Download Characterization of infectious Murray Valley encephalitis virus

Journal
of General Virology (1999), 80, 3115–3125. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Characterization of infectious Murray Valley encephalitis virus
derived from a stably cloned genome-length cDNA
Robert J. Hurrelbrink,1 Ann Nestorowicz2 and Peter C. McMinn1
1
2
Department of Microbiology, University of Western Australia, Nedlands, WA 6907, Australia
Endocrine Division, Lilly Research Laboratories, Indianapolis, IN 46285, USA
An infectious cDNA clone of Murray Valley encephalitis virus prototype strain 1-51 (MVE-1-51) was
constructed by stably inserting genome-length cDNA into the low-copy-number plasmid vector
pMC18. Designated pMVE-1-51, the clone consisted of genome-length cDNA of MVE-1-51 under
the control of a T7 RNA polymerase promoter. The clone was constructed by using existing
components of a cDNA library, in addition to cDNA of the 3h terminus derived by RT–PCR of poly(A)tailed viral RNA. Upon comparison with other flavivirus sequences, the previously undetermined
sequence of the 3h UTR was found to contain elements conserved throughout the genus Flavivirus.
RNA transcribed from pMVE-1-51 and subsequently transfected into BHK-21 cells generated
infectious virus. The plaque morphology, replication kinetics and antigenic profile of clone-derived
virus (CDV-1-51) was similar to the parental virus in vitro. Furthermore, the virulence properties of
CDV-1-51 and MVE-1-51 (LD50 values and mortality profiles) were found to be identical in vivo in
the mouse model. Through site-directed mutagenesis, the infectious clone should serve as a
valuable tool for investigating the molecular determinants of virulence in MVE virus.
Introduction
Murray Valley encephalitis (MVE) virus is a member of the
genus Flavivirus within the family Flaviviridae (Monath &
Heinz, 1996). Flaviviruses are small, lipid-enveloped viruses
that contain single-stranded positive-sense RNA genomes
approximately 11 kb in length. The genome encodes three
structural proteins (the capsid protein C, the membrane protein
prM and the envelope protein E) and seven non-structural
proteins (NS1, NS2A, NS2B, the helicase\protease NS3,
NS4A, NS4B and the viral RNA polymerase NS5). All viral
proteins are encoded in a single open reading frame that is
flanked by short untranslated regions (UTRs) (see Chambers et
al., 1990 ; Rice, 1996). Viral genomic RNA lacks a poly(A) tail
at the 3h terminus, has a 5h methylated cap (type I) and gives
rise to infectious virus particles when transfected into susceptible cells (Rice, 1996). Like other flaviviruses such as
yellow fever (YF), Japanese encephalitis (JE), Kunjin (KUN),
dengue (DEN) and tick-borne encephalitis (TBE) viruses, MVE
virus causes clinically significant disease in humans (reviewed
Author for correspondence : Peter McMinn.
Fax j61 8 9346 2912. e-mail peter.mcminn!health.wa.gov.au
The GenBank accession number of the sequence reported in this paper
is AF161266.
0001-6386 # 1999 SGM
in Monath & Heinz, 1996). Occasional cases of encephalitis are
seen in the Kimberley region of Western Australia and in
north-eastern Queensland, often coinciding with increased
mosquito activity during the wet season (December–June ; reviewed in Marshall, 1988).
Studies investigating the molecular determinants of virulence in flaviviruses have, in the past, focused on the
characterization of attenuated laboratory strains that were
derived by cell-culture passage and\or neutralization-escape
selection. More recent advances in this field have involved the
use of infectious cDNA clones, i.e. bacterial plasmids containing viral cDNA, from which infectious RNA can be
transcribed in vitro.
The first such flavivirus clone was produced by Rice et al.
(1989) and involved the ligation in vitro of two cDNA
fragments of YF virus. Infectious virus was derived from the
clone by in vitro transcription of viral RNA and subsequent
transfection into BHK-21 cells (Rice et al., 1989). Since this
report, infectious clones of flaviviruses have been similarly
constructed for JE (Sumiyoshi et al., 1992), various strains of
DEN-2 (Kapoor et al., 1995 ; Kinney et al., 1997 ; Polo et al.,
1997 ; Gualano et al., 1998), DEN-4 (Lai et al., 1991), KUN
(Khromykh & Westaway, 1994) and TBE (Mandl et al., 1997).
In some cases, genome-length cDNA was found to be unstable
in a bacterial host (YF, JE and DEN-2 strain New Guinea C),
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 10:55:57
DBBF
R. J. Hurrelbrink, A. Nestorowicz and P. C. McMinn
whereas for others (DEN-2 strains 16681, New Guinea C and
PUO-218, DEN-4, KUN and TBE), full-length cDNA was
stably cloned into Escherichia coli or yeast. Success in these
latter cases was often dependent on the use of different
combinations of plasmid vector and\or bacterial host strain.
To date, there has been no report of the construction of an
infectious clone for MVE virus.
In this report, we describe the derivation of the 3h-terminal
sequence of MVE virus prototype strain 1-51 and the
construction of a stable genome-length cDNA clone. RNA
transcribed from the clone was infectious when introduced into
susceptible cells. Furthermore, clone-derived virus (CDV) was
found to be indistinguishable from the parental strain with
respect to plaque phenotype, antigenicity, replication kinetics
in cell culture and neuroinvasiveness and neurovirulence in
mice.
Methods
Cells and virus. Vero (ATCC CCL81 P130–P145), BHK-21 (ATCC
CCL10 P56–P59) and Aedes albopictus C6\36 (ATCC CRL1660 P5–P20)
cells were grown in M199 medium supplemented with 2 mM -glutamine
and 10 % foetal calf serum (FCS) and were incubated either at 37 mC in an
atmosphere containing 5 % CO (Vero, BHK-21) or at 28 mC under
#
standard atmospheric conditions (C6\36). MVE-1-51, the prototype
strain of MVE virus (Berge, 1975), had been passaged twice in
embryonated eggs and 15 times in mouse brain (French, 1952). Working
stocks were prepared as 10 % (w\v) suspensions of infected sucklingmouse brain in Hanks’ balanced salt solution pH 8n0. Where required,
virus derived from the infectious cDNA clone (CDV-1-51) was passaged
on C6\36 cells to increase the titre for use in subsequent assays. Viral
genomic RNA was extracted from infected mouse brain using the
RNAzolB method (Tel-Test Inc.) according to the manufacturer’s
instructions.
Plaque assays. Monolayers of Vero cells in 12-well tissue culture
trays were used for plaque assays. After incubation for 1 h, virus was
removed and cells were overlaid with methyl cellulose containing 2 %
FCS in M199 medium. Cells were cultured for 4–6 days at 37 mC in 5 %
CO and stained with methylene blue to visualize plaques [1 % (w\v)
#
methylene blue, 10 % formaldehyde].
Virus growth assays. Monolayers of Vero cells in 60 mm# tissue
culture dishes were infected with either MVE-1-51 or CDV-1-51 at an
m.o.i. of 2. Aliquots of cell culture supernatant (500 µl) were then
collected at 12, 18, 24 and 30 h post-infection (p.i.) and replaced with
equal volumes of fresh medium. The titre of virus in each sample was
subsequently determined by plaque assay. All virus growth assays were
performed in duplicate.
Cloning of the 3h UTR of MVE-1-51. A cDNA clone encompassing the 3h terminus of the MVE-1-51 genome was derived by reverse
transcription of poly(A)-tailed MVE RNA and subsequent amplification
of MVE cDNA by PCR. Briefly, MVE RNA was isolated from purified
virus as described previously (Rice et al., 1989) and polyadenylated at the
3h terminus by using E. coli poly(A) polymerase (Bresatec) according to
the manufacturer’s instructions. First-strand cDNA was synthesized by
oligo(dT)-primed reverse transcription of polyadenylated RNA with
AMV reverse transcriptase (Gibco-BRL). After cDNA synthesis, the
MVE virus 3h UTR was amplified by PCR with Vent DNA polymerase
(New England Biolabs). Oligonucleotides used for PCR amplification
DBBG
were oligo(dT) – (New England Biolabs) and a primer corresponding
"# ")
to MVE virus nt 9940–9955 (Lee et al., 1990). The resultant PCR
products were isolated from low-melting-point agarose, methylated with
BamHI methylase and ligated to BamHI linkers (New England Biolabs).
Ligation products were isolated on low-melting-point agarose, digested
with BamHI and subcloned into BamHI-digested M13mp18. The
sequence of the 3h-terminal 85 nucleotides (nt 10 930–11 014) of MVE
virus RNA was obtained by sequence analysis of single-stranded M13
DNA isolated from a total of ten separate recombinants, generated from
two independent PCRs.
The predicted stem–loop structure at the 3h terminus of MVE virus
RNA (see Fig. 1 c) was derived by using MFOLD and SQUIGGLES
software, available on-line at WebANGIS GCG (http :\\www.angis.
org.au\WebANGIS\WAG).
Construction of genome-length cDNA. Clones from an MVE-151 cDNA library (Dalgarno et al., 1986) were used in the construction of
a full-length cDNA clone. Superscript numbers represent the nucleotide
positions in the full-length MVE virus sequence of 11 014 nucleotides.
Initially, cDNA of the 5h terminus (spanning nt 1–1943) was generated
by PCR by using clone p1\1\12 (Dalgarno et al., 1986) as a template. The
5h-end primer (containing a SalI restriction enzyme site for cloning, a T7
RNA polymerase promoter and the first 22 bases of the 5h MVE virus
sequence) was designed so that the first nucleotide of the MVE cDNA
sequence would be adjacent to the T7 promoter with one extra base (G)
added (see Fig. 1 b ; primer sequence 5h GAATTCGTCGACTTAATACGACTCACTATAGAGACGTTCATCTGCGTGAGCT 3h). The
PCR product isolated (SalI XbaI"*%$) was ligated to an XbaI"*%$
ClaI&%!( fragment excised from clone p1\1\12 and subsequently cloned
between the SalI and ClaI sites of pBR322 (designated pBR\5hMVE ; see
Fig. 1 a).
A cDNA copy of the 3h terminus (spanning nt 9951–11 014) was
generated by RT–PCR of viral RNA using a high-fidelity Pfu polymerase
(Stratagene). The reverse primer contained a SalI site for cloning as well
as the last 43 bases of the 3h MVE virus sequence. In addition, an
XbaI""!"% site was incorporated adjacent to the 3h terminus to enable
linearization of the clone and subsequent run-off transcription of fulllength RNA (see Fig. 1 a, b ; primer sequence 5h GCCGCGGTCGACTCTAGAGATCCTGTGGTCTTCTCCCCCATCAGTCACAGTGTCGGCGC 3h). The isolated RT–PCR product (SphI**&" SalI) was
ligated to a ClaI&%!( SphI**&" fragment excised from clone p2\2\6
(Dalgarno et al., 1986) and subsequently cloned between the ClaI and SalI
sites of pBR322 (designated pBR\3hMVE ; see Fig. 1 a).
Having constructed two sub-genomic clones spanning nt 1–5407
(pBR\5hMVE) and 5407–11 014 (pBR\3hMVE) of the viral genome, a
full-length clone was generated by ligating an excised SalI ClaI&%!(
fragment from pBR\5hMVE to an excised ClaI&%!( XbaI""!"% fragment
from pBR\3hMVE. This full-length cDNA was then cloned between the
SalI and XbaI sites of pMC18 (for plasmid reference see Gualano et al.,
1998) to give the full-length clone pMVE-1-51.
Competent E. coli DH5α cells, prepared by the calcium chloride
method of Sambrook et al. (1989), were used for the cloning and
amplification of sub-genomic and full-length plasmids.
PCR mutagenesis of pBR/5hMVE. To enable the use of the
XbaI""!"% site for linearization at the 3h terminus in a full-length clone, the
XbaI"*%$ site of pBR\5hMVE was abolished by replacing a short region of
pBR\5hMVE (SalI PstI"*&!) with a new fragment derived by PCR. The
reverse primer used to generate this fragment was designed with a single
mismatch at nucleotide 1943, resulting in a T A transition mutation
that did not alter the encoded amino acid sequence (GTT and GTA both
encode Val).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 10:55:57
Infectious cDNA clone of MVE virus
Fig. 1. (a) Construction of the genome-length MVE virus cDNA clone pMVE-1-51. The cDNA library was prepared by Dalgarno
et al. (1986). Both the 5h and 3h termini were synthesized by RT–PCR from MVE-1-51 RNA. A T7 RNA polymerase promoter
(grey box) was incorporated upstream of the 5h terminus to facilitate transcription. In addition, an XbaI site was incorporated at
the 3h terminus to allow linearization of the clone. Other restriction enzyme sites used in construction of the clone are shown.
Note that the XbaI** site of clone pBR/5hMVE was abolished by PCR. (b) The 5h and 3h termini of cDNA contained in the clone
pMVE-1-51. An additional G residue was added immediately downstream of the promoter (highlighted by larger font) to
improve the efficiency of transcription. Four non-viral nucleotides are predicted to be added to the 3h terminus of the viral RNA
following in vitro transcription. (c) The predicted stem–loop structure at the 3h terminus of MVE virus RNA. The secondary
structures formed by the last 100 nucleotides of the genome, including the putative pseudoknot (indicated by dashed lines)
are conserved throughout the genus Flavivirus. The predicted structure for KUN is shown for comparison (Proutski et al.,
1997).
In vitro transcription. Approximately 1 µg pMVE-1-51 containing
full-length cDNA was linearized by digestion with XbaI and prepared for
in vitro transcription by overnight incubation with proteinase K
(200 µg\ml) and SDS (0n5 %). DNA was subsequently purified by
phenol–chloroform extraction and ethanol precipitation and resuspended
in 8 µl nuclease-free water. Transcription was carried out by using a
MEGAscript T7 kit (Ambion) according to the manufacturer’s instructions. The reaction contained 7n5 mM each of dATP, dCTP and dUTP,
2n5 mM dGTP and the cap analogue m(G(5h)ppp(5h)GTP at 5 mM in a
final volume of 20 µl. The reaction was incubated at 37 mC for 3 h and
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 10:55:57
DBBH
R. J. Hurrelbrink, A. Nestorowicz and P. C. McMinn
RNA products were precipitated by the addition of 2n5 M LiCl at
k20 mC for 1 h. RNA was then pelleted by centrifugation in a bench-top
microfuge for 10 min, washed with 70 % ethanol and resuspended in
25 µl nuclease-free water. The efficiency of the reaction was determined
by running 1 µl of the resuspended RNA on a denaturing formaldehyde–agarose gel and staining with ethidium bromide.
RNA transfection. RNA transfections were carried out by using a
protocol slightly modified from that outlined by Mandl et al. (1997).
Briefly, sub-confluent BHK-21 cells were collected by trypsinization,
washed with ice-cold PBS and resuspended at 6n25i10' cells\ml in icecold PBS. Aliquots of 800 µl were then transferred to pre-chilled, 0n4 cm
gene pulser cuvettes containing 100 µl ice-cold PBS and 1n5 µg
resuspended RNA from in vitro transcription. After incubation on ice for
5 min, cells were electroporated by two successive pulses (settings
1n5 kV, 25 µF, _ Ω), resulting in a time constant of approximately
0n8 ms. A 1 ml aliquot of M199 medium supplemented with 5 % FCS was
added immediately and the cells were gently resuspended before being
transferred to an 80 cm# tissue culture flask containing 20 ml of the same
medium. Cells were incubated at 37 mC in 5 % CO and observed daily for
#
signs of cytopathic effect (CPE).
Virus derived from the above transfection was passaged three times
in C6\36 cells (72 h per passage) and designated CDV-1-51. This thirdpassage stock was subsequently used for phenotypic characterization of
the virus.
Immunofluorescence assay. Sub-confluent C6\36 cells were
seeded onto glass coverslips in 24-well tissue culture trays (containing
M199 supplemented with 10 % FCS) and left overnight at 28 mC prior to
infection with MVE-1-51 or CDV-1-51. At 60 h p.i., cells were washed
twice with cold PBS and fixed in 80 % acetone at k20 mC for 10 min.
After air-drying, cells were rehydrated with cold PBS and incubated in a
1 : 100 dilution of primary antibody (anti-MVE virus hyperimmune
ascites fluid ; a gift from M. Kroeger, Department of Microbiology,
University of Western Australia) at room temperature for 1 h. Cells were
subsequently washed three times in cold PBS and further incubated for
1 h in a 1 : 100 dilution of secondary antibody (FITC-conjugated goat
anti-mouse IgG). Cells were then washed again (three times) in cold PBS
and the coverslips were mounted onto clean microscope slides with
PBS–glycerol. Immunofluorescence was visualized under UV light by
using a Leitz Orthoplan microscope.
Sequence analysis. Complete sequence analysis of pMVE-1-51
was performed by using an ABI-Perkin Elmer automated sequencing
system that incorporates fluorescently labelled dideoxynucleotides.
Multiple analyses were performed to confirm any differences observed
between the published sequence of MVE-1-51 (Dalgarno et al., 1986 ; Lee
et al., 1990) and the sequence of the full-length clone. All primers were
supplied by Gibco-BRL as 20-mers and were used at a final concentration
of 0n8 nM. Details of primer sequences are available from R. J. H. on
request.
Labelling of polypeptides in infected cells. Sub-confluent
monolayers of Vero cells in 60 mm tissue culture dishes were infected
with either MVE-1-51 or CDV-1-51 at an m.o.i. of approximately 10. At
24 h p.i., cells were washed twice in amino acid-deficient medium (diluted
1 : 10) and incubated in the same medium for 30 min at 37 mC. Amino
acid-deficient medium was then removed and replaced with fresh medium
supplemented with tritiated -amino acids. Twenty-four hours later, cell
monolayers were washed twice in cold PBS and lysed by the addition of
200 µl cold NTE buffer (50 mM Tris–HCl, pH 7n5 ; 200 mM NaCl ;
10 mM EDTA ; 0n5 % Triton X-100) on ice for 20 min. Nuclei were
pelleted by centrifugation for 5 min at 4 mC in a bench-top microfuge and
the supernatant was stored at k20 mC until required.
DBBI
Immunoprecipitation of radiolabelled virus. Immunoprecipitation of radiolabelled virus from cytoplasmic lysates was achieved by
incubating the lysate at 4 mC for 1 h in the presence of pre-immune mouse
ascitic fluid (1 : 100 dilution). Immune complexes were then removed by
adding protein A-bearing Staphylococcus aureus cells (strain Cowan I,
Gibco-BRL) and incubating on ice for 30 min prior to centrifugation at
4 mC for 5 min in a bench-top microfuge. The supernatant was then
incubated in the presence of a 1 : 40 dilution of anti-MVE virus
hyperimmune ascites fluid for 2 h at 4 mC and immune complexes were
again removed by the addition of S. aureus cells as described above,
except that the suspension was incubated on ice for 1 h. The suspension
was then layered onto 1 ml of 10 % sucrose solution in NTE buffer and
centrifuged at 4000 r.p.m. for 10 min in a bench-top microfuge. Pellets
were washed twice in NTE buffer containing 0n1 % Triton X-100 and
resuspended in 30 µl electrophoresis sample buffer (60 mM Tris–HCl,
pH 6n8 ; 2 % SDS ; 0n1 % bromophenol blue ; 10 % glycerol). Samples were
heated to 60 mC for 20 min and then centrifuged for 2 min in an
Eppendorf tube to pellet S. aureus cells and the supernatant was
transferred to a fresh Eppendorf tube for storage at k20 mC.
SDS–PAGE of viral polypeptides. Prior to electrophoresis,
immunoprecipitated polypeptides were reduced by the addition of
100 mM DTT and 6 % (v\v) 2-mercaptoethanol and incubated at 95 mC
for 5 min. Samples were then loaded onto Tris–HCl 10–20 % polyacrylamide gradient gels (Bio-Rad) and electrophoresed at 130 V for 1 h.
Gels were fixed and stained in Coomassie blue, destained and treated for
fluorography with Amplify reagent (Amersham) prior to drying under
reduced pressure and exposing to X-ray film.
Virulence in mice. Litters of 21-day-old ARC\Swiss mice (five per
litter ; obtained from the Animal Resources Centre, Murdoch, Western
Australia) were injected intracranially (i.c.) or intraperitoneally (i.p.) with
10 µl or 50 µl, respectively, of a tenfold dilution of MVE-1-51 or CDV1-51. Mice were counted daily and deaths were recorded. Humane endpoints were employed to minimize distress to experimental animals, a
method that does not significantly alter LD values in models of viral
&!
encephalitis (Wright & Phillpotts, 1998). The 50 % ‘ humane end-point ’
dose (HD ) was calculated for each group by the LD method of Reed
&!
&!
& Muench (1938).
Alternatively, mean time to death was determined by injecting mice
(10 per group) i.c. or i.p. with 1000 p.f.u. MVE-1-51 or CDV-1-51 and
recording survival of mice over a period of 21 days. Statistical significance
was determined by using Student’s paired t-test.
Mouse experiments were undertaken by using protocols approved by
the UWA Animal Experimentation Ethics Committee. Mice were kept on
a clean litter of sawdust and given food and water ad libitum.
Results
Derivation of the 3h-terminal sequence of MVE-1-51
A cDNA copy of the 3h terminus of MVE-1-51 was derived
by polyadenylation of viral RNA with E. coli poly(A)
polymerase and subsequent RT–PCR with an oligo(dT) primer.
The resultant PCR products were successfully cloned into
M13mp18 by using BamHI linkers and the nucleotide sequence
of the terminal 85 nucleotides was obtained by sequence
analysis of single-stranded M13 DNA. The accuracy of this
sequence was confirmed by sequencing ten separate clones
generated from two independent PCRs. The sequence obtained
(GenBank accession no. AF161266) was further subjected to
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 10:55:57
Infectious cDNA clone of MVE virus
Table 1. Differences between the published sequence of MVE-1-51 and that of the
infectious cDNA clone pMVE-1-51
The published nucleotide and amino acid sequences were obtained from Dalgarno et al. (1986) and Lee et al.
(1990). Nucleotide and amino acid differences are indicated in the form MVE-1-51 clone.
Difference
Genome region
E
NS3
NS4A
NS5
3h UTR
Nucleotide
1196
1943*
4964
5718
5728
5993
6196
6655
6791
6955
6969
7919
8678
9062
9532
10344
10518†
10663
10665‡
Nucleotide
T
T
C
C
C
T
A
T
C
C
T
C
G
C
G
A
AC
G
C
A
T
A
G
C
G
C
T
T
C
T
A
T
A
G
CA
T
G
Amino acid
None
None
None
Leu Ile
Ser Cys
None
His Arg
Val Ala
None
Pro Leu
None
None
None
None
Ser Asn
Met Val
–
–
–
Corresponding residue in
related flaviviruses
–
–
–
Ile (JE, WNV, KUN)
Cys (JE, WNV, KUN)
–
Arg (JE, KUN, YF, DEN-2)
Val (JE, WNV, KUN)
–
Leu (WNV, KUN)
–
–
–
–
Asn (JE, KUN, WNV, YF, DEN-2)
Met (JE, WNV, YF, KUN)
–
–
–
* Abolished XbaI site in pMVE-1-51.
† Dinucleotide inversion.
‡ Single nucleotide insertion in pMVE-1-51.
secondary RNA structure analyses by using the genetic
algorithms implemented in the MFOLD and SQUIGGLES
software programs (for reference see Zuker, 1989). The optimal
secondary structure for the 3h-terminal 100 nucleotides of
MVE virus is depicted in Fig. 1 (c). As expected, the double
stem–loop structure predicted for MVE virus was similar to
that predicted for flaviviruses in general (Brinton et al.,
1986 ; Proutski et al., 1997). Furthermore, the derived sequence
had conserved elements that have been shown to be important
in the formation of putative pseudoknot structures in a range
of different flaviviruses such as JE, West Nile virus (WNV) and
YF (Shi et al., 1996).
Construction and sequencing of the full-length MVE
virus cDNA clone
The full-length MVE-1-51 clone was assembled by using
cDNA derived from an existing cDNA library (Dalgarno et al.,
1986). The genome was cloned in two halves into the lowcopy-number vector pBR322 ; the first half containing nt
1–5407 and the second half containing nt 5408–11 014 (see
Fig. 1 a). The two halves were subsequently joined at a unique
ClaI site (nt 5407) to form full-length cDNA, which was then
inserted into the plasmid pMC18. This plasmid was designated
pMVE-1-51.
The plasmid vector pMC18 was chosen because of its low
copy number (approximately six per cell ; Birnboim, 1983) and
because full-length cDNA could not be cloned into the vector
pBR322 (copy number greater than 25 per cell ; Holmes &
Quigley, 1981), a problem encountered during the construction
of clones of other flaviviruses such as YF (Rice et al., 1989), JE
(Sumiyoshi et al., 1992) and DEN-2 (Kapoor et al., 1995).
The sequences at both termini are depicted in Fig. 1 (b). A
T7 RNA polymerase promoter was positioned immediately
upstream of the 5h terminus and an additional G residue was
included to improve transcription efficiency (Milligan et al.,
1987). An XbaI site was incorporated to form part of the 3h
terminus and was utilized to generate RNA transcripts with
authentic 3h termini (plus four non-viral nucleotides ; see Fig.
1 b).
The nucleotide sequence of pMVE-1-51 was analysed by
complete sequence analysis and compared to both the
published sequence of MVE-1-51 (GenBank accession no.
M24220 ; Dalgarno et al., 1986 ; Lee et al., 1990) and the
sequence of the 3h terminus derived in this laboratory. The
differences between the two sequences are shown in Table 1.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 10:55:57
DBBJ
R. J. Hurrelbrink, A. Nestorowicz and P. C. McMinn
51 was visible at 3–4 days p.i. The specific infectivity of the
RNA was estimated to be between 10& and 10' p.f.u.\µg based
on the assumption that, at most, only two-thirds of the
transfected RNA was capped due to the proportion of cap
analogue in the reaction (as described above). A high-titre
stock of this virus, designated CDV-1-51, was generated by
passage on C6\36 cells and used for subsequent virulence
studies.
Confirming the presence of clone-derived virus
(CDV-1-51)
Fig. 2. Results of RT–PCR and restriction enzyme analysis of viral cDNA.
A 1n6 kb RT–PCR product was obtained from RNA extracted from mice
infected with CDV-1-51 (lane 2) or MVE-1-51 (lane 3). cDNA was then
digested with XbaI and electrophoresed on a 1n0 % agarose gel. Upon
digestion with XbaI, which cuts at nt 1943, MVE-1-51 cDNA was cleaved
into 1n0 and 0n6 kb fragments. Primer sequences used for RT–PCR
were ; forward primer (nt 947) 5h GCTCCCCGTTGCTCCTGC 3h, reverse
primer (nt 2540) 5h GTGTATGAATATTCCGCTGCC 3h. The sizes of the
DNA markers (Promega) in lane 1 are given on the left-hand side in bp.
Nineteen differences were found and confirmed by secondround sequencing. Seven of these differences led to amino acid
changes and three were located in the 3h UTR. None of the
seven amino acid changes altered the charge or polarity of the
encoded amino acid significantly. Furthermore, the three
changes in the 3h UTR were located well upstream of known
flavivirus consensus sequences and predicted stem–loop structures (Hahn et al., 1987 ; Lee et al., 1990 ; Shi et al., 1996).
The stability of pMVE-1-51 after propagation in E. coli was
confirmed by comparing restriction enzyme profiles of the
plasmid over three separate passages in E. coli strain DH5α. In
each case, the restriction profile remained the same. Furthermore, RNA transcribed from pMVE-1-51 of different
passages and transfected into BHK-21 cells generated CPE
with equal efficiency.
In vitro synthesis of infectious RNA and recovery of
recombinant virus
Capped RNA transcripts were transcribed from linearized
pMVE-1-51 (XbaI digested) by using T7 RNA polymerase
and an optimized 2 : 1 ratio of methylated cap analogue
[m(G(5h)ppp(5h)GTP] to dGTP. Increasing the proportion of
cap analogue in the reaction above this level resulted in a
substantial decrease in the yield of RNA. Transcribed RNA
was then precipitated in the presence of 2n5 M LiCl and
washed with 70 % ethanol prior to resuspension in nucleasefree water. An aliquot was electrophoresed on a 1 % denaturing
formaldehyde–agarose gel to check for efficient transcription
of full-length product and to estimate RNA concentration (data
not shown). Approximately 1n5 µg full-length RNA was
subsequently transfected into BHK-21 cells by electroporation.
CPE indistinguishable from that of the parental virus MVE-1DBCA
During virulence studies (outlined below), the presence of
CDV-1-51 was confirmed by extracting viral RNA from the
brains of encephalitic mice and performing a RT–PCR\restriction enzyme analysis. Approximately 1n6 kb of the viral
genome (spanning the abolished XbaI restriction enzyme site
at nt 1943) was amplified and digested with XbaI. The results
are shown in Fig. 2. When digested with this enzyme, MVE-151-derived cDNA (lane 3) is cleaved into two fragments,
approximately 1n0 kb and 0n6 kb in length. CDV-1-51-derived
cDNA (lane 2), however, is not cleaved due to the abolition of
the XbaI site during construction of the full-length clone, as
described in Methods.
Biological characterization of CDV-1-51
In order to confirm the antigenicity of CDV-1-51, monolayers of C6\36 cells were infected at an m.o.i. of 10 and
compared to cells infected with MVE-1-51. All cells were
found to show immunofluorescence at 60 h p.i. by using antiMVE virus hyperimmune ascites fluid (see Fig. 3). The antigenic
profile of CDV-1-51 was examined further by infecting Vero
cells with the virus and labelling viral proteins 24 h later with
tritiated amino acids. Cytoplasmic lysates and tissue culture
supernatants were collected at 48 h p.i. and immunoprecipitated in the presence of anti-MVE virus hyperimmune ascites
fluid. Immunoprecipitates were analysed by SDS–PAGE and
compared to those obtained for positive and negative controls.
As shown in Fig. 4, a range of MVE virus-specific proteins was
visible in both the cell lysates and cell culture supernatants of
MVE-1-51- and CDV-1-51-infected cells. At least five viral
proteins, including the E protein (" 57 kDa), NS1 (" 49 kDa)
and prM (" 26 kDa), were identified in cell lysates on the basis
of their size (Lee et al., 1990), and the electrophoretic mobility
of these proteins was identical for the two viruses. Two other
virus-specific proteins (" 42 and 15 kDa) were also identified ;
however, their identities are unknown. Mature E (and possibly
NS1) proteins were also detected in the cell culture supernatants of both viruses. The antigenic profiles of MVE-1-51
and CDV-1-51 (intra- and extracellular virus) were therefore
said to be identical.
In addition to the above observations, the plaque size and
morphology of CDV-1-51 were compared to those of MVE-151 by standard plaque assay on Vero cells. The viruses
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 10:55:57
Infectious cDNA clone of MVE virus
Fig. 3. Results of immunofluorescence assays. C6/36 cells were infected at an m.o.i. of 10 and assayed for
immunofluorescence at 60 h p.i. (a) Positive control (MVE-1-51) ; (b) negative control ; (c) CDV-1-51.
Fig. 4. Antigenic profiles of MVE-1-51 and CDV-1-51. Virus-infected Vero cells (and uninfected controls) were labelled with
tritiated amino acids and immunoprecipitated in the presence of either hyperimmune (HIAF) or pre-immune (NIAF) ascites fluid.
Lane 1 : CDV-1-51-infected cell lysate immunoprecipitated with HIAF ; 2, CDV-1-51-infected cell lysate immunoprecipitated
with NIAF ; 3, CDV-1-51-infected cell culture supernatant immunoprecipitated with HIAF ; 4, CDV-1-51-infected cell culture
supernatant immunoprecipitated with NIAF. Lanes 5–8 are identical to lanes 1–4 except that MVE-1-51 was used in place of
CDV-1-51. Lanes 9–12 are negative controls ; uninfected cell lysates (lanes 9–10) and cell culture supernatants (lanes 11–12)
immunoprecipitated with HIAF (lanes 9 and 11) or NIAF (lanes 10 and 12). Proteins E, NS1 and prM are indicated by arrows
and the relative positions of molecular mass markers are given in kDa.
generated indistinguishable plaque phenotypes at 3–4 days
p.i., with mean plaque diameters of approximately 2n2 mm (Fig.
5). Furthermore, single-step growth curves of MVE-1-51 and
CDV-1-51 in Vero cells (Fig. 6) showed that the replication
kinetics of the two viruses were very similar.
Pathogenicity of CDV-1-51
The virulence of MVE-1-51 and CDV-1-51 were compared
in the mouse model by injecting litters of ten 21-day-old mice
i.p. or i.c. with tenfold dilutions of virus. Mice were observed
daily for signs of encephalitis. The HD values by the i.p.
&!
route for MVE-1-51 and CDV-1-51 were 4 and 8 p.f.u.,
respectively, whilst by the i.c. route they were 1 and 9 p.f.u.,
respectively. The HD values were thus very similar for the
&!
two viruses by either route of administration.
In order to characterize the virulence of CDV-1-51 further,
a mortality profile was determined by injecting groups of ten
mice i.p. or i.c. with 1000 p.f.u. MVE-1-51 or CDV-1-51. Mean
time to death (humane end-point) was calculated for each
group. The differences in the profiles for each group (Fig.
7 a) were not statistically significant by Student’s t-test,
indicating that the neuroinvasiveness and neurovirulence
profiles of CDV-1-51 were similar to those of MVE-1-51.
Finally, to determine whether the central nervous system
growth kinetics of MVE-1-51 and CDV-1-51 were the same,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 10:55:57
DBCB
R. J. Hurrelbrink, A. Nestorowicz and P. C. McMinn
Fig. 5. Plaque morphology of MVE-1-51 (a) and CDV-1-51 (b). The
plaque morphologies of the viruses were identical at 3–4 days p.i.
Fig. 7. Mortality profiles and growth kinetics for MVE-1-51 (, ) and
CDV-1-51 (#, $) after infection by the i.p. (
, $) and i.c. (, #)
routes. (a) Mortality profiles. Note that the profiles for the two viruses
were identical by the i.c. route (mean time to death 4n0p0n5 days).
Differences between the profiles by the i.p. route were not statistically
significant by Student’s t-test (mean time to death : MVE-1-51, 5n8p0n6
days ; CDV-1-51, 6n3p0n9 days). (b) Growth kinetics in the brain
following i.c. inoculation of 21-day-old mice. Mice were inoculated with
1000 p.f.u. virus and were anaesthetized and the brains removed at the
times indicated. The infectivity of 10 % brain homogenates was titrated by
plaque assay on Vero cells. Titres are means from three individual mouse
brains, which varied by less than fivefold.
and were therefore said to be identical (Fig. 7 b). 100 %
mortality was evident in both groups by day 6 p.i.
Discussion
Fig. 6. Growth kinetics of MVE–1-51 and CDV-1-51 in Vero cells. Cell
monolayers were infected at an m.o.i. of 2 and incubated at 37 mC in 5 %
CO2. Aliquots of supernatant were sampled at the time-points indicated
and subsequently titrated by plaque assay on Vero cells. Growth curves for
each virus (
, MVE-1-51 ; $, CDV-1-51) were performed in duplicate.
groups of twenty 21-day-old mice were injected i.c. with 1000
p.f.u. of each virus. Three brains from each group were
collected each day and assayed separately by plaque assay on
Vero cells. The titres of the two viruses were found to be
comparable throughout the course of the infection (days 2–5)
DBCC
A stable full-length clone of MVE virus prototype strain 151 was constructed. Viral RNA transcribed from the clone
gave rise to infectious virus and, in all respects, this virus
(CDV-1-51) had an almost identical phenotype to wild-type
virus. The specific infectivity of clone-derived RNA, estimated
to be between 10& and 10' p.f.u.\µg, was similar to that
described for other flavivirus clones such as YF and TBE (Rice
et al., 1989 ; Mandl et al., 1997). The presence of an introduced
mutation in the clone was confirmed by RT–PCR and
restriction enzyme analysis of viral cDNA derived from the
brains of encephalitic mice, showing that the virus was indeed
clone derived.
Construction of the clone was made possible by determining the 3h-terminal sequence of the virus. In combination
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 10:55:57
Infectious cDNA clone of MVE virus
with the work of others, the full genomic sequence of MVE
virus is now known (Dalgarno et al., 1986 ; Lee et al., 1990). It
is our belief that the cDNA sequence of CDV-1-51 (reported in
this paper) is more accurate than that reported by Lee et al.
(1990), due only to the improved accuracy of automated
sequencing over the older Maxam and Gilbert method used in
their study (Maxam & Gilbert, 1980). This is supported by the
fact that five of the seven predicted amino acid changes in
CDV-1-51 appear to resemble more closely the sequences of
related flaviviruses than do those reported in the original
published sequence. For example, the serine residue encoded
by nt 9531–9533 of the original published sequence is an
asparagine residue in JE virus, KUN, YF virus, DEN-2 and
WNV (Lee et al., 1990) and is also an asparagine in CDV-1-51.
The presence of cloning artifacts, introduced during the
construction of the full-length clone, cannot be excluded,
however, even though their presence appears to have little
effect if any on the phenotype of the virus.
Molecular modelling of the 3h-terminal sequence of MVE
virus suggests that it forms a stem–loop structure similar to
that found in other flaviviruses. Furthermore, it appears that
the conserved elements for the putative pseudoknot structure,
involving a tertiary interaction between the loop of the smaller
3h stem–loop and the stem of the larger 5h stem–loop, are also
conserved (Shi et al., 1996). This supports the hypothesis that
a conserved secondary structure at the extreme 3h terminus of
viral RNA is important for the replication, transcription and\or
translation of the flavivirus genome (Blackwell & Brinton,
1997 ; Zeng et al., 1998).
This is the first report of an infectious clone of MVE virus.
It is likely that we were able to clone full-length cDNA into a
low-copy-number plasmid vector as a result of our increased
understanding of the difficulties involved in such cloning. In
the past, the construction of flavivirus clones has been
hampered by the instability of full-length cDNA in a bacterial
host. This was probably due to the choice or combination of
vector and host strain, a hypothesis used to explain difficulties
encountered during the construction of clones of other
flaviviruses such as YF and JE (Rice et al., 1989 ; Sumiyoshi et al.,
1992). As a result, other groups opted for an in vitro ligation
approach, where full-length cDNA was excised from two halfclones and ligated in vitro as a template for transcription. It is
our belief that the choice of the low-copy-number vector
pMC18, which has a copy number of approximately six per
cell, was essential to our success in obtaining a full-length clone
of MVE virus. In addition, the use of the E. coli DH5α host
strain, which has the deoR genotype engineered to allow the
uptake of large plasmids, may also have contributed to our
success.
Attempts to clone full-length cDNA into the plasmid
vector pBR322, which has a copy number of more than 25 per
cell, were unsuccessful. In the hands of others, however, this
vector has been used successfully in the construction of fulllength clones (Khromykh & Westaway, 1994 ; Kapoor et al.,
1995 ; Mandl et al., 1997). It is possible that the use of pBR322
represents the extreme limit of bacterial tolerance of full-length
flaviviral cDNA. The use of higher-copy-number vectors such
as pGEM may pose serious toxicity problems for the host,
resulting in cell death or genomic instability. This may or may
not be the result of the expression of flaviviral proteins in the
bacterial host, a deleterious effect that would be minimized by
the use of a lower-copy-number vector such as pMC18. In any
event, the early difficulties faced during the construction of
full-length flavivirus clones appear now to have been largely
circumvented, making the generation of clone-derived RNA a
much simpler process.
It is envisaged that the infectious cDNA clone of MVE
virus will serve as a useful tool for elucidating the molecular
determinants of virulence in flaviviruses. The mouse model of
MVE virus infection is well established and is arguably one of
the best working models for the encephalitic flaviviruses. The
availability of such a model will allow the use of the infectious
clone in the identification of molecular determinants of both
neuroinvasiveness and neurovirulence. In particular, the clone
is currently being used to confirm that a Ser Ile change at
position 277 in the envelope protein is responsible for the low
neuroinvasiveness of the BHv1 strain. This change also inhibits
the ability of the virus to haemagglutinate across the pH range
5n5–7n5 (McMinn et al., 1995 a). In separate experiments, the
clone will also be used to examine more rigorously a mutation
in the putative receptor-binding site (amino acid position 390
of the envelope protein) of a different strain of MVE virus. This
mutation alters an RGD motif thought to be important in the
interaction of the virus with host-cell integrins (Lobigs et al.,
1990 ; Chen et al., 1997).
To date, no neurovirulence determinants have been
identified for MVE virus. However, McMinn et al. (1995 b)
identified a strain of the virus that appears to have one or more
changes in the non-structural genes and\or 3h UTR of the
genome. These changes appear to affect neuron-specific
replication. The virus (C P ) is only seven passages removed
% *
from the prototype strain 1-51 and is therefore unlikely to
contain more than a few mutations. The mutation(s) is of
interest because it seriously inhibits the ability of the virus to
replicate in vivo in the brains of 21-day-old mice and in vitro in
mouse neuroblastoma cells (McMinn et al., 1995 b). By
constructing intratypic chimeras with the infectious cDNA
clone, it may be possible to identify the precise location of this
mutation(s) and confirm its role in the attenuation of neurovirulence. Such findings may have implications for future
flavivirus vaccine design and could be used in combination
with other molecular determinants of virulence to re-engineer
current live-attenuated vaccines, reducing the risk of their
reversion to wild-type. Recent work, involving the construction of a chimeric clone containing the prM and E genes
of JE virus strain SA -14-2 within the backbone of a YF virus
"%
17D infectious clone (Chambers et al., 1999), has shown that
mice inoculated subcutaneously with 10$ p.f.u. of chimeric
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 10:55:57
DBCD
R. J. Hurrelbrink, A. Nestorowicz and P. C. McMinn
virus (ChimeriVax-JE) are solidly protected against i.p. challenge with a virulent strain of JE virus (Guirakhoo et al., 1999),
as are rhesus monkeys immunized with a similar dose (Monath
et al., 1999). Such studies provide good evidence that infectious
clone technology can be applied successfully to the design and
construction of safe and efficacious vaccines.
Sincere thanks to Dr Lee Sammels, Ms Angela Carrello and Mr Dan
Andrews for technical assistance and to Dr A. Davidson for the kind gift
of the low-copy-number plasmid vector pMC18. This investigation was
supported by grants from the Raine Foundation of the University of
Western Australia and the National Health and Medical Research Council
of Australia. R. J. H. is supported by Baillieu and Jean Rogerson
Postgraduate Research Scholarships from the University of Western
Australia.
preparation of bacterial plasmids. Analytical Biochemistry 114, 193–197.
Kapoor, M., Zhang, L., Mohan, P. M. & Padmanabhan, R. (1995).
Synthesis and characterization of an infectious dengue virus type-2 RNA
genome (New Guinea C strain). Gene 162, 175–180.
Khromykh, A. A. & Westaway, E. G. (1994). Completion of Kunjin virus
RNA sequence and recovery of an infectious RNA transcribed from
stably cloned full-length cDNA. Journal of Virology 68, 4580–4588.
Kinney, R. M., Butrapet, S., Chang, G. J., Tsuchiya, K. R., Roehrig, J. T.,
Bhamarapravati, N. & Gubler, D. J. (1997). Construction of infectious
cDNA clones for dengue 2 virus : strain 16681 and its attenuated vaccine
derivative, strain PDK-53. Virology 230, 300–308.
Lai, C. J., Zhao, B. T., Hori, H. & Bray, M. (1991). Infectious RNA
transcribed from stably cloned full-length cDNA of dengue type 4 virus.
Proceedings of the National Academy of Sciences, USA 88, 5139–5143.
Lee, E., Fernon, C., Simpson, R., Weir, R. C., Rice, C. M. & Dalgarno, L.
(1990). Sequence of the 3h half of the Murray Valley encephalitis virus
References
Berge, T. O. (1975). In International Catalogue of Arboviruses Including
Certain Other Viruses of Vertebrates, 2nd edn, pp. 504–505. Bethesda, MD :
Department of Health, Education and Welfare.
Birnboim, H. C. (1983). A rapid alkaline extraction method for the
isolation of plasmid DNA. Methods in Enzymology 100, 243–255.
Blackwell, J. L. & Brinton, M. A. (1997). Translation elongation factor1 alpha interacts with the 3h stem–loop region of West Nile virus
genomic RNA. Journal of Virology 71, 6433–6444.
Brinton, M. A., Fernandez, A. V. & Dispoto, J. H. (1986). The 3hnucleotides of flavivirus genomic RNA form a conserved secondary
structure. Virology 153, 113–121.
Chambers, T. J., Hahn, C. S., Galler, R. & Rice, C. M. (1990). Flavivirus
genome organization, expression, and replication. Annual Review of
Microbiology 44, 649–688.
Chambers, T. J., Nestorowicz, A., Mason, P. W. & Rice, C. M. (1999).
Yellow fever\Japanese encephalitis chimeric viruses : construction and
biological properties. Journal of Virology 73, 3095–3101.
Chen, Y. P., Maguire, T., Hileman, R. E., Fromm, J. R., Esko, J. D.,
Linhardt, R. J. & Marks, R. M. (1997). Dengue virus infectivity depends
on envelope protein binding to target cell heparan sulfate. Nature
Medicine 3, 866–871.
Dalgarno, L., Trent, D. W., Strauss, J. H. & Rice, C. M. (1986). Partial
nucleotide sequence of the Murray Valley encephalitis virus genome.
Comparison of the encoded polypeptides with yellow fever virus
structural and non-structural proteins. Journal of Molecular Biology 187,
309–323.
French, E. (1952). Murray Valley encephalitis : isolation and characterisation of the aetiological agent. Medical Journal of Australia 1,
100–103.
Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J. & Davidson,
A. D. (1998). Identification of a major determinant of mouse neuro-
virulence of dengue virus type 2 using stably cloned genomic-length
cDNA. Journal of General Virology 79, 437–446.
Guirakhoo, F., Zhang, Z. X., Chambers, T. J., Delagrave, S., Arroyo, J.,
Barrett, A. D. T. & Monath, T. P. (1999). Immunogenicity, genetic
stability, and protective efficacy of a recombinant, chimeric yellow feverJapanese encephalitis virus (ChimeriVax-JE) as a live, attenuated vaccine
candidate against Japanese encephalitis. Virology 257, 363–372.
Hahn, C. S., Hahn, Y. S., Rice, C. M., Lee, E., Dalgarno, L., Strauss,
E. G. & Strauss, J. H. (1987). Conserved elements in the 3h untranslated
region of flavivirus RNAs and potential cyclization sequences. Journal of
Molecular Biology 198, 33–41.
DBCE
Holmes, D. S. & Quigley, M. (1981). A rapid boiling method for the
genome and mapping of the nonstructural proteins NS1, NS3, and NS5.
Virus Genes 4, 197–213.
Lobigs, M., Usha, R., Nestorowicz, A., Marshall, I. D., Weir, R. C. &
Dalgarno, L. (1990). Host cell selection of Murray Valley encephalitis
virus variants altered at an RGD sequence in the envelope protein and in
mouse virulence. Virology 176, 587–595.
McMinn, P. C., Lee, E., Hartley, S., Roehrig, J. T., Dalgarno, L. & Weir,
R. C. (1995 a). Murray valley encephalitis virus envelope protein
antigenic variants with altered hemagglutination properties and reduced
neuroinvasiveness in mice. Virology 211, 10–20.
McMinn, P. C., Marshall, I. D. & Dalgarno, L. (1995 b). Neurovirulence
and neuroinvasiveness of Murray Valley encephalitis virus mutants
selected by passage in a monkey kidney cell line. Journal of General
Virology 76, 865–872.
Mandl, C. W., Ecker, M., Holzmann, H., Kunz, C. & Heinz, F. X. (1997).
Infectious cDNA clones of tick-borne encephalitis virus European subtype
prototypic strain Neudoerfl and high virulence strain Hypr. Journal of
General Virology 78, 1049–1057.
Marshall, I. (1988). Murray Valley and Kunjin encephalitis. In The
Arboviruses : Epidemiology and Ecology, pp. 152–186. Edited by T. Monath.
Boca Raton, FL : CRC Press.
Maxam, A. M. & Gilbert, W. (1980). Sequencing end-labeled DNA with
base-specific chemical cleavages. Methods in Enzymology 65, 499–560.
Milligan, J. F., Groebe, D. R., Witherell, G. W. & Uhlenbeck, O. C.
(1987). Oligoribonucleotide synthesis using T7 RNA polymerase and
synthetic DNA templates. Nucleic Acids Research 15, 8783–8798.
Monath, T. P. & Heinz, F. X. (1996). Flaviviruses. In Fields Virology, 3rd
edn, pp. 961–1034. Edited by B. N. Fields, D. M. Knipe & P. M. Howley.
Philadelphia : Lippincott–Raven.
Monath, T. P., Soike, K., Levenbook, I., Zhang, Z. X., Arroyo, J.,
Delagrave, S., Myers, G., Barrett, A. D. T., Shope, R. E., Ratterree, M.,
Chambers, T. J. & Guirakhoo, F. (1999). Recombinant, chimaeric live,
attenuated vaccine (ChimeriVax) incorporating the envelope genes of
Japanese encephalitis (SA14-14-2) virus and the capsid and nonstructural
genes of yellow fever (17D) virus is safe, immunogenic and protective in
non-human primates. Vaccine 17, 1869–1882.
Polo, S., Ketner, G., Levis, R. & Falgout, B. (1997). Infectious RNA
transcripts from full-length dengue virus type 2 cDNA clones made in
yeast. Journal of Virology 71, 5366–5374.
Proutski, V., Gould, E. A. & Holmes, E. C. (1997). Secondary structure
of the 3h untranslated region of flaviviruses : similarities and differences.
Nucleic Acids Research 25, 1194–1202.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 10:55:57
Infectious cDNA clone of MVE virus
Reed, L. J. & Muench, H. (1938). A simple method of estimating fifty
percent endpoints. American Journal of Hygiene 27, 493–497.
Rice, C. M. (1996). Flaviviridae : the viruses and their replication. In Fields
Virology, 3rd edn, pp. 931–959. Edited by B. N. Fields, D. M. Knipe & P.
M. Howley. Philadelphia : Lippincott–Raven.
Rice, C. M., Grakoui, A., Galler, R. & Chambers, T. J. (1989).
Transcription of infectious yellow fever RNA from full-length cDNA
templates produced by in vitro ligation. New Biologist 1, 285–296.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning : A
Laboratory Manual, 2nd edn. Cold Spring Harbor, NY : Cold Spring
Harbor Laboratory.
Sumiyoshi, H., Hoke, C. H. & Trent, D. W. (1992). Infectious Japanese
encephalitis virus RNA can be synthesized from in vitro-ligated cDNA
templates. Journal of Virology 66, 5425–5431.
Wright, A. J. & Phillpotts, R. J. (1998). Humane endpoints are an
objective measure of morbidity in Venezuelan encephalomyelitis virus
infection of mice. Archives of Virology 143, 1155–1162.
Zeng, L., Falgout, B. & Markoff, L. (1998). Identification of specific
nucleotide sequences within the conserved 3h-SL in the dengue type 2
virus genome required for replication. Journal of Virology 72, 7510–7522.
Zuker, M. (1989). On finding all suboptimal foldings of an RNA
molecule. Science 244, 48–52.
Shi, P. Y., Brinton, M. A., Veal, J. M., Zhong, Y. Y. & Wilson, W. D.
(1996). Evidence for the existence of a pseudoknot structure at the 3h
terminus of the flavivirus genomic RNA. Biochemistry 35, 4222–4230.
Received 15 April 1999 ; Accepted 2 August 1999
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 10:55:57
DBCF