Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
The effects of genistein on TGF-β1-induced the invasion and metastasis in human pancreatic cancer cell line Panc-1 in vitro Lei HAN a, b ,Hong-wei ZHANGc, Wen-ping ZHOUb, Guang-ming CHENb and Ke-jian GUOa,* a Department of General surgery, College of Clinical Medical Sciences, China Medical University, No. 92 Beier Road, Heping District, Shenyang 110004, China b Department of Hepatobiliary & Pancreas surgery, The General Hospital of Shenyang Military Region, No. 83 Wenhua Road, Shenhe District, Shenyang 110016, China c Department of General surgery, The Tianjin Dongli Hospital, 300000, China *Corresponding author: Telephone: +86 24 83283330. E-mail address: [email protected] (Kejian Guo). Mailing address: Department of General surgery, College of Clinical Medical Sciences, China Medical University, No. 92 Beier Road, Heping District, Shenyang 110004, China Keywords: Genistein; TGF-β1-induced; Invasion; Metastasis; pancreatic cancer Background Pancreatic cancer is a devastating disease with the worst mortality rate. Therefore, a rational strategy for future drug development is critical. Genistein is a small, biologically active flavonoid that is found in high amounts in soy. This important compound possesses a wide variety of biological activities, but it is best known for its ability to inhibit cancer progression. Methods In the current study, we found that genistein can inhibit effectively TGF-β1-induced the invasion and metastasis in Panc-1 by Transwell assay, which is through regulating the mRNA and protein expression of uPA and MMP2, but not MMP9 by RT-PCR / Weston blot, and is positively correlated with the concentration of genistein. At the same time, genistein also could improve the progress of Epithelial-Mesenchymal Transition (EMT) via morphology observation using light microscope / TEM, which is mediated by the down-regulation of E-cadherin and the up-regulation of vimentin. Conclusions TGF-β1 mediates EMT process via numerous intracellular signal transduction pathways. The potential molecular mechanisms are all or partly through Smad4-dependent and -independent pathways (p38 MAPK) to regulate the antitumor effect of genistein. Pancreatic cancer is a devastating disease with the worst mortality rate. The 5-year survival of patients with pancreatic cancer is <5% without significant improvement over the past three decades. Although accounting for only 3% of all cancers, this disease is the fourth leading cause of death and represents 6% of all cancer related deaths in the United States [1]. Some sporadic reports have shown that the mortality rates of pancreatic cancer in China have increased constantly over the last decades [2] . Consequently, major improvement in the outlook of this disease will depend on the development of more effective drug therapies. Therefore, a rational strategy for future drug development is to specifically target the critical cellular pathways regulating proliferation, survival, and invasion. TGF-β plays an important role in the control of cell proliferation and in carcinogenesis. Relative research demonstrated that TGF-β1 plays a dual role in mouse skin carcinogenesis, as well as in other human and murine cancer models [3-7]. TGF-β1 acts as a cell growth inhibitor in non-transformed epithelial cells, but at later stages of carcinogenesis it induces an epithelial–mesenchymal transition in vitro and the transition from squamous to spindle cell carcinoma associated with increased invasion and metastasis in vivo. In addition, the TGF-β-SMAD signaling cascade is considered to mediate growth suppression in most epithelial cells, and disruption of this pathway is one mode how pancreatic cancer cells escape TGF-β-induced growth suppression. However, TGF-β can also induce cellular proliferation, particularly with disruption of SMAD signaling, suggesting that other TGF-β-mediated pathways may be operative or exposed with loss of intact SMAD signaling [8]. Genistein is a naturally occurring isoflavone present in soybeans [8]. The soy isoflavone genistein reportedly inhibit pancreatic carcinoma cell growth, induce apoptosis, and chemosensitize those cells by the inhibition of PI3K leading to inhibition of Akt and NF-κB [10-14] . In addition, relative research has reported that it regulates molecules that play key roles in tumor cell invasion and metastasis, in the cell cycle, and in apoptosis. [15] . However, in vivo studies showing the potentiation of TGF-β-induced antitumor activity by genistein have not been reported profusely. In this study, we used a mode of the invasion of human pancreatic cancer cell line Panc-1 induced by TGF-β1 and genistein against it, in order to study the effects of genistein antitumor and it’s mechanism in vitro, we estimate on the facts of genistein inhibiting the invasion and migration of Panc-1 cell, Epithelial-Mesenchymal Transition (EMT) and signaling pathway. This relative research will help not only to understand the regulation of invasion of pancreatic cancer, but also to elucidate the molecular mechanism of drug antitumor. MATERIALS AND METHODS Cell Culture, Drug and Reagents The Panc-1 human pancreatic cell line (American Type Culture Collection, Manassas, VA) was maintained in DMEM medium containing 10% fetal bovine serum, 100 units/mL penicillin, and 100 mg/mL streptomycin. Cells were incubated in a humidified, 5% CO2 atmosphere at 37°C. Genistein (Toronto Research Chemicals, North York, Ontario, Canada) was dissolved in 0.1 M Na2CO3 to make a 10-mM stock solution. Cell culture medium was purchased from Invitrogen (Carlsbad, CA). Experimental Group This experiment was divided into 5 experimental groups: ①Control group: Panc-1 cell (NO any treatment factors, adding the same volume PBS) ; ②TGF-β1 Stimulation group: TGF-β1 (5ng/ml) induced the Panc-1 cells; ③ Treatment group 1: after TGF-β1 (5ng/ml) induced the Panc-1 cells 30 minutes, adding the Genistein (1μmol/L); ④ Treatment group 2: after TGF-β1 (5ng/ml) induced the Panc-1 cells 30 minutes, adding the Genistein (25μmol/L); ⑤ Treatment group 3: after TGF-β1 (5ng/ml) induced the Panc-1 cells 30 minutes, adding the Genistein (50μmol/L). Transwell assay The transwell chamber (Corning) containing an 8-μm pore size polycarbonate membrane filter was coated with a matrigel (Sigma, USA) and inserted in a 24-well culture plate. Cells collected of different experimental group were adjusted to a density of 2×105 cells/L with serum-free DMEM high glucose culture medium. The cell suspension of 200 μL was added into the upper transwell chamber and 400 μL Chemokine (MRC-5 cells 48 hours serum-free conditioned medium) was added into the lower transwell chamber. After recultured with 5% CO2 at 37°C for 24 h, the cells in upper chambers should be removed. The transwell chambers were inverted and stained with hematoxylin and eosin. Five fields were randomly selected and the number of trans-membrane cells was counted. Compared with the invasion assay, migration experiment wasn’t coated with a matrigel on polycarbonate membrane filter, other steps is the same as it. Reverse transcription polymerase chain reaction (RT-PCR) Total RNA was extracted from different experimental group cells (different treated factors, cultured 24h) using TRIZOL reagent (Invitrogen, CA) as per standard protocol. RNA (1 μg) was used as a template for reverse transcription reaction (Takara, Japan), followed by PCR analysis using specific primers for MMP-2, MMP-9, uPA and β-actin. The primers of MMP-2, MMP-9, uPA and β-actin were as follows: forward primer 5' GGATGATGC -CTTTGCTCG 3', reverse primer 5' CAGTGGACATGGCGGTCT 3' ; forward primer 5'CAGCTGTATTTGTTCAAGGATGG 3’, reverse primer 5' CTTGTCC AGACGCCTCGG 3’; forward primer 5' CACGCTTGCTCACCACA 3', reverse primer 5' CTTCAGGGCACATCCAC 3' and forward primer 5’ATCATGTTTGAGACCTTCAA CA 3’, reverse primer 5’CATCTCTTGCTCGAAGTCCA3’. The amplified products were analyzed on an agarose gel. Protein extraction and Western immunoblotting Cells were lysed, and protein was extracted. Briefly, cells were lysed in buffer containing 50 mM Tris, pH 7.4, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 5 mM EDTA, 1 mM sodium vanadate, 1 mM -glycerophosphate, 1 mM sodium fluoride, 2μg/ml leupeptin, 10μg/ml aprotinin, and 1 mM phenylmethylsulfonyl fluoride (PMSF). Lysates were collected and centrifuged at 4°C at 14,000 rpm for 10 min to pellet cell debris. Supernatant (50μg) was separated on SDS-PAGE, and Western blotting was performed. Antibodies used included monoclonal uPA, monoclonal E-cadherin, monoclonal P38, monoclonal P-P38 and monoclonal ERK1/2 (Abs were purchased from Cell sciences, USA). MMP Activity The Panc-1 human pancreatic cell line (1.2×106) suspensions were seeded into 6-well plates in DMEM supplemented with 10% FBS. After 24 h, cells were incubated in serum-free DMEM for 24 h. The supernatants were collected after centrifugation and the cells were trypsinized and counted. An assay to measure MMP activity was performed using Gelatin Zymography according to Iwai’s report [16] . Briefly, a volume of 20 μl of medium was loaded under non-denaturing conditions into a zymogram gel supplemented with 0.1% gelatin to detect the presence of MMP-2 and -9. Electrophoresis was performed at a constant voltage of 120 V for 90 min. Gels were washed in a re-naturing buffer and incubated in an incubation buffer at 37°C for 24 h, stained with Coomassie brilliant blue R-250 (Sigma, USA), and then de-stained with gel-clear de-stain solution. Areas of gelatinolytic degradation appeared as transparent bands on the blue background. The enzymolysis strip volume [area × (gray stripe-gray background)] is expressed as the mean ± SD of the triplicate experiment for each group. Transmission Electron Microscope (TEM) PANC-1 cells in 25 cm² flasks treated 48h using Genistein of different concentration were harvested by trypsinization. The cells were fixed with 2.5 % glutaraldehyde and 1 % osmium tetroxide (TAAB Laboratories Equipment Ltd. Berkshire, UK). The dehydration was carried out with an ethanol series. The dehydrated TEM samples were mixed with proplylene oxide and Epok 812, which were embedded and proymerilizated. Ultrathin sections were made using the ultra-microtome (Porter-Blum MTZ-B) and then were stained with uranyl acetate and lead critrate. The inner ultrastructure of the cells was investigated using the TEM Device (Hitachi H-500). Statistical analysis SPSS 13.0 software was used for statistical analysis, and t test was used in the comparison between two groups. One-way analysis of variance was used for multiple comparisons. There was statistical significance when P value was less than 0.05. RESULTS Genistein inhibits TGF-β1-inducted invasion and metastasis in Panc-1 cell In order to confirm whether genistein is involved in the process of Panc-1 cell motility and invasiveness after stimulated by TGF-β1, transwell assay were used to determine the impact of genistein on Panc-1 cell migration and invasion. Compared with the control group, the number of cells through transwell’s artificial membrane after stimulated by TGF-β1 (10ng /ml for 48 hours) increased significantly (invasion assay: 60.92±10.71 VS 34.20±5.52, P<0.05; migration assay: 67.42±9.09 VS 40.36±6.10 P<0.05); Compared with TGF-β1 stimulation group, the numbers of cells in each treatment group through artificial membrane were obviously decreased (invasion assay: 49.03±7.93、37.12±6.27、 24.09±3.90, P<0.05/P<0.01; migration assay: 58.63±9.49、43.56±7.07、27.26±4.36, P<0.05/P<0.01). To be mentioned the inhibit rate of genistein during TGF-β1-inducted migration and invasion in Panc-1 cell is positively associated with the concentration of drug (Table 1A, 1B; Figure 1). Genistein inhibits TGF-β1-inducted invasion and metastasis in Panc-1 cell through down-regulation of uPA expression To validate the uPA functions in cell invasion and migration regulation, the mRNA and protein level of uPA in Panc-1 cells was monitored by RT-PCR and Weston blot. The results showed that the expressions of uPA mRNA and protein in each treatment groups were significantly decreased (P<0.05) in a dose-dependent manner compared with the group after stimulated by TGF-β1 (Fig 2A, 2B). Genistein inhibits TGF-β1-inducted invasion and metastasis in Panc-1 cell through down-regulation of MMP-2, but not MMP-9 expression MMP overexpression contributes to tumorigenesis and tumor progression through multiple mechanisms [17] . MMP proteolysis serves a path-clearing role in facilitating the movement of cells or groups of cells through ECM; in this process, cleavage of some ECM components unmasks cryptic sites, generating fragments with new biological activities modulating migration, growth, or angiogenesis [18, 19] . In this experiment, RT-PCR and gelatin zymography was performed to investigate whether the down-regulation of MMP-2/9 in Panc-1 cells affects invasion and metastasis or not. The results showed that the expressions and activity of MMP-2 not MMP-9 were inhibited in Panc-1 cells by gentistein compared with that in control cells (Figure 3A, 3B, 3C). Genistein inhibits TGF-β1-inducted EMT in Panc-1 cell through regulating the express of E-Cadherin / Vimentin and cell morphology We also investigated whether genistein could affect TGF-β1-dependent EMT. As shown in Figure 4A and 4B, cells developed EMT after 48 h of incubation with TGF-β1. However genistein could obviously improve the EMT development in Panc-1 cells through morphology detection. This was manifested that genistein need down-regulation of E-cadherin, an epithelial marker, the decrease of which is a hallmark of EMT. In contrast, the protein vimentin, a mesenchymal marker, was up-regulated in TGF-β1-treated cells as compared with control cells (Figure 4C, D and E). Genistein inhibits TGF-β1-inducted Smad4-dependent signaling pathway EMT in Panc-1 cell through a Of the many factors that trigger EMT, transforming growth factor-β1 (TGF-β1) is the most important and well studied [20] . TGF-β1 mediates the Epithelial–mesenchymal transition (EMT) process via numerous intracellular signal transduction pathways, including the canonical Smad pathway, mitogen-activated protein kinases (MAPK), PI3K/Akt and small GTPases that control the activity or expression of factors related to EMT [21, 22] . To investigate the roles of Smad4 in TGF-β1-inducted EMT, we examined the effects of genistein on regulation of the Smad4 mRNA expression in Panc-1cell. Our results displayed that the mRNA expression of Smad4 was down-regulated and was positively correlated with the concentration of genisteis (Fig 5A). Genistein inhibits TGF-β1-inducted EMT in Panc-1 cell through a p38 MAPK signaling pathway In recent years, significant evidence suggests that p38 MAPK pathway is an important intracellular signal transduction pathway involved in TGF-β1-induced EMT in renal tubular epithelial cells [23, 24] . To investigate the role of p38 MAPK pathway in TGF-β1-inducted EMT in Panc-1 cell, we detected the expression of P38, P-P38 and ERK1/2 protein. Compared with the TGF-β1 stimulation group, the expressions of P-P38 protein were inhibited significantly in genistein treatment group (P<0.05). However there is not difference on the expressions of ERK1/2 and P38 protein in every experiment group (P> 0.05) (Fig 6A and B). DISCUSSIONS Pancreatic cancer has the worst prognosis among all major cancers. This could be due to the fact that no effective methods of early diagnosis are currently available as well as the lack of effective therapies, resulting in high mortality of patients diagnosed with pancreatic cancer [25] . This disappointing outcome strongly suggests that innovative research is needed to control this deadly disease. Genistein (40,5,7-trihydroxyisoflavone), a component of commonly consumed dietary items such as soy, is an isoflavone having a heterocyclic diphenolic structure similar to estrogen with potent biological activity [26-30] . Relative studies reported that genistein regulates genes that are related in controlling cell proliferation, cell cycle, apoptosis, oncogenesis, transcription regulation, angiogenesis, and cancer cell invasion and metastasis [31-35] . Here, we further displayed that genistein inhibits TGF-β1-inducted invasion and metastasis in Panc-1 cell by transwell assay and is positively associated with the concentration of drug (Fig 1). These data implied that genistein may play a role in initial cancer prevention and/or in cancer progression, which was consistent with the results of Martinez-Montemayor et al [36]. The uPA-uPAR system has also been implicated in other tumor-related processes, such as adhesion, migration, proliferation and angiogenesis, via interactions with molecules on the cell surface (e.g., integrins and vitronectin) signaling pathways [39, 40] [37, 38] and by activation of . In addition, relative research demonstrated that MMPs play a role in aberrant cell growth and tumor formation, since they provide space for the tumor to grow and release various growth factors that drive tumor proliferation [41] . In the present study, we also found that the expressions of uPA mRNA and protein, as well as the expression and activity of MMP-2 not MMP-9 were inhibited in Panc-1 cells by gentistein compared with that in control cells. These results demonstrated that genistein can inhibit TGF-β1-inducted invasion and metastasis in PANC-1 cell through down-regulation of uPA and MMP2 expression (Fig 2 and 3). In recently, researcher considered that EMT is a critical normal process during development and wound healing, recently properties of EMT have been implicated in human pathology, including fibrosis and cancer metastasis [42] . Consistent with this hypothesis, numerous signaling pathways and transcription factors identified as critical mediators of developmental EMT have also been implicated in oncogenic EMT and in tumor progression. To be mentioned EMT is characterized as a downregulation of epithelial markers, particularly E-cadherin, and an upregulation of mesenchymal markers, particularly vimentin or fibronectin, accompanied by an increase in cell migration and invasion [46] . In the current experiments, according to our ultrastructural findings, genistein could obviously improve the EMT development in TGF-β1-induced Panc-1 cells, following the down-regulation of E-cadherin and the up-regulation of vimentin (Fig 4). In addition to transcription factors, cell signaling pathways are also critical inducers of EMT in the context ofdevelopment and in cancer. One of the best studied EMT signaling pathways is TGF-β signaling. TGF-β is a ubiquitously expressed cytokine that binds to a target cell through the type I and II TGF-β receptors, initiating multiple signaling cascades, including the canonical Smad signaling pathway, that ultimately regulate transcription in combination with cofactors [47] . Smad4 is a central intracellular effector of TGF-β signaling. Smad-independent TGF-β pathways, such as those mediated by p38 MAPK, have been identified in cell culture systems, but their in vivo functional mechanisms remain unclear [48] . Moreover, some research showed that genistein can inhibit the prometastatic processes of cancer cell detachment, migration, and invasion through a variety of mechanisms, including the transforming growth factor (TGF)-β signaling pathway. To investigate the roles of Smad4 and p38 MAPK in invasive and matastatic capabilities of pancreatic cancer by TGF-β1 induction, we examined the effects of Genistein on regulation of the Smad4 mRNA and P38, P-P38 and ERK1/2 protein expression in pancreatic cancer cell line Panc-1. Our results displayed that the expression of Smad4 mRNA and P-P38 protein was down-regulated and was positively correlated with the concentration of Genistein (Fig 5, 6). However, the expressions of P38 and ERK1/2 were not different between TGF-β1 stimulation group and genistein treatment group (Fig 6). Our data suggested genistein can inhibite TGF-β1-inducted invasion and metastasis in PANC-1 cell through Smad4-dependent and -independent pathways (p38 MAPK), which are critical and functionally redundant. In summary, in the current study we have demonstrated that genistein can inhibit TGF-β1-inducted invasion and migration in Panc-1 cell, which may be mediated by the down-regulation of uPA and MMP2 not MMP9 expression, result in controlling the progress of EMT by the down-regulation of E-cadherin and the up-regulation of vimentin. The potential molecular mechanisms are all or partly through Smad4-dependent and -independent pathways (p38 MAPK) to regulate the antitumor effect of genistein. Acknowledgments We thank Dr. Hao Zhang (Department of General surgery, China Medical University) for his guidance in this research. Critical reading of the manuscript by Dr. Guang Chen is gratefully acknowledged. References 1. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA Cancer J Clin. 2009; 59:225–249. PMID:19474385 2. Qian MF, Wang XH, Ma XY, Lei TH, Yao KY. Aresearch on the epidemiologic trend and mortality with cancer in Jiashan County. Zhongguo zhongliu 2001; 10: 381-383 3. Caulín C, Scholl FG, Frontelo P, Gamallo C, Quintanilla M. Chronic exposure of cultured transformed mouse epidermal cells to transforming growth factor-beta 1 induces an epithelialmesenchymal transdifferentiation and a spindle tumoral phenotype. Cell Growth Differ. 1995; 6, 1027–1035. PMID:8547217 4. Cui W, Fowlis DJ, Bryson S, Duffie E, Ireland H, Balmain A, Akhurst RJ. TGF-beta1 inhibits the formation of benign skin tumors, but enhances progression to invasive spindle carcinomas in transgenic mice. Cell, 1996; 86, 531–542. PMID:8752208 5. Portella G, Cumming SA, Liddell J, Cui W, Ireland H, Akhurst RJ, Balmain A.Transforming growth factor beta is essential for spindle cell conversion of mouse skin carcinoma in vivo: implications for tumor invasion. Cell Growth Differ. 1998; 9, 393–404. PMID:9607560 6. Frontelo P, González-Garrigues M, Vilaró S, Gamallo C, Fabra A, Quintanilla MTransforming growth factor beta 1 induces squamous carcinoma cell variants with increased metastatic abilities and a disorganized cytoskeleton. Exp. Cell Res., 1998; 244, 420–432. PMID:9806792 7. Romero D, Iglesias M, Vary CP, Quintanilla M. Functional blockade of Smad4 leads to a decrease in beta-catenin levels and signaling activity in human pancreatic carcinoma cells.Carcinogenesis. 2008; 29(5):1070-1076. PMID:18310088 8. Chow JY, Quach K, Cabrera BL, Cabral J, Beck SE, Carethers JM. RAS/ERK Modulates TGF[beta]-regulated PTEN expression in human pancreatic adenocarcinoma cells. Carcinogenesis 2007; 28:2321–2327. PMID:17638924 9. Ross JA, Kasum CM. Dietary flavonoids: bioavailability, metabolic effects, and safety. Annu Rev Nutr 2002; 22:19–34. PMID:12055336 10. Li Y, Ellis KL, Ali S, El-Rayes BF, Nedeljkovic-Kurepa A, Kucuk O, Philip PA, Sarkar FH.Apoptosis-inducing effect of chemotherapeutic agents is potentiated by soy isoflavone genistein, a natural inhibitor of NF-nB in BxPC-3 pancreatic cancer cell line. Pancreas 2004; 28:90–95. PMID:15097869 11. Sarkar FH, Li Y. Mechanisms of cancer chemoprevention by soy isoflavone genistein. Cancer Metastasis Rev 2002; 21:265–280. PMID:12549765 12. Li Y, Ahmed F, Ali S, Philip PA, Kucuk O, Sarkar FH. Inactivation of nuclear factor nB by soy isoflavone genistein contributes to increased apoptosis induced by chemotherapeutic agents in human cancer cells. Cancer Res 2005; 65:6934–6942. PMID:16061678 13. Banerjee S, Zhang Y, Ali S, Bhuiyan M, Wang Z, Chiao PJ, Philip PA, Abbruzzese J, Sarkar FH. Molecular evidence for increased antitumor activity of gemcitabine by genistein in vitro and in vivo using an orthotopic model of pancreatic cancer. Cancer Res 2005; 65:9064–9072. PMID:16204081 14. Li Y, Ellis KL, Ali S, El-Rayes BF, Nedeljkovic-Kurepa A, Kucuk O, Philip PA, Sarkar FH. Apoptosis-inducing effect of chemotherapeutic agents is potentiated by soy isoflavone genistein, a natural inhibitor of NF-kappa B in BxPC-3 pancreatic cancer cell line. Pancreas. 2004; 28:e90–e95. PMID:15097869 15. Li Y, Sarkar FH. Gene expression profiles of genisteintreated PC3 prostate cancer cells. J Nutr. 2002; 132:3623–3631. PMID:12468598 16. Iwai S, Nakanishi-Ueda T, Armstrong D, Oguchi K: Zymographical techniques for detection of matrix metalloproteinases. Methods Mol Biol 2008, 477:113-121. PMID:19082943 17. Radisky ES, Radisky DC. Matrix metalloproteinase-induced epithelial-mesenchymal transition in breast cancer.J Mammary Gland Biol Neoplasia. 2010, 15(2):201-12. PMID:20440544 18. Egeblad M, Werb Z. New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer. 2002; 2(3):161–174. PMID:11990853 19. Page-McCaw A, Ewald AJ, Werb Z. Matrix metalloproteinases and the regulation of tissue remodelling. Nat Rev Mol Cell Biol. 2007; 8(3):221–233. PMID:17318226 20. Ahmad H, Bani-Hania MTC, Daniel R Meldrum KK. Cytokines in epithelial–mesenchymal transition: a new insight into obstructive nephropathy. J Urol 2008; 180: 461–468 PMID:18550128 21. Moustakas A. Heldin CH. Non-Smad TGF-beta signals. J Cell. 2005; 118: 3573–3584 PMID:16105881 22. Zhang YE. Non-Smad pathways in TGF-signaling. Cell Res 2009; 19: 128–139 PMID:19114990 23. Rhyu DY, Yang Y, Ha H, Lee GT, Song JS, Uh ST, Lee HB. Role of reactive oxygen species in TGF-1-induced mitogen-activated protein kinase activation and epithelial–mesenchymal transition in renal tubular epithelial cells. J Am Soc Nephrol 2005; 16: 667–675 PMID:15677311 24. Sebe A, Leivonen SK, Fintha A, Masszi A, Rosivall L, Kähäri VM, Mucsi I.Transforming growth factor-β-induced alpha-smooth muscle cell actin expression in renal proximal tubular cells is regulated by p38β mitogen-activated protein kinase, extracellular signal-regulated protein kinase1,2 and the Smad signaling during epithelial–myofibroblast transdifferentiation. Nephrol Dial Transplant 2008; 23: 1537–1545 PMID:18192325 25. Banerjee S, Zhang Y, Wang Z, Che M, Chiao PJ, Abbruzzese JL, Sarkar FH. In vitro and in vivo molecular evidence of genistein action in augmenting the efficacy of cisplatin in pancreatic cancer. Int J Cancer. 2007; 120(4):906-917. PMID:17131310 26. Barnes S. Effect of genistein on in vitro and in vivo models of cancer. J Nutr 1995; 125:777S–783S. PMID:7884564 27. Hillman GG, Wang Y, Kucuk O, Che M, Doerge DR, Yudelev M, Joiner MC, Marples B, Forman JD, Sarkar FH. Genistein potentiates inhibition of tumor growth by radiation in a prostate cancer orthotopic model. Mol Cancer Ther 2004; 3:1271–1279. PMID:15486194 28. Huang J, Nasr M, Kim Y, Matthews HR. Genistein inhibits protein histidine kinase. J Biol Chem 1992; 267:15511–15515. PMID:1639791 29. Li Y, Che M, Bhagat S, Ellis KL, Kucuk O, Doerge DR, Abrams J, Cher ML, Sarkar FH. Regulation of gene expression and inhibition of experimental prostate cancer bone metastasis by dietary genistein. Neoplasia 2004; 6:354–363. PMID:15256057 30. Mohammad RM, Al-Katib A, Aboukameel A, Doerge DR, Sarkar F, Kucuk O. Genistein sensitizes diffuse large cell lymphoma to CHOP (cyclophosphamide, doxorubicin, vincristine, prednisone) chemotherapy. Mol Cancer Ther 2003; 2:1361–1368. PMID:14707277 31. Alhasan SA, Pietrasczkiwicz H, Alonso MD, Ensley J, Sarkar FH. Genistein-induced cell cycle arrest and apoptosis in a head and neck squamous cell carcinoma cell line. Nutr Cancer 1999; 34:12–19. PMID:10453436 32. Davis JN, Singh B, Bhuiyan M, Sarkar FH. Genistein-induced upregulation of p21WAF1, downregulation of cyclin B, and induction of apoptosis in prostate cancer cells. Nutr Cancer 1998; 32:123–131. PMID:10050261 33. Li Y, Bhuiyan M, Sarkar FH. Induction of apoptosis and inhibition of c-erbB-2 in MDA-MB-435 cells by genistein. Int J Oncol 1999; 15: 525–533. PMID:10427135 34. Li Y, Sarkar FH. Down-regulation of invasion and angiogenesisrelated genes identified by cDNA microarray analysis of PC3 prostate cancer cells treated with genistein. Cancer Lett 2002; 186:157–164. PMID:12213285 35. Li Y, Upadhyay S, Bhuiyan M, Sarkar FH. Induction of apoptosis in breast cancer cells MDA-MB-231 by genistein. Oncogene 1999; 18:3166–3172. PMID:10340389 36. Martínez-Montemayor MM, Otero-Franqui E, Martinez J, De La Mota-Peynado A, Cubano LA, Dharmawardhane S.Individual and combined soy isoflavones exert differential effects on metastatic cancer progression. Clin Exp Metastasis. 2010; 27(7):465-80. PMID:20517637 37. Wei Y, Waltz DA, Rao N, Drummond RJ, Rosenberg S, Chapman HA. Identification of the urokinase receptor as an adhesion receptor for vitronectin. J Biol Chem 1994; 269: 32380–32388. PMID:7528215 38. Wei Y, Lukashev M, Simon DI, Bodary SC, Rosenberg S, Doyle MV, Chapman HA. Regulation of integrin function by the urokinase receptor. Science 1996; 273:1551–1555. PMID:8703217 39. Chandrasekar N, Mohanam S, Gujrati M, Olivero WC, Dinh DH, Rao JS. Downregulation of uPA inhibits migration and PI3k/Akt signaling in glioblastoma cells. Oncogene 2003; 22: 392–400. PMID:12545160 40. Jo M, Thomas KS, Somlyo AV, Somlyo AP, Gonias SL Cooperativity between the Ras-ERK and Rho-Rho kinase pathways in urokinase-type plasminogen activator-stimulated cell migration. J Biol Chem 2002; 277:12479–12485. PMID:11805108 41. Pavese JM, Farmer RL, Bergan RC.Inhibition of cancer cell invasion and metastasis by genistein. Cancer Metastasis Rev. 2010; 29(3):465-482. PMID:20730632 42. Lopez-Novoa JM, Nieto MA. Inflammation and EMT: an alliance towards organ fibrosis and cancer progression. EMBO Mol Med. 2009; 1(6–7):303–314. PMID:20049734 43. Micalizzi DS, Farabaugh SM, Ford HL.Epithelial-mesenchymal transition in cancer: parallels between normal development and tumor progression. J Mammary Gland Biol Neoplasia. 2010; 15(2):117-134. PMID:20490631 44. Massague J, Seoane J, Wotton D. Smad transcription factors. Genes Dev. 2005; 19(23):2783–2810. PMID:16322555 45. Xu X, Han J, Ito Y, Bringas P Jr, Deng C, Chai Y. Ectodermal Smad4 and p38 MAPK are functionally redundant in mediating TGF-beta/BMP signaling during tooth and palate development. Dev Cell.2008; 15(2):322-329. PMID:18694570 Figure Legends Fig.1. Genistein inhibited TGF-β1-induced the invasion and migration in Panc-1 cell by transwell assay. The phase contrast imagine of Control group (a); TGF-β1 (5ng/ml) stimulation group (b); Genistein (1μmol/L) treatment group (c); Genistein (25μmol/L) treatment group (d); Genistein (50μmol/L) treatment group (e) (original magnification × 200). Fig.2. Genistein inhibits TGF-β1-inducted invasion and metastasis in Panc-1 cell through down-regulation of uPA expression. A: mRNA level of uPA after Panc-1 cells were treated with different concentration of genistein by RT-PCR assay; B: Protein level of uPA after Panc-1 cells were treated with different concentration of genistein by Western boltting assay. Results are presented as the arithmetic mean of 3 values per group ± SE. * indicate P < 0.05, compared with control group; # and ## respectively, compared with TGF-β1 stimulation group. indicate P < 0.05 and P < 0.01, Fig.3. Genistein inhibits TGF-β1-inducted invasion and metastasis in Panc-1 cell through down-regulation of MMP-2, but not MMP-9 expression. A: mRNA level of MMP-2 after Panc-1 cells was treated with different concentration of genistein by RT-PCR assay; B: mRNA level of MMP-9 after Panc-1 cells was treated with different concentration of genistein by RT-PCR assay; C: The activity assay of MMP-2/9 after Panc-1 cells were treated with different concentration of genistein by Gelatin Zymography. Results are presented as the arithmetic mean of 3 values per group ± SE. * indicate P < 0.05, compared with control group; # and ## indicate P < 0.05 and P < 0.01, respectively, compared with TGF-β1 stimulation group. Fig.4. Genistein inhibits TGF-β1-inducted EMT in Panc-1 cell through regulating the express of E-cadherin / Vimentin and cell morphology. A: The phase contrast images of Panc-1 cells with genistein treatment after 48 h (original magnification × 200); B: The images of Panc-1 cells with genistein treatment by light microscope and TEM; C: mRNA level of E-cadherin after Panc-1 cells was treated with different concentration of genistein by RT-PCR assay; D: mRNA level of Vimentin after Panc-1 cells was treated with different concentration of genistein by RT-PCR assay; E: Protein level of E-cadherin after Panc-1 cells were treated with different concentration of genistein by Western boltting assay. Results are presented as the arithmetic mean of 3 values per group ± SE. * indicate P < 0.05, compared with control group; # and ## respectively, compared with TGF-β1 stimulation group. indicate P < 0.05 and P < 0.01, Fig.5. Genistein inhibits TGF-β1-inducted EMT in Panc-1 cell through a Smad4-dependent signaling pathway. A: mRNA level of Smad-4 after Panc-1 cells was treated with different concentration of genistein by RT-PCR assay. Results are presented as the arithmetic mean of 3 values per group ± SE. * indicate P < 0.05, compared with control group; # and ## indicate P < 0.05 and P < 0.01, respectively, compared with TGF-β1 stimulation group. Fig.6. Genistein inhibits TGF-β1-inducted EMT in PANC-1 cell through a p38 MAPK signaling pathway. A: Protein level of total p38 and p-p38 after Panc-1 cells was treated with different concentration of genistein by Weston blot assay; B: Protein level of ERK1/2 after Panc-1 cells was treated with different concentration of genistein by Weston blot assay. Results are presented as the arithmetic mean of 3 values per group ± SE. * indicate P < 0.05, compared with control group; # and ## indicate P < 0.05 and P < 0.01, respectively, compared with TGF-β1 stimulation group. Table 1A,Genistein inhibit the ability of Panc-1 cell invasion (5ng/ml TGF-β1) Note: compared with control group:* P <0.05; compared with TGF-β1 stimulation group: △ P <0.05 △△P <0.01 Table 1B,Genistein inhibit the ability of Panc-1 cell migration (5ng/ml TGF-β1) Note: compared with control group:* P <0.05; compared with TGF-β1 stimulation group: △ P <0.05 △△P <0.01