARNSHI
Progressive and stable types are
reported
Vestibular dysfunction, like >100
complaints of vertigo, are
reported
Caucasian, Asia
Temporal bone abnormalities.
Great variability. Fluctuation
and/ or progression.
Hyporeflexia and
>30
hyperreflexia were detected
during
electronystagmography,
although the overall
prevalence was not above
change level.
8: Pakistan, Turkey, UK,
Germany, the Netherlands,
Korea
10: Palestine, Tunisia,
Turkey, Pakistan, Greece,
Spain, the Netherlands,
Italy, India
Progressive
Normal vestibular function
>40
Pakistan, Japan, Germany,
Progression is reported.
African America, European,
the Netherlands, India,
North America, Korea
No vestibular problems
reported
11
The Netherlands*, Turkey,
Pakistan, Saudi Arabia,
India.
No vestibular problems
reported
20
French, Pakistan, Caucasian, Non progressive
Asian, Middle East
Delayed motor milestones,
vestibular hypofunction
2
The Netherlands, Spain.
Might be slightly progressive
later in life
NA
9
Lebanon, Pakistan, Iran,
Korea
Non progressive, unilateral HI
reported in one patient
Vestibular dysfunction has
been reported.
4
The Netherlands, Pakistan
Can be progressive
No vestibular problems
reported
1
Jewish family (Iraq)
Progressive
NA
1
Qatar
Mildly progressive
NA
2
Iraqi (Jew)
Progressive
No vestibular problems
reported
6
Iran, Turkey, Askenazi Jews, Progressive
Qatar, the Netherlands*
62 | Chapter 1
Supplemental table 2 Autosomal recessive types of hearing impairment with
specific phenotypes characteristics.
Onset
Severity
Audiogram configuration
DFNB84A PTPRQ
[53-55]
Prelingual
Moderateprofound
Flat
DFNB84B OTOGL
[39, 56]
Prelingual
Mild- moderate
Flat- gently downsloping
DFNB91
[57]
SERPINB6
Post lingual
Moderate- severe
Flat- steeply downsloping
DFNB93
[58, 59]
CABP2
Prelingual
Moderate- severe
Flat- shallow U shape
DFNB101 GRXCR2
[60]
Early childhood
moderate
Gently downsloping
DFNB103 CLIC5
[61]
Prelingual
[62]
GJB3
Early childhood
Severe
Flat
[63]
USH1G
Early childhood
Moderate- severe
Downsloping
Locus
Gene
Downsloping
*marks the origin of a family where mutations are found, but which is not published.
1.
2.
3.
4.
5.
6.
7.
8.
9.
Berrettini S, Forli F, Bogazzi F, et al. Large vestibular aqueduct syndrome: audiological, radiological,
clinical, and genetic features. American journal of otolaryngology. 2005;26(6):363-71.
Wang Q J, Zhao YL, Rao SQ, et al. A distinct spectrum of SLC26A4 mutations in patients with enlarged
vestibular aqueduct in China. Clinical genetics. 2007;72(3):245-54.
Albert S, Blons H, Jonard L, et al. SLC26A4 gene is frequently involved in nonsyndromic hearing
impairment with enlarged vestibular aqueduct in Caucasian populations. European journal of human
genetics : EJHG. 2006;14(6):773-9.
Busi M, Castiglione A, Taddei Masieri M, et al. Novel mutations in the SLC26A4 gene. International
journal of pediatric otorhinolaryngology. 2012;76(9):1249-54.
Miyagawa M, Nishio SY, Usami S, et al. Mutation spectrum and genotype-phenotype correlation of
hearing loss patients caused by SLC26A4 mutations in the Japanese: a large cohort study. Journal of
human genetics. 2014;59(5):262-8.
Weegerink NJ, Schraders M, Oostrik J, et al. Genotype-phenotype correlation in DFNB8/10 families
with TMPRSS3 mutations. Journal of the Association for Research in Otolaryngology : JARO.
2011;12(6):753-66.
Ahmed ZM, Li XC, Powell SD, et al. Characterization of a new full length TMPRSS3 isoform and
identification of mutant alleles responsible for nonsyndromic recessive deafness in Newfoundland
and Pakistan. BMC medical genetics. 2004;5:24.
Ben-Yosef T, Wattenhofer M, Riazuddin S, et al. Novel mutations of TMPRSS3 in four DFNB8/B10 families
segregating congenital autosomal recessive deafness. Journal of medical genetics. 2001;38(6): 396-400.
Elbracht M, Senderek J, Eggermann T, et al. Autosomal recessive postlingual hearing loss (DFNB8):
compound heterozygosity for two novel TMPRSS3 mutations in German siblings. Journal of medical
genetics. 2007;44(6):e81.
Introduction
Vestibular involvement
Number of Geographic occurrence
families in
literature
| 63
Additional information
Hypofunction and complete 4
areflexia are reported
The Netherlands, Palestine,
Morocco
Delayed motor milestones,
vestibular hypofunction
3
The Netherlands, Turkey,
France.
No vestibular problems
reported
1
Turkey
Progression reported
NA
3
Iran
Stable
No vestibular problems
reported
1
Pakistan
Progressive
Vestibular areflexia and
1
associated balance problems
Turkey
Highly progressive vestibular and
hearing loss.
No vestibular problems
reported
2
China
Digenic inheritance is also
reported
Normal vestibular function
1
The Netherlands
Progressive
10.
11.
12.
13.
14.
15.
16.
17.
18.
Progressive, variability within
the family
Masmoudi S, Antonarakis SE, Schwede T, et al. Novel missense mutations of TMPRSS3 in two
consanguineous Tunisian families with non-syndromic autosomal recessive deafness. Human mutation.
2001;18(2):101-8.
Scott HS, Kudoh J, Wattenhofer M, et al. Insertion of beta-satellite repeats identifies a transmembrane
protease causing both congenital and childhood onset autosomal recessive deafness. Nature genetics.
2001;27(1):59-63.
Veske A, Oehlmann R, Younus F, et al. Autosomal recessive non-syndromic deafness locus (DFNB8)
maps on chromosome 21q22 in a large consanguineous kindred from Pakistan. Human molecular
genetics. 1996;5(1):165-8.
Wattenhofer M, Di Iorio MV, Rabionet R, et al. Mutations in the TMPRSS3 gene are a rare cause of
childhood nonsyndromic deafness in Caucasian patients. Journal of molecular medicine (Berlin,
Germany). 2002;80(2):124-31.
Wattenhofer M, Sahin-Calapoglu N, Andreasen D, et al. A novel TMPRSS3 missense mutation in a
DFNB8/10 family prevents proteolytic activation of the protein. Human genetics. 2005;117(6):528-35.
Hutchin T, Coy NN, Conlon H, et al. Assessment of the genetic causes of recessive childhood nonsyndromic deafness in the UK - implications for genetic testing. Clinical genetics. 2005;68(6):506-12.
Bonne-Tamir B, DeStefano AL, Briggs CE, et al. Linkage of congenital recessive deafness (gene DFNB10)
to chromosome 21q22.3. American journal of human genetics. 1996;58(6):1254-9.
Walsh T, Abu Rayan A, Abu Sa’ed J, et al. Genomic analysis of a heterogeneous Mendelian phenotype:
multiple novel alleles for inherited hearing loss in the Palestinian population. Human genomics.
2006;2(4):203-11.
Vozzi D, Morgan A, Vuckovic D, et al. Hereditary hearing loss: a 96 gene targeted sequencing protocol
reveals novel alleles in a series of Italian and Qatari patients. Gene. 2014;542(2):209-16.
64 | Chapter 1
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
Ammar-Khodja F, Faugere V, Baux D, et al. Molecular screening of deafness in Algeria: high genetic
heterogeneity involving DFNB1 and the Usher loci, DFNB2/USH1B, DFNB12/USH1D and DFNB23/
USH1F. European journal of medical genetics. 2009;52(4):174-9.
Astuto LM, Bork JM, Weston MD, et al. CDH23 mutation and phenotype heterogeneity: a profile of 107
diverse families with Usher syndrome and nonsyndromic deafness. American journal of human
genetics. 2002;71(2):262-75.
Bork JM, Peters LM, Riazuddin S, et al. Usher syndrome 1D and nonsyndromic autosomal recessive
deafness DFNB12 are caused by allelic mutations of the novel cadherin-like gene CDH23. American
journal of human genetics. 2001;68(1):26-37.
Chaib H, Place C, Salem N, et al. Mapping of DFNB12, a gene for a non-syndromal autosomal recessive
deafness, to chromosome 10q21-22. Human molecular genetics. 1996;5(7):1061-4.
Pennings RJ, Topsakal V, Astuto L, et al. Variable clinical features in patients with CDH23 mutations
(USH1D-DFNB12). Otology & neurotology : official publication of the American Otological Society,
American Neurotology Society [and] European Academy of Otology and Neurotology. 2004;25(5):699-706.
Schultz JM, Bhatti R, Madeo AC, et al. Allelic hierarchy of CDH23 mutations causing non-syndromic
deafness DFNB12 or Usher syndrome USH1D in compound heterozygotes. Journal of medical genetics.
2011;48(11):767-75.
Wagatsuma M, Kitoh R, Suzuki H, et al. Distribution and frequencies of CDH23 mutations in Japanese
patients with non-syndromic hearing loss. Clinical genetics. 2007;72(4):339-44.
Miyagawa M, Nishio SY, Usami S. Prevalence and clinical features of hearing loss patients with CDH23
mutations: a large cohort study. PloS one. 2012;7(8):e40366.
Ganapathy A, Pandey N, Srisailapathy CR, et al. Non-syndromic hearing impairment in India: high
allelic heterogeneity among mutations in TMPRSS3, TMC1, USHIC, CDH23 and TMIE. PloS one. 2014;
9(1):e84773.
Chen A, Wayne S, Bell A, et al. New gene for autosomal recessive non-syndromic hearing loss maps to
either chromosome 3q or 19p. American journal of medical genetics. 1997;71(4):467-71.
Ain Q, Nazli S, Riazuddin S, et al. The autosomal recessive nonsyndromic deafness locus DFNB72 is
located on chromosome 19p13.3. Human genetics. 2007;122(5):445-50.
Charizopoulou N, Lelli A, Schraders M, et al. Gipc3 mutations associated with audiogenic seizures
and sensorineural hearing loss in mouse and human. Nature communications. 2011;2:201.
Rehman AU, Gul K, Morell RJ, et al. Mutations of GIPC3 cause nonsyndromic hearing loss DFNB72 but
not DFNB81 that also maps to chromosome 19p. Human genetics. 2011;130(6):759-65.
Sirmaci A, Edwards YJ, Akay H, et al. Challenges in whole exome sequencing: an example from
hereditary deafness. PloS one. 2012;7(2):e32000.
Ramzan K, Al-Owain M, Allam R, et al. Homozygosity mapping identifies a novel GIPC3 mutation
causing congenital nonsyndromic hearing loss in a Saudi family. Gene. 2013;521(1):195-9.
Francey LJ, Conlin LK, Kadesch HE, et al. Genome-wide SNP genotyping identifies the Stereocilin
(STRC) gene as a major contributor to pediatric bilateral sensorineural hearing impairment. American
journal of medical genetics Part A. 2012;158A(2):298-308.
Verpy E, Masmoudi S, Zwaenepoel I, et al. Mutations in a new gene encoding a protein of the hair
bundle cause non-syndromic deafness at the DFNB16 locus. Nature genetics. 2001;29(3):345-9.
Villamar M, del Castillo I, Valle N, et al. Deafness locus DFNB16 is located on chromosome 15q13-q21
within a 5-cM interval flanked by markers D15S994 and D15S132. American journal of human
genetics. 1999;64(4):1238-41.
Campbell DA, McHale DP, Brown KA, et al. A new locus for non-syndromal, autosomal recessive,
sensorineural hearing loss (DFNB16) maps to human chromosome 15q21-q22. Journal of medical
genetics. 1997;34(12):1015-7.
Schraders M, Ruiz-Palmero L, Kalay E, et al. Mutations of the gene encoding otogelin are a cause of
autosomal-recessive nonsyndromic moderate hearing impairment. American journal of human
genetics. 2012;91(5):883-9.
Oonk AM, Leijendeckers JM, Huygen PL, et al. Similar phenotypes caused by mutations in OTOG and
OTOGL. Ear Hear. 2014;35(3):e84-91.
Introduction
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
| 65
Mustapha M, Weil D, Chardenoux S, et al. An alpha-tectorin gene defect causes a newly identified
autosomal recessive form of sensorineural pre-lingual non-syndromic deafness, DFNB21. Human
molecular genetics. 1999;8(3):409-12.
Naz S, Alasti F, Mowjoodi A, et al. Distinctive audiometric profile associated with DFNB21 alleles of
TECTA. Journal of medical genetics. 2003;40(5):360-3.
Meyer NC, Alasti F, Nishimura CJ, et al. Identification of three novel TECTA mutations in Iranian
families with autosomal recessive nonsyndromic hearing impairment at the DFNB21 locus. American
journal of medical genetics Part A. 2007;143A(14):1623-9.
Alasti F, Sanati MH, Behrouzifard AH, et al. A novel TECTA mutation confirms the recognizable
phenotype among autosomal recessive hearing impairment families. International journal of
pediatric otorhinolaryngology. 2008;72(2):249-55.
Sagong B, Park R, Kim YH, et al. Two novel missense mutations in the TECTA gene in Korean families
with autosomal dominant nonsyndromic hearing loss. Annals of clinical and laboratory science.
2010;40(4):380-5.
Diaz-Horta O, Duman D, Foster J, 2nd, et al. Whole-exome sequencing efficiently detects rare mutations
in autosomal recessive nonsyndromic hearing loss. PloS one. 2012;7(11):e50628.
Dodson KM, Georgolios A, Barr N, et al. Etiology of unilateral hearing loss in a national hereditary
deafness repository. American journal of otolaryngology. 2012;33(5):590-4.
Schraders M, Lee K, Oostrik J, et al. Homozygosity mapping reveals mutations of GRXCR1 as a cause of
autosomal-recessive nonsyndromic hearing impairment. American journal of human genetics.
2010;86(2):138-47.
Walsh T, Walsh V, Vreugde S, et al. From flies’ eyes to our ears: mutations in a human class III myosin
cause progressive nonsyndromic hearing loss DFNB30. Proceedings of the National Academy of
Sciences of the United States of America. 2002;99(11):7518-23.
Girotto G, Mezzavilla M, Abdulhadi K, et al. Consanguinity and hereditary hearing loss in Qatar.
Human heredity. 2014;77(1-4):175-82.
Horn HF, Brownstein Z, Lenz DR, et al. The LINC complex is essential for hearing. The Journal of
clinical investigation. 2013;123(2):740-50.
Grillet N, Schwander M, Hildebrand MS, et al. Mutations in LOXHD1, an evolutionarily conserved
stereociliary protein, disrupt hair cell function in mice and cause progressive hearing loss in humans.
American journal of human genetics. 2009;85(3):328-37.
Edvardson S, Jalas C, Shaag A, et al. A deleterious mutation in the LOXHD1 gene causes autosomal
recessive hearing loss in Ashkenazi Jews. American journal of medical genetics Part A. 2011;155A(5):1170-2.
Schraders M, Oostrik J, Huygen PL, et al. Mutations in PTPRQ are a cause of autosomal-recessive
nonsyndromic hearing impairment DFNB84 and associated with vestibular dysfunction. American
journal of human genetics. 2010;86(4):604-10.
Shahin H, Rahil M, Abu Rayan A, et al. Nonsense mutation of the stereociliar membrane protein gene
PTPRQ in human hearing loss DFNB84. Journal of medical genetics. 2010;47(9):643-5.
Shahin H, Walsh T, Rayyan AA, et al. Five novel loci for inherited hearing loss mapped by SNP-based
homozygosity profiles in Palestinian families. European journal of human genetics: EJHG. 2010;
18(4):407-13.
Yariz KO, Duman D, Seco CZ, et al. Mutations in OTOGL, encoding the inner ear protein otogelin-like,
cause moderate sensorineural hearing loss. American journal of human genetics. 2012;91(5):872-82.
Sirmaci A, Erbek S, Price J, et al. A truncating mutation in SERPINB6 is associated with autosomalrecessive nonsyndromic sensorineural hearing loss. American journal of human genetics. 2010;86(5):
797-804.
Tabatabaiefar MA, Alasti F, Shariati L, et al. DFNB93, a novel locus for autosomal recessive moderateto-severe hearing impairment. Clinical genetics. 2011;79(6):594-8.
Schrauwen I, Helfmann S, Inagaki A, et al. A mutation in CABP2, expressed in cochlear hair cells,
causes autosomal-recessive hearing impairment. American journal of human genetics. 2012;91(4):636-45.
Imtiaz A, Kohrman DC, Naz S. A Frameshift Mutation in GRXCR2 Causes Recessively Inherited
Hearing Loss. Human mutation. 2014;35(5):618-24.
66 | Chapter 1
61.
62.
63.
Seco CZ, Oonk AM, Dominguez-Ruiz M, et al. Progressive hearing loss and vestibular dysfunction
caused by a homozygous nonsense mutation in CLIC5. European journal of human genetics : EJHG.
2014.
Liu XZ, Xia XJ, Xu LR, et al. Mutations in connexin31 underlie recessive as well as dominant
non-syndromic hearing loss. Human molecular genetics. 2000;9(1):63-7.
Oonk AM, van Huet RA, Leijendeckers JM, et al. Nonsyndromic hearing loss caused by USH1G
mutations: widening the USH1G disease spectrum. Ear Hear. 2015;36(2):205-11.
Introduction
| 67
68 | Chapter 1
Supplemental table 3 Phenotype characteristics of auditory neuropathies.
Locus
Gene
Onset
Severity
Audiogram configuration
DFNB9
[1-17]
OTOF
Congenital, prelingual
Severe- profound
Flat- U shaped- downsloping
DFNB59
[18-25]
PJVK
Congenital, prelingual
Moderate- profound
Flat- gently downsloping
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Chaib H, Place C, Salem N, et al. A gene responsible for a sensorineural nonsyndromic recessive
deafness maps to chromosome 2p22-23. Human molecular genetics. 1996;5(1):155-8.
Leal SM, Apaydin F, Barnwell C, et al. A second middle eastern kindred with autosomal recessive nonsyndromic hearing loss segregates DFNB9. European journal of human genetics : EJHG. 1998;6(4):341-4.
Yasunaga S, Grati M, Cohen-Salmon M, et al. A mutation in OTOF, encoding otoferlin, a FER-1-like
protein, causes DFNB9, a nonsyndromic form of deafness. Nature genetics. 1999;21(4):363-9.
Adato A, Raskin L, Petit C, et al. Deafness heterogeneity in a Druze isolate from the Middle East: novel
OTOF and PDS mutations, low prevalence of GJB2 35delG mutation and indication for a new DFNB
locus. European journal of human genetics : EJHG. 2000;8(6):437-42.
Yasunaga S, Grati M, Chardenoux S, et al. OTOF encodes multiple long and short isoforms: genetic
evidence that the long ones underlie recessive deafness DFNB9. American journal of human genetics.
2000;67(3):591-600.
Houseman MJ, Jackson AP, Al-Gazali LI, et al. A novel mutation in a family with non-syndromic
sensorineural hearing loss that disrupts the newly characterised OTOF long isoforms. Journal of
medical genetics. 2001;38(8):E25.
Migliosi V, Modamio-Hoybjor S, Moreno-Pelayo MA, et al. Q829X, a novel mutation in the gene
encoding otoferlin (OTOF), is frequently found in Spanish patients with prelingual non-syndromic
hearing loss. Journal of medical genetics. 2002;39(7):502-6.
Rodriguez-Ballesteros M, del Castillo FJ, Martin Y, et al. Auditory neuropathy in patients carrying
mutations in the otoferlin gene (OTOF). Human mutation. 2003;22(6):451-6.
Varga R, Kelley PM, Keats BJ, et al. Non-syndromic recessive auditory neuropathy is the result of
mutations in the otoferlin (OTOF) gene. Journal of medical genetics. 2003;40(1):45-50.
Gallo-Teran J, Megia Lopez R, Morales-Angulo C, et al. [Evaluation of a family with sensorineural
hearing loss due to the Q829X mutation in the OTOF gene]. Acta otorrinolaringologica espanola.
2004;55(3):120-5.
Tekin M, Akcayoz D, Incesulu A. A novel missense mutation in a C2 domain of OTOF results in autosomal recessive auditory neuropathy. American journal of medical genetics Part A. 2005;138(1):6-10.
Gallo-Teran J, Morales-Angulo C, Rodriguez-Ballesteros M, et al. [Prevalence of the 35delG mutation in
the GJB2 gene, del (GJB6-D13S1830) in the GJB6 gene, Q829X in the OTOF gene and A1555G in the
mitochondrial 12S rRNA gene in subjects with non-syndromic sensorineural hearing impairment of
congenital/childhood onset]. Acta otorrinolaringologica espanola. 2005;56(10):463-8.
Varga R, Avenarius MR, Kelley PM, et al. OTOF mutations revealed by genetic analysis of hearing loss
families including a potential temperature sensitive auditory neuropathy allele. Journal of medical
genetics. 2006;43(7):576-81.
Choi BY, Ahmed ZM, Riazuddin S, et al. Identities and frequencies of mutations of the otoferlin gene
(OTOF) causing DFNB9 deafness in Pakistan. Clinical genetics. 2009;75(3):237-43.
Introduction
Vestibular involvement
NA, central vestibular
dysfunction
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
| 69
Geographic occurrence
Additional information
France, Spain, UK, Italy, Germany,
Austria, USA, Israel, Turkey, Lebanon,
Palestine, Libya, UAE, Iran, Pakistan,
Israel, Argentina, Brazil, Mexico, Cuba,
Colombia, China, Japan, Taiwan.
Temperature sensitive
Pakistan, Israel, Morocco, Iran, Turkey,
China
Can be moderate in the low
frequencies
Stable and progressive have
been reported.
Marlin S, Feldmann D, Nguyen Y, et al. Temperature-sensitive auditory neuropathy associated with an
otoferlin mutation: Deafening fever! Biochemical and biophysical research communications.
2010;394(3):737-42.
Mahdieh N, Shirkavand A, Rabbani B, et al. Screening of OTOF mutations in Iran: a novel mutation
and review. International journal of pediatric otorhinolaryngology. 2012;76(11):1610-5.
Matsunaga T, Mutai H, Kunishima S, et al. A prevalent founder mutation and genotype-phenotype
correlations of OTOF in Japanese patients with auditory neuropathy. Clinical genetics. 2012;82(5):425-32.
Delmaghani S, del Castillo FJ, Michel V, et al. Mutations in the gene encoding pejvakin, a newly
identified protein of the afferent auditory pathway, cause DFNB59 auditory neuropathy. Nature
genetics. 2006;38(7):770-8.
Collin RW, Kalay E, Oostrik J, et al. Involvement of DFNB59 mutations in autosomal recessive
nonsyndromic hearing impairment. Human mutation. 2007;28(7):718-23.
Ebermann I, Walger M, Scholl HP, et al. Truncating mutation of the DFNB59 gene causes cochlear
hearing impairment and central vestibular dysfunction. Human mutation. 2007;28(6):571-7.
Hashemzadeh Chaleshtori M, Simpson MA, Farrokhi E, et al. Novel mutations in the pejvakin gene
are associated with autosomal recessive non-syndromic hearing loss in Iranian families. Clinical
genetics. 2007;72(3):261-3.
Schwander M, Sczaniecka A, Grillet N, et al. A forward genetics screen in mice identifies recessive
deafness traits and reveals that pejvakin is essential for outer hair cell function. The Journal of
neuroscience : the official journal of the Society for Neuroscience. 2007;27(9):2163-75.
Wang J, Fan YY, Wang SJ, et al. Variants of OTOF and PJVK genes in Chinese patients with auditory
neuropathy spectrum disorder. PloS one. 2011;6(9):e24000.
Borck G, Rainshtein L, Hellman-Aharony S, et al. High frequency of autosomal-recessive DFNB59
hearing loss in an isolated Arab population in Israel. Clinical genetics. 2012;82(3):271-6.
Mujtaba G, Bukhari I, Fatima A, et al. A p.C343S missense mutation in PJVK causes progressive hearing
loss. Gene. 2012;504(1):98-101.
2
Novel genotypephenotype correlations
2.1
Similar phenotypes caused by
mutations in OTOG and OTOGL
A.M.M. Oonk
J.M. Leijendeckers
P.L.M. Huygen
M. Schraders
M. del Campo
I. del Castillo
M. Tekin
I. Feenstra
A.J. Beynon
H.P.M. Kunst
A.F.M. Snik
H. Kremer
R.J.C. Admiraal
R.J.E. Pennings
Ear and Hearing 2014 2014 May-Jun;35(3):e84-91
74 | Chapter 2
Abstract
Recently, OTOG and OTOGL were identified as human deafness genes. Currently, only
five families are known to have autosomal recessive hearing loss based on mutations
in these genes. Since the two genes code for proteins (otogelin and otogelin-like)
that are strikingly similar in structure and localization in the inner ear, this study
is focused on characterizing and comparing the hearing loss caused by mutations
in these genes.
To evaluate this type of hearing, an extensive set of audiometric and vestibular
examinations was performed in the 13 patients from four families.
All families show a flat to downsloping configuration of the audiogram with mild
to moderate sensorineural hearing loss. Speech recognition scores remain good
(>90%). Hearing loss is not significantly different in the four families and the
psychophysical test results also do not differ between the families. Vestibular
examinations show evidence for vestibular hyporeflexia.
Since otogelin and otogelin-like are localized in the tectorial membrane, one could
expect a cochlear conductive hearing loss, as was previously shown in DFNA13
(COL11A2) and DFNA8/12 (TECTA) patients. Results of psychophysical examinations,
however, do not support this. Furthermore, the authors can conclude that there
are no phenotypic differences between hearing loss based on mutations in OTOG or
OTOGL. This phenotype description will facilitate counseling of hearing loss caused
by defects in either of these two genes.
Novel genotype-phenotype correlations
| 75
Introduction
Hearing impairment is the most common sensorineural disorder in humans and
has many underlying causes e.g. infection, trauma or genetic defects. The latter
are responsible for at least half of the cases with an early onset 1. For hereditary
early onset hearing loss the inheritance pattern is recessive in about 80% of the
cases. Different techniques are available to identify the causative gene. An example
is linkage analysis in which parental consanguinity and large family size enable
easier identification of causative genes 2. Since these family characteristics are not
common in Western populations, it was difficult to identify new loci and genes for
autosomal recessive deafness in these populations in the past. The introduction of
novel screening techniques including exome sequencing has led to an increase in
the number of identified genetic causes of recessively inherited hearing loss also in
the Western population 3. So far, over 60 genes harboring more than 1,000 mutations
were identified for non-syndromic hearing impairment 4, 5.
OTOG (DFNB18B) is one of the novel human deafness- associated genes. It codes for
otogelin, which is a non-collagenous protein that was found to be specific to the
inner ear in mice by Cohen-Salmon et al. 6. Subsequently, Simmler et al. 7 indicated
OTOG to be a mouse deafness gene. Otogelin is held responsible for binding of the
otoconial membrane and cupula to the neuroepithelium. In the tectorial
membrane, otogelin might be important for the interaction or stabilization of the
type-A and B fibers 8. OTOG was therefore also considered to be a candidate gene for
hereditary non-syndromic hearing impairment in humans 7. The gene was mapped
to chromosome 11 of the human genome by Cohen- Salmon et al. 9 and we recently
confirmed that mutations in OTOG cause deafness in humans 10.
Shahin et al. 11 described a gene homologous to OTOG, which is called OTOGL
(DFNB84B). The predicted product of this gene is otogelin-like and 33.3% of the
amino acid sequence is identical to that of otogelin 12. Furthermore, otogelin-like
is a component of the tectorial membrane, as is otogelin. When expression of otogl
is knocked down in zebrafish, it leads to sensorineural hearing loss. Recently, we
also have shown that OTOGL is a human deafness gene 12.
Because of the striking similarities between otogelin and otogelin-like in terms of
structure and expression, we wanted to evaluate whether the phenotypes of
mutations in OTOG and OTOGL are also similar. This study presents an extensive
audiometric and vestibular evaluation of the patients currently known with
recessive sensorineural hearing loss caused by mutations in either OTOG or OTOGL
10, 12
. This description facilitates the identification of causative genetic defects in
76 | Chapter 2
the outpatient clinic and improves counseling of patients on prognosis and
rehabilitation of their hearing loss.
Patients and methods
Family data
Thirteen patients, from four different families were included in this study.
Families A (W11-0186) and C (W00-384) are of Dutch origin, family B originates in
Turkey and family D (S1778) is of Spanish origin. An autosomal recessive type of
inheritance is apparent in the pedigrees, which show hearing loss in only one
generation (figure 1). In family B a consanguineous marriage is present as the
parents are first cousins.
Figure 1 Pedigrees of families participating in this study. A square indicates a
male, a circle indicates a female. A filled symbol means affected an open symbol
means unaffected.
Novel genotype-phenotype correlations
| 77
All participants voluntarily participated in this study and informed consent was
obtained from the patients or parents when the patient was a minor. This study
was approved by the local medical ethical committee. All hearing impaired family
members filled in a standardized questionnaire on audiovestibular symptoms and
underwent ENT examination, including otoscopy and external ear inspection, to
exclude external ear deformities, previous surgery and other possible causes of
hearing impairment. A computed tomography (CT) scan of the temporal bone was
performed in one member of family B and family C (II:3), in order to screen for
possible anatomical causes of congenital hearing loss.
Genetic analysis of families A and B has been described by Yariz et al. 12. Mutation
analysis of OTOGL was initiated in family A and two compound heterozygous
mutations were identified, a nonsense mutation (c.547C>T (p.(Arg183X))) and a
splice site mutation (c.5238+5G>A). They found a mutation in a homozygous state
in OTOGL in family B (c.1430delT (p.(Val477Glufs*25))).
Genetic results for families C and D have been described by Schraders et al. 10. In
family C a homozygous region containing OTOG was identified by homozygosity
mapping and therefore, Sanger sequencing was applied to OTOG. A deletion
(c.5508delC) was found in a homozygous state. This deletion is predicted to cause a
frameshift and a premature stopcodon (p.(Ala1838ProfsX31)). In family D two
pathogenic compound heterozygous mutations in OTOG (c.6347C>T (p.(Pro2116Leu))
and c.6559C>T (p.(Arg2187X))) were identified.
Audiovestibular examination
Pure tone audiometry
Pure tone audiometry was performed according to current standards to determine
hearing thresholds at frequencies of 0.25, 0.5, 1, 2, 4 and 8 kHz. To exclude
conductive hearing impairment, air and bone conduction thresholds were
determined.
Speech recognition test
In families A and C standard Dutch phonetically balanced word lists (NVA Dutch
CVC lists, Bosman 1992) were used to measure speech recognition scores. The
average of the maximum percentage correct for both ears is the maximum
phoneme score. These scores were obtained from monaural performance versus
intensity curves.
Otoacoustic emissions (OAEs) and acoustic ref lexes
OAEs were assessed in individual II:1 from family C. In all members of families A,
B and C acoustic reflexes were measured contralateral and ipsilateral at 0.5, 1, 2
and 4 kHz up to the loudness discomfort level.
78 | Chapter 2
Vestibular function tests
Unterberger stepping test, Romberg test, head thrust test, head shake test and
smooth pursuit eye movements were used to roughly evaluate vestibular function
in family A. The parents of family A did not give consent for more extensive
vestibular testing. Vestibular function was evaluated in family B, C and D by electronystagmography. This involved calorics in families C and D and a velocity-step
test in all three families. Calorisation was performed by bithermal (30 and 44˚C)
water irrigation of the external auditory canal. The velocity step test was performed
with patients seated in a rotary chair and their head anteflexed at 30˚. The chair
was accelerated and when the rotatory nystagmus had subsided during constant
rotation the chair was suddenly stopped. Areflexia was defined as no responses
during vestibular function tests. Hyporeflexia was defined when responses are
below normal ranges (i.e. velocity step test: gain < 33%, slow phase velocity < 300/s,
time constant < 11 s; caloric tests: < 70/s and <100/s for cold and warm irrigation,
respectively). This test was previously described by Theunissen et al. 13.
Psychophysical examination
In order to try to distinguish further than a mere conductive or sensorineural
hearing loss we performed the following psychophysical examinations to families
A and C: loudness scaling, gap detection, difference limen for frequency and
speech reception in noise. The latter was measured in the soundfield, the other
tests were measured with a headphone at the best performing ear. Results of
loudness scaling, gap detection and difference limen for frequency were compared
to results of psychophysical examination of normal hearing individuals. The data
of normal hearing individuals were previously described by de Leenheer et al. and
Plantinga et al. 14, 15. The results of speech reception in noise were also compared to
those of presbyacusis patients 16 and normal hearing individuals.
Loudness scaling was measured with the Würzburger Hörfeld Skalierung developed
by Moser 17. Pure tones that ranged from threshold level (category 1) to loudness
discomfort level (category 7) were presented with duration of one second. Patients
were asked to rate the perceived loudness of stimuli on a scale from one to seven.
Loudness scaling was performed with 0.5 kHz and 2 kHz pure tones. At these two
frequencies, each stimulus level was presented four times in a random order.
Gap detection was performed as described by De Leenheer et al. 15. Unfiltered white
noise, octave band filtered white noise with 0.5 kHz centre frequency and with 2
kHz centre frequency were used to test the patient’s ability to perceive a period of
silence between two noise bursts. These bursts are of equal duration and intensity
and were presented at the most comfortable listening level (MCL). Gap widths of 0
(no gap), 2, 2.8, 4, 5.6, 8, 11.2, 16 and 22.4 ms were randomly presented. The random
gap procedure was repeated four times for each type of noise.
Novel genotype-phenotype correlations
| 79
Difference limen for frequency (DLF) was measured at 0.5 kHz and 2 kHz with
randomly emitted frequency modulated pure tones generated by an Interacoustics
AC-40 audiometer. Frequency fluctuations were 0 (no fluctuation), 0.2, 0.4, 0.6, 0.8,
1, 2, 3 and 5%. All the stimuli were presented three times at the MCL. The lowest
percentage of fluctuation that was detected by the patient was designated to be the
DLF.
The speech reception thresholds in noise (SRT), i.e. the presentation level at which
a score of 50% correct is achieved for whole sentences, were determined as described
by de Leenheer et al. 15. To define these SRTs, sentences in noise in the soundfield,
according to Plomp and Mimpen, were used 18. The noise level was fixed at the MCL
and the adaptive procedure described by Plomp and Mimpen was used to set the
level of the sentences. Both speech and noise were presented via one loudspeaker
facing the patient who was not wearing hearing aids. Outcome measure in this
experiment was the signal-to-noise ratio (S/N ratio), which is the difference in
decibels between the SRT and the noise level.
The youngest member of family A did not participate in the psychophysical
examinations since these tests were too difficult for his age.
Statistic analyses
To evaluate progression of hearing impairment linear regression analysis was
performed with Prism 5.0 (Graphpad, San Diego, Ca, USA). For each measured
frequency it was tested whether the regression coefficient differed significantly
from 0. Loudness scaling was evaluated with linear regression analysis as well. To
compare hearing loss between all four families a mean audiogram was calculated
and compared by means of an unpaired Students T-test. When more than two
groups were compared a one-way ANOVA was used.
Results
Clinical data
Family A consists of three hearing impaired boys in one generation aged five to
eight years at first visit. Follow-up comprised 1.8 years. In family B, four siblings
were analyzed. At first visit, II:1 was 34 years old, II:4 33 years, II:6 14 years and II:7
was 10 years old. Two audiograms were available of three of the four family
members each (II:1, II:6 and II:7). The time between both audiograms is about eight
years. Only one audiogram was available of individual II:4. In family C, one
generation consisting of four affected male siblings was analyzed. They were three
to seven years old at first visit and were followed for on average 11.5 years. Family
D consists of two hearing impaired siblings aged 4.9 and 6.7 years at first visit.
80 | Chapter 2
Follow-up comprised on average 21 years. The onset of hearing loss is potentially
prelingual in families A, C and D. One member (AII:3) of family A failed neonatal
hearing screening. Subsequently, the two older brothers were diagnosed with
hearing loss at the age of two (II:2) and three (II:1) years. Speech development was
A
dB
B
dB
-10
0
-10
0
20
20
40
40
60
60
E
80
80
dB
100
100
-10
0
120
120
140
.25
140
.25
.5
1
2
4
8 kHz
Combined
A
B
C
D
20
.5
1
2
4
40
8 kHz
60
C
dB
-10
0
-10
0
20
20
40
40
60
60
80
80
100
100
100
120
140
.25
120
120
140
.25
140
.25
.5
1
2
4
8 kHz
80
D
dB
.5
1
2
4
-10
0
-10
0
20
20
40
40
60
60
80
80
100
100
120
120
140
.25
140
.25
1
2
4
8 kHz
G
dB
II: 1
.5
1
8 kHz
F
dB
.5
2
4
8 kHz
II: 2
.5
1
2
4
8 kHz
Figure 2 A. Audiogram with the average hearing loss of all affected family members of
family A. Standard deviations are indicated by vertical lines. B. All affected family
members of family B. C. Family C. D. Family D. E. All four mean audiograms
combined. F. All audiograms (mean of both ears) of individual II.1 of family D
combined (6.7-24 years of age). G. All audiograms (mean of both ears) individual II.2
of family D combined (4.9-30.4 years of age).
Novel genotype-phenotype correlations
| 81
delayed in families C (II:1, II:2 and II:4) and D (both affected members). Physical
examination did not demonstrate any dysmorphic features. CT scans of the
temporal bone in subjects of family B and family C did not show any abnormalities.
Audiometric results
Overall, affected individuals in family A-D have a mild to moderate sensorineural
hearing loss with a configuration that is flat to gently downsloping from the lowto the mid-frequencies 19. This is equivalent to the results recently presented by
Bonnet et al. 20 for a patient with mutations in OTOGL. Figure 2A-E shows the mean
audiograms for each family separately, as well as combined. Hearing loss varies
between 25 and 65 dB HL, depending on the frequency. Hearing thresholds do not
significantly differ between the four families. Affected individuals of families A, B
and C do not report progression of hearing loss. Longitudinal regression analysis
indeed does not show progression. In family D, significant increase of thresholds at
frequencies 0.25 kHz (0.63 dB/yr), 1 kHz (0.53 dB/yr), 2 kHz (0.85 dB/yr) and 4 kHz
(1.17 dB/ yr) is seen in II:1 and at 1 kHz (0.35 dB/yr) and 2 kHz (0.50 dB/yr) in II:2
(figure 2F-G). This progression predominantly occurs after the age of twenty years.
Cross-sectional analysis of speech recognition scores shows that speech recognition
remains stable and above the 90% score.
OAEs could not be detected in II:1 from family C. Average reflex thresholds for
normal hearing individuals and patients with a hearing loss up to 50 dB HL are 85
dB HL. There is an interindividual standard deviation of 7 dB 21. Reflexes within
the normal range were detected in all individuals, except for II:4 of family C. His
reflex thresholds were beyond the loudness discomfort level.
Psychophysical results of both Dutch families
Individuals of family A had an average age of 9.3 years and those in family C
16.5 years at psychophysical examination. Mean results for loudness scaling
experiments at 0.5 and 2 kHz are depicted in figure 3. For 0.5 kHz, the curves of
loudness growth run almost parallel to or slightly steeper than those of normal
hearing individuals. For 2 kHz, the curves are clearly steeper in the affected
individuals as compared to those of controls. This suggests recruitment at 2 kHz,
which holds for both families. The slopes for both frequencies do not differ
significantly between both families (0.5 kHz p=0.62; 2 kHz p=0.57).
The results of average gap detection for unfiltered white noise stimuli and for
filtered white noise stimuli with 0.5 kHz and 2 kHz centre frequencies are displayed
in figure 4. Results of the youngest family member of family C (II:4, aged 13.9) were
qualified as unreliable since he failed to understand the explanation of the test
and therefore the results were excluded. For unfiltered white noise stimuli, the
average gap width was a little higher for patients than for normal hearing
82 | Chapter 2
B
0.5 kHz
2 kHz
7
7
6
6
Loudness scale
Loudness scale
A
5
4
3
2
1
5
4
3
2
1
0
0
0
20
40
60
80
100
120
0
20
40
db HL
60
80
100
120
db HL
Figure 3 A. Loudness scaling at 0.5 kHz, dotted line indicates mean results of
normal hearing individuals, dashed lines represent the results of family A, solid
lines indicate family C. B. Similar results of loudness scaling at 2 kHz.
white noise
0.5 kHz
10
2 kHz
unreliable
Gap detection (ms)
15
5
al
or
m
C
N
ge
ra
Av
e
ge
ra
Av
e
C
A
I I.
4
3
C
I I.
2
I I.
C
I I.
1
C
2
I I.
A
A
I I.
1
0
Subjects
Figure 4 Gap detection measured in milliseconds (ms) for unfiltered white noise
stimuli and for filtered white noise stimuli with 0.5 kHz and 2 kHz centre frequencies.
Mean results for families A and C compared to those of normal hearing individuals.
individuals (one way ANOVA, F(2,20)=280, p<0.001). This was more prominent in
family A compared to family C, although the two families did not differ
significantly from one another (p=0.30). For filtered white noise stimuli with 0.5
kHz centre frequency the average values for families A and C were both smaller
than for the average normal hearing individual (one way ANOVA, F(2,18)=0.82,
p=0.45). On the other hand, for the filtered white noise stimuli with 2 kHz centre
frequency the average value for family A was higher than for the average normal
hearing individual and the average value for family C was lower than for the
Novel genotype-phenotype correlations
| 83
1.0
0.8
DLF (%)
0.5 kHz
0.6
2 kHz
0.4
0.2
al
N
or
m
C
ge
ge
ra
Av
e
ra
Av
e
C
C
I I.
I I.
A
4
3
2
I I.
I I.
1
C
A
A
C
I I.
I I.
1
2
0.0
Subjects
Figure 5 Difference Limen for Frequency (DLF) measured in percentage (%) for
0.5 kHz and 2 kHz. Mean results for families A and C and the results for normal
hearing individuals are presented.
average normal hearing individual (one way ANOVA. F(2,19)=0.12, p=0.89). Between
both families the differences were not significant (0.5 kHz p=0.67; 2 kHz p=0.43).
The average results for the difference limen for frequency experiments with 0.5
kHz and 2 kHz stimuli are compared between the affected individuals and controls
in figure 5. Individuals with normal hearing achieve an average DLF of 0.5% in
response to a 0.5 kHz tone. The DLF averages of families A and C were slightly
2
S/N ratio
0
-2
-4
ra
g
Av e A
er
ag
e
C
N
o
Co
r
m
Pr
rr
a
es
ec
by l
te
cu
d
pr
si
s
es
by
cu
si
s
4
3
I I.
Av
e
C
I I.
I I.
2
C
C
I I.
1
C
2
I I.
A
A
I I.
1
-6
Subjects
Figure 6 SRT in noise in signal/ noise ratio. Mean results for families A and C
compared to those for normal hearing individuals, presbyacusis patients and
presbyacusis corrected for audibility.
84 | Chapter 2
higher at 0.5 kHz than normal hearing individuals. As for the 2 kHz stimuli, the
average DLF values of families A and C were clearly higher than the average value
of normal hearing individuals. Again, both families did not differ from one
another (0.5 kHz, p=0.34; 2 kHz, p=1).
The average values of speech reception thresholds in noise are higher, i.e. worse,
for both families than for the average normal hearing individual. This is more
prominent in family A, but does not differ significantly from family C (p=0.07)
(figure 6).
Vestibular examination
In family A, individual II:1 reported delayed motor development. He could only
roll over at 12 months of age and started walking after 21 months. The head thrust
test showed signs of hyporeflexia of the right vestibulum. In family C, delayed
motor development was reported for two boys. Individuals II:2 and II:4 were able to
sit at 12 months, could stand at 14 months, crawled at 12 and 11 months respectively
and walked after 18 and over 24 months, respectively. The rotatory tests revealed
hyporeflexia and calorisation showed bilateral weakness in all affected males of
this family. Both members of family D underwent vestibular testing and calorisation
showed a bilateral deficit. In family B one member (II:7) underwent calorisation
and showed vestibular hypofunction of the left vestibulum.
Discussion
Recently, OTOG and OTOGL were identified as novel human deafness genes and their
striking similarities in protein structure and localization in the tectorial membrane
were emphasized 10, 12. In the present study, the phenotypic characteristics of two
families with OTOG mutations and two families with OTOGL mutations are evaluated
to compare both phenotypes. All affected family members show a mild to moderate
hearing loss and a flat to gently downsloping audiogram, no differences between
the four families were noted. Mild progression may be seen in families with
hearing loss caused by mutations in OTOG when long term follow-up is present.
This progression occurs mainly in the mid frequencies and mainly after 20 years
of age.
In one family with mutations in OTOG and one family with mutations in OTOGL
additional psychophysical tests were performed. The results are similar in both
families, but differ from results of normal hearing individuals. Vestibular
examination showed evidence of hyporeflexia in all tested and affected family
members. In addition, delayed motor development was noticed in three individuals
(AII:1, CII:2 and CII:4).
Novel genotype-phenotype correlations
| 85
Mutations in genes encoding components of the tectorial
membrane give a similar hearing loss
Otogelin and otogelin-like are components of the tectorial membrane. TECTA
(DFNA8/12 and DFNB21), CEACAM16 (DFNA4B) and COL11A2 (DFNA13 and DFNB53),
are human deafness- associated genes that code for other proteins of the tectorial
membrane 22-24. The phenotypic characteristics of these inherited types of
sensorineural hearing loss are summarized in table 1. Non-syndromic hearing
impairment caused by defects in one of the tectorial membrane proteins is usually
characterized by a flat to U-shaped audiogram, has an early onset and is often not
progressive, especially when the defects are inherited in an autosomal recessive
way. These characteristics are comparable to those of the patients described here.
The hearing loss is not of the cochlear conductive type despite
suspected tectorial membrane involvement
Psychophysical evaluation in patients with a defect in the tectorial membrane due
to mutations in TECTA and COL11A2 revealed a clear cochlear conductive hearing
loss. This type of hearing loss is characterized by performance in the (near-)normal
range for the gap detection test, difference limen for frequency test and speech
reception in noise test, elevated acoustic reflex thresholds and a parallel shift of
the curve for loudness scaling 14, 15.
Otogelin and otogelin-like are also components of the tectorial membrane and
Simmler et al. 8 stated that the resistance of the tectorial membrane to mechanical
stress produced by sound wave pressure is reduced in the absence of otogelin.
Therefore, we also predicted a cochlear conductive hearing loss in patients with
mutations in OTOG or OTOGL. The present psychophysical and audiological data,
however, do not support this. On the other hand, the S/N value is obviously better
(mean value OTOG/OTOGL patients: -1.8 dB) than that found in presbyacusis patients
(+0.7 dB) (figure 6) which contradicts a sensorineural type of hearing loss. This
discrepancy is possibly caused by an audibility problem: speech and noise have a
broad frequency spectrum. When carrying out the speech in noise test in hearing
impaired subjects, amplification should enable full audibility. This is easily
acquired in case of a relatively flat hearing loss, as is found in phenotypes caused
by mutations in OTOG and OTOGL. Typically, hearing loss in presbyacusis is not flat
but downsloping, affecting predominantly the higher frequencies. In such
patients, whenever amplification is acceptable in the low and mid-frequencies,
speech sounds might still be poorly audible in the high frequencies. As shown by
Killion and Christensen 25, corrections can be made to deal with this audibility
problem. Following their method, the S/N ratio for the studied group of presbyacusis
corrected for audibility, is approximately -1.3 dB instead of +0.7 dB. That S/N value
is comparable with the mean S/N value of the patients with mutations in OTOG and
DFNA13 (COLL11A2) 22, 30
Prelingual
DFNB84B (OTOGL)
Prelingual
Prelingual
32
DFNB18B (OTOG)
DFNB53 (COLL11A2)
DFNB21 (TECTA) 31
Prelingual
Congenital
DFNA8/12 (TECTA) 28, 29
Autosomal recessive inheritance
Postlingual
Variable (depending on
affected domain)
DFNA4 (CEACAM16) 24
Autosomal dominant inheritance
Onset
All
All
All
All, mid frequency dip
Mid, occasionally high
Mid or high, depending
on affected protein domain.
All
Affected frequencies
Mild to moderate
Mild to moderate
Profound
Moderate to profound
Mild to moderate
Mild to severe
Moderate
Severity
None
Mild
None
None
None
Variable (depending on
cysteine-replacing substitutions)
Yes, +/- 50 dB HL
Progression
Table 1 Characteristics of hearing impairment caused by mutations in genes encoding components of the tectorial membrane.
86 | Chapter 2
Novel genotype-phenotype correlations
| 87
OTOGL. This strengthens the suggestion that, although the defect is located in the
tectorial membrane, it does not cause hearing loss of the cochlear conductive type.
A possible explanation might be that the outer hair cells, with their stereocilia in
contact with the tectorial membrane, do not function normally because of an
ineffective connection.
One should keep in mind that psychophysical tests are not easy to perform and
require good concentration. Therefore, the young age of the participants might
have influenced the reliability of the results of psychophysical examinations. This
might explain the minor, although not significant, differences between families A
and C, since the affected individuals of family A are younger than those of family
C. A more accurate description can and must be made when larger numbers of
(older) patients with OTOG and OTOGL mutations are available.
Consequences of impaired otogelin function for hearing and balance
In Otog knock-out mice, detachment of the otoconial membrane and cupulae from
the neuroepithelia endorses the requirement of otogelin for anchoring the
acellular membrane to the underlying neuroepithelia 8. This detachment of the
otoconial membrane and cupula may explain the impaired vestibular function in
the affected individuals and thereby the delayed motor development in AII:1, CII:2
en CII:4. Because of compensatory mechanisms, vestibular dysfunction will probably
not have any further clinical consequences 26.
Mice with a mutation in OTOG have progressive moderate to profound hearing loss.
However, in histology the tectorial membrane of these mice appears to be normal.
Otogelin does not seem to be involved in anchoring the tectorial membrane to the
spiral limbus. However, in transmission electron microscopy some abnormal fibrillar
or rod-like structures roughly parallel to the axis of the tectorial membrane were
detected. Simmler et al. 7 stated that the resistance of the tectorial membrane might
be reduced in the absence of otogelin, which might reduce sound transduction and
leads to sound attenuation. However the results of psychophysical testing in the
patients point towards a defect in the hair cells or the connection between the
stereocilia and tectorial membrane. Further research is necessary to unravel a
possible of role of otogelin and otogelin-like in these defects.
Progression of hearing loss
Progression of hearing loss is not seen nor reported in three out of four families. In
family D, which carries mutations in OTOG, progression is mainly seen after the
age of twenty and is relatively mild. The individuals of family C are too young to
make a statement on progression in this family. The slow progression might be
explained by the fact that otogelin transcription almost vanishes in the cochlea in
adult mice, but otogelin labeling persists. This suggests a slow turnover process of
88 | Chapter 2
otogelin in the cochlea 27. Yariz et al. 12 also describe high levels of OTOGL transcripts
in early development and down regulation in later development, which suggests
involvement in the development of the structure, but a low turnover. Further
follow-up or identification of older patients with hearing loss caused by mutations
in OTOG or OTOGL will reveal how hearing loss presents over time.
Conclusion
In this paper, the audiovestibular phenotypes of two families with autosomal
recessively inherited mutations in OTOG are compared with two families with
mutations in OTOGL, because of the striking similarities in structure of the proteins
and their localization in the tectorial membrane. So far, there are only five families
known with hearing loss with underlying mutations in OTOG or OTOGL. The present
results show that there are no significant phenotypic differences between all
examined families. Overall one can conclude that mutations in either OTOG or
OTOGL lead to a mild-to-moderate sensorineural hearing loss with a flat to gently
downsloping audiogram. So far, mild progression is only seen in one family with
mutations in OTOG. Clear evidence of vestibular hyporeflexia is found with
relatively mild clinical consequences. Additional psychophysical examinations in
two Dutch families also do not show any differences between the phenotypic
expression of OTOG and OTOGL mutations. Since otogelin and otogelin-like are
detected in the tectorial membrane, one could expect a cochlear conductive
hearing loss, as was shown in DFNA13 and DFNA8/12 patients. However, present
results of psychophysical examinations do not support this. Further research is
needed to determine the exact role of otogelin and otogelin-like in the cochlea.
Meanwhile, present results will improve genetic counseling of patients with
mutations in OTOG or OTOGL.
Novel genotype-phenotype correlations
| 89
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
van Laer L, Cryns K, Smith RJ, et al. Nonsyndromic hearing loss. Ear Hear. 2003;24(4):275-88.
Duman D, Tekin M. Autosomal recessive nonsyndromic deafness genes: a review. Front Biosci. 2012;17:
2213-36.
Rehman AU, Morell RJ, Belyantseva IA, et al. Targeted Capture and Next-Generation Sequencing
Identifies C9orf75, Encoding Taperin, as the Mutated Gene in Nonsyndromic Deafness DFNB79. Am J
Hum Genet. 2010;86(3):378-88.
Shearer AE, Hildebrand M, Sloan CM, et al. Deafness in the genomics era. Hear Res. 2011;282(1-2):1-9.
Sivakumaran TA, Husami A, Kissell D, et al. Performance Evaluation of the Next-Generation
Sequencing Approach for Molecular Diagnosis of Hereditary Hearing Loss. Otolaryngology--head and
neck surgery : official journal of American Academy of Otolaryngology-Head and Neck Surgery. 2013.
Cohen-Salmon M, El-Amraoui A, Leibovici M, et al. Otogelin: A Glycoprotein specific to the aellular
membranes of the inner ear. Proceedings of the National Academy of Sciences of the United States of
America. 1997;94:14450-5.
Simmler MC, Zwaenepoel I, Verpy E, et al. Twister mutant mice are defective for otogelin, a component
specific to inner ear acellular membranes. Mamm Genome. 2000;11:961–6.
Simmler MC, Cohen-Salmon M, El-Amraoui A, et al. Targeted disruption of Otog results in deafness
and severe imbalance. Nat genet. 2000;24:139-43.
Cohen-Salmon M, Mattei MG, Petit C. Mapping of the otogelin gene (OTGN) to mouse Chromosome 7
and human Chromosome 11p14.3: a candidaye for human autosomal recessive nonsyndromic
deafness DFNB18. Mamm Genome. 1999;10:520-2.
Schraders M, Ruiz-Palmero L, Kalay E, et al. Mutations of the gene encoding otogelin are a cause of
autosomal-recessive nonsyndromic moderate hearing impairment. Am J Hum Genet. 2012;91(5):883-9.
Shahin H, Rahil M, Rayan AA, et al. Nonsense mutation of the stereociliar membrane protein gene
PTPRQ in human hearing loss DFNB84. J Med Genet. 2010;47:643-5.
Yariz KO, Duman D, Seco CZ, et al. Mutations in OTOGL, encoding the inner ear protein otogelin-like,
cause moderate sensorineural hearing loss. Am J Hum Genet. 2012;91(5):872-82.
Theunissen EJ, Huygen PL, Folgering HT. Vestibular hyperreactivity and hyperventilation. Clinical
otolaryngology and allied sciences. 1986;11(3):161-9.
Plantinga RF, Cremers CWRJ, Huygen PLM, et al. Audiological evaluation of affected members from a
Ducth DFNA8/12 (TECTA) family. JARO. 2007;8:1-7.
de Leenheer EMR, Bosman AJ, Huygen PLM, et al. Audiological characteristics of some affected
members of a dutch DFNA13/ COL11A2 family. Ann Otol Rhinol Laryngol. 2004;113:922-9.
Bosman AJ, Smoorenburg GF. Intelligibility of Dutch CVC syllables and sentences for listeners with
normal hearing and with three types of hearing impairment. Audiology. 1995;34:260-84.
Moser MM. Das Würzburger Hörfeld, ein Test für prothetische Audiometrie. HNO. 1987;35:318-21.
Plomp R, Mimpen AM. Improving the reliabilty of testing the speech reception threshold for
sentences. Audiology. 1979;18:43-52.
Stephens D. Audiological terms. In: Martini A, Read A, Stephens D, Mazzoli M, editors. Definitions,
Protocols and Guidelines in Genetic Hearing Impairments. 1: Whurr Publishers; 2001.
Bonnet C, Louha M, Loundon N, et al. Biallelic nonsense mutations in the otogelin-like gene (OTOGL)
in a child affected by mild to moderate hearing impairment. Gene. 2013;527(2):537-40.
Silman S, Gelfand SA. The relationship between magnitude of hearing loss and acoustic reflex
threshold levels. The Journal of speech and hearing disorders. 1981;46(3):312-6.
McGuirt WT, Prasad SD, Griffith AJ, et al. Mutations in COL11A2 cause non-syndromic hearing loss
(DFNA13). Nat genet. 1999;23:413-9.
Verhoeven K, van Laer L, Kirschhofer K, et al. Mutations in the human -tectorin gene cause autosomal
dominant non-syndromic hearing impairment. Nat genet. 1998;19:60-2.
Zheng J, Miller KK, Yang T, et al. Carcinoembryonic antigen-related cell adhesion molecule 16 interacts
with alpha-tectorin and is mutated in autosomal dominant hearing loss (DFNA4). Proceedings of the
National Academy of Sciences of the United States of America. 2011;108(10):4218-23.
90 | Chapter 2
25.
26.
27.
28.
29.
30.
31.
32.
Killion M, Christensen L. The case of the missing dots: Al and SNR loss. Hear J. 1998;51(5):32-47.
Street VA, Kallman JC, Strombom PD, et al. Vestibular function in families with inherited autosomal
dominant hearing loss. J Vestib Res. 2008;18(1):51-8.
El-Amraoui A, Cohen-Salmon M, Petit C, et al. Spatiotemporal expression of otogelin in the developing
and adult mouse inner ear. Hear Res. 2001;158:151-9.
Hildebrand MS, Morin M, Meyer NC, et al. DFNA8/12 caused by TECTA mutations is the most identified
subtype of nonsyndromic autosomal dominant hearing loss. Human mutation. 2011;32(7):825-34.
Plantinga RF, Brouwer APMd, Huygen PLM, et al. A novel TECTA mutation in a Dutch DFNA8/12 family
confirms genotype–phenotype correlation. JARO. 2006;7:173-81.
De Leenheer EMR, McGuirt WT, Kunst HPM, et al. The phenotype of DFNA13/COL11A2. Advances in
oto-rhino-laryngology. 2002;61:85-91.
Meyer NC, Alasti F, Nishimura CJ, et al. Identification of three novel TECTA mutations in Iranian
families with autosomal recessive nonsyndromic hearing impairment at the DFNB21 locus. American
journal of medical genetics Part A. 2007;143A(14):1623-9.
Chen W, Kahrizi K, Meyer NC, et al. Mutation of COL11A2 causes autosomal recessive non-syndromic
hearing loss at the DFNB53 locus. J Med Genet. 2005;42(10):e61.
Novel genotype-phenotype correlations
| 91
2.2
Nonsyndromic hearing loss caused
by USH1G mutations: widening the
USH1G disease spectrum
A.M.M. Oonk
R.A.C. van Huet
J.M. Leijendeckers
J. Oostrik
H. Venselaar
E. van Wijk
A. Beynon
H.P.M. Kunst
C.B. Hoyng
H. Kremer
M. Schraders
R.J.E. Pennings
Ear and Hearing 2015 Mar-Apr;36(2):205-11.
94 | Chapter 2
Abstract
Currently, six genes are known to be associated with Usher syndrome type I and
mutations in most of these genes can also cause nonsyndromic hearing loss. The
one exception is USH1G, which is currently only known to be involved in Usher
syndrome type I and atypical Usher syndrome.
A Dutch family with autosomal recessively inherited hearing loss was examined.
Audiometric, ophthalmic and vestibular evaluations were performed besides the
genetic analysis.
The hearing loss had an early onset with a downsloping audiogram configuration.
Slight progression of the hearing loss was seen in both affected individuals.
Compound heterozygous mutations in USH1G were found to segregate with the
hearing loss in this family, a missense (c.310A>G, p.(Met104Val)) and a frameshift
mutation (c.780insGCAC, p.(Tyr261Alafs*96)). Extensive ophthalmic and vestibular
examinations demonstrated no abnormalities that are usually associated with
Usher syndrome type I.
This is the first family presented with nonsyndromic hearing loss caused by
mutations in USH1G. Our findings expand the phenotypic spectrum of mutations
in USH1G.
Novel genotype-phenotype correlations
| 95
Introduction
Usher syndrome is the most common cause of combined hereditary hearing and
vision loss 1. It is clinically and genetically heterogeneous, but it is mainly characterized
by bilateral sensorineural hearing loss and retinitis pigmentosa (RP). Vestibular
dysfunction is seen in part of the cases. Based on severity of hearing loss and presence
or absence of vestibular dysfunction, Davenport and Omenn distinguished three
types in 1977 2. Type I is characterized by congenital, stable, severe to profound
hearing loss, vestibular areflexia and RP that has an onset before puberty. Type II
can be distinguished from type I based on severity of hearing loss (moderate severe), absence of vestibular dysfunction and a later onset of RP. Type III is
characterized by progressive hearing loss, variable vestibular dysfunction and
variable onset of RP 1, 3. Up to now, twelve loci are known for Usher syndrome and
for ten of these loci the involved genes have been identified. Eight loci are known
for Usher syndrome type I and the six causative genes are: MYO7A, CDH23, USH1C,
PCDH15, USH1G and CIB2 4.
Like in Usher syndrome, clinical and genetic heterogeneity are also seen in autosomal
recessive nonsyndromic hearing loss, for which 49 genes have been identified so
far 4. Interestingly, five genes known to be involved in Usher syndrome type I,
MYO7A, CDH23, USH1C, PCDH15 and CIB2, are also involved in nonsyndromic hearing
loss: DFNB2, DFNB12, DFNB18A, DFNB23, and DFNB48, respectively. These DFNB
phenotypes are generally characterized by prelingual, severe to profound hearing
loss, occasionally including minor retinal abnormalities not typical for RP 5-8.
Exceptions are DFNB2, which is reported to have a more variable onset age 9, 10, and
DFNB12 which can also present with moderate hearing loss, but with a progressive
nature 11, 12.
USH1G is located at chromosome 17q25.1 and encodes the protein SANS. Mutations
in this gene have, up to now, only been described to cause Usher syndrome type I
or atypical Usher syndrome 13-15. The latter is characterized as atypical since the
patients did not suffer from visual problems. Ophthalmic examination, however,
revealed bone spicules and atrophy of the retinal pigment epithelium (RPE), which
was characterized as late-onset RP 14, 15. To our knowledge there are no reports that
describe hereditary non-syndromic sensorineural hearing loss caused by mutations
in USH1G. In this study, we report a Dutch family with nonsyndromic sensorineural
hearing loss caused by compound heterozygous missense and frameshift mutations
in USH1G.
96 | Chapter 2
Material and methods
Clinical examinations
A non-consanguineous Dutch family (W08-2221) was studied. The pedigree
demonstrates that hearing loss is present in only one generation, which may
indicate an autosomal recessive inheritance pattern (Figure 1). This study was
approved by the local medical ethics committee. All participants signed an
informed consent, which additionally was used to retrieve relevant data from
other medical centers. All family members of the second generation completed a
questionnaire on hearing and balance. Hearing impaired participants underwent
complete ear, nose and throat examination including otoscopy and external ear
inspection to exclude external ear deformities, previous surgery and other possible
causes of hearing impairment. A computed tomography (CT) scan of the temporal
bone was performed in individual II.1 in order to exclude cochlear malformations.
Figure 1 Pedigree of W08-2221. Squares indicate males, circles females. Solid
symbols depict affected individuals, clear symbols mean unaffected. WT means
wild type. The genotypes of individuals II.2 and II.3 are not shown because of
privacy reasons.
Genetic analyses and molecular modeling
Peripheral blood was drawn from all family members for genetic analysis. Genomic
DNA was isolated from lymphocytes according to standard procedures. Single
Nucleotide Polymorphism (SNP) genotypes of individuals II.1 and II.4 were
determined by use of the Affymetrix® Genome-Wide Human SNP Array 6.0. All
SNP array experiments were performed and data was analyzed according to the
Novel genotype-phenotype correlations
| 97
manufacturer’s protocol. Genotype calling and calculation of the regions of
homozygosity was performed with the Affymetrix® Genotype Console Software v2.1
with use of default settings. The segregation of the genotypes for each previously
reported nonsyndromic, recessive deafness gene was visually evaluated.
Haplotype analysis of Variable Number Tandem Repeat (VNTR) markers was used
to evaluate the family for involvement of OTOGL, PTPRQ , STRC, GJB3 and SYNE4. VNTR
marker analysis was performed as described before by Schraders et al. 16
We performed Sanger sequence analysis for genes associated with autosomal
recessive hearing impairment in shared genotype regions, TRIOBP, SOX10, GIPC3,
MSRB3, TECTA, BSND, WHRN, TPRN, SLC26A4, SLC26A5, GRXCR1, PJVK, TMC1 and USH1G.
The effect of the missense mutation on the surface and structure of the SANS
protein was predicted by using a hybrid model of the protein constructed by the
automatic script in YASARA 17. The structure of the area surrounding amino acid
residue 104 is based on the Protein Data Bank file 1n0r, which has a sequence
identity of 41% with SANS.
Audiometry
Pure tone audiometry was performed, according to current standards to determine
hearing thresholds at frequencies of 0.25, 0.5, 1, 2, 4 and 8 kHz. To exclude
conductive hearing impairment, both air and bone conduction thresholds were
determined. Speech recognition scores were measured by using standard Dutch
phonetically balanced consonant-vowel-consonant word lists. The maximum
phoneme recognition score (mean value of both ears) was obtained from monaural
performance versus intensity curves. The mean value of both ears was plotted
against age and mean pure tone average (PTA) at 1, 2 and 4 kHz. These curves were
compared to the curves of presbyacusis patients 18.
We additionally tested acoustic reflexes, as well as loudness scaling and speech
perception thresholds in individual II.1. Acoustic reflexes were measured at the
contralateral ear as well as at the ipsilateral ear at 0.5, 1, 2 and 4 kHz up to the
loudness discomfort level. Loudness scaling and speech perception thresholds in
noise were evaluated as described before 19, 20. The results of these examinations
were compared to those of normal hearing individuals, retrieved from our own
clinic, and to those of presbyacusis patients 19.
Prism 5.0 (Graphpad Software Inc., San Diego, CA, USA) was used to evaluate
progression of hearing loss, speech recognition scores and loudness scaling by
means of regression analysis.
Vestibular examination
Vestibular function was evaluated by electronystagmography in individual II.1.
This involved calorisation and a rotary chair testing using the velocity-step test. A
98 | Chapter 2
smooth pursuit, a gaze, an optokinetic test and saccadic tests were performed to
confirm normal vestibule-oculomotor function and to exclude the presence of
possible central lesions. To determine the reactivity and possible vestibular
preponderance of both individual vestibuli bithermal (30 and 44˚C) water
irrigation of the external auditory canal was used for calorisation. For the velocity
step test, the patient was seated in a rotary chair with the head ante-flexed at 30˚
to obtain a horizontal position of the horizontal semicircular canals. The chair
was accelerated and when the rotatory nystagmus had subsided during constant
rotation, the chair was suddenly stopped. This was done for both directions in
order to calculate the possible presence of directional preponderance (asymmetry).
Analyses were performed as described previously 21.
Ophthalmic evaluation
Retinal function was evaluated in detail in individual II.1. We performed history
taking and standard ophthalmic examination including best-corrected visual
acuity (BCVA), slit-lamp biomicroscopy and ophthalmoscopy. Goldmann perimetry
was performed using targets V-4e, III-4e, I-4e, I-3e, I-2e and I-1e. In addition to
fundus photography (Topcon TRC50IX, Topcon Corporation, Tokyo, Japan), we
obtained 30˚x30˚ and 55˚x55˚ fundus autofluorescence (FAF) images (Spectralis,
Heidelberg Engineering, Heidelberg, Germany). Cross-sectional images of the
central and peripheral retina were obtained with a commercially available Spectral-domain optical coherence tomography (SD-OCT) instrument (Spectralis,
Heidelberg Engineering, Heidelberg, Germany) using a 20°x15˚ 19-line volume
scan covering the fovea as well as a 20˚ single line scan in the superior midperiphery.
The patient underwent a full-field electroretinography (ERG) performed according
the guidelines of the International Society for Clinical Electrophysiology of Vision
(ISCEV) 22. Additionally, color vision was evaluated using Hardy-Rand-Rittler (HRR)
plates.
Results
Clinical evaluation
Family W08-2221 consists of parents and four siblings of whom two are hearing
impaired: a female (II.1) and a male (II.4). Hearing loss was noted since the age of
four in both siblings. Physical examination did not demonstrate any dysmorphic
features suggestive of syndromic disease. A CT scan of the temporal bones in
individual II.1 did not show any abnormalities.
Novel genotype-phenotype correlations
| 99
Genetic analyses and molecular modeling
Autozygosity mapping revealed 22 homozygous regions larger than one Mb including
one known gene for recessive deafness, STRC. For 17 other known autosomal recessive
deafness- associated genes the genotypes segregated with the hearing loss upon
manual inspection of the SNP genotypes. OTOGL, PTPRQ , STRC, GJB3 and SYNE4 were
excluded by haplotype analysis of flanking VNTR markers. Mutation analysis was
performed for the other genes by Sanger sequencing and three rare variants were
identified. A heterozygous synonymous variant was detected in TRIOBP (c.4809T>C;
p.= (p.(Asp1603Asp)), NM_001039141.2) and two variants in USH1G (NM_173477.2).
One novel variant, c.780insGCAC, which causes a frameshift and a predicted
premature stop codon (p.(Tyr261Alafs*96)), and a missense variant (c.310A>G; p.
(Met104Val)). The USH1G variants segregated with the hearing loss in the family
(Figure 1) and were not present in 350 Dutch control alleles. The insertion was also
not present in the exome variant server (EVS), while the c.310G>A variant was
identified in 4 out of 13002 European American and African American alleles 23.
The amino acid substitution p.(Met104Val) is predicted to be benign by Polyphen2
(score 0.066; range 0-1 with 0= benign and 1= probably damaging) 24. SIFT predicts
that the substitution affects protein function (score 0.03; a score ≤ 0.05 predicts the
change to be damaging and >0.05 predicts it to be tolerated) 25. Mutation taster
predicts the substitution to be disease causing with a probability of 0.99 (0-1) 26.
Molecular modeling predicts that substitution of methionine for valine in the
third ankyrin domain of SANS causes a change at the surface of this domain, and
therefore possible loss of hydrophobic contacts but no change in structure of the
domain (Figure 2A). For comparison, modeling of a previously described missense
mutation (p.(Leu48Pro)) in patients with Usher syndrome type Ig was performed 27.
This missense mutation is predicted to cause a disturbance of the protein structure
(Figure 2B). Ankyrin domains are mainly formed by helical structures, and proline
is known to disrupt helical structures. Therefore, it is expected that this missense
mutation changes the helical structure of the protein and hence affects protein
function (figure 2B).
Audiometric evaluation
Figure 3A demonstrates the deterioration of air conduction thresholds of individual
II.1 over time. Air conduction thresholds did not differ from bone conduction
thresholds. At onset, her hearing loss was moderate, but over time it progressed to
severe. The audiogram configuration was initially flat to gently downsloping, but
over time the curve became steeper downsloping, demonstrating significant
progression especially in the high frequencies (Table 1).
100 | Chapter 2
Figure 2 A. Molecular modeling of missense variants in SANS. Close-up of the
third ankyrin domain with wild type amino acid (methionine) in green and the
variant (valine) in red. The change of methionine to a valine at position 104, leads
to a change at the surface of the ankyrin domain. B. Close-up of the first ankyrin
domain with wild type (leucine) in green and the variant (proline) in red. Insertion
of a proline for a leucine at position 48 causes a change in structure, due to the
interference with the helix structure of the ankyrin domain.
Table 1 Annual deterioration thresholds
0.25 kHz
0.5 kHz
1 kHz
2 kHz
4 kHz
8 kHz
II.1
p-value
-0.25
(n.s.)
0.09
(n.s.)
-0.25
(0.02)
-1.51
(<0.0001)
-1.71
(<0.0001)
-1.60
(<0.0001)
II.4
p-value
-0.82
(0.03)
-0.25
(n.s.)
-0.09
(n.s)
-0.51
(n.s.)
-1.17
(0.0001)
-2.02
(0.0001)
Results of longitudinal regression analysis of individual binaural mean air conduction thresholds in dB/yr.
Novel genotype-phenotype correlations
| 101
When speech perception scores were plotted against age, scores began to
deteriorate after the age of 20 years. When speech perception scores were plotted
against PTA1,2,4kHz, individual II.1 clearly performed better than presbyacusis
patients (Figure 4).
A
B
dB
-10
0
4.8
dB
-10
0
20
10.0
20
10.3
40
15.2
40
15.2
II.1
20.9
60
II.4
4.9
20.3
60
25.6
80
80
100
100
120
120
140
140
.25
.5
1
2
4
8 kHz
.25
.5
1
2
4
8 kHz
Figure 3 Longitudinal binaural mean air conduction threshold data of family
members II.1 (A); aged 4.8-25.6 years and II.4 (B); aged 4.9-20.3 years. Age (years) is
shown with a symbol key.
B
100
90
100
90
80
80
% Correct
% Correct
A
60
40
60
40
20
20
0
0
0
20
40
60
Age (y)
80
100
0
20
40
60
80
100
PTA 1, 2, 4 kHz
Figure 4 A. Longitudinal regression analysis of mean monaural phoneme recognition
score (% correct) related to age (year) of both affected family members. Scores of II.1
are indicated in grey circles, the regression line is a dashed grey curve. Scores of
II.4 are indicated as black squares, the regression line is black and solid. The dashed
curve indicates nonlinear regression of presbyacusis patients. B. Longitudinal
regression analysis of mean monaural phoneme recognition score (% correct) related
to PTA1, 2, 4 kHz (dB HL). Same legend as figure 4A.
102 | Chapter 2
Patient II.4 also showed a moderate hearing loss and progression was less outspoken
over time than in case II.1. Audiogram configuration remained flat to gently
downsloping (Figure 3B) but progression was significant at 0.25, 4 and 8 kHz (Table
1). Speech recognition scores plotted against age were comparable to those of
individual II.1 and remained stable. However, individual II.4 had just reached the
age at which the scores of individual II.1 began to deteriorate. When the scores
were plotted against PTA1,2,4kHz, they were comparable to those of individual II.1.
Acoustic reflexes were absent in individual II.1. Loudness scaling of II.1 showed a
steeper loudness growth than one would expect from normal hearing individuals
for both 0.5 kHz and 2 kHz. The signal to noise ratio was worse than the average
ratio of normal hearing individuals and presbyacusis patients.
Vestibular evaluation
Patient II.1 complained of motion sickness. She showed a spontaneous nystagmus
of 3 deg/s to the left, which was considered to be non-significant. Recording of the
optokinetic nystagmus and results of all vestibule-oculomotor tests were normal.
During the velocity step test, gain and start speed were slightly higher than
normal; time constant and amplitude were normal. Results of calorisation were
normal as well. There was a slight asymmetry between both labyrinths, to the
detriment of the right vestibulum. Based on these results, vestibular function was
considered normal.
Ophthalmic evaluation
Both patients had no visual complaints, including absence of night blindness,
visual field loss and decrease in central vision. Patient II.1 presented with amblyopia
of the right eye, with a suboptimal visual acuity of 20/30 after occlusion therapy,
whereas visual acuity reached 20/12 in the left eye. Ophthalmic examination
revealed normal anterior segments and retinas. There were no signs of RP: no bone
spicules, no attenuation of the retinal vasculature, no (waxy) pallor of the optic
disc or degeneration of the RPE were observed (Figure 5A). FAF images revealed
normal autofluorescence of the RPE (Figure 5B) and SD-OCT revealed normal
retinal architecture, including intact photoreceptor layer reflectance in the
macula and midperiphery (Figure 5D and 5E). Additionally, Goldmann perimetry
showed normal visual field sizes and sensibility levels and HRR plates were named
correctly. Rod- and cone-derived responses on full-field ERG were normal in both
eyes.
We concluded that subject II.1 had normal retinal appearance and function in both
eyes. The amblyopia found in this patient was not considered to be a (prodromal)
symptom of an Usher syndrome phenotype.
Novel genotype-phenotype correlations
| 103
Figure 5 Multi-modal imaging of the right eye of patient II.1 at age 25. A. Fundus
photography of central fundus of the right eye showing no abnormalities. B. Fundus
autofluorescence imaging of the right eye with normal autofluorescence levels in
the posterior pole. C. Infra-red en face image of the posterior pole of the right eye.
The green lines indicate the location of the optical coherence tomography (OCT)
images depicted in panels D and E. D. OCT image of the central retina of the right
eye depicting the fovea, which reveals no retinal abnormalities and especially a
normal photoreceptor layer and retinal pigment epithelium (RPE). E. OCT image of
the midperipheral retina of the right eye revealing normal retinal architecture.
Discussion
Here, we present, to our knowledge, the first cases of non-syndromic autosomal
recessively inherited hearing loss caused by mutations in USH1G. The moderate
hearing loss has an onset during early childhood. Mild progression of hearing loss,
especially in the higher frequencies, was observed. Resulting in a downsloping
audiogram configuration. Although it was only performed in one individual,
results of psychophysical examination were in line with a cochlear, sensorineural
hearing loss. No vestibular abnormalities were detected. During ophthalmic
examination of patient II.1, no retinal pathology was observed, especially no signs
104 | Chapter 2
of RP which is a clinical hallmark for Usher syndrome. This absence of ophthalmic
abnormalities made us characterize the phenotype in individual II.1 as
nonsyndromic. However, while absent at the age of 25 years, RP may develop at a
later age, which is highly atypical for type I Usher syndrome. Atypical USH1G-associated Usher syndrome has been described by Kalay et al. and Bashir et al. in
patients with retinal abnormalities, but without visual problems 14, 15. However,
these retinal abnormalities were already observed in patients younger than
individual II.1.
Of the six known Usher syndrome type I genes, five were already known to be
involved in nonsyndromic autosomal recessive hearing loss, except for USH1G 6, 8,
28-30
. A number of explanations have been given for the fact that mutations in these
genes either lead to syndromic or nonsyndromic hearing loss. Ouyang et al.
illustrated the importance of tissue-dependent alternative splicing as a cause of
phenotypic heterogeneity in Usher syndrome type 1c, since harmonin has isoforms
that are only expressed in the inner ear and not in the retina 5. However, to our
knowledge, only one isoform is currently known for the USH1G encoded protein
SANS.
The difference between Usher syndrome type 1f and DFNB23 has been correlated
to the mutational effect and residual function of specific protein domains. Only
missense mutations that do not affect calcium binding and rigidification of
protocadherin15 (PCDH15) cause DFNB23 thus far 6, 29, 31. Missense mutations are
more likely to result in residual protein function than truncating mutations.
Furthermore, Riazuddin et al. hypothesize that some residual function of myosin
VIIA is retained in DFNB2 and that no residual function of the protein will be
found in Usher syndrome type 1b 8, which was also hypothesized for CDH23
(DFNB12 and Usher syndrome type 1d) 7, 30.
Families have been described with Usher syndrome type Ig carrying USH1G
missense mutations that are expected to result in residual protein function.
Therefore, we assume that the differences of the genotypic spectrum depend on
the extent of residual protein function. In addition, other factors are probably also
involved in the heterogeneity of the phenotypic spectrum of USH1G-associated
disease.
When compared to other USH1G genotypes, the genotype described here mostly
resembles the genotype of a German family described by Weil et al. 27. In this
family, one allele contains a missense mutation (c.143T>C) which leads to a
substitution of proline for leucine (p.(Leu48Pro)) in the first ankyrin domain. The
second mutation (c.186-187delCA) is predicted to lead to a truncated protein (p.
(Ile63Leufs*71)). The phenotype in the affected members of this German family
deviates from that in family W08-2221 as the former demonstrates an Usher
Novel genotype-phenotype correlations
| 105
syndrome type I phenotype. As shown by modeling, the change of methionine to
valine at position 104 might only alter the surface of SANS, and not the overall
structure (figure 2A). This may result in a reduction or loss of binding of one or
more interactions partner of SANS. The p.(Leu48Pro) substitution is predicted to
lead to a more severe structure alteration and predicted loss of hydrophobic
contacts (Figure 2B). This may interfere more with interaction partners than the
slight surface change caused by p.(Met104Val). Interacting with other proteins is
essential for the function of SANS, since it is a scaffold protein and is known to
bind with multiple proteins of the Usher interactome 32. Furthermore, the p.
(Leu48Pro) mutation might affect binding of one or more proteins that are essential
in both inner ear and retina whereas the p.(Met104Val) might affect the interaction
with protein(s) that are only essential in cochlear function. To our knowledge, no
interaction partners for the ankyrin domains of SANS have been identified.
Questions now rise on the prevalence of nonsyndromic hearing loss based on
mutations in USH1G. One is probably less vigilant on USH1G as a causal gene for
nonsyndromic hearing loss since it has not been described before to be associated
with a nonsyndromic type of the disease. We assume that more patients with
USH1G-associated isolated hearing loss will be identified in the future, especially as
the c.310A>G mutation has been found in 0.03% of alleles in the EVS database. We
demonstrate that several different phenotypes can trigger one to consider USH1G
as the causative gene: when a patient presents with Usher syndrome type I or with
atypical Usher syndrome, but most certainly also when a patient presents with a
nonsyndromic, autosomal recessive, slightly progressive hearing loss.
Conclusion
We describe, to our knowledge, the first family with nonsyndromic sensorineural
hearing loss based on mutations in USH1G. The hearing loss has an onset during
early childhood, is progressive and has a downsloping audiogram configuration.
Ophthalmic and vestibular abnormalities are absent. More knowledge on
interaction partners and how they bind to SANS will probably clarify the
heterogeneous spectrum of phenotypes found with mutations in USH1G in the
near future.
106 | Chapter 2
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Millan JM, Aller E, Jaijo T, et al. An update on the genetics of usher syndrome. Journal of ophthalmology.
2011;2011:417217.
Davenport SLH, Omenn GS. The heterogeneity of Usher Syndrome Davenport, abstract. In: Littlefield
JW, G EFJ, W HJ, editors. Fifth International Conference on Birth Defects; Amsterdam, Excerpta
Medica1977. p. 87-8.
Saihan Z, Webster AR, Luxon L, et al. Update on Usher syndrome. Current opinion in neurology.
2009;22(1):19-27.
Van Camp G, Smith RJ. Hereditary Hearing Loss homepage 2013 [updated June 3th, 2013]. Available
from: http://hereditaryhearingloss.org/.
Ouyang XM, Xia XJ, Verpy E, et al. Mutations in the alternatively spliced exons of USH1C cause
non-syndromic recessive deafness. Human genetics. 2002;111(1):26-30.
Ahmed ZM, Riazuddin S, Ahmad J, et al. PCDH15 is expressed in the neurosensory epithelium of the
eye and ear and mutant alleles are responsible for both USH1F and DFNB23. Human molecular
genetics. 2003;12(24):3215-23.
Pennings RJ, Topsakal V, Astuto L, et al. Variable clinical features in patients with CDH23 mutations
(USH1D-DFNB12). Otology & neurotology: official publication of the American Otological Society,
American Neurotology Society [and] European Academy of Otology and Neurotology. 2004;25(5):699-706.
Riazuddin S, Nazli S, Ahmed ZM, et al. Mutation spectrum of MYO7A and evaluation of a novel
nonsyndromic deafness DFNB2 allele with residual function. Human mutation. 2008;29(4):502-11.
Weil D, Kussel P, Blanchard S, et al. The autosomal recessive isolated deafness, DFNB2, and the Usher
1B syndrome are allelic defects of the myosin-VIIA gene. Nature genetics. 1997;16(2):191-3.
Hildebrand MS, Thorne NP, Bromhead CJ, et al. Variable hearing impairment in a DFNB2 family with
a novel MYO7A missense mutation. Clinical genetics. 2010;77(6):563-71.
Astuto LM, Bork JM, Weston MD, et al. CDH23 mutation and phenotype heterogeneity: a profile of 107
diverse families with Usher syndrome and nonsyndromic deafness. American journal of human
genetics. 2002;71(2):262-75.
Wagatsuma M, Kitoh R, Suzuki H, et al. Distribution and frequencies of CDH23 mutations in Japanese
patients with non-syndromic hearing loss. Clinical genetics. 2007;72(4):339-44.
Mustapha M, Chouery E, Torchard-Pagnez D, et al. A novel locus for Usher syndrome type I, USH1G,
maps to chromosome 17q24-25. Human genetics. 2002;110(4):348-50.
Kalay E, de Brouwer AP, Caylan R, et al. A novel D458V mutation in the SANS PDZ binding motif causes
atypical Usher syndrome. Journal of molecular medicine (Berlin, Germany). 2005;83(12):1025-32.
Bashir R, Fatima A, Naz S. A frameshift mutation in SANS results in atypical Usher syndrome. Clinical
genetics. 2010;78(6):601-3.
Schraders M, Ruiz-Palmero L, Kalay E, et al. Mutations of the gene encoding otogelin are a cause of
autosomal-recessive nonsyndromic moderate hearing impairment. American journal of human
genetics. 2012;91(5):883-9.
Krieger E, Koraimann G, Vriend G. Increasing the precision of comparative models with YASARA
NOVA--a self-parameterizing force field. Proteins. 2002;47(3):393-402.
De Leenheer EMR, McGuirt WT, Kunst HPM, et al. The phenotype of DFNA13/COL11A2. Advances in
oto-rhino-laryngology. 2002;61:85-91.
De Leenheer EMR, Bosman AJ, Huygen PLM, et al. Audiological characteristics of some affected
members of a dutch DFNA13/ COL11A2 family. Ann Otol Rhinol Laryngol. 2004;113:922-9.
Plantinga RF, Cremers CWRJ, Huygen PLM, et al. Audiological evaluation of affected members from a
Ducth DFNA8/12 (TECTA) family. JARO. 2007;8:1-7.
Theunissen EJ, Huygen PL, Folgering HT. Vestibular hyperreactivity and hyperventilation. Clinical
otolaryngology and allied sciences. 1986;11(3):161-9.
Marmor MF, Fulton AB, Holder GE, et al. ISCEV Standard for full-field clinical electroretinography
(2008 update). Documenta ophthalmologica Advances in ophthalmology. 2009;118(1):69-77.
Novel genotype-phenotype correlations
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
| 107
Exome Variant Server. NHLBI GO Exome Sequencing Project (ESP) Seattle, WA2013 [15-09-2013].
Available from: http://evs.gs.washington.edu/EVS/.
Adzhubei IA, Schmidt S, Peshkin L, et al. A method and server for predicting damaging missense
mutations. Nat Meth. 2010;7(4):248-9.
Kumar P, Henikoff S, Ng PC. Predicting the effects of coding non-synonymous variants on protein
function using the SIFT algorithm. Nature protocols. 2009;4(7):1073-81.
Schwarz JM, Rodelsperger C, Schuelke M, et al. MutationTaster evaluates disease-causing potential of
sequence alterations. Nature methods. 2010;7(8):575-6.
Weil D, El-Amraoui A, Masmoudi S, et al. Usher syndrome type I G (USH1G) is caused by mutations in
the gene encoding SANS, a protein that associates with the USH1C protein, harmonin. Human
molecular genetics. 2003;12(5):463-71.
Ouyang XM, Yan D, Du LL, et al. Characterization of Usher syndrome type I gene mutations in an
Usher syndrome patient population. Human genetics. 2005;116(4):292-9.
Doucette L, Merner ND, Cooke S, et al. Profound, prelingual nonsyndromic deafness maps to
chromosome 10q21 and is caused by a novel missense mutation in the Usher syndrome type IF gene
PCDH15. European journal of human genetics : EJHG. 2009;17(5):554-64.
Schultz JM, Bhatti R, Madeo AC, et al. Allelic hierarchy of CDH23 mutations causing non-syndromic
deafness DFNB12 or Usher syndrome USH1D in compound heterozygotes. Journal of medical genetics.
2011;48(11):767-75.
Ahmed ZM, Riazuddin S, Aye S, et al. Gene structure and mutant alleles of PCDH15: nonsyndromic
deafness DFNB23 and type 1 Usher syndrome. Human genetics. 2008;124(3):215-23.
Maerker T, van Wijk E, Overlack N, et al. A novel Usher protein network at the periciliary reloading
point between molecular transport machineries in vertebrate photoreceptor cells. Human molecular
genetics. 2008;17(1):71-86.
2.3
Progressive hearing loss and
vestibular dysfunction caused by
a homozygous nonsense
mutation in CLIC5
C.Z. Seco*
A.M.M. Oonk*
M. Domínguez-Ruiz
J.M.T. Draaisma
M. Gandía
J. Oostrik
K. Neveling
H.P.M. Kunst
L.H. Hoefsloot
I. del Castillo
R.J.E. Pennings
H. Kremer
R.J.C. Admiraal
M. Schraders
*These authors contributed equally
Eur J Hum Genet. 2015 Feb;23(2):189-94.
110 | Chapter 2
Abstract
In a consanguineous Turkish family diagnosed with autosomal recessive nonsyndromic hearing impairment (arNSHI), a homozygous region of 47.4 Mb was
shared by the two affected siblings on chromosome 6p21.1-q15. This region
contains 247 genes including the known deafness- associated gene MYO6. No
pathogenic variants were found in MYO6 neither with sequence analysis of the
coding region and splice sites nor with mRNA analysis. Subsequent candidate gene
evaluation revealed CLIC5 as an excellent candidate gene. The orthologous mouse
gene is mutated in the jitterbug mutant that exhibits progressive hearing
impairment and vestibular dysfunction. Mutation analysis of CLIC5 revealed a
homozygous nonsense mutation c.96T>A (p.(Cys32X)) that segregated with the
hearing loss. Further analysis of CLIC5 in 213 arNSHI patients from mostly Dutch
and Spanish origin did not reveal any additional pathogenic variants. CLIC5
mutations are thus not a common cause of arNSHI in these populations.
The hearing loss in the present family had an onset in early childhood and
progressed from mild to severe or even profound before the second decade.
Impaired hearing is accompanied by vestibular areflexia and in one of the patients
with mild renal dysfunction. Although we demonstrate that CLIC5 is expressed in
many other human tissues no additional symptoms were observed in these
patients.
In conclusion, our results show that CLIC5 is a novel arNSHI gene involved in
progressive hearing impairment, vestibular and possibly mild renal dysfunction
in a family of Turkish origin.
Novel genotype-phenotype correlations
| 111
Introduction
Hearing impairment is the most common sensory disorder worldwide and it is
clinically and genetically very heterogeneous 1. Approximately 80% of early onset
hereditary non-syndromic hearing impairment inherits in an autosomal recessive
pattern. Currently, 80 loci and 49 genes have been identified for autosomal
recessive non-syndromic hearing impairment (arNSHI), showing the great genetic
heterogeneity 2. This heterogeneity might well be explained by the complexity of
the auditory system. Defects in a large variety of biological processes such as gene
regulation, ion homeostasis and hair bundle morphogenesis can lead to hearing
impairment 3.
In the last decade, homozygosity mapping using genome-wide SNP genotyping has
been a powerful tool in the identification of arNSHI loci and genes 4. Lately, next
generation sequencing technologies have revolutionized the genetics field and
also led to the identification of novel arNSHI genes at fast pace 5. The most powerful
evidence to assign a candidate gene as a novel deafness gene is to discover
pathogenic variants in several families and not in controls. However, due to the
large genetic heterogeneity of hearing impairment this can be very difficult even
with the current technologies. This is also evident from three recently identified
arNSHI genes, PNPT1, SERPINB6 and TSPEAR, for which mutations have only been
described in a single family each 6-8. Further evidence to assign a candidate gene as
a deafness gene can come from animal models, especially mouse models with
hearing loss. Several genes essential for hearing in humans were identified after
they had already been demonstrated to be associated with deafness in mice 9.
Using homozygosity mapping and candidate gene analysis we identified a
homozygous nonsense mutation in CLIC5 in a consanguineous Turkish family
(W05-009). The orthologous mouse gene, Clic5, was described to be mutated in the
jitterbug (jbg) mouse exhibiting congenital progressive hearing impairment and
vestibular dysfunction due to progressive hair cell degeneration 10.
Materials and Methods
Subjects and clinical evaluations
This study was approved by the local medical ethics committee of the Radboud
university medical center and Hospital Universitario Ramon y Cajal. Signed
informed consent was obtained from the parents, since all patients are minors. In
addition, a signed form was used to retrieve relevant data from other medical
centers.
For the affected individuals of family W05-009 general physical examination was
112 | Chapter 2
performed by a pediatrician. Blood and urine samples were analyzed to evaluate
renal and thyroid function. ENT examination was executed to exclude other
possible causes of hearing impairment like previous ear surgery and external ear
deformities. A computed tomography (CT) scan of the temporal bone was performed
in order to exclude possible anatomical causes of hearing loss. Pure tone audiometry
was performed according to current standards to determine hearing thresholds at
0.25, 0.5, 1, 2, 4 and 8 kHz. To exclude conductive hearing loss both air conduction
and bone conduction thresholds were obtained. Classification of the hearing loss is
in accordance with the GENDEAF guidelines 2. In addition, otoacoustic emissions
(OAEs) were measured in individual II.3. Vestibular function was evaluated by
electronystagmography and rotatory tests 11. GraphPad Prism 5.00 (GraphPad, San
Diego, CA, USA) was used to perform linear regression analysis to evaluate
progression of the hearing impairment.
Three panels of arNSHI patients were analyzed for involvement of CLIC5. GJB2
mutations or GJB6 deletions were excluded by routine analysis in most of these
patients. The first panel consisted of 76 arNSHI index patients, mostly of Dutch
origin, and these were selected based on the hearing loss phenotype. They
presented either with a downsloping audiogram configuration and progression of
hearing loss or early onset progressive hearing loss accompanied by vestibular
areflexia or hyporeflexia.
The second panel consisted of 69 unrelated arNSHI sibships of Spanish origin
which were not preselected based on type or severity of their hearing impairment.
The third panel contained 18 arNSHI index patients of Spanish origin selected
based on the hearing loss phenotype. In most of the cases, the hearing loss was
postlingual (16 in childhood, at school age; two in the second decade of life) and
progressive with a downsloping audiogram configuration.
Homozygosity Mapping
Genomic DNA was isolated from peripheral-blood lymphocytes by standard
procedures. Individuals II.2 and II.3 from family W05-009 were genotyped using
the Affymetrix mapping 250K NspI SNP array. All SNP array experiments were
performed and analyzed according to the manufacturer’s protocol (Affymetrix,
Santa Clara, CA, USA). Genotype calling and calculation of the regions of
homozygosity were performed with the Genotyping Console software (Affymetrix)
with the default settings. The cosegregation of the genotypes for each previously
reported arNSHI gene was visually evaluated.
Mutation Analysis
Primers for amplification of exons and exon-intron boundaries of CLIC5
(NM_016929.4, CLIC5A and NM_001114086.1, CLIC5B), ESPN (NM_031475.2), MYO6
Novel genotype-phenotype correlations
| 113
(NM_004999.3) and for mRNA analysis of MYO6 (NM_004999.3) were designed with
ExonPrimer 12. Primer sequences and PCR conditions are provided in Supplemental
Table S1. Amplification by PCR was performed on 40 ng of genomic DNA with Taq
DNA polymerase (Roche, Mannheim, Germany). For MYO6 mRNA analysis, total
RNA was isolated from Epstein-Barr-virus (EBV)-transformed lymphoblastoid cells
of affected individual II.2 using the NucleoSpin RNA II kit (Machery Nagel, Düren,
Germany) according to the manufacturer’s protocol. Subsequently, cDNA synthesis
was performed with 1.5 µg RNA as starting material by using the iScript cDNA
Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA), according to the
manufacturer’s protocol. PCR reactions were performed on 2 µl cDNA with the Taq
DNA polymerase (Invitrogen, Carlsbad, CA, USA).
PCR fragments were purified with the use of NucleoFast 96 PCR plates (Clontech,
Mountain View, CA, USA) or ExoI/FastAP (Fermentas, Vilnius, Lithuania) in
accordance with the manufacturer’s protocol. Sequence analysis was performed
with the ABI PRISM BigDye Terminator Cycle Sequencing V2.0 Ready Reaction kit
and analyzed with the ABI PRISM 3730 DNA analyzer (Applied Biosystems Foster
City, CA, USA). The presence of the CLIC5 c.96T>A transversion was investigated in
111 ethnically matched healthy controls. Exon 2 of CLIC5 was amplified and PCR
products were purified as described above. Digestion of the PCR products with
HpyCH4III (New England Biolabs, Ipswich, MA, USA) was performed in accordance
with the manufacturer’s protocol, and restriction fragments were analyzed on
gels containing 1.5% agarose and 1% low-melting agarose. The mutation removes a
restriction site.
Nonsense-mediated mRNA decay (NMD) evaluation
EBV-transformed lymphoblastoid cell lines were established from heparin blood of
individuals II.2 and II.3. Cells were grown with and without cycloheximide, a
protein synthesis inhibitor, which prevents the nonsense-mediated mRNA decay
process as described previously 13. Total RNA was isolated as described above. cDNA
synthesis was performed with 3 µg RNA as starting material by using the iScript
cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA), according to the
manufacturer’s protocol. For the quantitative PCR (qPCR), specific primers
(Supplemental Table S1) were designed with Primer3Plus14 and reference sequence
NM_016929.4. PCRs were performed with the Applied Biosystem Fast 7900 System
in accordance with the manufacturer’s protocol. The human beta glucuronidase
gene (GUSB [MIM 611499]) was employed as an internal control. PCR mixtures were
prepared with the Power Syber Green Master Mix (Applied Biosystems) in
accordance with the manufacturer’s protocol. Temperatures and reaction times
for PCR were as follows: 10 min at 95°C, followed by 40 cycles of 15 s at 95°C and 30
s at 60°C. All reactions were performed in duplicate. Relative gene expression
114 | Chapter 2
levels were determined with the delta delta Ct method as described previously 15.
CLIC5 Expression Profile
RNA derived from adult heart, retina, brain and kidney was purchased from
Clontech (Mountain View, CA, USA). RNA derived from adult skeletal muscle, liver,
duodenum, testis, spleen, thymus, and placenta were purchased from Stratagene
(La Jolla, CA, USA) and bone marrow from Bio-chain (Newark, CA, USA). RNA
derived from fetal brain, colon, kidney, stomach, spleen, heart, skeletal muscle,
lung and thymus was purchased from Stratagene. In addition, RNA was isolated
from adult lung, fetal cochlea and fetal liver as described previously 16. The inner
ear was derived from a fetus at 8 weeks of gestation and the other fetal tissues
from fetuses at 20 – 21 weeks of gestation. cDNA synthesis, primer design
(Supplemental Table S1) and qPCR analysis were performed as described above. The
forward primer was located on the boundary of exons 2 and 3, and the reverse
primer in exon 3. This enabled detection of all CLIC5 isoforms affected by the
nonsense mutation that is located in exon 2. Relative gene expression levels were
determined with the comparative delta Ct method as described previously 17.
Results
Hearing loss and vestibular dysfunction in family W05-009
ENT examination and CT scanning did not reveal an apparent cause of hearing
impairment in the two affected children of family W05-009. The parents have
normal hearing and are first cousins of Turkish ancestry (Figure 1A). The patients
presented with an early onset sensorineural hearing loss since the bone conduction
thresholds did not differ from the air conduction thresholds. The hearing
impairment probably was not congenital since individual II.2 passed a behavioural
reflex audiometry test which is performed between 7 and 9 months of age (Ewing
test) and individual II.3 had normal hearing at the age of 3 months during
brainstem evoked response audiometry. The hearing loss started mildly, affecting
the mid and high frequencies mostly. OAEs were not present in individual II.3 at
the age of 4 months. It progressed to a severe-to-profound hearing loss with a
gently to steeply downsloping audiogram configuration as is shown in Figure 1B.
Longitudinal linear regression analysis indicated significant progression in all
frequencies (Figure 1C). Individual II.2 received a cochlear implant at the age of 11
years. Five years post-implantation, the speech recognition scores were 88% (using
the standard Dutch phonetically balanced consonant-vocal-consonant word lists)
18
. Initial motor milestones were reported to be normal, but later in life balance
problems did occur e.g. difficulties with walking in the dark and cycling. Vestibular
Novel genotype-phenotype correlations
| 115
areflexia was found in both individuals during the rotatory test at the age of 16
years (II.2) and 11 years (II.3).
General physical examination showed that both children had a normal height and
weight. No other abnormalities besides the hearing impairment were noted in
individual II.2. On history, there were no signs of any other abnormalities in
individual II.3. Thyroid function was also normal in individuals II.2 and II.3. Renal
function was normal in II.2. However, in individual II.3 a blood pressure of 127/73
to 129/88 mmHg (90% value for this age and length: 120/76 mmHg) was measured
and an elevated albumin/creatinine ratio was detected at the last two visits in the
outpatient clinic (9.2 and 3.8 mg/mmol, respectively, normal value <2.5 mg/mmol)
during urine analysis at the age of 11 years. The glomerular filtration rate,
calculated with the Schwartz equation, was normal with a value of 114 ml/
min/1.73 m2 (normal > 90 ml/min/1.73 m2). Since the elevated blood pressure and
albumin/creatinine ratio were seen in repeated measurements, these might be the
first signs of a nephropathy. However, no other more invasive studies were
performed, since the renal function was overall only mildly affected. Subsequent
renal function follow-up of patient II.3 in the future will be needed to determine
whether it is indeed a nephropathy.
Homozygosity mapping confines a critical region on chromosome
6p21.1-q15
To identify genes for arNSHI, homozygosity mapping was performed in some large
series of familial and isolated arNSHI patients living in the Netherlands. In family
W05-009 homozygosity mapping revealed a homozygous region of 47.4 Mb on
chromosome 6p21.1-q15 (Figure 2A). This was the largest homozygous region
shared by the two affected individuals. This region contains the known deafnessassociated gene MYO6. There were 15 other shared homozygous regions larger than
1 Mb (Supplemental Table S2), and in one of them ESPN is located, which is another
gene known for arNSHI. Mutation analysis was performed for all exons and
exon-intron boundaries of ESPN and MYO6, which revealed no putative causative
variants. Since MYO6 was located in the largest shared homozygous region, MYO6
mRNA was analyzed by RT-PCR. No PCR-products of an aberrant size were
indentified and also sequence analysis of the PCR products did not reveal
indications for aberrant splicing. To exclude compound heterozygous or allozygous
mutations in the other known arNSHI genes, cosegregation of the genotypes was
visually evaluated for each gene. PNPT1, ILDR1, RDX, TECTA, OTOGL, PTPRQ and OTOA
were present within the genotype shared regions. OTOA could be excluded by short
tandem repeat (STR) marker analysis in the family. No putative pathogenic variants
were identified in the other genes by sequence analysis of the exons and exon-intron
boundaries.
116 | Chapter 2
A nonsense mutation in CLIC5 causes arNSHI
Since no pathogenic variants could be identified in MYO6 or ESPN we hypothesized
that another gene would be underlying the hearing loss in this family. Therefore,
we continued with the evaluation of the 247 annotated genes in the largest
homozygous region, 6p21.1-q15 19. For three of the genes, mutations in the
orthologous mouse gene cause deafness. Slc17a5 (MGI:1924105)20 and Bmp5
(MGI:88181) are associated with mixed and conductive hearing loss in the mouse,
respectively. The third gene, Clic5, was described to underlie progressive
A
I.2
p.Cys32Ter
WT
I.1
p.Cys32Ter
WT
II.1
WT
WT
II.3
p.Cys32Ter
p.Cys32Ter
II.2
p.Cys32Ter
p.Cys32Ter
B
dB
-10
0
20
dB
II.2
4.6 y
3.1 y
6.4 y
20
4.4 y
8.2 y
40
16.0 y
p95
60
5.2 y
40
6.5 y
60
80
80
100
100
120
120
140
II.3
-10
0
8.1 y
11.2 y
p95
140
.25
.5
1
2
4
8 kHz
.25
.5
1
2
4
8 kHz
Figure 1 A. Pedigree of family W05-009 and segregation of the CLIC5 c.96T>A
variant. B. Longitudinal binaural mean air-conduction pure tone thresholds are
shown of affected members of family W05-009. Age (years) is shown with a symbol
key. The p95 line, matched for age and sex, indicates that 95% of the population
has thresholds lower than these. C. Regression analysis of longitudinal binaural
mean air conduction threshold data for each frequency separately. Circles indicate
individual II.2, squares indicate individual II.3. Annual threshold deterioration is
shown behind the symbol key for each frequency.
10
Figure 1 Continued.
0
5
10
5
10
15
20
0
5
10
15
20
-100
-100
-5.3 dB HL/y
-2.6 dB HL/y
0
-100
0
4 kHz
20
-50
0
15
-50
-4.0 dB HL/y
-2.5 dB HL/y
20
-50
0
2 kHz
15
-100
-100
-6.0 dB HL/y
-5.7 dB HL/y
0
-100
5
0.5 kHz
-50
-5.9 dB HL/y
-4.1 dB HL/y
0
-50
0
0.25 kHz
-50
0
0
0
5
5
Age (y)
10
8 kHz
10
1 kHz
20
15
20
-4.8 dB HL/y (n.s.)
-2.4 dB HL/y
15
-3.9 dB HL/y
-1.4 dB HL/y
Novel genotype-phenotype correlations
C
| 117
db HL
118 | Chapter 2
sensorineural hearing loss and vestibular dysfunction in the jbg mouse mutant 10.
Therefore, CLIC5 represented an excellent candidate gene.
Mutation analysis of CLIC5 revealed a homozygous nonsense variant c.96T>A
(p.(Cys32X)) (Figure 2B), which segregated with the hearing impairment in family
W05-009 (Figure 1A). This variant was not present in 222 Turkish control alleles,
the Exome Variant Server21 and the Nijmegen in-house exome database (1302
exomes). This variant was submitted to the Leiden Open Variant Database 22.
The homozygous CLIC5 c.96C>T mutation is predicted to result in NMD, since it
creates a premature stop codon (p.(Cys32X)) more than 54 bp upstream of the
3’-most intron 23. However, we could not confirm NMD. The relative CLIC5 mRNA
expression is comparable in cycloheximide treated and untreated patient EBV-cell
lines (157.24% vs. 157.89%, respectively) and higher - albeit not significantly - than
in controls (set at 100%) as shown in Supplemental figure 1.
A
B
Figure 2 A. Schematic overview of the chromosomal region 6q21.1-q15 showing
the homozygous regions (black bars) identified in the affected individuals of
family W05-009. The homozygous region of individual II.2 delimits the region to
47.4 Mb. Mb positions and chromosome bands are according to the UCSC genome
browser (GRCh37). B. Partial sequences are shown of CLIC5 exon 2 from an affected
member, a parent and an unaffected sib of family W05-009. The predicted amino
acid changes and the surrounding amino acids are indicated above the sequence.
Mutated nucleotides are marked by an arrowhead. As reference sequence NM_016929.4
was employed.
Novel genotype-phenotype correlations
| 119
For identification of other families with CLIC5 mutations, sequence analysis of the
coding region and splice sites of CLIC5 was performed in 76 arNSHI index patients,
mostly of Dutch origin, and 18 Spanish arNSHI index patients. These patients were
preselected based on the hearing loss and vestibular phenotype as described in the
materials and methods section. No putatively causative variants were identified in
these patients. In a parallel approach, compatibility with linkage to DFNB102 was
investigated in a panel of 69 unrelated arNSHI sibships of Spanish origin. These
were genotyped for STR-markers D6S459, D6S1920, D6S1632 and D6S1638, which
flank CLIC5. Haplotype analysis revealed compatibility with linkage of the disease
locus to these markers in 18 sibships. Sequence analysis of CLIC5 in the index cases
of these sibships did not reveal any putative pathogenic variants. Finally, data of 50
whole exome sequence analysis of arNSHI patients, mainly of Dutch origin were
evaluated for the presence of variants in CLIC5. These patients were not preselected
based on the type or severity of the hearing loss. No putatively pathogenic variants
were identified in this cohort.
CLIC5 is expressed in the human inner ear
The expression of CLIC5 was studied via qPCR in human fetal inner ear and
compared to that in additional 13 adult and 10 fetal-stage human tissues (Figure
3). Since this was performed in two separate experiments for adult and fetal
tissues, fetal inner ear was included in both for comparison. The tissues were not
derived from fetuses of the same gestational stage; therefore, a direct comparison
of the transcript levels cannot be made. In fetal tissues, CLIC5 transcript levels were
highest in skeletal muscle, kidney, spleen, heart and colon. A lower expression
level was found in fetal brain, thymus, lung and stomach. Expression in the fetal
inner ear was 26 fold higher than in fetal liver in which the expression level was
the lowest. In adult tissues, the highest expression levels were found in heart, lung,
skeletal muscle and kidney and there was a gradual decrease through retina,
spleen, brain, placenta, duodenum and thymus. Finally, the lowest expression
levels were found in bone marrow, testis and liver. We can conclude that CLIC5 is
widely expressed in both fetal and adult human tissues.
120 | Chapter 2
Relative CLIC5 expression in fetal tissues
A
10000
1000
100
10
B
Sk
r
ve
h
om
Li
ac
ng
St
Lu
ai
n
Th
ym
us
Br
rt
Co
lo
n
In
ne
re
ar
H
ea
n
Sp
le
e
el
et
al
m
us
cl
e
Ki
dn
ey
1
Relative CLIC5 expression in adult tissues
10000
1000
100
10
r
r
li
nn
er
ea
ve
Li
ta
Fe
cl
e
Ki
dn
ey
Re
ti
na
Sp
le
en
Br
ai
n
Pl
ac
en
D
ta
uo
de
nu
m
T
Bo hy m
ne
us
m
ar
ro
w
Te
st
is
m
us
ng
Sk
el
et
al
Lu
H
ea
rt
1
Figure 3 CLIC5 expression profile in human tissues. Relative CLIC5 mRNA levels as
determined by qPCR in human fetal (A) and adult (B) tissues. The relative expression
values were determined by using the comparative delta Ct method 17. The expression
levels are relative to those in liver, which showed the lowest CLIC5 expression of all
the tissues that were tested.
Discussion
We present a homozygous nonsense mutation, c.96T>A (p.(Cys32X)) in CLIC5
(DFNB102) as a cause of sensorineural hearing impairment accompanied by
vestibular dysfunction. This nonsense variant will lead to an early truncation of
the protein. Screening a series of arNSHI index patients did not reveal additional
causative variants, suggesting that mutations in CLIC5 are not a common cause of
arNSHI neither in the Netherlands nor in Spain.
Initially, the hearing loss in the affected individuals of family W05-009 was mild,
mainly affecting the mid and high frequencies, and then it progressed to severe to
profound. They also showed vestibular areflexia in the second decade of life. The
combination of progression to profound hearing loss and complete vestibular
dysfunction in the patients of family W05-009 resembles the phenotype of the jbg
mutants. Auditory-evoked brainstem responses (ABRs) at 1-5 months of age in jbg
Novel genotype-phenotype correlations
| 121
mutant mice, which are null for Clic5, were 40-50 dB above those of wildtype mice.
By 7 months of age their hearing loss had progressed to complete deafness due to
progressive hair bundle degeneration and a reduced density of spiral ganglion
cells 10. The vestibular hair cells of jbg mice also showed a progressive degeneration.
In the crista ampullaris, the number of vestibular hair cells was reduced at 3
months and hair cells were nearly absent at 12 months of age 10.
Besides inner ear dysfunction, the phenotype in humans and mice with Clic5
mutations may well overlap with respect to the renal phenotype. The jbg mice have
abnormalities in the foot processes of the kidney podocytes leading to proteinuria 24,25.
The elevated albumin/creatinine ratio and pre-hypertension in affected individual
II.3 indicate mild renal dysfunction and may well be the first signs of a nephropathy.
Therefore, follow-up of renal function is indicated for individual II.3 but also for
his hearing impaired sister.
In addition to the inner ear and kidney phenotypes, the jbg mutant mice also
exhibit emphysema-like lung pathology, hyperactivity and resistance to dietinduced obesity 26. Characteristics of lung emphysema and hyperactivity were
excluded in family W05-009 by history taking. The affected individuals had
normal height and weight. No other gross abnormalities in the organs of the jbg
mutants were detected and no other complaints from the affected siblings were
reported so far. The lack of symptoms in organs with relatively high CLIC5
expression (Figure 3) points towards redundancy for CLIC5 function there.
CLIC5 belongs to a family of chloride intracellular channel proteins, but its protein
structure differs from other typical ion channel proteins. CLICs (CLIC1-6) show no
sequence homology to any known channel family, but significant homology to
glutathione S-transferases in the core region 27. Moreover, some of the CLIC
proteins, including CLIC5, are not only integral membrane proteins, but are also
found as soluble proteins in the cytoplasm 28. In the inner ear, CLIC5 localizes to
stereocilia of both the cochlear and vestibular hair cells and on the surface of
Kolliker’s organ during cochlea development in mice 10. Specifically, CLIC5 is
predominantly present at the base of stereocilia and, to lesser extent, in the cell
bodies of hair cells in the region surrounding the cuticular plate 10. CLIC5 was
initially identified in placental microvilli as a component of a multimeric complex
consisting of several known cytoskeletal proteins, including actin and ezrin 29.
Although the function of CLIC5 is still elusive, there are several facts that support
its role in stereocilia integrity. Firstly, radixin immunostaining is reduced in the
hair bundle of jbg mice where it colocalizes with Clic5 10. This suggests that Clic5
is needed for proper radixin activity, so when interacting with the ERM (erzin,
radixin and moesin) complex, Clic5 may stabilize connections between the plasma
membrane and the filamentous actin core 10. Secondly, Clic5 functions as an
122 | Chapter 2
adapter between the plasma membrane of podocytes and the actin cytoskeleton by
facilitating the interaction between ezrin and podocalyxin 24, 25, 30. Thirdly, a recent
study proposes that Clic5 functions as part of a multiprotein linker complex in
companion with radixin, erzin and taperin 31. Protein tyrosine phosphatase
receptor Q (Ptprq), which is mislocalized as radixin in the jbg mice, and Myosin VI,
key regulator of the proper localization of Ptprq32, might well participate in this
complex too. Radixin33, Ptprq32, 34 Myosin VI35 and Clic5 deficient mice10 show loss
of stereocilia at the bundle vertex and fusion of stereocilia in postnatal stage. This
suggests that this multiprotein complex is essential for stable membrane-cytoskeletal attachments at the stereocilia base.
Conclusion
We show that a homozygous nonsense mutation in CLIC5 (p.(Cys32X)) underlies the
progressive hearing impairment, vestibular and possibly mild renal dysfunction
in a family of Turkish origin. CLIC5 mutations do not seem to be a common cause
of arNSHI in the Dutch and Spanish populations. Further screening of CLIC5 in
other populations will provide important information about the frequency of
CLIC5 mutations and may aid to further define the phenotype associated with CLIC5
mutations.
Novel genotype-phenotype correlations
| 123
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
Mehl AL, Thomson V. The Colorado newborn hearing screening project, 1992-1999: on the threshold
of effective population-based universal newborn hearing screening. Pediatrics. 2002;109(1):E7.
Hereditary Hearing Loss Homepage, http://hereditaryhearingloss.org
Dror AA, Avraham KB. Hearing loss: mechanisms revealed by genetics and cell biology. Annual review
of genetics. 2009;43:411-37.
Schraders M, Lee K, Oostrik J, et al. Homozygosity mapping reveals mutations of GRXCR1 as a cause of
autosomal-recessive nonsyndromic hearing impairment. American journal of human genetics.
2010;86(2):138-47.
Shearer AE, Smith RJ. Genetics: advances in genetic testing for deafness. Current opinion in pediatrics.
2012;24(6):679-86.
Delmaghani S, Aghaie A, Michalski N, et al. Defect in the gene encoding the EAR/EPTP domain-containing
protein TSPEAR causes DFNB98 profound deafness. Human molecular genetics. 2012;21(17): 3835-44.
Sirmaci A, Erbek S, Price J, et al. A truncating mutation in SERPINB6 is associated with autosomalrecessive nonsyndromic sensorineural hearing loss. American journal of human genetics. 2010;8 6(5):
797-804.
von Ameln S, Wang G, Boulouiz R, et al. A mutation in PNPT1, encoding mitochondrial-RNA-import
protein PNPase, causes hereditary hearing loss. American journal of human genetics. 2012;91(5):919-27.
Friedman LM, Dror AA, Avraham KB. Mouse models to study inner ear development and hereditary
hearing loss. The International journal of developmental biology. 2007;51(6-7):609-31.
Gagnon LH, Longo-Guess CM, Berryman M, et al. The chloride intracellular channel protein CLIC5 is
expressed at high levels in hair cell stereocilia and is essential for normal inner ear function. The
Journal of neuroscience: the official journal of the Society for Neuroscience. 2006;26(40):10188-98.
Theunissen EJ, Huygen PL, Folgering HT. Vestibular hyperreactivity and hyperventilation. Clinical
otolaryngology and allied sciences. 1986;11(3):161-9.
http://ihg.gsf.de/ihg/ExonPrimer.html
Go SL, Maugeri A, Mulder JJ, et al. Autosomal dominant rhegmatogenous retinal detachment
associated with an Arg453Ter mutation in the COL2A1 gene. Investigative ophthalmology & visual
science. 2003;44(9):4035-43.
http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR
and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-8.
Luijendijk MW, van de Pol TJ, van Duijnhoven G, et al. Cloning, characterization, and mRNA
expression analysis of novel human fetal cochlear cDNAs. Genomics. 2003;82(4):480-90.
Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic acids
research. 2001;29(9):e45.
Bosman AJ SG. Woordenlijst voor spraakaudiometrie (Compact Disc) Gouda, the Netherlands: Electro
Medical Instruments bv & Veenhuis Medical Audio bv; 1992.
http://genome.ucsc.edu/, RefSeq genes, hg19; assigned DFNB102
Prolo LM, Vogel H, Reimer RJ. The lysosomal sialic acid transporter sialin is required for normal CNS
myelination. The Journal of neuroscience : the official journal of the Society for Neuroscience.
2009;29(49):15355-65.
http://evs.gs.washington.edu/EVS/
http://databases.lovd.nl/shared/variants/0000022995
Nagy E, Maquat LE. A rule for termination-codon position within intron-containing genes: when
nonsense affects RNA abundance. Trends in biochemical sciences. 1998;23(6):198-9.
Pierchala BA, Munoz MR, Tsui CC. Proteomic analysis of the slit diaphragm complex: CLIC5 is a
protein critical for podocyte morphology and function. Kidney Int. 2010;78(9):868-82.
Wegner B, Al-Momany A, Kulak SC, et al. CLIC5A, a component of the ezrin-podocalyxin complex in
glomeruli, is a determinant of podocyte integrity. American journal of physiology Renal physiology.
2010;298(6):F1492-503.
124 | Chapter 2
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
Bradford EM, Miller ML, Prasad V, et al. CLIC5 mutant mice are resistant to diet-induced obesity and
exhibit gastric hemorrhaging and increased susceptibility to torpor. American journal of physiology
Regulatory, integrative and comparative physiology. 2010;298(6):R1531-42.
Dulhunty A, Gage P, Curtis S, et al. The glutathione transferase structural family includes a nuclear
chloride channel and a ryanodine receptor calcium release channel modulator. The Journal of
biological chemistry. 2001;276(5):3319-23.
Ashley RH. Challenging accepted ion channel biology: p64 and the CLIC family of putative
intracellular anion channel proteins (Review). Molecular membrane biology. 2003;20(1):1-11.
Berryman M, Bretscher A. Identification of a novel member of the chloride intracellular channel gene
family (CLIC5) that associates with the actin cytoskeleton of placental microvilli. Molecular biology
of the cell. 2000;11(5):1509-21.
Jiang L, Phang JM, Yu J, et al. CLIC proteins, ezrin, radixin, moesin and the coupling of membranes to
the actin cytoskeleton: A smoking gun? Biochimica et biophysica acta. 2014;1838(2):643-57.
Salles FT, Andrade LR, Tanda S, et al. CLIC5 stabilizes membrane-actin filament linkages at the base of
hair cell stereocilia in a molecular complex with radixin, taperin, and myosin VI. Cytoskeleton. 2013.
Sakaguchi H, Tokita J, Naoz M, et al. Dynamic compartmentalization of protein tyrosine phosphatase
receptor Q at the proximal end of stereocilia: implication of myosin VI-based transport. Cell motility
and the cytoskeleton. 2008;65(7):528-38.
Kitajiri S, Fukumoto K, Hata M, et al. Radixin deficiency causes deafness associated with progressive
degeneration of cochlear stereocilia. The Journal of cell biology. 2004;166(4):559-70.
Goodyear RJ, Legan PK, Wright MB, et al. A receptor-like inositol lipid phosphatase is required for the
maturation of developing cochlear hair bundles. The Journal of neuroscience : the official journal of
the Society for Neuroscience. 2003;23(27):9208-19.
Self T, Sobe T, Copeland NG, et al. Role of myosin VI in the differentiation of cochlear hair cells.
Developmental biology. 1999;214(2):331-41.
Novel genotype-phenotype correlations
| 125
Supplemental Table S1 Primer sequences and PCR conditions for genomic PCR,
sequence analysis and QPCR.
Target
Oligonucleotides
Product
Annealing
size (bps) Temperature
(°C)
Primers for genomic PCR and sequence analysis of CLIC5, MYO6 and ESPN
CLIC5 Exon 1
Forward primer
CCAGGACCAGCTCTGTCTC
Reverse primer
AACCTGCCTTCCTCCATTC
CLIC5 Exon 2
Forward primer
TTATTGAGCCCTTACATGCTG
Reverse primer
ACTTGCCTTTGCAGACTCTC
CLIC5 Exon 3
Forward primer
ACAGGCATGTTGGATAGCAC
Reverse primer
GTCACTGGGTTACCCTTTCC
CLIC5 Exon 4
Forward primer
GCTGGAAAGGGAAGTATTGC
Reverse primer
CTCTGGCCCAAGTATTTGAC
CLIC5 Exon 5
Forward primer
TCCAGGTATTCTGCAGTGTG
Reverse primer
AGGTTCTTGACCAACAGGTG
CLIC5 Exon 6
Forward primer
AAAGAAGACAGCACTGCCAC
Reverse primer
GCCTCAAGGCAGTGATACAG
CLIC5 Exon 1a*
MYO6 Exon 1
MYO6 Exon 2
MYO6 Exon 3
MYO6 Exon 4
MYO6 Exon 5
MYO6 Exon 6
MYO6 Exon 7
MYO6 Exon 8
MYO6 Exon 9
Forward primer
TCCAATGGACTTGTGGTTTG
Reverse primer
TGACTGATTTAGTCCCTCCG
Forward primer
TCCGTAGCCGTGACGTG
Reverse primer
TCGGGCAGTGAACAGAAG
Forward primer
TGGGCAGATGTGTTTGTTAG
Reverse primer
TGCTTTCCCAAATATCTACCTC
Forward primer
GTATGCAACCAATTAAGCCC
Reverse primer
TAGATTGTTTCTGAACCCGC
Forward primer
TAGGGTTTACATCAGCCAGG
Reverse primer
TCAAGCATGATTTTCTGTTAGAC
Forward primer
TGGGTCCCTATAAAGATCAGG
Reverse primer
CCCTGTGTAAAATACTTGCTCC
Forward primer
TGATTTCTTTAAGAGTAAGTGGTCC
Reverse primer
TACAGTGAGCTGTGGTGGTG
Forward primer
TGATGATCTAGGTTTCAGTTTTATATG
Reverse primer
TGAGAGAAGAACATTCCAGACC
Forward primer
GCATGAGCCACTGTGTCC
Reverse primer
TGCAAATACAGCACCAACTG
Forward primer
AACCTCTTTGATAGACAAATGG
Reverse primer
CAGGCTCAAGCAATCCATC
733
56
484
56
653
56
306
56
431
56
427
56
885
56
532
56
388
56
262
56
337
56
471
56
322
58
238
56
324
56
651
58
126 | Chapter 2
Supplemental Table S1 Continued.
Target
Oligonucleotides
Product
Annealing
size (bps) Temperature
(°C)
Primers for genomic PCR and sequence analysis of CLIC5, MYO6 and ESPN
MYO6 Exon 10
MYO6 Exon 11
MYO6 Exon 12
MYO6 Exon 13
MYO6 Exon 14
MYO6 Exon 15
MYO6 Exon 16
MYO6 Exon 17
MYO6 Exon 18
MYO6 Exon 19
MYO6 Exon 20
Forward primer
TTCATGGTTGGCACTATTTG
Reverse primer
CAACAAGAGGTATAAAGTATTACACTG
Forward primer
AGTGCATTAATTGACCTGGTG
Reverse primer
TTTAAGCAAACTGCATATAAAGAGAC
Forward primer
AAAAGTTACAAATAAGCCTTGCC
Reverse primer
TTTTGATCTACCAAGCTCAGG
Forward primer
GTTTAGGTGCACTCTGTGGC
Reverse primer
CATATTATGAAATGTGAGTGTGGAC
Forward primer
TGAGAACATTTGGGAAGTATAGAAC
Reverse primer
ATACACCATCCATCCACACC
Forward primer
TTCAGAAACAGTGCAAAATTC
Reverse primer
CTTCCAGGCAGTAATACAGAAG
Forward primer
TGTTGTTTCTGATCAGTCCTTG
Reverse primer
TCCATCTAAGGAAGATACTGTGC
Forward primer
CTTACACCTATTTTCTTTCCTAAGAG
Reverse primer
TCACCACTAGTCAGTGTGGAC
Forward primer
AAGTTCCTTTGGACAGAGCC
Reverse primer
CAAATATCAACAATGCAGGG
Forward primer
CCAGGAGGTTGTTAAACTGG
Reverse primer
CAGGGTTACTATGCCTACTTGC
Forward primer
CCCAGCCTTGAGTTCTTTAG
Reverse primer
AAGATGAAAATTTTATTGCACTG
MYO6 Exon 21-22 Forward primer
Reverse primer
MYO6 Exon 23
MYO6 Exon 24
MYO6 Exon 25
MYO6 Exon 26
MYO6 Exon 27
TCTCATAAATTGCCCGTTTC
353
56
363
58
375
56
376
56
351
56
295
56
389
56
500
56
390
56
267
56
361
56
580
56
354
56
307
56
375
56
460
56
309
56
TGTTGTTAGTGACCATATAATTCAAG
Forward primer
TGCCAAGGCCTATGTAATTG
Reverse primer
AGCATCACCTCTGAGACAGC
Forward primer
GGTCGTCAAGATTTCATGTTTC
Reverse primer
AAAACCTGAGTATCCAAACTGC
Forward primer
TTGAAAACAGAAGTGAAATACCC
Reverse primer
GTCTCAACACATTTTGTAATTTTG
Forward primer
GCTGTATTTGCATATTGGAGTAG
Reverse primer
TTGTCATTAACCACTGTCAATACC
Forward primer
TTCCCAATCTGTTACCTTTG
Reverse primer
TTGATCTCCTGACCTCGTG
Novel genotype-phenotype correlations
| 127
Supplemental Table S1 Continued.
Target
Oligonucleotides
Product
Annealing
size (bps) Temperature
(°C)
Primers for genomic PCR and sequence analysis of CLIC5, MYO6 and ESPN
MYO6 Exon 28
MYO6 Exon 29
MYO6 Exon 30
MYO6 Exon 31
MYO6 Exon 32
MYO6 Exon 33
MYO6 Exon 34
MYO6 Exon 35_1
MYO6 Exon 35_2
MYO6 Exon 35_3
ESPN Exon 1
ESPN Exon 2
ESPN Exon 3-5
Forward primer
GGGGCAGTTATGCTTTCC
Reverse primer
TTCTGCATGGAAATGAGAGG
Forward primer
CACAAATTTGCACAATCCAG
Reverse primer
AGCACCATACAAGAGCATTAAAC
Forward primer
TGTGTTACGGCTAGATTTGTTG
Reverse primer
TCATGTAACAGGTTCTGGTCC
Forward primer
TCCGGTTTTCAAACTTATGC
Reverse primer
GTGCATTCATGGACCAAAAG
Forward primer
GCTTATCCTTATGAATAATTAGCTTAC
Reverse primer
GCCATCAAGGCTGTATTAGG
Forward primer
ACTTTTCAGTCACCACCTCG
Reverse primer
TCCACTGAAAATTGTAGCAAAAC
Forward primer
GGGGTATATTTTAGGATTAAAGGC
Reverse primer
TGGAAATGTGATTTAACCGC
Forward primer
ATTGAAAGGGTCCTTGATGG
Reverse primer
TGCCTTGATCATTTTAAGTGG
Forward primer
CCGCTGTAATTCCCAAAAC
Reverse primer
TCCAGTTAAGCCACTATGCC
Forward primer
GCACAATGTGTGTTGCTGTC
Reverse primer
CCTAACTGAGGTAATCTTTCTAGGG
Forward primer
ATTCGAACCCAGTTTTGCTG
Reverse primer
CCACCCACTTCCAGGACTAC
Forward primer
AGGAAGGGTGGAGAGATC
Reverse primer
ATGTTGAGTGGGAGCCATTT
Forward primer
GAGGTCAGACACAGCAGGTG
Reverse primer
AGCGTGGGTTTCCAGTTATG
Forward primer
AGGTGAGCTGCACCGACGTG
Reverse primer
TGACCTCTAGCTCCCCGTTC
ESPN Exon 6
Forward primer
GGAACCTGGGTCCTGCTG
Reverse primer
CCTCCCCATGTTTAAGAGCA
ESPN Exon 7
Forward primer
TGGTCTTCCCCCAGTAAGTG
Reverse primer
TACTCTCCTCCCAGTCCAGTG
ESPN Exon 3-5S#
ESPN Exon 8
Forward primer
GCTGCCCACTGTGAGAACC
Reverse primer
GGGAGGCCCTTTCTAGCTG
336
56
271
56
309
56
367
56
431
56
296
56
438
58
831
56
614
56
658
56
1010
58
859
58
1954
58
NA
NA
552
58
673
58
933
58
128 | Chapter 2
Supplemental Table S1 Continued.
Target
Oligonucleotides
Product
Annealing
size (bps) Temperature
(°C)
Primers for genomic PCR and sequence analysis of CLIC5, MYO6 and ESPN
ESPN Exon 9
ESPN Exon 10
ESPN Exon 11-12
ESPN Exon 13
Forward primer
CCATCCAATCTTGGCTTAGG
Reverse primer
ACTGGTGACAGTGCAGGTGA
Forward primer
CACAGTGTTCTCAGGCATCG
Reverse primer
GATGGGCTGTGCATCCAG
Forward primer
TCCCAGCTACTTGTTCTCTGC
Reverse primer
GTGGGGTTAGGTTAACTGAAGG
Forward primer
CTCAGTAACCCACCCCTTG
Reverse primer
ATCTGGGTCAGAGAGGAAGG
377
58
444
58
691
58
741
58
826
56
787
56
738
56
851
56
750
56
754
56
115
60
80
60
Primers for MYO6 mRNA analysis
MYO6 mRNA
Ex1-9
MYO6 mRNA
Ex8-13
MYO6 mRNA
Ex13-19
MYO6 mRNA
Ex18-26
MYO6 mRNA
Ex25-31
MYO6 mRNA
Ex30/31-35
Forward primer
TTCACCCGTACAGGTAGCC
Reverse primer
TTCCTCTTTGCCTTGAACAC
Forward primer
CTTTGGAAATGCGAAGACTG
Reverse primer
TCCAATAAAATAGGATGATGTTTC
Forward primer
GCAAGCAAACAATGCTCG
Reverse primer
CTTCGAAGTTTATCCAGAAGC
Forward primer
TGAATCCAGAGATAAGTTTATACGG
Reverse primer
GTTCCTGCGTCATCATAGTG
Forward primer
TGATGGTCTGGTTAAGGTGG
Reverse primer
TCACGTAGTTCTGCATATTTCC
Forward primer
TTTGAGTAGAGGTCCTGCTG
Reverse primer
GGGCACACACCCTACCTAAG
Forward primer
CGGCAACTGTCCTTTCTCTC
Reverse primer
GGCTAGGTTGTGCAGGTCAG
Primer for QPCR
CLIC5 Exon2-3
GUSB Exon2-3
Forward primer
AGAGTGGTGCTGAGGATTGG
Reverse primer
CCCTCATGCTCTAGCGTGTC
The reference sequences for exon numbering CLIC5, MYO6 and ESPN were NM_016929.4, NM_004999.3
and NM_031475.2, respectively. *This is the first exon of an alternative CLIC5 transcript (NM_001114086.1)
#
These primers were only used for sequence analysis.
rs2477828
rs196004
rs10915317
rs11152920
rs17238567
rs1912515
rs8105809
rs1447595
rs2159579
rs10503951
rs1124531
rs9302387
rs308409
rs16840977
rs1631550
rs7118543
SNP_A-4193053
SNP_A-2227424
SNP_A-1794682
SNP_A-2090773
SNP_A-2152234
SNP_A-2013197
SNP_A-2303650
SNP_A-2194601
SNP_A-4212479
SNP_A-1993002
SNP_A-2146287
SNP_A-2206226
SNP_A-4227577
SNP_A-4195575
SNP_A-4203661
SNP_A-1826210
SNP_A-2013513
SNP_A-2048940
SNP_A-4239672
SNP_A-2214677
SNP_A-2138415
SNP_A-1860565
SNP_A-4216078
SNP_A-2215144
SNP_A-1974496
SNP_A-2059039
SNP_A-4224094
SNP_A-1980966
SNP_A-2155415
SNP_A-2070006
SNP_A-2061244
SNP_A-2248124
Name
End SNP
rs4483549
rs2979684
rs277638
rs3113377
rs11642765
rs891974
rs6996639
rs7800245
rs10513030
rs3745836
rs11018855
rs1366419
rs783403
rs12119878
rs153219
rs2057276
rsId
11
8
3
4
16
5
8
7
3
19
11
5
7
1
16
6
Chr.
89949097
23786381
99034331
123752692
20478724
169773687
33665680
84845546
135476532
55123464
88287451
20964216
48809712
5081066
23966086
41430495
Start
position
90955972
24817441
100079447
124834671
21582734
170902780
34843712
86103733
136877493
56652592
89835267
22916852
50903934
9218721
29215298
88865821
End
position
Genomic position were determined using the UCSC Genome Browser website (http://genome-euro.ucsc.edu/index.html, hg19).
rsId
Name
Start SNP
1.01
1.03
1.05
1.08
1.10
1.13
1.18
1.26
1.40
1.53
1.55
1.95
2.09
4.16
5.25
47.38
Size (Mb)
Supplemental Table S2 Overview of homozygous regions shared by the affected individuals of family W05-009.
-
-
-
-
-
-
-
-
-
-
-
-
-
ESPN
-
MYO6
Known
arNSHI gene
Novel genotype-phenotype correlations
| 129
200
150
100
50
0
mRNA expression CLIC5 (% of normal)
130 | Chapter 2
Controle (-CH)
-CH
+CH
Supplemental Figure 1 The homozygous mutation CLIC5 c.96T>A (p.(Cys32Ter)) in
family W05-009 does not result in nonsense mediated mRNA decay (NMD).
Shown is the mean expression of CLIC5 in Epstein-Barr-virus (EBV)-transformed
lymphoblastoid cells of affected individuals II.2 and II.3 (n=2) and controls (n=10)
treated with (+CH) and without (-CH) cycloheximide. Quantifications were
normalized against GUSB expression. Differences in expression between the
affected individuals and 10 controls were calculated by using the delta delta Ct
method.11 The p-value was derived from the standard score (Z-value) calculated for
untreated samples (-CH) as compared to the normal distribution of the 10 controls.
Since we assume a lower expression level as a result of NMD, a one-sided test was
enough to reject the null hypothesis (p=0.376). Also, no difference was seen in
CLIC5 expression between treated and untreated patient samples. In conclusion,
occurrence of NMD could not be confirmed.
Novel genotype-phenotype correlations
| 131
3
Expanding a genotypephenotype correlation
3.1
Vestibular function and temporal
bone imaging in DFNB1
A.M.M. Oonk
A.J. Beynon
T.A. Peters
H.P.M. Kunst
R.J.C. Admiraal
H. Kremer
B. Verbist
R.J.E. Pennings
Hearing Research 2015 July
(Epub ahead of print)
136 | Chapter 3
Abstract
DFNB1 is the most prevalent type of hereditary hearing impairment known
nowadays and the audiometric phenotype is very heterogeneous. There is, however,
no consensus in literature on vestibular and imaging characteristics.
Vestibular function and imaging results of 44 DFNB1 patients were evaluated in
this retrospective study.
All patients displayed a response during rotational velocity step testing. In 65% of
the cases, the caloric results were within normal range bilaterally. The video head
impulse test was normal in all patients.
In 34.4% of the CT scans one or more temporal bone anomalies were found. The
various anomalies found, were present in small numbers and none seemed
convincingly linked to a specific DFNB1genotype.
The group of DFNB1 patients presented here is the largest thus far evaluated for
their vestibular function. From this study, it can be assumed that DFNB1 is not
associated with vestibular dysfunction or specific temporal bone anomalies.
Expanding a genotype-phenotype correlation | 137
Introduction
DFNB1 is the most common type of autosomal recessive hearing impairment and
is caused by mutations in GJB2 and/or a deletion of GJB6. Up to 40% of the autosomal
recessively inherited sensorineural hearing impairments is caused by defects in
these two genes 1. Many different pathogenic mutations in GJB2 have been identified
to cause hearing impairment. Because of the high incidence of mutations in GJB2
and deletions of GJB6 in different populations, it is recommended to first screen for
DFNB1 in patients with suspected autosomal recessive hearing loss or in isolated
cases with a congenital or prelingual hearing impairment 2, 3.
The audiological phenotype of DFNB1 is highly variable. The onset is most often
prelingual or congenital. In most cases, hearing impairment is stable, however,
when it is not congenital it can also be progressive. The severity of hearing
impairment varies between mild to profound. Audiogram configuration can vary
from flat to downsloping, which therefore is not pathognomonic 1. Snoekcx et al. 4
performed a large multicenter study to correlate the different GJB2 genotypes to
the audiometric phenotype. They concluded that the degree of hearing impairment
associated with biallelic truncating mutations was significantly more severe than
hearing impairment associated with biallelic non-truncating mutations.
A genotype-phenotype correlation does not only comprise audiometric features,
but also vestibular and imaging characteristics. The available information in
literature on vestibular function is based on small numbers of patients and both
imaging and vestibular results are not consistent 5-9 .
Several studies have evaluated vestibular function in DFNB1 patients. Denoyelle
et al. and Cohn et al. described a genotype- phenotype correlation study for DFNB1
patients 5-6. Both have retrospectively evaluated vestibular function based on
vestibular testing. Cohn et al. 5 described a normal vestibular function in 11 out of
13 patients. The deviating results of the two other patients were assigned to
immaturity of the vestibular system in a premature birth at 31 weeks gestation
and to recurrent vestibulopathy related to migrainous vertigo. Denoyelle et al. 6
reported on 10 DFNB1 patients with normal vestibular function.
Dodson et al. 10 assessed subjective vestibular function in DFNB1 patients by means
of a survey study. Patients with DFNB1 had significantly more vestibular problems
than other hearing impaired individuals. On the other hand, there were no
subjective vestibular problems in DFNB1 patients studied by Kasai et al. 9. In this
study six out of seven patients demonstrated unilateral abnormal responses during
vestibular examination. In the study by Todt et al. 7 only two out of seven patients
had normal vestibular responses. They, therefore, conclude that mutations in GJB2
138 | Chapter 3
are not only responsible for hearing impairment but also for vestibular dysfunction.
The studies by Denoyelle et al. 6 and Cohn et al. 5 also evaluate temporal bone
imaging in 19 and 23 patients, respectively. All 42 computed tomography (CT)
scans did not display temporal bone anomalies. Temporal bone anatomy was also
assessed by Propst et al. 8 by means of CT scans in 53 DFNB1 patients. In over 50%
of their cases temporal bone anomalies were found. Among the most prevalent
anomalies are a dilated endolymphatic fossa and an enlarged vestibular aqueduct.
These anomalies can be associated with vestibular problems.
Considering the varieties in findings in the different studies we evaluated both
vestibular test results and imaging results in 44 DFNB1 patients from our clinic.
This study further defines the genotype-phenotype correlation in DFNB1 patients.
Patients and methods
Patients
Patients diagnosed with DFNB1 in our clinic in the time period 2002-2014 were
eligible for inclusion in this retrospective study (n=65). DFNB1 patients were
included when vestibular results or imaging results were available. Since vestibular
function assessment and imaging are standard items of the cochlear implant
selection procedure, 37 patients were cochlear implant users.
The diagnosis of DFNB1 was based on two pathogenic mutations in GJB2, two
pathogenic deletions in GJB6 or a pathogenic mutation in GJB2 in combination with
a pathogenic deletion in GJB6. Hearing impaired offspring of parents both
diagnosed with DFNB1 were also considered to have DFNB1. General features and
genetic characteristics were collected by means of a chart review.
Vestibular testing
The vestibular function was evaluated in 28 patients. To confirm normal vestibularoculomotor function and to exclude possible central lesions smooth pursuit, gaze,
optokinetic, and saccadic tests were performed.
Vestibular function was evaluated by electronystagmography. This involved rotary
chair testing using the velocity-step test (VST) and caloric irrigation. For the VST,
the patient was seated in a rotary chair. To obtain a horizontal position of the
horizontal semicircular canals the head was ante-flexed at 30 degrees. To provoke
a nystagmus, the chair is accelerated with 2˚/s2 to 0.25 Hertz. After a plateau time
of 60 seconds, the chair was suddenly stopped with a deceleration of 200˚/s2,
inducing a physiological response, i.e. a nystagmus in opposite direction. The
maximum slow phase velocity of the nystagmus and time constant were recorded.
This was done for both directions to calculate the possible presence of the
Expanding a genotype-phenotype correlation | 139
nystagmus’ directional preponderance (asymmetry). The reactivity and possible
vestibular preponderance of individual vestibules were determined by caloric
testing using bithermal (30 and 44°C) water irrigation of the external auditory
canal (n=21). Analyses were performed as described previously 11.
In 10 patients, additionally a video Head Impulse Test (vHIT) has been performed
to evaluate the individual function of the semicircular canals in the higher
frequency domain. The patient has to focus on a dot on the wall while the examiner
makes a short but rapid movement with the head in the plane of the canal. All
three canals are examined individually. The eye movements were recorded by a
camera (vHIT Ulmer, Synapsys, Marseille, France) 12.
In 17 patients vestibular function was evaluated after cochlear implantation.
Three patients were too young to complete the VST and/ or caloric test reliably
because of fatigue or loss of concentration. In three patients the tests was
considered to be unreliable due to ear abnormalities (otitis media, tympanic
membrane perforation). In four patients the results were not available for
evaluation. In seven patients the VST was not performed according to the procedure
described here, therefore results were considered unreliable. These patients were
excluded from vestibular function analysis.
Temporal bone imaging
Temporal bone imaging by means of computed tomography (CT) or magnetic
resonance imaging (MRI) has been evaluated in 41 patients. A CT scan was available
for 33 patients but was evaluated in 32 patients. One CT scan was excluded from
evaluation since a combined approach tympanotomy altered the anatomy. The
temporal bones of three of these patients were also evaluated by MRI scan. In nine
patients only an MRI scan of the temporal bone was performed. All scans were
displayed to an experienced head-, neck- and neuroradiologist (BV) and an
experienced otologist (RP) using IMPAX (version 6.5.3.1005 AGFA healthcare
Mortsel, Belgium). Both ears were evaluated separately according to a structured
list of items (size and aspect of external auditory canal, middle ear, ossicles,
mastoid, cochlea, vestibule, semicircular canals (SCC), vascular structures,
endolymphatic fossa/vestibular aqueduct) . Precise measurements of the cochlear
height, width, length size of the bony island were executed with the electronic
calipers available in IMPAX. All CT scans were systematically scored on 33 items 13.
The MRI scans were scored on 14 items.
140 | Chapter 3
Results
General characteristics
Forty-four patients were included in this study. Forty-three patients were diagnosed
with DFNB1 based on two mutations in GJB2 and/or GJB6. An additional patient was
included because both parents were diagnosed with DFNB1 (table 1). Twenty-two
female and 22 male patients were evaluated. The mean age at vestibular testing
was 14.4 years (range 0.38-68.4) and the mean age during temporal bone imaging
was 9.6 years (range 0.21-62.3).
In 25 patients results of both VST and temporal bone imaging were available. In sixteen
patients only imaging results were available, in three patients only vestibular results
were present.
In general, these patients were cochlear implant candidates and had profound
hearing loss with a congenital onset. Two patients had a moderate to severe hearing
impairment. Temporal bone imaging abnormalities were not seen in these patients
and vestibular testing was not performed.
In four patients, history was not taken on vestibular complaints or motor milestone
development issues. Five patients complained about balance problems or demonstrated
delayed motor milestones. Two of them displayed normal results on the VST and
one showed hyporeflexia on VST and areflexia during calorisation. Temporal bone
imaging demonstrated an opacification of the mastoid and middle ear in two
patients (age 0.5-1.1 years old) and another patient with delayed motor milestones
demonstrated a superior semicircular canal dehiscence.
Vestibular tests
Eye movements were evaluated in 20 patients. In two patients oculomotor test
responses were deviant. One patient presented with slow responses during the
saccadic and optokinetic test. However, VST, calorics and vHIT displayed normal
responses in this patient. Another patient demonstrated a disturbed optokinetic
response to the right. VST revealed a vestibular hypofunction and an areflexia of
the right vestibulum during calorics. This was tested before cochlear implantation.
The results of the vestibular tests are displayed in figure 1. Twenty-one patients
had normal VST responses, of which 12 also showed normal calorics results. Six
patients demonstrated hyporeflexia during VST (aged 3.6- 42.2), four of them were
tested after cochlear implantation. The two who were tested before implantation
displayed unilateral areflexia during calorics (tested at 45.7 and 51.5 years). One of
these two patients demonstrated normal vHIT results.
Homozygous
c.35delG: 2
del GJB6/
IVS1+1G>A: 1
Homozygous
c.35delG: 7
del GJB6/
c.35delG: 1
c.35delG/
c.71G>A:1
c.35delG/
IVS1+1G>A:1
c.35delG/
c.139G>T: 1
c.313-326del14
del GJB6: 1
c.407dup/
c.71G>A: 1
Normal
n=1
Post
implantation
n=1
n=1
Not applied
Homozygous
del GJB6: 1
c.35delG/
c.229T>C: 1
c.-23+1G>A/
c.238C>A: 1
Normal
n=1
Post
implantation
n=3
Normal
bilateral
n=3
Hyporefle
f xia
n=6
Homozygous
c.35delG: 1
del GJB6/
c.35delG: 1
Normal
n=1
Pre
implantation
n=2
Arefle
f xia
unilateral
n=2
Homozygous
c.23+1G>A: 1
Not applied
n=1
Post
implantation
n=1
Hyperrefle
f xia
bilateral
n=1
Hyperrefle
f xia
n=1
Homozygous
c.35delG: 9
del GJB6/
c.35delG: 1
IVS1+1G>A/
del GJB6: 1
c.35delG/
c.427C>T: 1
c.35delG/
c.229T>C: 2
homozygous
c.235delG: 1
c.101T>C/
c.283G>A: 1
Not applied
n=16
Figure 1 Flowchart of vestibular and genetic results. The figure starts at the top with the total of patients evaluated in this study.
When the figure is tracked down the results of the VST, calorisation test and vHit are presented, respectively. At the bottom the
different genotypes for these specific results are presented. VST: velocity step test, vHIT: video head impulse test, del: deletion.
Homozygous
c.35delG: 3
del GJB6/
c.35delG: 2
parents
DFNB1: 1
Mutations
Post
implantation
n=3
Normal
n=1
Post
implantation
n=1
Hyporefle
f xia
unilateral
n=3
Normal
n=5
Post
implantation
n=8
n=6
n=21
Normal
n=1
Normal
bilateral
n=12
Not applied
Calorics
vHIT
n=10
Normal
n=21
VST
N=28
n=44
Expanding a genotype-phenotype correlation | 141
142 | Chapter 3
Table 1 Overview of mutations and/ or deletions of GJB2/ GJB6 in the study population.
Mutation 1
Mutation 2
N (%)
c.35delG (p.(G12fs))
c.35delG (p.(G12fs))
22 (50.0)
c.35delG (p.(G12fs))
deletion GJB6
5 (11.4)
c.35delG (p.(G12fs))
c.229T>C (p.(W77R))
3 (6.8)
c.35delG (p.(G12fs))
c.IVS1+1G>A
1 (2.3)
c.35delG (p.(G12fs))
c.71G>A (p.(W24X))
1 (2.3)
c.35delG (p.(G12fs))
c.427C>T (p.(R143W))
1 (2.3)
c.35delG (p.(G12fs))
c.139G>T (p.(E47X))
1 (2.3)
c.35delG (p.(G12fs))
c.313-326del14
1 (2.3)
deletion GJB6
deletion GJB6
1 (2.3)
deletion GJB6
c.313-326del14
1 (2.3)
deletion GJB6
c.IVS1+1G>A
1 (2.3)
c.-23+1G>A
c.-23+1G>A
1 (2.3)
c.235delG (p.(L79fs))
c.235delG (p.(L79fs))
1 (2.3)
c.407dup (p.(Y136X))
c.71G>A (p.(W24X))
1 (2.3)
c.238C>A (p.(Q80K))
c.-23+1G>A
1 (2.3)
c.283G>A (p.(V95M))
c.101T>C (p.(M34T))
Both parents deaf due to DFNB1
1 (2.3)
1 (2.3)
Between brackets the protein change is noted.
Imaging results
Table 2 summarizes the results of the evaluation of temporal bone imaging. In 34,4% of
the CT scans a temporal bone anomaly was detected (i.e. enlarged endolymphatic
fossa, semicircular canal dehiscence, bifide malleus, hyper- or hypoplasia of the
cochlea/ semicircular canal). Evaluation of the CT scans demonstrated a (partially)
opacified middle ear in seven patients. The age of these patients ranged from
0.21-1.10 years and the opacification was considered to be based on otitis media
with effusion.
Evaluation of the labyrinth demonstrated minor abnormalities. The measured
cochlear height was within normal range in 28 patients (4.4 mm-5.9 mm; <4.4 mm
is categorized as hypoplasia, >5.9 mm is defined as hyperplasia) 13. The median
measured cochlear height was 5.3 mm. In two patients the cochlear height was
unilaterally 4.1 and 4.3 mm (hypoplasia), respectively. Another patient displayed a
hyperplasia of the cochlea unilaterally (6.0 mm)(Figure 2 and 3). In the remaining
patient the cochlear height could not be assessed due to absent coronal section.
Expanding a genotype-phenotype correlation | 143
Figure 2 Different sizes of the cochlea. A. Normal size. B. Hypoplasia. C. Hyperplasia.
The CT scan of fifteen patients demonstrated opacification in different degrees of
the horizontal semicircular canal (SCC). In 10 patients this was present bilaterally.
The size of the bony island of the horizontal SCC is correlated to vestibular
abnormalities. In one patient the bony island of the left labyrinth measured 5.2
mm (>4.8 mm is defined as hyperplasia). The size in the remaining 63 ears ranged
from 2.9 mm – 4.8 mm (normal 2.6 mm - 4.8 mm) 13 (Figure 3 and 4). The median
size of the bony island was 3.9 mm. The superior SCC appeared dehiscent in three
patients (unilaterally), clinically there were no indications for a SSCC dehiscence.
In four patients an enlarged endolymphatic fossa was present, two cases showed
this bilaterally (Figure 5). The endolymphatic fossa was not visible in seven patients
and therefore not assessable.
Twelve MRI scans of in total 24 ears did not show any abnormalities except for one
patient with a subarachnoidal cyst as an incidental finding.
144 | Chapter 3
6
Size (mm)
5
4
la
is
ny
Bo
Co
ch
l
ea
rh
ei
gh
nd
t
3
Figure 3 Scatter plot of the cochlear height and bony island size. Line indicates the
median. The filled symbols are the deviating results, hypoplasia or hyperplasia.
The upper and lower limit of the normal range is indicated by dashed lines.
Figure 4 Different appearances of the horizontal semicircular canal. A. Normal
appearance (white arrow). B. Opacification of the horizontal semicircular canal
(white arrow). C. Enlarged bony island (white arrow).
Expanding a genotype-phenotype correlation | 145
Figure 5 Variations of the endolymphatic fossa. A. Normal appearance (white arrow).
B. Enlarged endolymphatic fossa (white arrow).
Correlation between vestibular and radiological findings
The more prevalent radiological findings in this study are combined with
vestibular results in figure 6. The patient with unilateral cochlear hypoplasia had
normal results on VST and calorics. The patient with hyperplasia of the cochlea also
displayed normal VST results, results of calorics were not available. The patient
with hyperplasia of the horizontal SCC presented with a normal VST and calorics
response.
Truncating versus non-truncating mutations
Thirty-nine patients presented with homozygous truncating mutations. Four patients
presented with compound heterozygous truncating/ non-truncating mutations.
VST results were available in two out of these four patients and both showed
hyporeflexia, although caloric results were normal and both patients were tested
after cochlear implantation. In three of these four patients temporal bone imaging
results were present, none demonstrated temporal bone anomalies. One patient
presented with heterozygous non-truncating mutations, temporal bone imaging
did not display any anomalies.
Jugular bulb
Size
50
None
1 (1/0)
Shape
14 (12/1)
Present
Short 28
Dehiscence SSCC 3 (3/0)
Bifid malleus 1 (1/0)
Emissary vein
Hypoplastic
Aspect
61
Normal
6
12
4
3 (3/0)
Lateralized
Sigmoid sinus
HSCC 25 (5/10)
16 (2/7)
12 (2/5)
1 (1/0)
Opacification
na
Different temporal bone characteristics indicated per ear. Numbers between brackets indicate number of patients with the characteristics unilateral/bilateral.
*possibility of >1 anomaly in one ear.
EAC: external auditory canal; SCC: semi circular canal (H: horizontal; S: superior); EF: endolymphatic fossa; VA: vestibular aqueduct; Na: not assessed.
17 (11/3)
30
VA
6 (2/2)
1 (1/0)
47
46
EF
High riding
38
SCC*
1 (1/0)
4 (0/2)
Enlarged
Normal
58
Cochlea
Vascular variants
63
48
Mastoid
52
Middle ear
Ossicles
59
Normal
EAC
Ears (n=52)
Table 2 Temporal bone imaging characteristics.
146 | Chapter 3
Normal
n=1
vHIT
Arefle
f xia
uni n=1
Normal
n=2
Normal
n=1
Calorisation
vHIT
Normal
n=1
Normal
n=1
Normal
n=1
Hyporefle
f xia
n=1
homozygous c.35delG: 3
c.35delG/ c.del GJB6: 1
c.35delG/ c.139G>T: 1
c.-23+1G>A/c.238C>A: 1
Normal
n=1
hyporefle
f xia
uni n=1
Normal
n=4
Not assessable
EF n=6
c.35delG/c.71G>A :1
c.IVS1+1G>A/c.delGJB6: 1
homozygous c.35delG: 9
c.35delG/ c.del GJB6: 2
c.35delG/ c.427C>T: 1
parents DFNB1: 1
Hyporefle
f xia
uni n=1
Figure 6 Flowchart of common radiological findings on computed tomography scan combined with vestibular and genetic
results. The figure starts at the top with the temporal bone anomaly and when the figure is followed down the results of the VST,
calorisation and vHit (when performed), respectively, are presented. At the bottom the different genotypes from the patients with
that specific temporal bone anomaly are presented. HSCC: horizontal semicircular canal; SSCC: superior semicircular canal, EF:
endolymphatic fossa, VST: velocity step test, uni: unilateral, vHIT: video Head Impulse Test, del: deletion.
homozygous c.35delG: 2
c.35delG/ del GJB6: 1
parents DFNB1: 1
Normal
n=1
Hyporefle
f xia
n=1
Enlarged EF
n=4
Homozygous
c.35delG: 2
c.IVS1+1G>A/
c.del GJB6: 1
Normal
n=2
Mutations
Normal
n=3
Normal
n=3
Normal
n=9
Normal
n=1
Hyporefle
f xia
n=1
Opacificatio
acif
n
HSCC n=15
SSCC dehiscence
n=3
VST
Temporal bone anomaly
Mutations
Normal
n=1
Calorisation
VST
Temporal bone anomaly
Expanding a genotype-phenotype correlation | 147
148 | Chapter 3
Discussion
Because of the relatively high incidence of DFNB1 the audiological phenotype has
been extensively studied previously. The audiological phenotype is very divergent.
Vestibular function and imaging of the temporal bones remain underexposed in
these descriptions. In addition, the scarce reports on vestibular function and
imaging in DFNB1 patients are not consistent with each other. This retrospective
study presents an evaluation of vestibular function and imaging results, including
CT as well as MRI in a relatively large number of DFNB1 patients (n= 44). Based on
the present vestibular examinations and temporal bone imaging, our results in
general show that neither vestibular dysfunction nor evident temporal bone
anomalies are associated with DFNB1.
Radiological phenotype of DFNB1
In 34,4% (11/32) of the CT scans one or more asymptomatic temporal bone anomalies
were identified. This is a higher percentage than previously reported for DFNB1
patients (0-11%) 5, 14-19. However, much less than the percentage reported by Propst
et al. 8 (72%).
The temporal bone anomalies found in the previously mentioned studies are very
diverse. Each anomaly is only detected in a limited number of cases, except for the
anomalies mentioned by Propst et al. (table 3). They found an enlarged endolymphatic
fossa (28.3%), a modiolus deficiency (24.7%) and an EVA (14.2%) in a substantial
proportion of their cases. In 10,3% of the temporal bones in which the endolymphatic
fossa could be assessed, it was enlarged in our patients. A modiolus deficiency or
EVA were not identified in any of our cases. The number of DFNB1 patients with
an enlarged endolymphatic fossa did not significantly differ from age-matched
normal hearing controls in the study of Propst et al. Given the fact that the
enlargement is only found in a limited number of patients, where it could not be
linked to a specific GJB2/ GJB6 genotype, we draw the conclusion that DFNB1 is not
associated with an increased prevalence of an enlarged endolymphatic fossa.
However, it cannot be completely ruled out that specific GJB2 mutations present
with an increased risk for an enlarged vestibular aqueduct.
Opacification of the horizontal semicircular canal is a remarkable detail, present
in 15 patients. Since the scans were of optimal quality and were evaluated with
utmost care but the opacification could not be linked to vestibular dysfunction, we
consider this as a true finding without clinical significance rather than an artifact.
All together, a variety of abnormalities were found in this group of patients, each
in small numbers and none seemed consistently linked to a specific genotype.
113
21
35
53
Preciado et al. 14
Lee et al. 17
Propst et al. 8
38
2
1
12
0
2
1
3
Number of
patients with
temporal bone
anomalies
72.0%
5.7%
4.8%
10.6%
0%
8.3%
5.6%
11%
Percentage of patients with
temporal bone anomalies
EVA; enlarged vestibular aqueduct. SCC: semicircular canal. CNC: cochlear nerve canal.
EF: endolymphatic fossa, HSCC: horizontal semicircular canal. SSCC: superior semicircular canal.
VA: vestibular aqueduct.
19
Kenna et al. 19
24
Cohn et al. 5
Angeli et al.
18
Kochhar et al. 16
15
27
Lipan et al. 18
Number
of patients
Dilated EF (28.3%)
Modiolus deficiency (24.7%)
EVA (14.2%)
Hypoplastic HSCC (7.5%)
Hypoplastic cochlea (3.8%)
Dilated ampulla (3.8%)
Dehiscent HSCC (3.8%)
Dehiscent SSCC (1.9%)
Pericochlear lucency (0.9%)
VA extending in ampulla (0.9%)
EVA
Borderline EVA
SCC abnormalities
Internal auditory meati asymmetry
Modiolus deficiency and CNC hypoplasia
Bilateral CNC hypoplasia
EVA
Mondini malformation
EVA
Mondini malformation
Internal auditory canal with bulbous shape
Dilated vestibule and HSCC
Type of anomaly
Table 3 Summary of studies reporting on temporal bone imaging in DFNB1 patients.
Expanding a genotype-phenotype correlation | 149
150 | Chapter 3
No vestibular abnormalities in DFNB1 patients
A vestibular response was found in all patients during the VST, additionally all
patients had at least one excitable vestibule during calorics and, as far as data was
available, the vHIT was normal in all patients. In two patients the vHIT was normal,
while calorics demonstrated areflexia or hyporeflexia, respectively. This difference
can be explained by the fact that the vHIT stimulates the vestibule in the 4-7 Hz
frequency range, while caloric irrigation stimulates the vestibule in a much lower
frequency range i.e. 0.003 Hz 20. There was no correlation between vestibular
function and the underlying genotype (homozygous truncating mutations or
compound heterozygous non-truncating/ truncating mutations). This conclusion
is, however, based on a small number of patients.
The vestibular function is considered to be normal in DFNB1 patients, however
since this is a retrospective study we should take into account that the vestibular
function was evaluated after cochlear implantation in 17 patients. On the other hand,
this only endorses the point of normal vestibular function in DFNB1 patients.
With a mean age of 14.4 at vestibular testing and 9.6 at temporal bone imaging,
a relatively young group of patients is presented here. Since the auditory phenotype
of DFNB1 with a congenital onset in general is not progressive, the vestibular
phenotype is not expected to deter later in life. However, further research should
include older patients since vestibular dysfunction could appear later in life together
with temporal bone imaging abnormalities. This is for example seen in patients
with DFNA9, a dominantly inherited progressive cochleovestibular disorder. DFNA9
patients develop focal sclerosis of the semicircular canals and cochlea later in life 21.
Evaluation of connexin function and dysfunction in the vestibule
GJB2 and GJB6 encode connexin 26 and connexin 30, respectively. Co-localized
connexin 26 and connexin 30 form intercellular gap junctions which, in addition
to others, are responsible for potassium diffusion in the membranous labyrinth.
This is necessary in maintaining cochlear ion homeostasis 22. When one of both
genes is mutated, insufficient or less functional gap junctions will be formed. This
will change the potassium concentration in the endolymph, which is toxic to hair
cells 23.
Connexin 26 and connexin 30 are expressed in the sensory and non-sensory
epithelia of the saccule, utricle and ampullae of mice. A crucial difference in these
structures is the presence of dark cells in the utricle and ampullae 24. These dark
cells are also involved in potassium recirculation by other potassium regulating
channels: NaK-ATPase, NaKCl and KCNQ1/KCNE1 25, 26 . In the absence of sufficient
connexin 26 and connexin 30 based gap junctions, these dark cells may correct
the ratio of potassium in the endolymph in the utricle and ampullae. Hence, a
change in gap junction may mainly affect the function of the saccule.
Expanding a genotype-phenotype correlation | 151
The function of the utricle and saccule can be evaluated by measuring vestibular
evoked myogenic potentials (VEMPs). Cervical VEMPs have been tested in DFNB1
patients in two previous studies by Todt et al. 7 and Kasai et al. 9. They performed
VEMPs in nine patients with biallelic GJB2 mutations. Two patients did not show
any response, three patients only demonstrated a unilateral response and four
patients responded normal. When the genetic defect would affect saccular
function as suggested above, it would be logically to find this deterioration
bilaterally, regarding the symmetry of the hearing impairment. Although the
number of patients in the studies by Todt et al. 7 and Kasai et al. 9 are relatively
small, the results indicate no or minimal effect of the genetic defect on the saccule.
With the VST, caloric test and the vHIT, the focus in this retrospective study is on
the semicircular canals, and not on the utricle and saccule. To rule out or confirm
a functional role of connexin 26 or connexin 30 in the saccule, we recommend to
examine cervical VEMPs in future DFNB1 patients.
In connexin 30 knockout mice, the early development of hair cells in the saccule
was not affected. The hair cells, however, degenerate similar to hair cells of the
cochlea. When connexin 26 is overexpressed in these mice, the morphology of the
saccular hair cells was restored. The hair cells of the utricle and ampullae were not
affected in knockout mice 24. Insufficient quantity of gap junctions probably leads
to saccular hair cell death. This raises the question which combination of mutations
and how severe these mutations need to be, before the gap junction quantity is
poor enough for saccular dysfunction. And what will the clinical consequences be,
or will this be compensated well?
Conclusion
In this study, a large variety of temporal bone anomalies in DFNB1 patients were
identified. These anomalies were only found in small numbers and not linked to
specific genotypes. Therefore, we assume that DFNB1 is not associated with specific
temporal bone anomalies. In addition, no significant vestibular dysfunction is
seen in DFNB1 patients, nor was there a relation between vestibular findings and
imaging results. This retrospective study did not evaluate saccular function.
Because of a hypothetical relationship between saccular dysfunction and DFNB1 it
is recommended that future studies evaluate this shortcoming, in order to assess
saccular function in DFNB1 patients.
Since temporal bone anomalies and vestibular dysfunction (except potential saccular
dysfunction) could not be linked to DFNB1, it is currently not recommended to
routinely perform temporal bone imaging or vestibular testing in DFNB1 patients.
From a scientific point of view these diagnostic tools should, however, be considered
152 | Chapter 3
in order to expand the genotype-phenotype correlation or to emphasize the current
correlation.
During the cochlear implant selection procedure or when clinical features of
vestibular dysfunction or temporal bone anomalies (e.g. mixed hearing loss) are
present, additional vestibular testing or temporal bone imaging should be
considered. Before implantation of a second cochlear implant, vestibular function
should always be re-assessed in order to rule out vestibular areflexia of the first
implanted ear.
Expanding a genotype-phenotype correlation | 153
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
del Castillo FJ, del Castillo I. The DFNB1 subtype of autosomal recessive non-syndromic hearing
impairment. Frontiers in bioscience. 2011;16:3252-74.
Ardle BM, Bitner-Glindzicz M. Investigation of the child with permanent hearing impairment.
Archives of disease in childhood Education and practice edition. 2010;95(1):14-23.
Pandya A, Arnos KS, Xia XJ, et al. Frequency and distribution of GJB2 (connexin 26) and GJB6 (connexin
30) mutations in a large North American repository of deaf probands. Genetics in medicine : official
journal of the American College of Medical Genetics. 2003;5(4):295-303.
Snoeckx RL, Huygen PL, Feldmann D, et al. GJB2 mutations and degree of hearing loss: a multicenter
study. American journal of human genetics. 2005;77(6):945-57.
Cohn ES, Kelley PM, Fowler TW, et al. Clinical studies of families with hearing loss attributable to
mutations in the connexin 26 gene (GJB2/DFNB1). Pediatrics. 1999;103(3):546-50.
Denoyelle F, Marlin S, Weil D, et al. Clinical features of the prevalent form of childhood deafness,
DFNB1, due to a connexin-26 gene defect: implications for genetic counselling. Lancet. 1999;353(9161):
1298-303.
Todt I, Hennies HC, Basta D, et al. Vestibular dysfunction of patients with mutations of Connexin 26.
Neuroreport. 2005;16(11):1179-81.
Propst EJ, Blaser S, Stockley TL, et al. Temporal bone imaging in GJB2 deafness. The Laryngoscope.
2006;116(12):2178-86.
Kasai M, Hayashi C, Iizuka T, et al. Vestibular function of patients with profound deafness related to
GJB2 mutation. Acta oto-laryngologica. 2010;130(9):990-5.
Dodson KM, Blanton SH, Welch KO, et al. Vestibular dysfunction in DFNB1 deafness. American journal
of medical genetics Part A. 2011;155A(5):993-1000.
Theunissen EJ, Huygen PL, Folgering HT. Vestibular hyperreactivity and hyperventilation. Clinical
otolaryngology and allied sciences. 1986;11(3):161-9.
Macdougall HG, McGarvie LA, Halmagyi GM, et al. The video Head Impulse Test (vHIT) detects vertical
semicircular canal dysfunction. PloS one. 2013;8(4):e61488.
Purcell DD, Fischbein NJ, Patel A, et al. Two temporal bone computed tomography measurements
increase recognition of malformations and predict sensorineural hearing loss. The Laryngoscope.
2006;116(8):1439-46.
Preciado DA, Lim LH, Cohen AP, et al. A diagnostic paradigm for childhood idiopathic sensorineural
hearing loss. Otolaryngology--head and neck surgery : official journal of American Academy of Otolaryngology-Head and Neck Surgery. 2004;131(6):804-9.
Angeli SI. Phenotype/genotype correlations in a DFNB1 cohort with ethnical diversity. The
Laryngoscope. 2008;118(11):2014-23.
Kochhar A, Angeli SI, Dave SP, et al. Imaging correlation of children with DFNB1 vs non-DFNB1
hearing loss. Otolaryngology--head and neck surgery : official journal of American Academy of Otolaryngology-Head and Neck Surgery. 2009;140(5):665-9.
Lee KH, Larson DA, Shott G, et al. Audiologic and temporal bone imaging findings in patients with
sensorineural hearing loss and GJB2 mutations. The Laryngoscope. 2009;119(3):554-8.
Lipan M, Ouyang X, Yan D, et al. Clinical comparison of hearing-impaired patients with DFNB1
against heterozygote carriers of connexin 26 mutations. The Laryngoscope. 2011;121(4):811-4.
Kenna MA, Rehm HL, Frangulov A, et al. Temporal bone abnormalities in children with GJB2
mutations. The Laryngoscope. 2011;121(3):630-5.
Blodow A, Heinze M, Bloching MB, et al. Caloric stimulation and video-head impulse testing in
Meniere’s disease and vestibular migraine. Acta oto-laryngologica. 2014;134(12):1239-44.
de Varebeke SP, Termote B, Van Camp G, et al. Focal sclerosis of semicircular canals with severe
DFNA9 hearing impairment caused by a P51S COCH-mutation: is there a link? Otology & neurotology:
official publication of the American Otological Society, American Neurotology Society [and] European
Academy of Otology and Neurotology. 2014;35(6):1077-86.
154 | Chapter 3
22.
23.
24.
25.
26.
Kamiya K, Yum SW, Kurebayashi N, et al. Assembly of the cochlear gap junction macromolecular
complex requires connexin 26. The Journal of clinical investigation. 2014;124(4):1598-607.
Nickel R, Forge A. Gap junctions and connexins in the inner ear: their roles in homeostasis and
deafness. Current opinion in otolaryngology & head and neck surgery. 2008;16(5):452-7.
Qu Y, Tang W, Dahlke I, et al. Analysis of connexin subunits required for the survival of vestibular
hair cells. The Journal of comparative neurology. 2007;504(5):499-507.
Wangemann P. K(+) cycling and its regulation in the cochlea and the vestibular labyrinth. Audiology
& neuro-otology. 2002;7(4):199-205.
Lang F, Vallon V, Knipper M, et al. Functional significance of channels and transporters expressed in
the inner ear and kidney. American journal of physiology Cell physiology. 2007;293(4):C1187-208.
Expanding a genotype-phenotype correlation | 155
4
Psychosocial impact of
a genetic diagnosis
4.1
Psychological impact of a genetic
diagnosis on hearing impairment
an exploratory study
A.M.M. Oonk
S. Ariens
H.P.M. Kunst
R.J.C. Admiraal
H. Kremer
R.J.E. Pennings
Submitted
160 | Chapter 4
Abstract
Genetic testing for hereditary hearing impairment becomes more routinely available
as a diagnostic tool in the outpatient clinic. Little is, however, known on the
psychological impact of a genetic diagnosis. In order to evaluate this impact, an
exploratory study was conducted.
Prospectively, 48 individuals who underwent genetic testing for hereditary
hearing impairment were included in this study. They were asked to fill out the
following different questionnaires: Hospital Anxiety Depression Scale, Impact of
Event Scale, Self Efficacy 24, Illness Cognition Questionnaire and the Inventory for
Social Reliance. The questionnaires were filled out at three time points; before
genetic testing, directly after counseling on the either positive or negative test
result and six weeks thereafter.
No statistical differences were found between the groups who received a genetic
diagnosis for their hearing impairment (positive group) and the group who did not
(negative group).
Special attention to the psychological well being should be offered to hearing
impaired patients who seek a genetic diagnosis for their hearing impairment. In
addition, the psychological impact of sensorineural hearing impairment might be
larger than the impact of a genetic diagnosis itself. Based on the current exploratory
study, there are no psychological reasons in favor or against genetic testing for
hereditary hearing impairment. In the future, studies should focus on the impact
of the genetic diagnosis retrieved from whole exome sequencing and on the impact
of a syndromic or nonsyndromic hearing impairment.
Psychosocial impact of a genetic diagnosis | 161
Introduction
Early onset hearing impairment has a hereditary cause in about 50% of cases 1.
Nowadays, over 75 genes have been identified to be associated with hereditary
hearing impairment 2. In addition, genetic testing for a hereditary cause of hearing
impairment is increasingly available in out-patient clinics as routine diagnostics.
After establishing a genetic diagnosis for hearing impairment, the individual and
his/her relatives need proper counseling. This counseling should focus on inheritance,
prognosis of hearing impairment, potential vestibular dysfunction, additional
symptoms 3 and possible effects of rehabilitation 4. So far, only little is known on
the psychological impact of a genetic diagnosis for hearing impairment 5.
More research has been performed on the impact of genetic testing in, for example,
Huntington disease or hereditary breast and ovarian cancer. Some patients with
these disorders demonstrated an increase in psychological distress after receiving
a positive test result. The observed psychological distress mostly vanished within
a short period of time 6, 7. On the other hand, patients who received negative results
displayed a decrease in psychological distress 8.
Results of counseling on a genetic diagnosis in these more frequently studied
diseases can probably not be transposed to hereditary hearing impairment because
they may be fatal or may require medical intervention to avert this fatality.
In addition, research on the impact of genetic testing for Huntington disease
or hereditary breast and ovarian cancer also concerns pre-symptomatic testing.
Genetic testing for hereditary hearing impairment in adults is usually performed
when hearing impairment is already symptomatic.
Humans naturally seek explanations to elucidate the cause of an event. Some of
these causes are controllable (e.g. will power), and some are uncontrollable (e.g.
genetics). Research by Gordon et al. demonstrated that patients who were counseled
on a neutral genotype (no mutations with beneficial or adverse effects) had an
increase in health perception and self concepts, which was designated as increased
psychological well being. This was dedicated to a probable increase in personal
control 9.
Based on the study of Gordon et al., Palmer et al. hypothesized that hearing
impaired individuals who receive a genetic diagnosis for their hearing impairment
would display an increase in psychological well being compared to those without
a genetic diagnosis 5. They tested this hypothesis in adults with an early onset
hearing impairment, who were tested for mutations in GJB2/ GJB6 (DFNB1). A positive
test result led to an increase in perceived personal control and a decrease in
anxiety level. Patients who received a negative result, had an increase in anxiety
162 | Chapter 4
level and decrease in perceived personal control. These effects were still substantially
present six months after diagnosis and were more outspoken and lasted longer
than to be expected from previous research 5. Palmer et al. focused only on patients
who were tested on mutations in GJB2/ GJB6 (DFNB1). The hearing impairment in
these patients is mostly congenital and severe to profound.
The present exploratory study aimed to evaluate the psychological impact of a
genetic diagnosis on nonsyndromic hearing impairment in adult individuals in
order to improve counseling of genetic hearing impairment.
Patients and methods
Patients
This study was approved by the local medical ethics committee. Individuals were
requested to participate in this study when they fulfilled three criteria. First,
subjects had to be at least 18 years of age. Second, a hereditary cause of their
hearing impairment was suspected. Third, a single gene mutation analysis was
applied in order to identify the cause of their hearing impairment. Individuals
who were not mentally competent and/ or not able to read and understand Dutch
were excluded from the study. Subjects were recruited over a 15 month period of
time (September 2013- November 2014). The study protocol contained three time
points of evaluation. The first time point concerned inclusion, the moment genetic
testing was requested (T0). The second evaluation concerned the period from
counseling on the result of the genetic test (either positive or negative) until two
weeks after (T1). The third time point was six weeks after the questionnaires of T1
were completed (T2).
At the time of these three evaluation time points, individuals were asked to
complete several questionnaires. The questionnaires of T0 were completed at the
outpatient clinic. The questionnaires of T1 and T2 were sent and returned by mail.
Questionnaires
Demographic data
Demographic data were collected at T0 by means of a questionnaire. This self-constructed questionnaire assessed educational level 10, (history of) psychological
complaints, medication, offspring or the desire to have children, hereditary
disease in the family and reasons for genetic testing. This questionnaire also
assessed hearing characteristics including onset, progression and rehabilitation of
hearing impairment.
Psychosocial impact of a genetic diagnosis | 163
Illness Cognition Questionnaire (ICQ )
The ICQ was developed to evaluate three subscales: acceptation, helplessness and
disease benefits of a chronic disease 11. In this study the ICQ was focused on hearing
impairment as chronic disease. The questionnaire was completed at T0. The
questionnaire contains 18 items, six for each subscale. Each item can be scored
according to a four points Likert scale. Scores range from six to twenty-four for
each subscale. A higher score indicates a higher level of acceptation, helplessness
or disease benefits. The crohnbach т ranged from 0.84-0.90 for the three subscales 11.
Inventory for Social Reliance (ISR)
The ISR is a self report questionnaire on social support. It consists of different
subscales 12. For this study, the subscale on perceived emotional support was used.
This subscale contains five items, that can be scored on a four point Likert scale.
Scores ranged from five to twenty, higher scores indicate a greater level of perceived
emotional support 12. This questionnaire was completed at T0 only.
Hospital Anxiety and Depression Scale (HADS)
The HADS is a self reporting scale to indicate possible presence of anxiety and
depression 13. This questionnaire was completed at T0, T1 and T2 and contains 14
items. Each item has four response options. The subscales for anxiety and
depression consist of seven items each. Scores can range from zero to twenty-one
for each subscale 13, 14. Higher scores indicate higher levels of anxiety or depression,
respectively. Scores ≤7 are considered normal. Percentages of individuals with
scores of ≥8 were calculated. Cronbachs т for the subscale scores ranged from
0.67-0.93 15.
Self Efficacy Scale (SE24)
The SE24 scale was focused on hearing impaired individuals in this study and was
completed at T0, T1 and T2. This scale is used to evaluate the sense of control by
means of five items. Four items can be scored on a five points Likert scale, one item
can be scored on a four point Likert scale. Total scores range from five to twenty-four.
A higher score reflects more sense of control. Crohnbach т ranges from 0.70-0.77 16.
Impact of Event Scale (IES)
The IES was completed at the T1 and T2. This scale evaluated the response on an
event (getting acquainted with the genetic diagnosis). The scale consists of 15
items, which can be scored by a four point Likert scale. The 15 items can be divided
into two subsets, avoidance and intrusion 17. Higher scores indicate more avoidance
or intrusion due to the event.
164 | Chapter 4
Audiometry and genetic evaluation
The data gathered with the questionnaires were complemented with audiometric
results. Pure tone audiometry was performed according to current standards to
determine hearing thresholds at frequencies of 0.25, 0.5, 1, 2, 4 and 8 kHz. The
mean thresholds at 1, 2 and 4 kHz of the best hearing ear from the last available
audiogram was noted as the pure tone average (PTA) for every individual. In all
subjects Sanger sequencing of a specific deafness- associated gene was requested at T0.
The selection of the gene to be tested was based on family history and audiometric
phenotype. At T1 individuals were counseled about the positive (a mutation was
identified) or negative (no mutation was identified) result of the genetic test.
Statistic analyses
Individuals were divided into two groups; a group with a positive genetic test result
and a group with a negative test result. Demographic characteristics, including
degree of hearing impairment and the results of the ICQ and ISR were compared
between both groups by means of Chi square test for categorical variables and
t-test for continuous variables. Continuous variables are presented by the median
combined with the interquartile range (IQR). Linear mixed models for repeated
measures were used for studying the differences between groups for each of the
outcomes of the HADS subscales, SE24 and the IES subscales. The dependent variable
was the genetic test result.
The independent fixed variables were point of measurement (two levels: two and six
weeks since baseline), group (Negative, Positive) and the baseline value. Individuals
were treated as a random variable. Baseline-adjusted mean difference between
groups at each measurement point with 95% confident intervals are presented.
The statistical analysis was carried out by using IBM SPSS Statistics 20 (Chicago, IL)
and SAS 9.0 for Windows (SAS Institute inc., Cary, NC)..
Results
Fifty-four individuals were eligible to be enrolled in this study. Four subjects did
not complete the questionnaires at the first time point (T0). Two subjects were
analyzed by means of next generation sequencing instead of single gene mutation
analyses and were therefore excluded. Thus, 48 individuals were included in this
study. In 11 of the 48 individuals (23%), a genetic cause of their hearing impairment was
identified. Eight individuals were diagnosed with autosomal dominant inherited
deafness (DFNA) based on mutations in COCH (DFNA9), two with DFNB8/10 (autosomal
recessive inherited deafness (DFNB) based on mutations in TMPRSS3) and one with
DFNA8/12 (TECTA).
Psychosocial impact of a genetic diagnosis | 165
Table 1 Demographics and baseline characteristics.
T0
T1
T2
Age
Sex:
- Female
- Male
Education:
- ISCED 7
- ISCED 6
- ISCED 5
- ISCED 4
- ISCED 3
- ISCED 2
- ISCED 1
PTA
(average 1, 2 and 4 kHz of the best hearing ear)
Progression:
- Yes
- No
Rehabilitation:
- None
- Hearing aid
- Cochlear implant
- Hearing aid and cochlear implant
- SOLO
History of psychiatric diseases:
- Yes
- No
Children/ childrens wish:
- Yes
- No
- Do not know
Other hereditary diseases in the family
- Yes
- No
- No answer
Why do you pursue a genetic diagnosis?
Treatment
Prognosis
Inheritance patterns
ICQ (range 6-24)
- Acceptation
- Helplessness
- Disease benefits
ISR (range 5-20)
Positive (n=11)
Negative (n=37)
11/11 (100%)
8/11 (73%)
6 (55%)
54 (52-66)
37/37 (100%)
26 (70%)
20 (54%)
48 (36-58)
7/11 (64%)
4/11 (36%)
23/37 (62%)
14/37 (38%)
0/11 (0%)
0/11 (0%)
2/11 (18%)
2/11 (18%)
0/11 (0%)
6/11 (55%)
1/11 (9%)
73 (47-93)
9/37 (24%)
13 (35%)
0/37 (0%)
6 (16%)
3 (8%)
6 (16%)
0 (0%)
48 (32-71)
11/11 (100%)
0/11 (0%)
31/37 (84%)
6/37 (16%)
2/11 (18%)
7/11 (64%)
0/11 (0%)
2/11 (18%)
0/11 (0%)
14/37 (38%)
21/37 (57%)
1/37 (3%)
0/37 (0%)
1/37 (3%)
0/11 (0%)
11/11 (100%)
7/37 (19%)
30/37 (81%)
9/11 (82%)
1/11 (9%)
1/11 (9%)
28/37 (76%)
6/37 (16%)
3/37 (8%)
2/11 (18%)
8/11 (73%)
1/11 (9%)
9/37 (24%)
28/37 (76%)
0/37 (0%)
5/11 (45%)
6/11 (55%)
8/11 (73%)
21/37 (57%)
33/37 (89%)
26/37 (70%)
13 (7-14)
18 (13-21)
8 (7-11)
20 (19-20)
11 (8.5-14)
17 (12-18.5)
9 (7-12.5)
18 (14.5-20)
ISCED (International Standard Classification of Education). Numbers between brackets are percentages or
the median is presented with the upper and lower quartile between brackets.
166 | Chapter 4
Baseline characteristics
All 48 subjects completed the questionnaires at T0. At T1, 34 individuals filled out
the questionnaires. Eight of these received a positive result on genetic testing.
Twenty-six individuals completed the questionnaires at T2, six of them had a
positive genetic test result. As a consequence, 22 subjects were lost to follow up.
Overall, the participants pursued a genetic diagnosis in order to be informed
about treatment in 54% (26/48), about prognosis in 81% (39/48) and about
inheritance patterns in 71% (34/48). Baseline characteristics were comparable for
the positive and negative genetic test result group and are shown in Table 1. The
only significant difference was observed for educational level. Individuals who
received a negative result for genetic testing had a higher level of education than
those with a positive result (p= 0.03).
Illness cognition and social reliance
Individuals of the positive and negative test result group were also comparable for
each subscale of the ICQ. The mean score of all included subjects for helplessness
was 11.2 and for disease benefits 9.7 (scoring range 6-24). This indicates that the
hearing impaired individuals in this study experience helplessness toward their
hearing impairment and do not experience disease benefits. The mean score for
acceptance was 16.6 (scoring range 6-24). This indicates that the acceptance of
hearing impairment is of an average level (figure 1A). Both groups also experienced
similar levels of social support with a mean score for all subjects of 18.6. The scores
B
25
25
20
20
15
15
Score
Score
A
10
5
5
0
0
–
H
s
les
elp
10
ss
ne
+
–
ce
Ac
+
–
e
nc
pta
Di
se
b
a se
+
–
ts
ef i
en
So
c
re
ia l
l ia
+
e
nc
Figure 1 Mean scores for the Illness Cognition Questionnaire (A) and the Inventory
Social Reliance (B). The minus indicates the negative group, the plus indicates the
positive group. The dashed lines indicate the possible scoring range.
Psychosocial impact of a genetic diagnosis | 167
of the ISR range from 5-20, which indicates that the individuals in this study
experience a great amount of perceived emotional support (figure 1B).
Hospital Anxiety Depression Scale (HADS)
The results of the HADS are shown for both the positive and negative test result
group in table 2. Evaluation of the anxiety subscale shows some differences in both
groups. The positive result group scores higher at T1, at T2 the scores have increased
even more. Scores of the negative group at T2 have decreased and as a result the
difference between both groups has increased at T2. This difference at T2 shows a
trend towards significance (p=0.05; figure 2).
Between the negative and positive result group no significant differences were
found at both T1 and T2 for the depression subscale.
In total, 14.6% of the cases scored 8 or higher on the anxiety subscale; 9.1% (1/11) of
the positive group, 16.2% (6/37) of the negative group and 12.5% scored 8 or higher
on the depression subscale (9.1% (1/11) of the positive group, 13.5 (5/37) of the
negative group). When looked at the severely to profoundly hearing impaired
individuals (PTA of ≥70 decibel hearing level) 13.3% (2/15) scored ≥ 8 on the anxiety
subscale and 20% (3/15) scored ≥ 8 on the depression subscale.
Self Efficacy 24 scale
The Self Efficacy 24 Scale evaluates sense of control. No statistic significant
difference was found between the scores for this sense of control of the positive
and negative result group at T1 and T2.
HADS-A
20
Negative
Positive
Score
15
10
5
0
T0
T1
T2
Figure 2 Anxiety level. Mean scores of the anxiety subscale of the HADS
questionnaire at diagnosis and six weeks after in the positive and negative test
result group. Dashed lines demonstrated the 95% CI’s. Dots and bars are means and
standard deviation.
11
11
Positive
11
Positive
8
8
Positive
4.5 (0-20)
1 (0-28)
3.5 (0-10)
1.5 (0-29)
15.5 (9-20)
14.5 (8-21)
3 (0-7)
3.5 (0-11)
4,5 (1-12)
4 (0-14)
Median
6
20
6
20
6
19
6
20
6
20
n
T2
9 (0-24)
0 (0-33)
5.5 (0-22)
2 (0-27)
17.5 (13-21)
13 (3-20)
3 (1-10)
2.5 (0-9)
6 (1-8)
3.5 (0-11)
Median
-0.59 (-7.96-6.79)
3.82 (-4.13-11.76)
0.59 (-2.50-3.68)
0.61 (-1.20-2.43)
-1.3 (3.36-0.76)
Mean (95% CI)
Difference at T1
between groups
0.87
0.33
0.70
0.49
0.20
p
-1.90 (-9.58-5.77)
-1.03 (-9.38-7.32)
-1.88 (-5.13-1.38)
-1.21 (-3.27-0.84)
-2.3 (-4.64-0.05)
Mean (95% CI)
Difference at T2
between groups
0.61
0.80
0.24
0.23
0.05
p
Number of participants in each group for each time point (T0, T1, T2). Median scores of each questionnaire of questionnaire subscale, with the lowest and highest
score between brackets. Differences with the 95% confidence interval between brackets and p-values for the Hospital Anxiety and Depression Scale (HADS) subscales,
Self Efficacy 24 (SE24) questionnaire and the Impact of Event Scale (IES) subscales between groups over time
26
Negative
IES - Intrusion
26
8
26
8
26
8
26
Positive
17 (11-22)
15 (0-23)
4 (0-9)
3 (0-13)
3 (0-10)
4 (0-14)
Negative
IES – avoidance
37
Negative
SE24
37
Negative
HADS - depression
37
Positive
n
Median
n
Negative
HADS - anxiety
T1
T0
Table 2 Difference between groups over time.
168 | Chapter 4
Psychosocial impact of a genetic diagnosis | 169
Impact of Event Scale
Overall, scores of IES were low. This means that either a positive or negative genetic
test result does not lead to much avoidance or intrusion. The differences at T1 and
T2 for both subscales were not statistically significant between the positive and
negative result group.
Discussion
Currently, efficacy of genetic testing for hearing impairment is much higher than
10 years ago. Little is, however, known on the impact of such a diagnosis on
psychological well being of hearing impaired individuals. The psychological
impact of receiving a positive or negative genetic test result was evaluated in 48
individuals in this exploratory study. These individuals pursued a genetic diagnosis
in order to be informed about treatment in 54%, about prognosis in 81% and about
inheritance patterns in 71%. Receiving a positive result on genetic testing was not
associated with an increase in psychological distress in the short term. Only a
trend towards a significantly higher anxiety level in the positive genetic test result
group was found.
Comparison to other studies on the impact of a genetic diagnosis
The study by Palmer et al. presented opposite findings compared to the current
study. Patients who received a negative genetic test result had significantly higher
anxiety levels after six months when compared to patients who received a positive
test result (n= 183) 5. The effect demonstrated by Palmer et al. is also the opposite of
other studies and remains present for a longer period of time 5, 7. A systematic review
by Vansenne et al. demonstrated that a positive genetic test result might first lead
to an increase in psychological distress levels that, however, vanishes over time 7.
In the present study, we only evaluated short term effects of genetic testing.
The result of the current study is similar to the outcome of the study by Reichelt
et al. 18. This study investigated females who were presymptomatically tested on
mutations in BRCA1, involved in increased susceptibility for ovarian and breast cancer.
Receiving a positive genetic test result of a BRCA1 mutation was not associated with
an increase in psychological distress. Reichelt et al. therefore stated that receiving
a genetic diagnosis might be less distressing than getting the diagnosis of cancer
itself. Considering the low scores on the impact of event scale in the current study,
a similar consideration might be applicable to hereditary hearing impaired
individuals. It could be hypothesized that receiving the diagnosis and dealing
with sensorineural hearing impairment might increase levels of distress far more
than receiving the genetic diagnosis that might explain the hearing impairment.
170 | Chapter 4
Attention to psychological distress
In the current study, many individuals added personal information to the
questionnaire, stating their appreciation for the attention to their psychological
well being as a hearing impaired individual. Kvam et al. demonstrated that anxiety
and depression occur significantly more in the hearing impaired population
compared to the normal hearing population 19. Carlsson et al. demonstrated that
31.2% and 22.5% of the severely to profoundly hearing impaired patients score
above the cutoff point of 8 on the HADS for anxiety and depression, respectively.
The Swedish reference population scored in 12% and 9% of the cases above the
cutoff point of 8 for anxiety and depression, respectively 20. In comparison, the
present group of individuals has scores of ≥ 8 in 13.3% and 20% of the cases for
anxiety and depression, respectively for the severe to profound hearing impaired
individual. The percentage for depression is comparable to the one reported by
Carlsson et al.
This indicates that counselors on genetic testing for hereditary hearing impairment
need to be aware of a possible increased level of psychological distress in individuals
seeking a genetic diagnosis for their hearing impairment. In order to screen for
psychological distress, a questionnaire focusing on these problems may be useful.
As there were no significant differences in psychological distress between the
positive and negative genetic test result group over time, this screening can take
place at the first visit to the outpatient clinic. In 2013, Esplen et al. described the
Genetic Psychological Risk Inventory (GPRI) that aims to identify subjects at risk
for psychological distress after genetic testing for adult onset hereditary diseases
21
. This inventory is a useful screening tool to implement in the first visit.
Dominant versus recessive inheritance patterns
A possible explanation for the lack of difference in psychological impact between
a positive and a negative diagnosis might be the large number of individuals with
an autosomal dominantly inherited type of hearing impairment within this study.
It can be assumed that patients with a dominantly inherited hearing impairment
know a lot about the phenotype of their hearing impairment, based on the
experiences of their relatives. They also might expect the genetic diagnosis more
than subjects with a recessive type of inheritance. This study only included two
subjects with autosomal recessive hearing impairment. Only one of them completed
the questionnaires at T1 and T2. Therefore, the conclusion on the impact of a
genetic diagnosis in DFNB patients remains more unclear.
Study limitations and further recommendations
One of the limitations of this study is the small number of subjects. This small
number is due to the fact that this study was carried out at the time that testing a
Psychosocial impact of a genetic diagnosis | 171
panel of hearing impairment genes by whole exome sequencing (WES) was being
implemented in our clinic. The implementation of targeted exome sequencing as
a routine diagnostics in our out-patient clinic has completely changed our protocol
and single gene analysis is currently only performed in selected cases with a very
directive phenotype such as is seen in DFNA9 and GJB2 is tested due to the large
prevalence of DFNB1. In all other cases, the deafness gene panel test by WES is the
preferred first choice of diagnostics. Therefore, the number of individuals who
were suitable for single gene genetic testing decreased.
The gene panel test entails other factors that might influence the psychological
status of a hearing impaired individual, such as finding a mutation in a gene
associated with syndromic hearing impairment. This study needs to be repeated
for individuals tested by whole exome sequencing in order to state something on
the psychological distress in individuals who undergo whole exome sequencing to
find the cause of their hearing impairment. When this study is repeated it should
be considered to include hearing impaired subjects who do not request genetic
testing in order to exclude a possible selection bias. In this study only subjects
eligible for genetic testing were included which could lead to a selection bias.
In addition to the small number of individuals that could be included, quite a
number of individuals were lost to follow up. A possible explanation could be the
small window of time in which individuals were allowed to complete the
questionnaires of T1.
This study only focused on non-syndromic hearing impairment. In several
syndromic types of hearing impairment, the additional symptoms occur at a later
age 22. The knowledge that these additional symptoms can eventually occur might
cause more psychological distress. Therefore, the results of this present study
might not be applicable to individuals who are genetically tested for syndromic
hearing impairment.
Conclusion
This pilot study evaluated the psychological impact of a genetic diagnosis of hereditary
hearing impairment in 48 individuals. There was no difference in psychological
impact between a positive or negative genetic test result and the test results did
not significantly influence psychological well being of the participants in a positive
or negative way.
This study also demonstrated that increased levels of depression can be observed
in severe to profound hearing impaired individuals that visit the out-patient clinic
for a genetic diagnosis.
172 | Chapter 4
Further research is needed to evaluate the psychological impact of a genetic
diagnosis of hereditary hearing impairment and of the impact of hearing
impairment itself. Testing of a panel with known deafness- associated genes has
led to an increased percentage of positive genetic diagnosis in our clinic. The
present study, therefore needs to be repeated in individuals who are tested by the
hereditary hearing impairment gene panel test.
Psychosocial impact of a genetic diagnosis | 173
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Morton CC, Nance WE. Newborn hearing screening--a silent revolution. The New England journal of
medicine. 2006;354(20):2151-64.
Van Camp G, Smith R. Hereditary Hearing Loss Homepage. 2014 [4-12-2014]. Available from: http://
hereditaryhearingloss.org
Seco CZ, Oonk AM, Dominguez-Ruiz M, et al. Progressive hearing loss and vestibular dysfunction
caused by a homozygous nonsense mutation in CLIC5. European journal of human genetics : EJHG.
2015;23(2):189-94.
Wu CC, Liu TC, Wang SH, et al. Genetic characteristics in children with cochlear implants and the
corresponding auditory performance. The Laryngoscope. 2011;121(6):1287-93.
Palmer CG, Boudreault P, Baldwin EE, et al. Deaf genetic testing and psychological well-being in deaf
adults. Journal of genetic counseling. 2013;22(4):492-507.
Shaw C, Abrams K, Marteau TM. Psychological impact of predicting individuals’ risks of illness: a
systematic review. Social science & medicine. 1999;49(12):1571-98.
Vansenne F, Bossuyt PM, de Borgie CA. Evaluating the psychological effects of genetic testing in
symptomatic patients: a systematic review. Genetic testing and molecular biomarkers. 2009;13(5):555-63.
Broadstock M, Michie S, Marteau T. Psychological consequences of predictive genetic testing: a
systematic review. European journal of human genetics : EJHG. 2000;8(10):731-8.
Gordon ES, Gordish-Dressman HA, Devaney J, et al. Nondisease genetic testing: reporting of muscle
SNPs shows effects on self-concept and health orientation scales. European journal of human genetics:
EJHG. 2005;13(9):1047-54.
statistics Uif. International Standard Classification of Education. 2011.
Evers AW, Kraaimaat FW, van Lankveld W, et al. Beyond unfavorable thinking: the illness cognition
questionnaire for chronic diseases. Journal of consulting and clinical psychology. 2001;69(6):1026-36.
Dam-Baggen R, Kraaimaat F. De Inventarisatielijst Sociale Betrokkenheid (ISB): een zelfbeoordelingslijst om sociale steun te meten (Inventory for social reliance (ISR): a self-report inventory for the
measurement of social support). Gedragtherapie. 1992;25:27-46.
Zigmond AS, Snaith RP. The hospital anxiety and depression scale. Acta psychiatrica Scandinavica.
1983;67(6):361-70.
Spinhoven P, Ormel J, Sloekers PP, et al. A validation study of the Hospital Anxiety and Depression
Scale (HADS) in different groups of Dutch subjects. Psychological medicine. 1997;27(2):363-70.
Bjelland I, Dahl AA, Haug TT, et al. The validity of the Hospital Anxiety and Depression Scale. An
updated literature review. Journal of psychosomatic research. 2002;52(2):69-77.
Prins JB, Bleijenberg G, Bazelmans E, et al. Cognitive behaviour therapy for chronic fatigue syndrome:
a multicentre randomised controlled trial. Lancet. 2001;357(9259):841-7.
van der Ploeg E, Mooren TT, Kleber RJ, et al. Construct validation of the Dutch version of the impact of
event scale. Psychological assessment. 2004;16(1):16-26.
Reichelt JG, Heimdal K, Moller P, et al. BRCA1 testing with definitive results: a prospective study of
psychological distress in a large clinic-based sample. Familial cancer. 2004;3(1):21-8.
Kvam MH, Loeb M, Tambs K. Mental health in deaf adults: symptoms of anxiety and depression among
hearing and deaf individuals. Journal of deaf studies and deaf education. 2007;12(1):1-7.
Carlsson PI, Hjaldahl J, Magnuson A, et al. Severe to profound hearing impairment: quality of life,
psychosocial consequences and audiological rehabilitation. Disability and rehabilitation. 2014:1-8.
Esplen MJ, Cappelli M, Wong J, et al. Development and validation of a brief screening instrument for
psychosocial risk associated with genetic testing: a pan-Canadian cohort study. BMJ open. 2013;3(3).
Kochhar A, Hildebrand MS, Smith RJ. Clinical aspects of hereditary hearing loss. Genetics in medicine:
official journal of the American College of Medical Genetics. 2007;9(7):393-408.
5
Discussion and Conclusion
Discussion and conclusion
| 177
The aim of this thesis was to describe new genotype-phenotype correlations for
autosomal recessively inherited hearing impairment in order to improve counseling
and to gain more knowledge on the effect of different (mutated) genes on cochlear
performance.
Clinical characteristics of known genotype-phenotype correlations were first
summarized in a general review on autosomal recessively inherited hearing
impairment in chapter 1.2. The first described genotype-phenotype correlation in
this thesis are those of DFNB18B and DFNB84B. In chapter 2.1, phenotypes of
patients with mutations in OTOG and OTOGL were compared. Previous studies
concluded that OTOG and OTOGL are comparable in terms of expression and that
otogelin and otogelin-like have structural similarities. The present study
demonstrated that phenotypes resulting from mutations in these two genes are
also similar. The second genotype-phenotype correlation described in chapter 2.2,
focused on mutations in USH1G. Mutations in USH1G were prior to this study only
linked to syndromic hearing impairment, i.e. Usher syndrome type 1, or atypical
Usher syndrome. The patients in this study, however, presented with moderate
hearing loss, and in addition, normal vestibular and ophthalmologic function was
found. Therefore, this is the first description of nonsyndromic hearing impairment
based on mutations in USH1G. In chapter 2.3, the third genotype-phenotype
correlation was the description of a phenotype resulting from recessive mutations in a
novel deafness gene: CLIC5. Besides hearing impairment and vestibular dysfunction,
also early indications of a possible mild renal dysfunction were found.
In the third chapter of this thesis, the genotype-phenotype correlation of DFNB1,
the most common autosomal recessively inherited type of hearing loss, was
expanded by further examining temporal bone imaging and assessing vestibular
function. It was concluded that DFNB1 might not be associated with specific
temporal bone anomalies or with vestibular dysfunction. In chapter 4, we focused
on the psychological impact of receiving genetic results concerning hearing
impairment. From this study it was concluded that receiving a genetic diagnosis
on hearing impairment does not affect psychological distress levels. Therefore,
genetic evaluation of hearing impairment can be offered to each hearing impaired
patient. Physicians in general should also be conscious of the enhanced
susceptibility to psychological stress in severe to profound hearing impaired
patients.
The results of these studies contribute to counseling of patients with hereditary
hearing impairment and their families. These studies are also essential for future
studies on therapy for hereditary hearing impairment, because they provide
insight in the natural progression of the disease.
178 | Chapter 5
From animal models to clinical consequences
Mouse models
When a novel human deafness gene is identified, knowledge on the function of the
encoded protein in the cochlea is often obtained from animal models. Different
animal models are used to study hereditary hearing impairment e.g.: mice, guinea
pigs and zebrafish. Most of the knowledge on hereditary hearing impairment is,
however, based on studies in mouse models. A candidate human deafness gene can
be studied in animal models by performing gene targeted mutagenesis to create a
knock-out mouse model. Not only the expression of the mutated gene can be
studied in vivo in an animal model, but also the functional consequences can be
studied for example by testing auditory brainstem responses 1.
Since otogelin was found to be part of the tectorial membrane in mice 2, we
hypothesized a conductive cochlear hearing loss in patients with hearing loss
resulting from mutations in OTOG. However, psychophysical testing did not
confirm this hypothesis (chapter 2.1). On the other hand, Clic5 knockout mice
displayed, besides hearing loss, also dysfunction of various other organs. Therefore,
the DFNB102 patients were screened for other, subclinical organ dysfunctions
and, the first signs of nephropathy were discovered. Without the clues from the
mouse model, this would have remained unnoticed until the first symptoms
would appear. Now these patients can be followed up and early interventions are
possible when necessary (chapter 2.3).
In chapter 3, the results of vestibular testing in DFNB1 patients are correlated to
histological observations in connexin 26 (GJB2) and connexin 30 (GJB6) knock-out
mice. From connexin 30 knock-out mice it can possibly be concluded that
insufficient numbers of gap junctions may lead to saccular hair cell death 3. The
human sacculus can be evaluated in vivo by means of measuring cervical vestibular
evoked myogenic potentials (cVEMP). These cVEMPs could not be evaluated due to
the retrospective character of the study in chapter 3. However, a recent study
demonstrated signs of saccular dysfunction in DFNB1 patients 4.
In conclusion, it can be stated that mouse models are very valuable to study the
function of proteins in the cochlea and other organs, when these proteins are
encoded by newly identified human deafness- associated genes. The translation
to humans, however, should be made very carefully and supported by clinical
audiometric findings.
Phenotype evaluation and number of affected patients
When a phenotype description is based on a large group of patients, it is considered
to be more precise than when it is substantiated by a small number of cases. This
makes research on autosomal recessively inherited hearing impairment in the
Discussion and conclusion
| 179
Western world with small families and low numbers of affected individuals
difficult. In order to make phenotype descriptions of autosomal recessive hearing
loss more accurate and to uncover possible variability, larger numbers of patients
are needed.
Variability of phenotypic effect of mutations
The phenotypic effect of different mutations in a gene can be highly variable.
This is, for example, clearly demonstrated in DFNB1. Snoeckx et al. performed a
multicenter study on DFNB1 patients and showed that phenotypes of biallelic
truncating mutations are more severe than those of biallelic non-truncating
mutations 5. Studies describing novel deafness- associated genes often include
different families with different mutations in the same deafness gene. The numbers of
patients with autosomal recessive hearing loss based on a specific gene are usually
small. Therefore, it is difficult to establish robust genotype-phenotype correlations.
The variation in phenotypes caused by mutations in the same gene is demonstrated
in chapter 2.2. In this chapter, the examined family with causative mutations in
USH1G was compared to a family studied earlier by Weil et al. 6. Both families, with
similar genotypes, present with completely different phenotypes: syndromic as well
as nonsyndromic.
Modifier genes
Differences in phenotypes can even exist between patients with the same genotype.
Weegerink et al. described, for example, that the age of onset within DFNB8/10
families could differ by more than ten years 7. This heterogeneity can possibly be
explained by effects induced by, amongst others, modifier genes. When it comes to
phenotypic expression of a mutation, the modifier gene can enhance the mutant
phenotype, or suppress it. Modifier genes may therefore lead to more severe or
milder hearing impairment, respectively 8. Research into modifier genes and associated
mutations will provide more insight in the biological pathways influenced by the
primary mutated gene in the inner ear. In order to identify these modifier genes,
large numbers of patients with comparable genotypes need to be studied. When
there is a large variability in phenotype, the whole exome sequencing (WES) data
of the worst and best hearing individuals can be compared. Since WES is emerging
as a diagnostic tool, it will facilitate identification of modifier genes.
The first dominant modifier gene is located at DFNM1. In a Pakistani family with
eight hearing impaired family members affected by DFNB26, seven non-affected
family members appeared to display the same haplotype as the affected subjects.
During linkage analysis the DFNM1 locus was defined 9. However, the identity of
the DFNM1 modifier is still elusive. Autosomal recessively inherited modifier
genes have not been identified thus far.
180 | Chapter 5
Environmental factors
Hearing impairment can also be influenced by environmental factors. The most
important environmental factor in hearing is noise exposure. Daily exposure to 85
dB SPL (sound pressure level) or more may lead to noise induced hearing impairment
10
. Genetic factors can predispose to hearing impairment caused by noise exposure.
This is demonstrated in several mouse models 11. Mutations in TRPV4 may enhance
susceptibility to noise induced hearing impairment . This might explain the large
variability in hearing thresholds within a family known with hearing impairment
due to mutations in TRPV4 12.
Exposure to different types of chemicals may also lead to hearing impairment. No
consensus has been reached yet on the influence of tobacco and alcohol on hearing.
Another familiar environmental factor is ototoxic medication; loop diuretics,
chemotherapy and aminoglycoside antibiotics are known to cause hearing
impairment 11. The latter is also associated with genetic predisposition. Some
mitochondrial mutations are, for example, known to enhance the susceptibility to
hearing impairment caused by the use of aminoglycoside antibiotics. Mutations in
MT-RNR1 are known to cause this predisposition 13. Therefore, testing for known
mutations associated with susceptibility to aminoglycosides should be performed.
Clinicians should be aware of this susceptibility before starting treatment with
aminoglycoside antibiotics. For example when the mother of the patient is hearing
impaired after antibiotic use, since mitochondrial mutations inherit maternally.
Improving diagnostics in hereditary
hearing impairment
Genetics
Due to the heterogeneous nature of hereditary hearing loss, it is difficult to select
the right candidate gene for diagnostics based on clinical features. The introduction
of WES has changed this process since all exons are screened for mutations and
candidate gene selection is no longer necessary. Phenotype driven testing is in the
Netherlands often replaced by analyzing only known deafness- associated genes
from the WES data (targeted exome sequencing). When the mutated gene cannot
be found by this analysis, targeted exome sequencing can be followed by opening
the exome. Up to 60% of cases of hereditary hearing impairment are currently
solved by WES 14. It can, therefore, be expected that phenotype driven genetic
testing will become less valuable than previously and will only be applied to
clearly distinguishable phenotypes, such as amongst others DFNA9 (COCH). Due to
its high prevalence, DFNB1 (GJB2/ GJB6) should always be tested in non syndromic
recessive hearing impairment or isolated cases 15.
Discussion and conclusion
| 181
Novel exome and whole genome sequencing technologies are still evolving, the
techniques become faster and cheaper. One of these new techniques is, for example,
nanopore sequencing. With this method, individual DNA strands pass through
tiny protein pores. While these strands pass, the changes in electrical current are
measured 16, 17. Up to 512 DNA molecules can be read simultaneously. This is a
single molecule method that does not require fluorescent labeling. This will
improve the speed of sequencing and will reduce costs 18. These new techniques
produce data faster and in larger quantities than ever before.
These new techniques also have their disadvantages. Since the amount of data
keeps increasing, data storage needs to improve in order to handle the large
amounts of sensitive data. This type of data is interesting for different people and
therefore should be carefully managed in order to prevent genetic discrimination 19.
Data interpretation is another issue. Variants of unknown significance and
secondary findings should be handled with care. In addition, the patient and its
counselor need to be aware of what the patients wants and must know 20-22. For
example, in case of incidental findings on predisposing mutations associated with
hereditary breast cancer or spinal muscular atrophy.
Imaging in hereditary hearing impairment
When the genetic defect has been determined, the next step is to evaluate whether
there is an effect on the inner ear structures. The resolution of magnetic resonance
imaging and computed tomography scans is improving, but up until now it is still
not possible to reveal pathogenic pathways in the cochlea on a micro scale.
Currently, the only way to visualize the microanatomy of the cochlea is by
histopathology. Optical coherence tomography is an imaging technique that
allows evaluation of the microanatomy of the cochlea in vivo. In ophthalmology
this technique is already extensively used and depicts, amongst others, structural
and functional characteristics of the complete eyeball 23 (chapter 2.2). Therefore,
this is also an interesting research topic in the inner ear 24, 25. Optical coherence
tomography can determine structures with a resolution between 2 and 20 +m. The
principle of this technique is analogous to the principle of ultrasound. Ultrasound
is, however, based on reflection of acoustic stimuli from biological tissue layers,
while optical coherence tomography is based on the reflection of light. A disadvantage
thus far is that direct sight on the cochlea was necessary in mouse models to
retrieve good images of the microstructures 26.
Imaging of the cochlea on a micro scale in vivo would reveal insight into the
effect of genetic defects on structural dysfunction. For example, in mice defective
for otogelin, detachment of the otoconial membrane in the utricle and saccule
is seen. Since DFNB18B (OTOG) patients demonstrated vestibular hyporeflexia it
can be expected that the otoconial membrane in humans is also defective.
182 | Chapter 5
With in vivo imaging of the cochlea this hypothesis could be directly confirmed
or rejected.
Improving audiometric evaluation
Patients not only want to be informed on the cause of their hearing loss, but
usually also prefer to know how their hearing will function in the future. For this
purpose, expanding knowledge on psychophysical results is necessary. In
Nijmegen, several families with hereditary hearing impairment have been
evaluated by means of the Nijmegen psychophysical test battery. Unfortunately, no
indisputable conclusion could be drawn from the studies on sensory types of
hearing impairment since the numbers of tested patients were small and the
results demonstrated variability between patients from the same families 27-31. On
the other hand, the Nijmegen psychophysical test battery did successfully indicate
the cochlear conductive type of hearing impairment in DFNA8/12 (TECTA) and
DFNA13 (COL11A2) patients 32, 33.
The test battery proposed by the HEARCOM project could be a solution for the
small number of patients. One of the goals of the HEARCOM project was to create
an auditory profile for each patient. In order to do so, a test battery was composed
which could be used in several European countries. This test battery contains the
Acalos test to determine loudness perception and the combined F and T-test for
frequency resolution and temporal acuity. To evaluate speech reception the SRT in
quiet, stationary and fluctuating noise and the MATRIX-OLSA test are used 34.
When the same tests are used internationally, larger numbers of patients can be
evaluated and compared. Hopefully, these kind of studies lead to more knowledge
on the auditory phenotype.
Ultimate goal: normal hearing
Normal hearing is the ultimate wish of every patient with hereditary hearing loss.
This wish can currently not be fulfilled and therefore the main focus lies on
rehabilitation by (implantable) hearing devices. Another treatment option that is
explored is based on preservation and restoration of dysfunctional parts of the
cochlea.
Rehabilitation
Hearing aids
The first choice of rehabilitation in patients with a mild to moderate sensorineural
hearing loss is a hearing aid. Remarkably, research on hearing aids in hereditary
hearing-impaired patients is rather scarce. Research on outcomes of different
hearing aid settings in different types of hearing impairment can enhance fitting
Discussion and conclusion
| 183
of hearing aids in hereditary hearing impaired patients. For example, patients
with a cochlear conductive hearing impairment can be predicted to benefit more
from a linear setting of their hearing aids than patients with a sensory type of
hearing impairment. A cochlear conductive hearing loss, such as DFNA13 (COL11A2)
and DFNA8/12 (TECTA), is associated with a shifted curve during loudness scaling 32, 33.
Patients with sensorineural hearing loss present with a steeper than normal curve,
which is distinctive for recruitment. To overcome recruitment, hearing aids are
set with a compressed setting 35. Since DFNA13 (COL11A2) and DFNA8/12 (TECTA)
patients present with sensorineural hearing loss during standard audiometric
evaluation, their hearing aids are set to a compressed setting. While patients
without recruitment (and a (cochlear) conductive hearing loss) might benefit more
from a linear setting. More research is therefore needed on the translation of
cochlear dysfunction and audiometric profiles into hearing aid adjustments.
Cochlear implantation
A number of correlation studies on performance after cochlear implantation in
patients with hereditary hearing impairment have been published so far. For
example, Vermeire et al. evaluated speech perception after cochlear implantation
in DFNA9 patients. When compared to other patients with adult onset sensorineural
hearing loss, DFNA9 patients performed equally or even better after cochlear
implantation. Since DFNA9 patients demonstrate severe auditory neuronal
damage, these results were not expected 36.
Performance after cochlear implantation is influenced by multiple factors. The most
important factors are age at implantation, inner ear malformations and duration of
hearing impairment before implantation 37-39. Therefore, drawing conclusions on the
effect of the type of hereditary hearing impairment on postoperative performance
is rather difficult. This is particularly difficult because the numbers of patients in
these studies are still relatively low. In the mean time, cochlear implantation
keeps improving considering every aspect. One of these aspects is electro-acoustic
stimulation (EAS). EAS combines acoustic and electric stimulation in the same ear
and yields better performance than electric stimulation only. EAS also improves
results of speech perception, hearing in noise and music appreciation 40.
In order to preserve residual hearing after cochlear implantation different aspects
of the procedure have been studied. Different characteristics of hearing
impairment influence preservation of residual hearing after implantation. In
congenital hearing loss, more residual hearing is retained after implantation than
in acquired or idiopathic hearing loss. Progressive hearing impairment is less
likely to retain residual hearing after implantation 41. Therefore, accurate genotype-phenotype correlations are important in counseling of cochlear implant
candidates on the expectations of a cochlear implant (CI).
184 | Chapter 5
A shallow insertion depth would reduce trauma to the cochlea, and therefore give
better results concerning residual hearing 40. In progressive types of hearing
impairment this should be a point of interest since the possibility of acoustic
stimulation will diminish over time. In such cases, a deeper insertion depth, with
a longer, atraumatic electrode should be considered. In this respect, accurate genotype-phenotype correlations are also important. Initially, EAS seems a good
option in DFNB8/10 patients, since hearing thresholds of the lower frequencies
remain well at first. However, at a later stage hearing loss progresses7 and complete
electric stimulation is necessary.
Insertion of the electrode can provoke an inflammatory response, which can
further damage the cochlea. Administration of topical or systemic steroids perioperatively, reduces the inflammatory intracochlear response and leads to better
preservation of residual hearing 41, 42.
Besides preservation of residual hearing, improving the coating of the electrode is
also an interesting field of research, since it can be used as a drug delivery system.
Maintenance or stimulating of the outgrowth of spiral ganglion cell neurites by
neurotrophic factors is of special interest 43, 44. This could also be interesting in
hereditary hearing impairment types that involve the spiral ganglion, such as
DFNB8/10 45.
Increasing knowledge on proteins encoded by deafness- associated genes and their
function, or dysfunction in hearing impaired individuals, might provide insights
in new factors to investigate for their positive effect when applied via the coating
of electrodes.
Intracochlear therapy
Hearing with hearing aids is not a perfect solution. Restoration of normal hearing
without having to use a hearing aid is the ultimate goal. The first steps are being
made towards this prospect. Different therapies are currently explored like gene
therapy, stem cell therapy and regeneration of cochlear structures.
Gene therapy
With genetic therapy a disease is treated by genetic molecules. Specific DNA or
RNA is administered by a vector into the target cells in order to compensate for
loss-of-function mutations, interfere with gain-of-function mutations or suppress
a dominant negative mutation. Gene therapy has already been performed in mice
with hereditary hearing impairment. Mice that do not express vesicular glutamate
transporter 3 (Vglut3) are congenitally deaf. Normal synaptic transmission cannot
be carried out without a glutamate transporter. Vglut3 was introduced in the
inner hair cells of Vglut3 knockout mice by means of an adeno-associated viral
vector encoding the wild type Vglut3. As a result, auditory brain stem responses
Discussion and conclusion
| 185
normalized and this effect remained for at least some weeks. Another interesting
result is that the delivery technique also influenced the results since a cochleostomy
was found to be more traumatic than delivery through the round window
membrane 46.
Splice site mutations can also be corrected by means of genetic therapy. In mice
with splice site mutations in Ush1c hearing impairment and vestibular dysfunction
occur. Antisense oligonucleotides can be used to correct defective splicing. In
Ush1c.216A knock–in mice, antisense oligonucleotides were administered intraperitoneally. When this administration took place early in the development of the
inner ear, hearing and vestibular function could be retained 47.
In humans, SLC17A8 codes for VGLUT3 48 and mutations in USH1C can cause Usher
syndrome and nonsyndromic hearing loss 49, 50. However, before these therapies are
applicable in humans, some difficulties have to be overcome. For the strategies
mentioned above the different routes of delivery are outlined in table 1. Many factors
such as safety, immunogenicity, expression regulation and long term efficacy need
to be addressed before genetic therapies can be broadly applied in humans 51.
Autosomal recessively inherited hearing impairment often has a congenital onset.
This congenital onset occurs due to partial failure of development of the cochlea.
Development of the human ear is completed in utero and this means that genetic
therapy should also be applicable in a later stage, since treatment in utero is fairly
impractical 54.
Other organs, such as the eye, are more suited for gene therapy research. In
ophthalmology, gene augmentation therapy has been studied extensively in retinal
degeneration disorders and positive results in humans have been published
already 55-57. A phase 3 clinical trial is currently initiated 58. This expertise on
genetic therapies in retinal degeneration disorders may well provide new insights
applicable to disorders of the cochlea.
Stem cell therapy
Another future treatment option could be stem cell therapy. Stem cells are
introduced into the cochlea with the aim that these cells differentiate into cells
specific to the inner ear (e.g. hair cells, auditory neurons) once they are in the right
environment 59. Differentiation into hair cells encounters still some difficulties. A
large amount of the stem cells transplanted into the cochlea do not integrate into
the organ of Corti and therefore, do not develop into hair cells 60.
However, some promising results have been achieved with human fetal auditory
stem cells (hFASCs). These specific stem cells could differentiate into auditory
neurons in vitro. Eventually, these stem cells were transplanted into the cochlea of
gerbils with an auditory neuropathy. This improved the auditory function
substantially 61.
Which cells are infected?
Mostly vestibular cells
Inner and outer hair cells
Supporting cells
Spiral ganglion cells
Cells in the vestibule and scala vestibuli
All cochlear cells
Cells in the: endolymphatic sac and
duct;
Vestibular end organs
Stria vascularis;
Reisners membrane;
Hensen cells
Route of delivery
Intratympanic injection
Round window sponge
Injection through a canalostomy
(posterior semicircular canal)
Round window injection
Oval window injection
Injection through a cochleostomy
Endolymphatic sac injection
Hearing outcome was not reported.
Higher incidence of sensorineural hearing loss
-
-
Transduction is variable
Low uptake in inner ear due to diffusion through
the round window
Low uptake in inner ear due to diffusion through
the round window
Disadvantage of the technique
Table 1 Different routes of delivering therapeutic molecules into the cochlea 52, 53.
186 | Chapter 5
Discussion and conclusion
| 187
Regeneration therapy
Humans do not have the capacity to regenerate hair cells, however, regeneration of
hair cells is seen in, amongst others, avian and zebrafish’ inner ear. Atoh1 has been
demonstrated to be regulating the behavior of progenitor cells 62. In human, ATOH1 is a
gene of great interest for regeneration therapy since it codes for a transcription factor
necessary for hair cell development. Different studies have already demonstrated that
delivery of Atoh1 in mice by an adeno-associated virus can restore auditory and
vestibular hair cells and therefore, can restore loss of function 54. Some remaining
cells need, however, to be present in order to restore hair cells. This is not possible
from undifferentiated epithelium 63.
The difficulties of genetic therapy mentioned above also apply to this type of
regeneration therapy.
Future directions
In different paragraphs of this discussion it is indicated that larger numbers of
patients are needed to determine genotype-phenotype correlations more accurately
and to evaluate and identify possible influences of environmental factors and
modifiers genes. In addition, larger numbers of patients with hereditary hearing
impairment need to be evaluated by psychophysical testing in order to be able to
draw conclusions on the type of hearing loss. Also, more patients are to be evaluated
to establish a correlation between performance with a CI or hearing aids and genetic
types.
Since the numbers of patients with defects in a specific gene for autosomal
recessive nonsyndromic hearing impairment are small for most of the deafnessassociated genes, international collaborative studies with standardized evaluation
protocols are necessary to establish correlations between genetic defects, the
deafness phenotypes and efficacy of rehabilitations methods. Only then, counseling on
hereditary hearing impairment can be improved and therapeutic strategies evaluated
to reach optimal results for individuals with hereditary hearing impairment in
the future.
188 | Chapter 5
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
Friedman LM, Dror AA, Avraham KB. Mouse models to study inner ear development and hereditary
hearing loss. The International journal of developmental biology. 2007;51(6-7):609-31.
Simmler MC, Cohen-Salmon M, El-Amraoui A, et al. Targeted disruption of otog results in deafness
and severe imbalance. Nature genetics. 2000;24(2):139-43.
Qu Y, Tang W, Dahlke I, et al. Analysis of connexin subunits required for the survival of vestibular
hair cells. The Journal of comparative neurology. 2007;504(5):499-507.
Tsukada K, Fukuoka H, Usami SI. Vestibular Functions of Hereditary Hearing Loss Patients with GJB2
Mutations. Audiology & neuro-otology. 2015;20(3):147-52.
Snoeckx RL, Huygen PL, Feldmann D, et al. GJB2 mutations and degree of hearing loss: a multicenter
study. American journal of human genetics. 2005;77(6):945-57.
Weil D, El-Amraoui A, Masmoudi S, et al. Usher syndrome type I G (USH1G) is caused by mutations in
the gene encoding SANS, a protein that associates with the USH1C protein, harmonin. Human
molecular genetics. 2003;12(5):463-71.
Weegerink NJ, Schraders M, Oostrik J, et al. Genotype-phenotype correlation in DFNB8/10 families with
TMPRSS3 mutations. Journal of the Association for Research in Otolaryngology: JARO. 2011; 12(6):753-66.
Haider NB, Ikeda A, Naggert JK, et al. Genetic modifiers of vision and hearing. Human molecular
genetics. 2002;11(10):1195-206.
Riazuddin S, Castelein CM, Ahmed ZM, et al. Dominant modifier DFNM1 suppresses recessive
deafness DFNB26. Nature genetics. 2000;26(4):431-4.
Moselhi M, El-Sadik YM, El-Dakhakhny A. A six-year follow up study for evaluation of the 85 dBA safe
criterion for noise exposure. American Industrial Hygiene Association journal. 1979;40(5):424-6.
Van Eyken E, Van Camp G, Van Laer L. The complexity of age-related hearing impairment: contributing
environmental and genetic factors. Audiology & neuro-otology. 2007;12(6):345-58.
Oonk AM, Ekker MS, Huygen PL, et al. Intrafamilial variable hearing loss in TRPV4 induced spinal
muscular atrophy. The Annals of otology, rhinology, and laryngology. 2014;123(12):859-65.
Jing W, Zongjie H, Denggang F, et al. Mitochondrial mutations associated with aminoglycoside
ototoxicity and hearing loss susceptibility identified by meta-analysis. Journal of medical genetics.
2015;52(2):95-103.
Atik T, Bademci G, Diaz-Horta O, et al. Whole-exome sequencing and its impact in hereditary hearing
loss. Genetics research. 2015;97:e4.
Hoefsloot LH, Roux AF, Bitner-Glindzicz M. EMQN Best Practice guidelines for diagnostic testing of
mutations causing non-syndromic hearing impairment at the DFNB1 locus. European journal of
human genetics : EJHG. 2013;21(11):1325-9.
Loman NJ, Watson M. Successful test launch for nanopore sequencing. Nature methods. 2015;12(4):303-4.
Jain M, Fiddes IT, Miga KH, et al. Improved data analysis for the MinION nanopore sequencer. Nature
methods. 2015;12(4):351-6.
Clarke J, Wu HC, Jayasinghe L, et al. Continuous base identification for single-molecule nanopore DNA
sequencing. Nature nanotechnology. 2009;4(4):265-70.
van Dijk EL, Auger H, Jaszczyszyn Y, et al. Ten years of next-generation sequencing technology. Trends
in genetics : TIG. 2014;30(9):418-26.
Desai AN, Jere A. Next-generation sequencing: ready for the clinics? Clinical genetics. 2012;81(6):503-10.
Katsanis SH, Katsanis N. Molecular genetic testing and the future of clinical genomics. Nature reviews
Genetics. 2013;14(6):415-26.
Shearer AE, Hildebrand MS, Sloan CM, et al. Deafness in the genomics era. Hearing research.
2011;282(1-2):1-9.
Kostanyan T, Wollstein G, Schuman JS. New developments in optical coherence tomography. Current
opinion in ophthalmology. 2015;26(2):110-5.
Lee HY, Raphael PD, Park J, et al. Noninvasive in vivo imaging reveals differences between tectorial
membrane and basilar membrane traveling waves in the mouse cochlea. Proceedings of the National
Academy of Sciences of the United States of America. 2015;112(10):3128-33.
Discussion and conclusion
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
| 189
Cho NH, Jang JH, Jung W, et al. In vivo imaging of middle-ear and inner-ear microstructures of a
mouse guided by SD-OCT combined with a surgical microscope. Optics express. 2014;22(8):8985-95.
Subhash HM, Davila V, Sun H, et al. Volumetric in vivo imaging of intracochlear microstructures in
mice by high-speed spectral domain optical coherence tomography. Journal of biomedical optics.
2010;15(3):036024.
van Beelen E, Leijendeckers JM, Admiraal RJ, et al. Audiometric characteristics of a dutch family with
a new mutation in GATA3 causing HDR syndrome. Audiology & neuro-otology. 2014;19(2):106-14.
van Beelen E, Leijendeckers JM, Huygen PL, et al. Audiometric characteristics of two Dutch families
with non-ocular Stickler syndrome (COL11A2). Hearing research. 2012;291(1-2):15-23.
Oonk AM, Leijendeckers JM, Huygen PL, et al. Similar phenotypes caused by mutations in OTOG and
OTOGL. Ear and hearing. 2014;35(3):e84-91.
Oonk AM, Leijendeckers JM, Lammers EM, et al. Progressive hereditary hearing impairment caused
by a MYO6 mutation resembles presbyacusis. Hearing research. 2013;299:88-98.
Leijendeckers JM, Pennings RJ, Snik AF, et al. Audiometric characteristics of USH2a patients.
Audiology & neuro-otology. 2009;14(4):223-31.
De Leenheer EMR, Bosman AJ, Huygen PLM, et al. Audiological characteristics of some affected
members of a dutch DFNA13/ COL11A2 family. Ann Otol Rhinol Laryngol. 2004;113:922-9.
Plantinga RF, Cremers CWRJ, Huygen PLM, et al. Audiological evaluation of affected members from a
Ducth DFNA8/12 (TECTA) family. JARO. 2007;8:1-7.
Hearcom homepage 2013 [cited 2015 April 4]. Available from: http://www.hearcom.info.
Moore BC. The choice of compression speed in hearing AIDS: theoretical and practical considerations
and the role of individual differences. Trends in amplification. 2008;12(2):103-12.
Vermeire K, Brokx JP, Wuyts FL, et al. Good speech recognition and quality-of-life scores after cochlear
implantation in patients with DFNA9. Otology & neurotology : official publication of the American
Otological Society, American Neurotology Society [and] European Academy of Otology and
Neurotology. 2006;27(1):44-9.
Black J, Hickson L, Black B, et al. Paediatric cochlear implantation: adverse prognostic factors and
trends from a review of 174 cases. Cochlear implants international. 2014;15(2):62-77.
Black J, Hickson L, Black B, et al. Prognostic indicators in paediatric cochlear implant surgery: a
systematic literature review. Cochlear implants international. 2011;12(2):67-93.
Gomaa NA, Rubinstein JT, Lowder MW, et al. Residual speech perception and cochlear implant
performance in postlingually deafened adults. Ear and hearing. 2003;24(6):539-44.
Irving S, Gillespie L, Richardson R, et al. Electroacoustic stimulation: now and into the future. BioMed
research international. 2014;2014:350504.
Causon A, Verschuur C, Newman TA. A Retrospective Analysis of the Contribution of Reported Factors
in Cochlear Implantation on Hearing Preservation Outcomes. Otology & neurotology : official
publication of the American Otological Society, American Neurotology Society [and] European
Academy of Otology and Neurotology. 2015.
Santa Maria PL, Gluth MB, Yuan Y, et al. Hearing preservation surgery for cochlear implantation: a
meta-analysis. Otology & neurotology : official publication of the American Otological Society,
American Neurotology Society [and] European Academy of Otology and Neurotology. 2014;35(10):e256-69.
Schendzielorz P, Scherzed A, Rak K, et al. A hydrogel coating for cochlear implant arrays with
encapsulated adipose-derived stem cells allows brain-derived neurotrophic factor delivery. Acta
oto-laryngologica. 2014;134(5):497-505.
Ceschi P, Bohl A, Sternberg K, et al. Biodegradable polymeric coatings on cochlear implant surfaces
and their influence on spiral ganglion cell survival. Journal of biomedical materials research Part B,
Applied biomaterials. 2014;102(6):1255-67.
Guipponi M, Toh MY, Tan J, et al. An integrated genetic and functional analysis of the role of type II
transmembrane serine proteases (TMPRSSs) in hearing loss. Human mutation. 2008;29(1):130-41.
Akil O, Seal RP, Burke K, et al. Restoration of hearing in the VGLUT3 knockout mouse using virally
mediated gene therapy. Neuron. 2012;75(2):283-93.
190 | Chapter 5
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
Lentz JJ, Jodelka FM, Hinrich AJ, et al. Rescue of hearing and vestibular function by antisense oligonucleotides in a mouse model of human deafness. Nature medicine. 2013;19(3):345-50.
Ruel J, Emery S, Nouvian R, et al. Impairment of SLC17A8 encoding vesicular glutamate transporter-3,
VGLUT3, underlies nonsyndromic deafness DFNA25 and inner hair cell dysfunction in null mice.
American journal of human genetics. 2008;83(2):278-92.
Verpy E, Leibovici M, Zwaenepoel I, et al. A defect in harmonin, a PDZ domain-containing protein
expressed in the inner ear sensory hair cells, underlies Usher syndrome type 1C. Nature genetics.
2000;26(1):51-5.
Ouyang XM, Xia XJ, Verpy E, et al. Mutations in the alternatively spliced exons of USH1C cause
non-syndromic recessive deafness. Human genetics. 2002;111(1):26-30.
Gillespie LN, Richardson RT, Nayagam BA, et al. Treating hearing disorders with cell and gene therapy.
Journal of neural engineering. 2014;11(6):065001.
Chien WW, Monzack EL, McDougald DS, et al. Gene therapy for sensorineural hearing loss. Ear and
hearing. 2015;36(1):1-7.
Staecker H, Rodgers B. Developments in delivery of medications for inner ear disease. Expert opinion
on drug delivery. 2013;10(5):639-50.
Kohrman DC, Raphael Y. Gene therapy for deafness. Gene therapy. 2013;20(12):1119-23.
Maguire AM, High KA, Auricchio A, et al. Age-dependent effects of RPE65 gene therapy for Leber’s
congenital amaurosis: a phase 1 dose-escalation trial. Lancet. 2009;374(9701):1597-605.
Boye SE, Boye SL, Lewin AS, et al. A comprehensive review of retinal gene therapy. Molecular therapy
: the journal of the American Society of Gene Therapy. 2013;21(3):509-19.
Bainbridge JWB, Mehat MS, Sundaram V, et al. Long-Term Effect of Gene Therapy on Leber’s Congenital
Amaurosis. New England Journal of Medicine.0(0):null.
NCT00999609 2015. Available from: clinicaltrials.gov.
Muller U, Barr-Gillespie PG. New treatment options for hearing loss. Nat Rev Drug Discov. 2015;advance
online publication.
Okano T, Kelley MW. Stem cell therapy for the inner ear: recent advances and future directions.
Trends in amplification. 2012;16(1):4-18.
Chen W, Jongkamonwiwat N, Abbas L, et al. Restoration of auditory evoked responses by human EScell-derived otic progenitors. Nature. 2012;490(7419):278-82.
Cafaro J, Lee GS, Stone JS. Atoh1 expression defines activated progenitors and differentiating hair
cells during avian hair cell regeneration. Developmental dynamics : an official publication of the
American Association of Anatomists. 2007;236(1):156-70.
Izumikawa M, Batts SA, Miyazawa T, et al. Response of the flat cochlear epithelium to forced
expression of Atoh1. Hearing research. 2008;240(1-2):52-6.
Discussion and conclusion
| 191
6
Summary / Samenvatting
6.1
English summary
Summary / Samenvatting | 197
Summary
This thesis starts with a general introduction on hereditary hearing impairment.
Different topics are discussed, from the basics of sound and anatomy and physiology
of the human ear to characteristics of hearing impairment and genetic testing.
A review that summarizes all currently known genes involved in autosomal recessively
inherited types of hearing impairment is found in chapter 1.2. The review concludes
that genotype-phenotype descriptions in deafness gene identification studies often
lack precise information on audiovestibular characteristics.
Chapter 2 describes several novel genotype-phenotype correlations. In chapter 2.1
the phenotypes of two novel human deafness- associated genes are described, OTOG
and OTOGL. Seven hearing impaired patients of two families demonstrated mutations
in OTOGL. In two other families six hearing impaired patients showed mutations in
OTOG. A similar type of hearing impairment is found in patients with mutations
in either one of the genes. In general, patients present with a mild to moderate
hearing impairment and with a flat to downsloping audiogram configuration.
Speech recognition scores remain fairly well (>90%). In one of the four families
progression was seen after the second decade.
In order to further characterize the hearing impairment, extensive audiometric
tests were performed. The curves of loudness scaling at two kHz run steeper than
normal hearing individuals and speech recognition scores in noise are worse than
normal hearing individuals. These results indicate a sensorineural type of hearing
impairment, instead of a intracochlear conductive hearing impairment. The latter
could be expected, based on the involvement of otogelin and otogelin-like in the
tectorial membrane. Previous studies on TECTA and COL11A2, which are expressed
in the tectorial membrane, displayed an intracochlear conductive type of hearing
impairment. In two families the vestibular function was assessed which
demonstrated a hyporeflexia. Therefore, it is concluded from this chapter that
both novel deafness genes give rise to a similar phenotype when mutated.
In chapter 2.2, a novel non-syndromic hearing impairment is linked to mutations
(c.310A>G, p.(Met104Val) and c.780insGCAC, p.(Tyr261Alafs*96)) in USH1G. Thus far,
only Usher syndrome type I and atypical Usher syndrome were linked to mutations
in USH1G. Usher syndrome type I is characterized by congenital, stable, severe to
profound hearing loss, vestibular areflexia, and retinitis pigmentosa that has an
onset before puberty. The phenotype described in this chapter displays an early
onset hearing impairment with a downsloping audiogram configuration. The
hearing impairment only progresses slightly. Extensive examination of the eyes
and vestibulum did not display any abnormalities.
198 | Chapter 6
This non-syndromic character of this hearing impairment is assigned to the
non-truncating mutation (c.310G>A). Modeling of this mutation predicted only a
surface change and not a structural change of the SANS protein.
In chapter 2.3, the genotype-phenotype correlation of two siblings from a
consanguineous Turkish family is described. Both patients presented with early
childhood onset of hearing impairment. Hearing impairment progressed quickly
from mild to severe to profound before the second decade. Initially, motor
milestones were normal, however, also vestibular function deteriorated to vestibular
areflexia over time. Additionally, in one of the patients mild renal dysfunction is
noted.
This phenotype is linked to a homozygous nonsense mutation c.96T>A (p.(Cys32X))
in CLIC5. In this chapter it is demonstrated that CLIC5 is expressed in many human
tissues. However, besides the mild renal dysfunction no additional symptoms have
been found.
Mutation analysis for CLIC5 was applied to 213 patients with autosomal recessive
non-syndromic hearing impairment from mostly Dutch and Spanish origin. No
additional pathogenic variants were revealed. CLIC5 is therefore a novel deafnessassociated gene, however, mutations in this gene are not a common cause of
autosomal recessive hearing loss in the Dutch and Spanish populations.
Chapter 3 is aimed to expand the phenotype description of the most prevalent
type of hereditary hearing impairment, DFNB1. The audiometric phenotype is
very heterogeneous and extensively described in literature. Less is known on
temporal bone anomalies and vestibular function and in literature there is no
consensus on these topics. In this chapter, 44 DFNB1 patients were evaluated for
their vestibular function and/ or temporal bone imaging results. Five patients
complained of balance problems or displayed delayed motor milestones. However,
all patients demonstrated a response during velocity step testing. The calorisation
test results were within normal range bilaterally in 65% of cases and the video
head impulse test was normal in all tested patients. Therefore, vestibular
dysfunction is not correlated to DFNB1. In this retrospective study, saccular
function was not evaluated by cVEMPs and it is therefore recommended to evaluate
this in future studies.
In 34.4% of the computed tomography scans one or more temporal bone anomalies
were identified. A variety of anomalies was found and all presented in small
numbers, therefore, none seemed convincingly connected to a specific DFNB1
genotype.
Summary / Samenvatting | 199
In chapter 4 the focus is not on hearing impairment itself, but on the impact of a
genetic diagnosis of hereditary hearing impairment.
Forty-eight patients were asked to fill out the Hospital Anxiety Depression Scale,
Impact of Event Scale, Self Efficacy 24, Illness Cognition Questionnaire and the
Inventory for Social Reliance. General characteristics were collected by means of a
self constructed questionnaire and reviewing patient files.
The questionnaires were completed at three time points: before genetic testing,
directly after counseling on the results and six weeks thereafter.
There were no differences between patients who received a genetic explanation for
their hearing impairment (positive result) and the patients who did not (negative
result). This study also confirmed that hearing impaired individuals may present
with an increased level of psychological distress. It is, therefore, recommended to
pay special attention to the psychological well being of hearing impaired
individuals, who present at an outpatient clinic to have the cause of their hearing
impairment identified. A positive genetic test result, however, does not affect their
psychological well being. No reasons in favor or against genetic testing on
hereditary hearing impairment were found in this chapter.
By means of this thesis a contribution is made to the knowledge of autosomal
recessive hearing impairment. This is, however, only a small part of the research
on hereditary hearing impairment. Expansion of the possibilities to find novel
genes or mutations, to examine the cochlea or to treat hereditary diseases will
eventually lead to the ultimate goal:
normal hearing.
6.2
Nederlandse samenvatting
Summary / Samenvatting | 203
Samenvatting
Dit proefschrift begint met een algemene introductie over erfelijke slechthorendheid. Deze introductie beschrijft onder andere de basiskarakteristieken van geluid,
de anatomie en fysiologie van het menselijk oor, de kenmerken van gehoorverlies
en tot slot genetische diagnostiek.
Hoofdstuk 1.2 bevat een overzicht van alle genen die op dit moment geïdentificeerd
zijn voor autosomaal recessief gehoorverlies. Een van de conclusies van dit overzicht is
dat artikelen die een nieuw doofheidsgen beschrijven vaak een grondige genotypefenotype beschrijving missen over de audiovestibulaire karakteristieken. Dit belemmert
adequate counseling van patiënten met een zelfde vorm van erfelijk gehoorverlies.
Hoofdstuk 2 bevat enkele genotype-fenotype correlaties van nieuwe doofheidsgenen. Hoofdstuk 2.1 beschrijft de fenotypes van twee nieuwe doofheidsgenen,
OTOG en OTOGL. Zeven slechthorende patiënten uit twee families dragen mutaties
in OTOGL. In twee andere families zijn er zes patiënten met gehoorverlies en
mutaties in OTOG geïdentificeerd. Gehoorverlies met dezelfde karakteristieken
werd in alle vier de families gevonden. Mild tot matig van ernst en met een vlak tot
aflopende audiogramconfiguratie. Het spraakverstaan bleef redelijk goed (>90%).
In een van de vier families werd progressie gezien na het twintigste levensjaar. Om het
gehoorverlies nog verder te karakteriseren zijn psychofysica-testen uitgevoerd.
De luidheidsschaling bij 2 kHz resulteerde in curven die steiler verlopen dan bij
normaal horenden en daarnaast werden er ook slechtere spraakverstaan in ruis
scores gevonden in vergelijking met normaal horende individuen. Deze resultaten
wijzen op een sensorineuraal gehoorverlies, in plaats van een intracochleair
conductief verlies. Dit laatste werd verwacht gezien de lokalisatie van otogelin en
otogelin-like in de tectoriaal membraan. Eerdere studies hebben laten zien dat
genen die tot uiting komen in de tectoriaal membraan juist een intracochleair
conductief verlies veroorzaken. De vestibulaire functie werd in twee families
onderzocht en dit liet een hyporeflexie van het vestibulaire orgaan zien. De
conclusie van het onderzoek uit dit hoofdstuk is dat mutaties in beide nieuwe
doofheidsgenen eenzelfde fenotype veroorzaken.
Hoofdstuk 2.2 beschrijft een niet syndromaal gehoorverlies dat veroorzaakt wordt
door mutaties (c.310A>G, p.(Met104Val) en c.780insGCAC, p.(Tyr261Alafs*96)) in
USH1G. Tot dusver zijn alleen Usher syndroom type I en het atypische Usher
syndroom geassocieerd met mutaties in USH1G. Usher syndroom type I wordt
gekenmerkt door een congenitaal, stabiel, ernstig tot zeer ernstig gehoorverlies,
vestibulaire areflexie en retinitis pigmentosa die begint voor de puberteit. Het in
204 | Chapter 6
dit hoofdstuk beschreven fenotype laat een gehoorverlies zien dat vroeg in het
leven tot uiting komt en een aflopende audiogramconfiguratie heeft. Het
gehoorverlies is maar matig progressief. Uitgebreid onderzoek van de oculaire en
vestibulaire functie lieten geen afwijkingen zien. Het niet-syndromale karakter
van dit gehoorverlies wordt toegeschreven aan een niet-truncerende aminozuursubstitutie (c.310G>A). Een bio-informatisch model van deze mutatie voorspelde
namelijk een oppervlakte verandering en geen structurele verandering van het
SANS eiwit waarvoor USH1G codeert.
Hoofdstuk 2.3 beschrijft een genotype-fenotype correlatie van een broer en zus uit
een consanguine Turkse familie. Beide patiënten lieten een gehoorverlies zien dat
vroeg in de kindertijd begint. Het gehoorverlies verslechterde van mild naar
ernstig tot zeer ernstig voor het tiende levensjaar. De initiële motorische
ontwikkeling was normaal, maar de vestibulaire functie verslechterde in de loop
der tijd tot vestibulaire areflexie. Aanvullend werd er in één van de patiënten een
milde nierfunctiestoornis gevonden. Dit fenotype wordt veroorzaakt door een
homozygote nonsense mutatie c.96T>A (p.(Cys32X)) in CLIC5. In dit hoofdstuk wordt
ook aangetoond dat CLIC5 in verschillende menselijke weefsels tot expressie komt.
Naast de milde nierfunctie stoornis werden er geen andere afwijkingen gevonden.
In 213 patiënten van voornamelijk Nederlandse en Spaanse afkomst met een
verdenking op een autosomaal recessief overervend niet-syndromaal gehoorverlies
werd mutatieanalyse voor CLIC5 uitgevoerd. Hierbij werden geen nieuwe pathogene
varianten gevonden. De conclusie in dit hoofdstuk is dan ook dat CLIC5 een nieuw
doofheidsgen is, maar dat mutaties in dit gen geen frequente oorzaak zijn voor
slechthorendheid in de Nederlandse of Spaanse populatie.
Hoofdstuk 3 is een onderzoek met doel het fenotype van DFNB1, de meest
voorkomende vorm van erfelijke slechthorendheid, uit te breiden. Het audiologische
fenotype is zeer heterogeen en eerder uitgebreid onderzocht en beschreven. Over
bijpassende anomalieën van het os temporale of de vestibulaire functie is minder
bekend en in de literatuur is er over deze onderwerpen voor DFNB1 dan ook geen
consensus. In dit hoofdstuk werden de vestibulaire functie en/of de resultaten van
beeldvorming van het rotsbeen bij een grote groep van 44 DFNB1 patiënten
retrospectief geëvalueerd. Vijf patiënten rapporteerden evenwichtsproblemen of
lieten een afwijkende motorische ontwikkeling zien. Tijdens het draaistoelonderzoek lieten alle onderzochte patiënten echter een respons zien. Van de patienten
had 65% een respons binnen de normaalwaarden bij calorisatie van beide oren en
de ‘video head impulse’ test was normaal in alle geteste patiënten. Vestibulaire
disfunctie is dan ook niet gecorreleerd aan het DFNB1 fenotype. Aanbevolen wordt
om de sacculaire en utriculaire functie van het vestibulum nader te onderzoeken
Summary / Samenvatting | 205
omdat dit in deze studie niet is onderzocht en er in de literatuur aanwijzingen zijn
dat het connexine 26 eiwit hier mogelijk wel een belangrijke rol speelt. In 34,4%
van de CT scans werden één of meer afwijkingen gezien van het rotsbeen. Deze
anomalieën waren zeer variabel en kwamen elk maar in kleine aantallen patiënten
voor. Geen enkele anomalie kan dan ook overtuigend gecorreleerd worden aan het
DFNB1 genotype.
In hoofdstuk 4 ligt de focus niet op het gehoorverlies, maar op de impact van een
genetische diagnose van erfelijk gehoorverlies. Achtenveertig patiënten werden
gevraagd om de volgende vragenlijsten: ‘Hospital Anxiety Depression Scale’, ‘Impact of
Event Scale’, ‘Self Efficacy 24’, ‘Illness Cognition Questionnaire’ en de ‘Inventory
for Social Reliance’ in te vullen. Algemene kenmerken werden verzameld door een
samengestelde vragenlijst en statusonderzoek te gebruiken. De vragenlijsten
dienden op drie momenten te worden ingevuld: ten tijde van de aanvraag van
genetisch onderzoek, direct na de uitslag van het genetisch onderzoek en zes
weken nadien. Tussen de patiënten die een genetische verklaring kregen voor hun
gehoorverlies (positief resultaat) en de patiënten die dat niet kregen (negatief
resultaat) werden geen significante verschillen gevonden. Dit onderzoek bevestigt
ook dat een aantal slechthorenden die vragen over de oorzaak van hun slechthorendheid hebben, zich kunnen presenteren met een hoge mate van psychologische
stress. Daarom wordt geadviseerd om extra aandacht te besteden aan het
psychologisch welzijn van slechthorenden die zich met vragen naar de oorzaak
van hun gehoorverlies presenteren. Genetische diagnostiek naar de oorzaak van
de slechthorendheid heeft echter geen positief noch negatief effect op dit welzijn.
Derhalve zijn er geen redenen om genetische diagnostiek naar erfelijke slechthorendheid wel of niet te verrichten.
Dit proefschrift draagt bij aan de toename van kennis over autosomaal recessief
overervend gehoorverlies. Dit is hier echter maar een klein onderdeel van en
uitgebreider onderzoek is dan ook essentieel om patiënten die de oorzaak van hun
slechthorendheid willen weten beter voor te kunnen lichten. De toekomstige
ontwikkeling van nieuwe technieken om makkelijker genen of mutaties te
identificeren, de cochlea in meer detail te kunnen onderzoeken en mogelijkheden
om erfelijke slechthorendheid te kunnen behandelen, zullen leiden tot het
uiteindelijke doel:
een normaal gehoor
7
Dankwoord
Dankwoord
| 209
Dankwoord
Het dankwoord, veelal het meest gelezen hoofdstuk van een proefschrift. Ook ik
heb hier uitermate mijn best op gedaan, want zonder de hulp van velen had dit
boekje er nu niet gelegen.
Allereerst hartelijk dank aan alle patiënten en familieleden die hebben meegewerkt
aan dit onderzoek. Dank dat ik jullie medische gegevens mocht gebruiken en dat
jullie de tijd hebben genomen om al die vragenlijsten in te vullen.
Mijn co-promotor, Dr. Pennings, beste Ronald, de beste co-promotor die ik me kon
wensen. Jouw tomeloze enthousiasme heeft ervoor gezorgd dat dit proefschrift er
nu ligt. Avonden, weekenden, vakanties, je was altijd bereikbaar. En als ik het even
niet meer zag zitten wist jij mij altijd weer te motiveren om door te gaan. Dank
voor alle tijd, betrokkenheid en energie.
Geachte professor Kremer, beste Hannie. Dank voor de introductie in de moleculaire
genetica en de mogelijkheid om ervaring op te doen in het laboratorium. Jouw
kritische blik heeft dit proefschrift naar een hoger niveau getild.
Beste leden van de manuscript commissie; professor Cremers, professor van Dijk en
doctor Topsakal. Hartelijk dank voor het lezen en beoordelen van mijn proefschrift.
Geachte professor Snik, beste Ad, hartelijk dank voor het meedenken op het vlak
van de psychophysica. Heel fijn hoe jij dit inzichtelijk wist te maken.
Beste Joop Leijendeckers, altijd bereid om mee te denken, altijd bereid om nog een
meting te verrichten. Dank voor de goede samenwerking.
Beste medewerkers van het audiologisch centrum, dank voor alle metingen die
jullie voor dit proefschrift verricht hebben.
Beste Patrick Huygen, dank voor de hulp bij de statistiek en je geduld om dit (soms
meerdere malen) uit te leggen.
Beste leden van de otogenetica werkgroep, veel over de otogenetica heb ik van
jullie mogen leren. Daarnaast waren jullie altijd bereid om mee te denken, dank
daarvoor!
210 | Chapter 7
Medewerkers van de afdeling vestibulogie, dank voor al jullie metingen. Andy,
hartelijk dank voor al de uitleg en inzet. Jouw begeleiding was onmisbaar, vooral
voor hoofdstuk 3.
Een half jaar lang heb ik op het laboratorium gepoogd om de oorzaak achter de
slechthorendheid in verschillende families te achterhalen. Zo’n dokter op het lab
was soms wel even wennen, maar uiteindelijk heb ik hier veel geleerd. Dank aan
alle medewerkers voor de behulpzaamheid. In het bijzonder dank aan Jaap: jouw
geduld en manier van uitleggen zijn bewonderenswaardig. Dank dat je me dat half
jaar wilde begeleiden. Beste Margit, ook jij hartelijk dank voor de begeleiding.
Beste Erwin, jouw enthousiasme is eindeloos. Door met jou te discussiëren over het
onderzoek werd mijn motivatie voor dit proefschrift altijd weer aangewakkerd.
Dank daarvoor! Beste Lisette, helaas hebben we ons PTPRQ project niet samen
kunnen afronden, maar gezellig was het altijd zeker. Heel fijn om gewoon even
gezellig te kunnen kletsen, dank daarvoor!
Beste Ramon, dank voor de samenwerking. Heel leuk om tijdens dit promotietraject
ook een klein uitstapje naar de oogheelkunde te maken.
Beste staf van de afdeling keel-, neus- en oorheelkunde van het Radboud UMC,
dank voor het in mij gestelde vertrouwen en de kans om mijn opleiding bij jullie
te volgen en te combineren met dit promotietraject.
Beste dames van het stafsecretariaat, dank voor jullie hulp bij al mijn logistieke
vragen. In het speciaal dank ik Loes Temmink, jij wist altijd de moeilijkste agenda
puzzel op te lossen maar was ook altijd in om even gezellig te kletsen.
Beste (oud) arts-assistenten, researchers en PA: Godelieve, Stijn, Hans, AnneMartine, Veronique, Rabia, Arthur, Maarten, Richard, Hubert, Lisette, Erik,
Annemarie, Caroline, Henrieke, Jasmijn, Ingrid, Eline, Ruud, Rik, Saskia, Thijs,
Josephine, Charlotte, Corinne, Chrisje, Luuk, Bas, Mieke, Machteld, Mayke, Ivo en
David. Voordat ik ging solliciteren was ik nog nooit in Nijmegen geweest, maar
onze groep maakte dat ik me hier snel helemaal thuis voelde. Dank voor alle
gezelligheid binnen en buiten het Radboud!
Union Dames 4, wat ben ik blij dat ik met jullie mag hockeyen. Twee keer per week
de gelegenheid om alles eruit te lopen en te slaan. Vanaf nu ga ik ook weer voor een
basisplek in de derde helft!
Dankwoord
| 211
Lieve clubgenoten, al 10 jaar samen door dik en dun. Dank voor de nodige afleiding
die jullie hebben gegeven afgelopen jaren.
Lieve Teun en Joris, mijn grote kleine broertjes. Dank voor de nodige afleiding
tijdens dit proefschrift in de vorm van gekke foto’s over de app of een borrel
drinken op Schiermonnikoog, de volgende keer laat ik mijn laptop thuis!
Lieve Ingrid, jouw ambitie en doorzettingsvermogen hebben afgelopen jaren zeker
geïnspireerd. Maar daarnaast breng je vooral veel gezelligheid en afleiding in
fietsen, eten, lachen! Fijn dat je als medegroninger/ LvBer naast me wilt staan.
Lieve Charlotte, grote zus, rond dezelfde tijd zijn we begonnen aan een ‘vervolg’
van onze opleiding. Jij hebt het inmiddels afgerond. Nu ik nog! Wat fijn dat je me
daarbij wilt ondersteunen als paranimf. En Jeroen, fijn om te weten dat jij daar
met jouw rust achter staat.
Lieve Han en Sieka, dank voor jullie interesse en support. Ik ben blij dat we jullie
nu zo dicht in de buurt hebben.
Lieve Loes, heel fijn hoe jij altijd luistert en zo nodig relativeert. Onze dagjes uit
waren altijd een hele fijne afleiding. Beste Sjoerd, dat jij probeerde om mij op twee
jarige leeftijd desoxyribonucleinezuur te laten zeggen zou wel eens de basis voor
dit proefschrift kunnen zijn geweest. Met z’n drieën hebben we heel wat uren mijn
opleiding en onderzoek doorgenomen, dank dat jullie er zijn!
Lieve papa en mama, van jullie mocht ik altijd worden wat ik maar wilde. Jullie
hebben me de basis gegeven om uiteindelijk te promoveren en de opleiding tot
KNO-arts te volgen en me daarbij zo goed mogelijk ondersteund. En als de energie
dan echt op was, was het goed bijkomen in het Hoge Noorden. Dank dat jullie er
voor me zijn.
Liefste Ernst, jij bent altijd onvoorwaardelijk in mij blijven geloven, ook al had ik
het al lang opgegeven. Zonder jouw liefde en steun was het me nooit gelukt. Hoe
vaak hebben we niet gezegd: als het straks af is.. En die straks is nu. Ik kijk uit naar
de toekomst met jou!
8
Curriculum Vitae
Curriculum Vitae
| 215
Curriculum Vitae
Anne Oonk werd op 3 mei 1987 geboren te Haarlem. Zij groeide op in Hoofddorp
met haar ouders, zus en twee broertjes. In 2000 verhuisden zij naar Dokkum,
alwaar Anne in 2005 haar eindexamen behaalde aan het VWO van het Dockinga
College. Hierna startte zij met haar studie Geneeskunde aan de Rijksuniversiteit
Groningen. Naast haar studie was zij onder andere actief bij de lustrumcommissie
van M.F.V. Panacea, de public relations committee van het International Student
Congress of (Bio)Medical Sciences (ISCOMS) en op het hockeyveld van GCHC. In
2008 volgde zij een klinische stage op de kinderafdeling van het El Mansoura
University Hospital in El Mansoura, Egypte. Tijdens het reguliere KNO coschap in
het Deventer Ziekenhuis werd de interesse voor de Keel-, Neus- en Oorheelkunde
gewekt. De reguliere coschappen werden afgesloten met een coschap sociale
geneeskunde in het Ngwelezana Hospital in Empageni, Zuid Afrika. In 2011 startte
zij met haar onderzoek naar triple negatieve borstkanker tumoren in het Deventer
Ziekenhuis in samenwerking met het Antoni van Leeuwenhoek in Amsterdam.
Hierop volgde een keuze coschap KNO in het UMC in Utrecht en in het Deventer
Ziekenhuis. Eind 2011 behaalde zij haar artsenexamen en startte zij als artsonderzoeker aan het Radboud UMC onder begeleiding van Dr. R.J.E. Pennings en
Prof. Dr. H. Kremer. Dit onderzoekstraject resulteerde uiteindelijk in dit proefschrift.
Sinds 2013 is zij in opleiding tot KNO-arts in het Radboud UMC onder Prof. Dr.
H.A.M. Marres en opleider Dr. F.J.A. van den Hoogen.
9
List of publications
List of publications | 219
List of publications
E.H. Lips, N. Laddach, S.P. Savola, M.A. Vollebergh, A.M.M. Oonk, A.L.T. Imholz, L.F.
Wessels, J. Wesseling, P.M. Nederlof and S. Rodenhuis (2011).”Quantitative copy
number analysis by Multiplex Ligation-dependent Probe Amplification (MLPA) of
BRCA1-associated breast cancer regions identifies BRCAness.” Breast Cancer Res
13(5): R107.
A.M.M. Oonk, C. van Rijn, M.M. Smits, L. Mulder, N. Laddach, S.P. Savola, J.
Wesseling, S. Rodenhuis, A.L.T Imholz and E.H. Lips (2012).”Clinical correlates of
‘BRCAness’ in triple-negative breast cancer of patients receiving adjuvant
chemotherapy.” Ann Oncol 23(9): 2301-2305.
K.O. Yariz, D. Duman, C.Z. Seco, J. Dallman, M. Huang, T.A. Peters, A. Sirmaci, N. Lu,
M. Schraders, I. Skromne, J. Oostrik, O. Diaz-Horta, J.I. Young, S. Tokgoz-Yilmaz, O.
Konukseven, H. Shahin, L. Hetterschijt, M. Kanaan, A.M.M. Oonk, Y.J. Edwards, H.
Li, S. Atalay, S. Blanton, A.A. Desmidt, X.Z. Liu, R.J.E. Pennings, Z. Lu, Z.Y. Chen, H.
Kremer and M. Tekin (2012).”Mutations in OTOGL, encoding the inner ear protein
otogelin-like, cause moderate sensorineural hearing loss.” Am J Hum Genet 91(5):
872-882.
M. Schraders, L. Ruiz-Palmero, E. Kalay, J. Oostrik, F.J. del Castillo, O. Sezgin, A.J.
Beynon, T.M. Strom, R.J.E. Pennings, C.Z. Seco, A.M.M. Oonk, H.P.M. Kunst, M.
Dominguez-Ruiz, A.M. Garcia-Arumi, M. del Campo, M. Villamar, L.H. Hoefsloot, F.
Moreno, R.J.C. Admiraal, I. del Castillo and H. Kremer (2012).”Mutations of the gene
encoding otogelin are a cause of autosomal-recessive nonsyndromic moderate
hearing impairment.” Am J Hum Genet 91(5): 883-889.
E.H. Lips, L. Mulder, A.M.M. Oonk, L.E. van der Kolk, F.B. Hogervorst, A.L.T. Imholz,
J. Wesseling, S. Rodenhuis and P.M. Nederlof (2013).”Triple-negative breast cancer:
BRCAness and concordance of clinical features with BRCA1-mutation carriers.” Br
J Cancer 108(10): 2172-2177.
A.M.M. Oonk, J.M. Leijendeckers, E.M. Lammers, N.J. Weegerink, J. Oostrik, A.J.
Beynon, P.L.M. Huygen, H.P.M. Kunst, H. Kremer, A.F.M. Snik and R.J.E. Pennings
(2013).”Progressive hereditary hearing impairment caused by a MYO6 mutation
resembles presbyacusis.” Hear Res 299: 88-98.
220 | Chapter 9
D. Ragancokova, E. Rocca, A.M.M. Oonk, H. Schulz, E. Rohde, J. Bednarsch, I.
Feenstra, R.J.E. Pennings, H. Wende and A.N. Garratt (2014).”TSHZ1-dependent
gene regulation is essential for olfactory bulb development and olfaction.” J Clin
Invest 124(3): 1214-1227.
A.M.M. Oonk, M.S. Ekker, P.L.M. Huygen, H.P.M. Kunst, H. Kremer, J.J. Schelhaas
and R.J.E. Pennings (2014).”Intrafamilial variable hearing loss in TRPV4 induced
spinal muscular atrophy.” Ann Otol Rhinol Laryngol 123(12): 859-865.
A.M.M. Oonk, J.M. Leijendeckers, P.L.M. Huygen, M. Schraders, M. del Campo, I. del
Castillo, M. Tekin, I. Feenstra, A.J. Beynon, H.P.M. Kunst, A.F.M. Snik, H. Kremer,
R.J.C. Admiraal and R.J.E. Pennings (2014).”Similar phenotypes caused by mutations
in OTOG and OTOGL.” Ear Hear 35(3): e84-91.
A.M.M. Oonk, S.C. Steens and R.J.E. Pennings (2014).”Radiologic confirmation of
patulous eustachian tube by recumbent computed tomography.” Otol Neurotol
35(3): e117-118.
A.M.M. Oonk, R.A.C. van Huet, J.M. Leijendeckers, J. Oostrik, H. Venselaar, E. van
Wijk, A.J. Beynon, H.P.M. Kunst, C.B. Hoyng, H. Kremer, M. Schraders and R.J.E.
Pennings (2015).”Nonsyndromic hearing loss caused by USH1G mutations:
widening the USH1G disease spectrum.” Ear Hear 36(2): 205-211.
C.Z. Seco, A.M.M. Oonk, M. Dominguez-Ruiz, J.M.T. Draaisma, M. Gandia, J. Oostrik,
K. Neveling, H.P.M. Kunst, L.H. Hoefsloot, I. del Castillo, R.J.E. Pennings, H. Kremer,
R.J.C. Admiraal and M. Schraders (2015).”Progressive hearing loss and vestibular
dysfunction caused by a homozygous nonsense mutation in CLIC5.” Eur J Hum
Genet 23(2): 189-194.
C.Z. Seco, A.P. Giese, S. Shafique, M. Schraders, A.M.M. Oonk, M. Grossheim, J.
Oostrik, T. Strom, R. Hegde, E. van Wijk, G.I. Frolenkov, M. Azam, H.G. Yntema, R.H.
Free, S. Riazuddin, J.B. Verheij, R.J.C. Admiraal, R. Qamar, Z.M. Ahmed and H.
Kremer (2015).”Novel and recurrent CIB2 variants, associated with nonsyndromic
deafness, do not affect calcium buffering and localization in hair cells.” Eur J Hum
Genet (Epub ahead of print).
A.M.M. Oonk, A.J. Beynon, T.A. Peters, H.P.M. Kunst, R.J.C. Admiraal, H. Kremer, B.
Verbist and R.J.E. Pennings (2015).”Vestibular function and temporal bone imaging
in DFNB1.” Hear Res 327:227-34.
List of publications | 221
E. van Beelen, A.M.M. Oonk, J.M. Leijendeckers, R.J.E. Pennings, H.J. Dieker, A.F.M.
Snik, H. Kremer, H.P.M. Kunst (2015).“Audiometric Characteristics of a Dutch
DFNA10 Family With Mid-Frequency Hearing Impairment.”Hear Res (Epub ahead
of print).
A.M.M. Oonk, P.L.M. Huygen, H.P.M. Kunst, H. Kremer, R.J.E. Pennings (2015).
Features of autosomal recessive nonsyndromic hearing impairment; a review to
serve as a reference. Clin Otol (Epub ahead of print).
10
List of abbreviations
List of abbreviations | 225
List of abbreviations
ABR:
ANSD:
arNSHI:
ARTA:
ATD:
BCVA:
CI:
CMV:
CNC:
CT:
cVEMPS:
dB HL:
Del:
DFNA:
DFNB:
DFN:
DLF:
EAC:
EAS:
EBV:
EF:
ERG:
EVA:
EVS:
FAF:
FM:
GPRI:
HADS:
HFASCs:
HRR:
HSCC:
ICQ:
IES:
IQR:
ISCED:
ISCEV:
ISR:
Jbg:
auditory-evoked brainstem response
auditory neuropathy spectrum disorder
autosomal recessive non-syndromic hearing impairment
age related typical audiograms
annual threshold deterioration
best-corrected visual acuity
cochlear implant
cytomegalo virus
cochlear nerve canal
computed tomography
cervical vestibular-evoked myogenic potentials
decibel hearing level
deletion
autosomal dominant inherited deafness
autosomal recessive inherited deafness
deafness
difference limen for frequency
external auditory canal
electro acoustic stimulation
Epstein Barr Virus
endolymphatic fossa
electroretinography
enlarged vestibular aqueduct
exome variant server
fundus autofluorescence
frequency modulation
genetic psychological risk inventory
hospital anxiety and depression scale
human fetal auditory stem cells
Hardy-Rand-Rittler
horizontal semicircular canal
illness cognition questionnaire
impact of event scale
interquartile range
international standard classification of education
international society for clinical electrophysiology of vision
inventory of social reliance
Jitterbug
226 | Chapter 10
kHz:
MCL:
MET:
ms:
MRI:
NMD:
n.s.:
OAEs:
OCT:
Pa:
PTA:
qPCR:
RP:
RPE:
SCC:
SD-OCT:
SE24:
SNP:
S/N:
SPL:
SRT:
SSCC:
STR:
VA:
VEMPs:
vHIT:
VNTR:
VST:
WES:
yr:
kilo Hertz
most comfortable listening level
mechanoelectric transductor
millisecond
magnetic resonance imaging
nonsense-mediated mRNA decay
not significant
otoacoustic emissions
optical coherence tomography
Pascal
pure tone audiometry
quantitative polymerase chain reaction
retinitis pigmentosa
retinal pigment epithelium
semicircular canal
spectral-domain optical coherence tomography
self efficacy scale
single nucleotide polymorphism
signal/ noise
sound pressure level
speech reception threshold
superior semicircular canal
single tandem repeat
vestibular aqueduct
vestibular-evoked myogenic potentials
video head impulse test
variable number tandem repeat
velocity step test
whole exome sequencing
year