Download The effects of genistein on TGF-β1

The effects of genistein on TGF-β1-induced the invasion
and metastasis in human pancreatic cancer cell line
Panc-1 in vitro
Lei HAN
a, b
,Hong-wei ZHANGc, Wen-ping ZHOUb, Guang-ming CHENb and Ke-jian
GUOa,*
a
Department of General surgery, College of Clinical Medical Sciences, China Medical University, No.
92 Beier Road, Heping District, Shenyang 110004, China
b
Department of Hepatobiliary & Pancreas surgery, The General Hospital of Shenyang Military
Region, No. 83 Wenhua Road, Shenhe District, Shenyang 110016, China
c Department of General surgery, The Tianjin Dongli Hospital, 300000, China
*Corresponding author: Telephone: +86 24 83283330. E-mail address: [email protected] (Kejian
Guo). Mailing address: Department of General surgery, College of Clinical Medical Sciences, China
Medical University, No. 92 Beier Road, Heping District, Shenyang 110004, China
Keywords: Genistein; TGF-β1-induced; Invasion; Metastasis; pancreatic cancer
Background Pancreatic cancer is a devastating disease with the worst mortality rate.
Therefore, a rational strategy for future drug development is critical. Genistein is a small,
biologically active flavonoid that is found in high amounts in soy. This important
compound possesses a wide variety of biological activities, but it is best known for its
ability to inhibit cancer progression.
Methods In the current study, we found that genistein can inhibit effectively
TGF-β1-induced the invasion and metastasis in Panc-1 by Transwell assay,
which is
through regulating the mRNA and protein expression of uPA and MMP2, but not MMP9
by RT-PCR / Weston blot, and is positively correlated with the concentration of genistein.
At the same time, genistein also could improve the progress of Epithelial-Mesenchymal
Transition (EMT) via morphology observation using light microscope / TEM, which is
mediated by the down-regulation of E-cadherin and the up-regulation of vimentin.
Conclusions TGF-β1 mediates EMT process via numerous intracellular signal
transduction pathways. The potential molecular mechanisms are all or partly through
Smad4-dependent and -independent pathways (p38 MAPK) to regulate the antitumor
effect of genistein.
Pancreatic cancer is a devastating disease with the worst mortality rate. The 5-year
survival of patients with pancreatic cancer is <5% without significant improvement over
the past three decades. Although accounting for only 3% of all cancers, this disease is the
fourth leading cause of death and represents 6% of all cancer related deaths in the United
States [1]. Some sporadic reports have shown that the mortality rates of pancreatic cancer
in China have increased constantly over the last decades
[2]
. Consequently, major
improvement in the outlook of this disease will depend on the development of more
effective drug therapies. Therefore, a rational strategy for future drug development is to
specifically target the critical cellular pathways regulating proliferation, survival, and
invasion.
TGF-β plays an important role in the control of cell proliferation and in carcinogenesis.
Relative research demonstrated that TGF-β1 plays a dual role in mouse skin
carcinogenesis, as well as in other human and murine cancer models [3-7]. TGF-β1 acts as
a cell growth inhibitor in non-transformed epithelial cells, but at later stages of
carcinogenesis it induces an epithelial–mesenchymal transition in vitro and the transition
from squamous to spindle cell carcinoma associated with increased invasion and
metastasis in vivo. In addition, the TGF-β-SMAD signaling cascade is considered to
mediate growth suppression in most epithelial cells, and disruption of this pathway is one
mode how pancreatic cancer cells escape TGF-β-induced growth suppression. However,
TGF-β can also induce cellular proliferation, particularly with disruption of SMAD
signaling, suggesting that other TGF-β-mediated pathways may be operative or exposed
with loss of intact SMAD signaling [8].
Genistein is a naturally occurring isoflavone present in soybeans [8]. The soy isoflavone
genistein reportedly inhibit pancreatic carcinoma cell growth, induce apoptosis, and
chemosensitize those cells by the inhibition of PI3K leading to inhibition of Akt and
NF-κB
[10-14]
. In addition, relative research has reported that it regulates molecules that
play key roles in tumor cell invasion and metastasis, in the cell cycle, and in apoptosis.
[15]
. However, in vivo studies showing the potentiation of TGF-β-induced antitumor
activity by genistein have not been reported profusely. In this study, we used a mode of
the invasion of human pancreatic cancer cell line Panc-1 induced by TGF-β1 and
genistein against it, in order to study the effects of genistein antitumor and it’s
mechanism in vitro, we estimate on the facts of genistein inhibiting the invasion and
migration of Panc-1 cell, Epithelial-Mesenchymal Transition (EMT) and signaling
pathway. This relative research will help not only to understand the regulation of invasion
of pancreatic cancer, but also to elucidate the molecular mechanism of drug antitumor.
MATERIALS AND METHODS
Cell Culture, Drug and Reagents
The Panc-1 human pancreatic cell line (American Type Culture Collection, Manassas,
VA) was maintained in DMEM medium containing 10% fetal bovine serum, 100
units/mL penicillin, and 100 mg/mL streptomycin. Cells were incubated in a humidified,
5% CO2 atmosphere at 37°C. Genistein (Toronto Research Chemicals, North York,
Ontario, Canada) was dissolved in 0.1 M Na2CO3 to make a 10-mM stock solution. Cell
culture medium was purchased from Invitrogen (Carlsbad, CA).
Experimental Group
This experiment was divided into 5 experimental groups: ①Control group: Panc-1 cell
(NO any treatment factors, adding the same volume PBS) ; ②TGF-β1 Stimulation group:
TGF-β1 (5ng/ml) induced the Panc-1 cells; ③ Treatment group 1: after TGF-β1 (5ng/ml)
induced the Panc-1 cells 30 minutes, adding the Genistein (1μmol/L); ④ Treatment
group 2: after TGF-β1 (5ng/ml) induced the Panc-1 cells 30 minutes, adding the
Genistein (25μmol/L); ⑤ Treatment group 3: after TGF-β1 (5ng/ml) induced the Panc-1
cells 30 minutes, adding the Genistein (50μmol/L).
Transwell assay
The transwell chamber (Corning) containing an 8-μm pore size polycarbonate membrane
filter was coated with a matrigel (Sigma, USA) and inserted in a 24-well culture plate.
Cells collected of different experimental group were adjusted to a density of 2×105
cells/L with serum-free DMEM high glucose culture medium. The cell suspension of 200
μL was added into the upper transwell chamber and 400 μL Chemokine (MRC-5 cells 48
hours serum-free conditioned medium) was added into the lower transwell chamber.
After recultured with 5% CO2 at 37°C for 24 h, the cells in upper chambers should be
removed. The transwell chambers were inverted and stained with hematoxylin and eosin.
Five fields were randomly selected and the number of trans-membrane cells was counted.
Compared with the invasion assay, migration experiment wasn’t coated with a matrigel
on polycarbonate membrane filter, other steps is the same as it.
Reverse transcription polymerase chain reaction (RT-PCR)
Total RNA was extracted from different experimental group cells (different treated
factors, cultured 24h) using TRIZOL reagent (Invitrogen, CA) as per standard protocol.
RNA (1 μg) was used as a template for reverse transcription reaction (Takara, Japan),
followed by PCR analysis using specific primers for MMP-2, MMP-9, uPA and β-actin.
The primers of MMP-2, MMP-9, uPA and β-actin were as follows: forward primer 5'
GGATGATGC -CTTTGCTCG 3', reverse primer 5' CAGTGGACATGGCGGTCT 3' ;
forward primer 5'CAGCTGTATTTGTTCAAGGATGG 3’, reverse primer 5' CTTGTCC
AGACGCCTCGG 3’; forward primer 5' CACGCTTGCTCACCACA 3', reverse primer
5' CTTCAGGGCACATCCAC 3' and forward primer 5’ATCATGTTTGAGACCTTCAA
CA 3’, reverse primer 5’CATCTCTTGCTCGAAGTCCA3’. The amplified products were
analyzed on an agarose gel.
Protein extraction and Western immunoblotting
Cells were lysed, and protein was extracted. Briefly, cells were lysed in buffer containing
50 mM Tris, pH 7.4, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 5 mM EDTA, 1
mM sodium vanadate, 1 mM -glycerophosphate, 1 mM sodium fluoride, 2μg/ml
leupeptin, 10μg/ml aprotinin, and 1 mM phenylmethylsulfonyl fluoride (PMSF). Lysates
were collected and centrifuged at 4°C at 14,000 rpm for 10 min to pellet cell debris.
Supernatant (50μg) was separated on SDS-PAGE, and Western blotting was performed.
Antibodies used included monoclonal uPA, monoclonal E-cadherin, monoclonal P38,
monoclonal P-P38 and monoclonal ERK1/2 (Abs were purchased from Cell sciences,
USA).
MMP Activity
The Panc-1 human pancreatic cell line (1.2×106) suspensions were seeded into 6-well
plates in DMEM supplemented with 10% FBS. After 24 h, cells were incubated in
serum-free DMEM for 24 h. The supernatants were collected after centrifugation and the
cells were trypsinized and counted. An assay to measure MMP activity was performed
using Gelatin Zymography according to Iwai’s report
[16]
. Briefly, a volume of 20 μl of
medium was loaded under non-denaturing conditions into a zymogram gel supplemented
with 0.1% gelatin to detect the presence of MMP-2 and -9. Electrophoresis was
performed at a constant voltage of 120 V for 90 min. Gels were washed in a re-naturing
buffer and incubated in an incubation buffer at 37°C for 24 h, stained with Coomassie
brilliant blue R-250 (Sigma, USA), and then de-stained with gel-clear de-stain solution.
Areas of gelatinolytic degradation appeared as transparent bands on the blue background.
The enzymolysis strip volume [area × (gray stripe-gray background)] is expressed as the
mean ± SD of the triplicate experiment for each group.
Transmission Electron Microscope (TEM)
PANC-1 cells in 25 cm² flasks treated 48h using Genistein of different concentration
were harvested by trypsinization. The cells were fixed with 2.5 % glutaraldehyde and 1 %
osmium tetroxide (TAAB Laboratories Equipment Ltd. Berkshire, UK). The dehydration
was carried out with an ethanol series. The dehydrated TEM samples were mixed with
proplylene oxide and Epok 812, which were embedded and proymerilizated. Ultrathin
sections were made using the ultra-microtome (Porter-Blum MTZ-B) and then were
stained with uranyl acetate and lead critrate. The inner ultrastructure of the cells was
investigated using the TEM Device (Hitachi H-500).
Statistical analysis
SPSS 13.0 software was used for statistical analysis, and t test was used in the
comparison between two groups. One-way analysis of variance was used for multiple
comparisons. There was statistical significance when P value was less than 0.05.
RESULTS
Genistein inhibits TGF-β1-inducted invasion and metastasis in Panc-1 cell
In order to confirm whether genistein is involved in the process of Panc-1 cell motility
and invasiveness after stimulated by TGF-β1, transwell assay were used to determine the
impact of genistein on Panc-1 cell migration and invasion. Compared with the control
group, the number of cells through transwell’s artificial membrane after stimulated by
TGF-β1 (10ng /ml for 48 hours) increased significantly (invasion assay: 60.92±10.71 VS
34.20±5.52, P<0.05; migration assay: 67.42±9.09 VS 40.36±6.10 P<0.05); Compared
with TGF-β1 stimulation group, the numbers of cells in each treatment group through
artificial membrane were obviously decreased (invasion assay: 49.03±7.93、37.12±6.27、
24.09±3.90, P<0.05/P<0.01; migration assay: 58.63±9.49、43.56±7.07、27.26±4.36,
P<0.05/P<0.01). To be mentioned the inhibit rate of genistein during TGF-β1-inducted
migration and invasion in Panc-1 cell is positively associated with the concentration of
drug (Table 1A, 1B; Figure 1).
Genistein inhibits TGF-β1-inducted invasion and metastasis in Panc-1 cell through
down-regulation of uPA expression
To validate the uPA functions in cell invasion and migration regulation, the mRNA and
protein level of uPA in Panc-1 cells was monitored by RT-PCR and Weston blot. The
results showed that the expressions of uPA mRNA and protein in each treatment groups
were significantly decreased (P<0.05) in a dose-dependent manner compared with the
group after stimulated by TGF-β1 (Fig 2A, 2B).
Genistein inhibits TGF-β1-inducted invasion and metastasis in Panc-1 cell through
down-regulation of MMP-2, but not MMP-9 expression
MMP overexpression contributes to tumorigenesis and tumor progression through
multiple mechanisms
[17]
. MMP proteolysis serves a path-clearing role in facilitating the
movement of cells or groups of cells through ECM; in this process, cleavage of some
ECM components unmasks cryptic sites, generating fragments with new biological
activities modulating migration, growth, or angiogenesis
[18, 19]
. In this experiment,
RT-PCR and gelatin zymography was performed to investigate whether the
down-regulation of MMP-2/9 in Panc-1 cells affects invasion and metastasis or not. The
results showed that the expressions and activity of MMP-2 not MMP-9 were inhibited in
Panc-1 cells by gentistein compared with that in control cells (Figure 3A, 3B, 3C).
Genistein inhibits TGF-β1-inducted EMT in Panc-1 cell through regulating the
express of E-Cadherin / Vimentin and cell morphology
We also investigated whether genistein could affect TGF-β1-dependent EMT. As shown
in Figure 4A and 4B, cells developed EMT after 48 h of incubation with TGF-β1.
However genistein could obviously improve the EMT development in Panc-1 cells
through morphology detection. This was manifested that genistein need down-regulation
of E-cadherin, an epithelial marker, the decrease of which is a hallmark of EMT. In
contrast, the protein vimentin, a mesenchymal marker, was up-regulated in
TGF-β1-treated cells as compared with control cells (Figure 4C, D and E).
Genistein
inhibits
TGF-β1-inducted
Smad4-dependent signaling pathway
EMT
in
Panc-1
cell
through
a
Of the many factors that trigger EMT, transforming growth factor-β1 (TGF-β1) is the
most important and well studied
[20]
. TGF-β1 mediates the Epithelial–mesenchymal
transition (EMT) process via numerous intracellular signal transduction pathways,
including the canonical Smad pathway, mitogen-activated protein kinases (MAPK),
PI3K/Akt and small GTPases that control the activity or expression of factors related to
EMT
[21, 22]
. To investigate the roles of Smad4 in TGF-β1-inducted EMT, we examined
the effects of genistein on regulation of the Smad4 mRNA expression in Panc-1cell. Our
results displayed that the mRNA expression of Smad4 was down-regulated and was
positively correlated with the concentration of genisteis (Fig 5A).
Genistein inhibits TGF-β1-inducted EMT in Panc-1 cell through a p38 MAPK
signaling pathway
In recent years, significant evidence suggests that p38 MAPK pathway is an important
intracellular signal transduction pathway involved in TGF-β1-induced EMT in renal
tubular epithelial cells
[23, 24]
. To investigate the role of p38 MAPK pathway in
TGF-β1-inducted EMT in Panc-1 cell, we detected the expression of P38, P-P38 and
ERK1/2 protein. Compared with the TGF-β1 stimulation group, the expressions of P-P38
protein were inhibited significantly in genistein treatment group (P<0.05). However there
is not difference on the expressions of ERK1/2 and P38 protein in every experiment
group (P> 0.05) (Fig 6A and B).
DISCUSSIONS
Pancreatic cancer has the worst prognosis among all major cancers. This could be
due to the fact that no effective methods of early diagnosis are currently available as well
as the lack of effective therapies, resulting in high mortality of patients diagnosed with
pancreatic cancer
[25]
. This disappointing outcome strongly suggests that innovative
research is needed to control this deadly disease.
Genistein (40,5,7-trihydroxyisoflavone), a component of commonly consumed
dietary items such as soy, is an isoflavone having a heterocyclic diphenolic structure
similar to estrogen with potent biological activity
[26-30]
. Relative studies reported that
genistein regulates genes that are related in controlling cell proliferation, cell cycle,
apoptosis, oncogenesis, transcription regulation, angiogenesis, and cancer cell invasion
and metastasis
[31-35]
. Here, we further displayed that genistein inhibits TGF-β1-inducted
invasion and metastasis in Panc-1 cell by transwell assay and is positively associated with
the concentration of drug (Fig 1). These data implied that genistein may play a role in
initial cancer prevention and/or in cancer progression, which was consistent with the
results of Martinez-Montemayor et al [36].
The uPA-uPAR system has also been implicated in other tumor-related processes,
such as adhesion, migration, proliferation and angiogenesis, via interactions with
molecules on the cell surface (e.g., integrins and vitronectin)
signaling pathways
[39, 40]
[37, 38]
and by activation of
. In addition, relative research demonstrated that MMPs play a
role in aberrant cell growth and tumor formation, since they provide space for the tumor
to grow and release various growth factors that drive tumor proliferation
[41]
. In the
present study, we also found that the expressions of uPA mRNA and protein, as well as
the expression and activity of MMP-2 not MMP-9 were inhibited in Panc-1 cells by
gentistein compared with that in control cells. These results demonstrated that genistein
can inhibit TGF-β1-inducted invasion and metastasis in PANC-1 cell through
down-regulation of uPA and MMP2 expression (Fig 2 and 3).
In recently, researcher considered that EMT is a critical normal process during
development and wound healing, recently properties of EMT have been implicated in
human pathology, including fibrosis and cancer metastasis
[42]
. Consistent with this
hypothesis, numerous signaling pathways and transcription factors identified as critical
mediators of developmental EMT have also been implicated in oncogenic EMT and in
tumor progression. To be mentioned EMT is characterized as a downregulation of
epithelial markers, particularly E-cadherin, and an upregulation of mesenchymal markers,
particularly vimentin or fibronectin, accompanied by an increase in cell migration and
invasion
[46]
. In the current experiments, according to our ultrastructural findings,
genistein could obviously improve the EMT development in TGF-β1-induced Panc-1
cells, following the down-regulation of E-cadherin and the up-regulation of vimentin (Fig
4).
In addition to transcription factors, cell signaling pathways are also critical inducers
of EMT in the context ofdevelopment and in cancer. One of the best studied EMT
signaling pathways is TGF-β signaling. TGF-β is a ubiquitously expressed cytokine that
binds to a target cell through the type I and II TGF-β receptors, initiating multiple
signaling cascades, including the canonical Smad signaling pathway, that ultimately
regulate transcription in combination with cofactors
[47]
. Smad4 is a central intracellular
effector of TGF-β signaling. Smad-independent TGF-β pathways, such as those mediated
by p38 MAPK, have been identified in cell culture systems, but their in vivo functional
mechanisms remain unclear
[48]
. Moreover, some research showed that genistein can
inhibit the prometastatic processes of cancer cell detachment, migration, and invasion
through a variety of mechanisms, including the transforming growth factor (TGF)-β
signaling pathway. To investigate the roles of Smad4 and p38 MAPK in invasive and
matastatic capabilities of pancreatic cancer by TGF-β1 induction, we examined the
effects of Genistein on regulation of the Smad4 mRNA and P38, P-P38 and ERK1/2
protein expression in pancreatic cancer cell line Panc-1. Our results displayed that the
expression of Smad4 mRNA and P-P38 protein was down-regulated and was positively
correlated with the concentration of Genistein (Fig 5, 6). However, the expressions of
P38 and ERK1/2 were not different between TGF-β1 stimulation group and genistein
treatment group (Fig 6). Our data suggested genistein can inhibite TGF-β1-inducted
invasion and metastasis in PANC-1 cell through Smad4-dependent and -independent
pathways (p38 MAPK), which are critical and functionally redundant.
In summary, in the current study we have demonstrated that genistein can inhibit
TGF-β1-inducted invasion and migration in Panc-1 cell, which may be mediated by the
down-regulation of uPA and MMP2 not MMP9 expression, result in controlling the
progress of EMT by the down-regulation of E-cadherin and the up-regulation of vimentin.
The potential molecular mechanisms are all or partly through Smad4-dependent and
-independent pathways (p38 MAPK) to regulate the antitumor effect of genistein.
Acknowledgments
We thank Dr. Hao Zhang (Department of General surgery, China Medical University) for his
guidance in this research. Critical reading of the manuscript by Dr. Guang Chen is
gratefully acknowledged.
References
1. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA
Cancer J Clin. 2009; 59:225–249. PMID:19474385
2. Qian MF, Wang XH, Ma XY, Lei TH, Yao KY. Aresearch on the epidemiologic
trend and mortality with cancer in Jiashan County. Zhongguo zhongliu 2001; 10:
381-383
3. Caulín C, Scholl FG, Frontelo P, Gamallo C, Quintanilla M. Chronic exposure of
cultured transformed mouse epidermal cells to transforming growth factor-beta 1
induces an epithelialmesenchymal transdifferentiation and a spindle tumoral
phenotype. Cell Growth Differ. 1995; 6, 1027–1035. PMID:8547217
4. Cui W, Fowlis DJ, Bryson S, Duffie E, Ireland H, Balmain A, Akhurst RJ. TGF-beta1
inhibits the formation of benign skin tumors, but enhances progression to invasive
spindle carcinomas in transgenic mice. Cell, 1996; 86, 531–542. PMID:8752208
5. Portella G, Cumming SA, Liddell J, Cui W, Ireland H, Akhurst RJ, Balmain
A.Transforming growth factor beta is essential for spindle cell conversion of mouse
skin carcinoma in vivo: implications for tumor invasion. Cell Growth Differ. 1998; 9,
393–404. PMID:9607560
6. Frontelo P, González-Garrigues M, Vilaró S, Gamallo C, Fabra A, Quintanilla
MTransforming growth factor beta 1 induces squamous carcinoma cell variants with
increased metastatic abilities and a disorganized cytoskeleton. Exp. Cell Res., 1998;
244, 420–432. PMID:9806792
7. Romero D, Iglesias M, Vary CP, Quintanilla M. Functional blockade of Smad4 leads
to a decrease in beta-catenin levels and signaling activity in human pancreatic
carcinoma cells.Carcinogenesis. 2008; 29(5):1070-1076. PMID:18310088
8. Chow JY, Quach K, Cabrera BL, Cabral J, Beck SE, Carethers JM. RAS/ERK
Modulates
TGF[beta]-regulated
PTEN
expression
in
human
pancreatic
adenocarcinoma cells. Carcinogenesis 2007; 28:2321–2327. PMID:17638924
9. Ross JA, Kasum CM. Dietary flavonoids: bioavailability, metabolic effects, and
safety. Annu Rev Nutr 2002; 22:19–34. PMID:12055336
10. Li Y, Ellis KL, Ali S, El-Rayes BF, Nedeljkovic-Kurepa A, Kucuk O, Philip PA,
Sarkar FH.Apoptosis-inducing effect of chemotherapeutic agents is potentiated by
soy isoflavone genistein, a natural inhibitor of NF-nB in BxPC-3 pancreatic cancer
cell line. Pancreas 2004; 28:90–95. PMID:15097869
11. Sarkar FH, Li Y. Mechanisms of cancer chemoprevention by soy isoflavone
genistein. Cancer Metastasis Rev 2002; 21:265–280. PMID:12549765
12. Li Y, Ahmed F, Ali S, Philip PA, Kucuk O, Sarkar FH. Inactivation of nuclear factor
nB by soy isoflavone genistein contributes to increased apoptosis induced by
chemotherapeutic agents in human cancer cells. Cancer Res 2005; 65:6934–6942.
PMID:16061678
13. Banerjee S, Zhang Y, Ali S, Bhuiyan M, Wang Z, Chiao PJ, Philip PA, Abbruzzese J,
Sarkar FH. Molecular evidence for increased antitumor activity of gemcitabine by
genistein in vitro and in vivo using an orthotopic model of pancreatic cancer. Cancer
Res 2005; 65:9064–9072. PMID:16204081
14. Li Y, Ellis KL, Ali S, El-Rayes BF, Nedeljkovic-Kurepa A, Kucuk O, Philip PA,
Sarkar FH. Apoptosis-inducing effect of chemotherapeutic agents is potentiated by
soy isoflavone genistein, a natural inhibitor of NF-kappa B in BxPC-3 pancreatic
cancer cell line. Pancreas. 2004; 28:e90–e95. PMID:15097869
15. Li Y, Sarkar FH. Gene expression profiles of genisteintreated PC3 prostate cancer
cells. J Nutr. 2002; 132:3623–3631. PMID:12468598
16. Iwai S, Nakanishi-Ueda T, Armstrong D, Oguchi K: Zymographical techniques for
detection of matrix metalloproteinases. Methods Mol Biol 2008, 477:113-121.
PMID:19082943
17. Radisky ES, Radisky DC. Matrix metalloproteinase-induced epithelial-mesenchymal
transition in breast cancer.J Mammary Gland Biol Neoplasia. 2010, 15(2):201-12.
PMID:20440544
18. Egeblad M, Werb Z. New functions for the matrix metalloproteinases in cancer
progression. Nat Rev Cancer. 2002; 2(3):161–174. PMID:11990853
19. Page-McCaw A, Ewald AJ, Werb Z. Matrix metalloproteinases and the regulation of
tissue remodelling. Nat Rev Mol Cell Biol. 2007; 8(3):221–233. PMID:17318226
20. Ahmad
H,
Bani-Hania
MTC,
Daniel
R
Meldrum
KK.
Cytokines
in
epithelial–mesenchymal transition: a new insight into obstructive nephropathy. J
Urol 2008; 180: 461–468 PMID:18550128
21. Moustakas A. Heldin CH. Non-Smad TGF-beta signals. J Cell. 2005; 118:
3573–3584 PMID:16105881
22. Zhang YE. Non-Smad pathways in TGF-signaling. Cell Res 2009; 19: 128–139
PMID:19114990
23. Rhyu DY, Yang Y, Ha H, Lee GT, Song JS, Uh ST, Lee HB. Role of reactive oxygen
species in TGF-1-induced mitogen-activated protein kinase activation and
epithelial–mesenchymal transition in renal tubular epithelial cells. J Am Soc Nephrol
2005; 16: 667–675 PMID:15677311
24. Sebe A, Leivonen SK, Fintha A, Masszi A, Rosivall L, Kähäri VM, Mucsi
I.Transforming growth factor-β-induced alpha-smooth muscle cell actin expression
in renal proximal tubular cells is regulated by p38β mitogen-activated protein kinase,
extracellular signal-regulated protein kinase1,2 and the Smad signaling during
epithelial–myofibroblast transdifferentiation. Nephrol Dial Transplant 2008; 23:
1537–1545 PMID:18192325
25. Banerjee S, Zhang Y, Wang Z, Che M, Chiao PJ, Abbruzzese JL, Sarkar FH. In vitro
and in vivo molecular evidence of genistein action in augmenting the efficacy of
cisplatin in pancreatic cancer. Int J Cancer. 2007; 120(4):906-917. PMID:17131310
26. Barnes S. Effect of genistein on in vitro and in vivo models of cancer. J Nutr 1995;
125:777S–783S. PMID:7884564
27. Hillman GG, Wang Y, Kucuk O, Che M, Doerge DR, Yudelev M, Joiner MC,
Marples B, Forman JD, Sarkar FH. Genistein potentiates inhibition of tumor growth
by radiation in a prostate cancer orthotopic model. Mol Cancer Ther 2004;
3:1271–1279. PMID:15486194
28. Huang J, Nasr M, Kim Y, Matthews HR. Genistein inhibits protein histidine kinase.
J Biol Chem 1992; 267:15511–15515. PMID:1639791
29. Li Y, Che M, Bhagat S, Ellis KL, Kucuk O, Doerge DR, Abrams J, Cher ML, Sarkar
FH. Regulation of gene expression and inhibition of experimental prostate cancer
bone metastasis by dietary genistein. Neoplasia 2004; 6:354–363. PMID:15256057
30. Mohammad RM, Al-Katib A, Aboukameel A, Doerge DR, Sarkar F, Kucuk O.
Genistein sensitizes diffuse large cell lymphoma to CHOP (cyclophosphamide,
doxorubicin, vincristine, prednisone) chemotherapy. Mol Cancer Ther 2003;
2:1361–1368. PMID:14707277
31. Alhasan SA, Pietrasczkiwicz H, Alonso MD, Ensley J, Sarkar FH. Genistein-induced
cell cycle arrest and apoptosis in a head and neck squamous cell carcinoma cell line.
Nutr Cancer 1999; 34:12–19. PMID:10453436
32. Davis JN, Singh B, Bhuiyan M, Sarkar FH. Genistein-induced upregulation of
p21WAF1, downregulation of cyclin B, and induction of apoptosis in prostate cancer
cells. Nutr Cancer 1998; 32:123–131. PMID:10050261
33. Li Y, Bhuiyan M, Sarkar FH. Induction of apoptosis and inhibition of c-erbB-2 in
MDA-MB-435 cells by genistein. Int J Oncol 1999; 15: 525–533. PMID:10427135
34. Li Y, Sarkar FH. Down-regulation of invasion and angiogenesisrelated genes
identified by cDNA microarray analysis of PC3 prostate cancer cells treated with
genistein. Cancer Lett 2002; 186:157–164. PMID:12213285
35. Li Y, Upadhyay S, Bhuiyan M, Sarkar FH. Induction of apoptosis in breast cancer
cells MDA-MB-231 by genistein. Oncogene 1999; 18:3166–3172. PMID:10340389
36. Martínez-Montemayor MM, Otero-Franqui E, Martinez J, De La Mota-Peynado A,
Cubano LA, Dharmawardhane S.Individual and combined soy isoflavones exert
differential effects on metastatic cancer progression. Clin Exp Metastasis. 2010;
27(7):465-80. PMID:20517637
37. Wei Y, Waltz DA, Rao N, Drummond RJ, Rosenberg S, Chapman HA. Identification
of the urokinase receptor as an adhesion receptor for vitronectin. J Biol Chem 1994;
269: 32380–32388. PMID:7528215
38. Wei Y, Lukashev M, Simon DI, Bodary SC, Rosenberg S, Doyle MV, Chapman HA.
Regulation of integrin function by the urokinase receptor. Science 1996;
273:1551–1555. PMID:8703217
39. Chandrasekar N, Mohanam S, Gujrati M, Olivero WC, Dinh DH, Rao JS.
Downregulation of uPA inhibits migration and PI3k/Akt signaling in glioblastoma
cells. Oncogene 2003; 22: 392–400. PMID:12545160
40. Jo M, Thomas KS, Somlyo AV, Somlyo AP, Gonias SL Cooperativity between the
Ras-ERK
and
Rho-Rho
kinase
pathways
in
urokinase-type
plasminogen
activator-stimulated cell migration. J Biol Chem 2002; 277:12479–12485.
PMID:11805108
41. Pavese JM, Farmer RL, Bergan RC.Inhibition of cancer cell invasion and metastasis
by genistein. Cancer Metastasis Rev. 2010; 29(3):465-482. PMID:20730632
42. Lopez-Novoa JM, Nieto MA. Inflammation and EMT: an alliance towards organ
fibrosis and cancer progression. EMBO Mol Med. 2009; 1(6–7):303–314.
PMID:20049734
43. Micalizzi DS, Farabaugh SM, Ford HL.Epithelial-mesenchymal transition in cancer:
parallels between normal development and tumor progression. J Mammary Gland
Biol Neoplasia. 2010; 15(2):117-134. PMID:20490631
44. Massague J, Seoane J, Wotton D. Smad transcription factors. Genes Dev. 2005;
19(23):2783–2810. PMID:16322555
45. Xu X, Han J, Ito Y, Bringas P Jr, Deng C, Chai Y. Ectodermal Smad4 and p38 MAPK
are functionally redundant in mediating TGF-beta/BMP signaling during tooth and
palate development. Dev Cell.2008; 15(2):322-329. PMID:18694570
Figure Legends
Fig.1. Genistein inhibited TGF-β1-induced the invasion and migration in Panc-1 cell by
transwell assay. The phase contrast imagine of Control group (a); TGF-β1 (5ng/ml)
stimulation group (b); Genistein (1μmol/L) treatment group (c); Genistein (25μmol/L)
treatment group (d); Genistein (50μmol/L) treatment group (e) (original magnification ×
200).
Fig.2. Genistein inhibits TGF-β1-inducted invasion and metastasis in Panc-1 cell through
down-regulation of uPA expression. A: mRNA level of uPA after Panc-1 cells were
treated with different concentration of genistein by RT-PCR assay; B: Protein level of
uPA after Panc-1 cells were treated with different concentration of genistein by Western
boltting assay. Results are presented as the arithmetic mean of 3 values per group ± SE. *
indicate P < 0.05, compared with control group; # and
##
respectively, compared with TGF-β1 stimulation group.
indicate P < 0.05 and P < 0.01,
Fig.3. Genistein inhibits TGF-β1-inducted invasion and metastasis in Panc-1 cell through
down-regulation of MMP-2, but not MMP-9 expression. A: mRNA level of MMP-2 after
Panc-1 cells was treated with different concentration of genistein by RT-PCR assay; B:
mRNA level of MMP-9 after Panc-1 cells was treated with different concentration of
genistein by RT-PCR assay; C: The activity assay of MMP-2/9 after Panc-1 cells were
treated with different concentration of genistein by Gelatin Zymography. Results are
presented as the arithmetic mean of 3 values per group ± SE. * indicate P < 0.05,
compared with control group;
#
and
##
indicate P < 0.05 and P < 0.01, respectively,
compared with TGF-β1 stimulation group.
Fig.4. Genistein inhibits TGF-β1-inducted EMT in Panc-1 cell through regulating the
express of E-cadherin / Vimentin and cell morphology. A: The phase contrast images of
Panc-1 cells with genistein treatment after 48 h (original magnification × 200); B: The
images of Panc-1 cells with genistein treatment by light microscope and TEM; C: mRNA
level of E-cadherin after Panc-1 cells was treated with different concentration of genistein
by RT-PCR assay; D: mRNA level of Vimentin after Panc-1 cells was treated with
different concentration of genistein by RT-PCR assay; E: Protein level of E-cadherin
after Panc-1 cells were treated with different concentration of genistein by Western
boltting assay. Results are presented as the arithmetic mean of 3 values per group ± SE. *
indicate P < 0.05, compared with control group; # and
##
respectively, compared with TGF-β1 stimulation group.
indicate P < 0.05 and P < 0.01,
Fig.5.
Genistein
inhibits
TGF-β1-inducted
EMT
in
Panc-1
cell
through
a
Smad4-dependent signaling pathway. A: mRNA level of Smad-4 after Panc-1 cells was
treated with different concentration of genistein by RT-PCR assay. Results are presented
as the arithmetic mean of 3 values per group ± SE. * indicate P < 0.05, compared with
control group;
#
and
##
indicate P < 0.05 and P < 0.01, respectively, compared with
TGF-β1 stimulation group.
Fig.6. Genistein inhibits TGF-β1-inducted EMT in PANC-1 cell through a p38 MAPK
signaling pathway. A: Protein level of total p38 and p-p38 after Panc-1 cells was treated
with different concentration of genistein by Weston blot assay; B: Protein level of
ERK1/2 after Panc-1 cells was treated with different concentration of genistein by
Weston blot assay. Results are presented as the arithmetic mean of 3 values per group ±
SE. * indicate P < 0.05, compared with control group; # and ## indicate P < 0.05 and P <
0.01, respectively, compared with TGF-β1 stimulation group.
Table 1A，Genistein inhibit the ability of Panc-1 cell invasion (5ng/ml TGF-β1)
Note: compared with control group:* P <0.05; compared with TGF-β1 stimulation group:
△
P <0.05 △△P <0.01
Table 1B，Genistein inhibit the ability of Panc-1 cell migration (5ng/ml TGF-β1)
Note: compared with control group:* P <0.05; compared with TGF-β1 stimulation group:
△
P <0.05 △△P <0.01