Download materials and methods

81
MATERIALS AND METHODS
Primer design and construction of vectors (construction of
pMPZADAR1-E3L, and pMPZADAR1-E3L). Nucleotides 61–261 (amino
acids 1-67) of the vaccinia virus E3L (VVE3L) gene (accession number
S64006) were replaced by either nucleotides 554-742 (ZADAR1) or nucleotides
1025-1216 (ZADAR1) of the human ADAR1 gene (accession number U10439),
using a two-step PCR based mutagenesis protocol. First the mega primers
were constructed using pGEXADAR as a template and either ZADAR1-E3L or
ZADAR1-E3L primers. The primers for ZADAR1-E3L mega primer synthesis
were designed as follows:
5’AAAATGTCTATCTACCAAGATCAGGAACAAAGG 3’ (U10439, nt
554-580). In this primer the nucleotide sequence around 5’ATG 3’ was altered, without
altering the codon usage, such that the kozak sequence around ATG in the chimeric gene
was the same as that in VVE3L.
5’CCGGCTTATCCGCCTCCGTTGTCATTTTCCACAAAGGGGGTGTT
CC TGCCTCTTTC 3’ (S64006, nt 262-286, (underlined); U10439, nt 711742.).
The primers for ZADAR1-E3L mega primer synthesis were designed as
follows:
82
5’AAAATGTTGGAGTTTTTAGACATGGCCGAG 3’ (U10439, nt 10251048); In this primer the nucleotide sequence around 5’ATG 3’ was altered, without
altering the codon usage, such that the kozak sequence around ATG in the chimeric gene
was the same as that in VVE3L.
5’CCGGCTTATCCGCCTCCGTTGTCATATGCCATATGGGAGGGGTT
GTCCCTTG 3’ (S64006, nt 262-286, (underlined); U10439, nt 1190-1216.).
PCR was performed using Taq polymerase (Promega) as follows: (94ºC
for 1 minute), 25 cycles (94ºC for 1 minute, 50ºC for 2 minutes, 72ºC for 3
minutes). All PCR products were purified using QIAquick PCR purification
kit (Qiagen).
Next, whole plasmid PCR based mutagenesis (8) was used to construct
pMPZADAR1-E3L and pMPZADAR1-E3L. pMPE3L (12) was used as the
template with one primer that anneals immediately upstream of the E3L
gene, and the second a mega primer as described above. Primers were
phosphorylated using T4 polynucleotide kinase (Gibco BRL). PCR and
subsequent cloning were as described (8).
Construction of pMPZDLM-1-E3L. Nucleotides 61–261 of VVE3L
gene (coding for amino acids 1-67) were replaced by nucleotides 116-316
(ZDLM-1) of murine DLM-1 (AF136520). The ZDLM-1 sequence was amplified
from pGEM-T containing DLM1 cDNA (9), with BamHI and AatII sites at the
83
5’ and 3’ ends respectively, and cloned into the BamHI and AatII sites of
pMPE3L. The primers for the amplification of ZDLM-1 were designed as
follows:
5’TCTAAAAAGGATCCCCCGGGCTGCCTGAAAATGGCAGAAGCTCC
TGTTGAC 3’ (pMPE3Lgpt) (30), nt 2207-2181 (numbering from the parental
plasmid, pBluescript) (underlined); AF136520, nt 116-136).
5’ATCTATTATGACGTCAGCCATAGCATCAGCATCCGGCTTATCCG
CCTCCGTTGTCATGCTCCATGTTGCAGGCTCTG 3’ (S64006, nt 1920-1976
(underlined); AF136520, nt (297-316)).
PCR was performed using Platinum Pfx (Gibco BRL) (13) as follows:
(95ºC for 1 minute), 35 cycles (95ºC for 1 minute, 50ºC for 1 minutes, 68ºC for
1 minute). The PCR product and vector pMPE3Lgpt were digested with
BamHI, and AatII, gel purified, and ligated together.
Generation of point mutations in pMPZADAR1-E3L,
pMPZADAR1-E3L and pMPE3L: Whole plasmid PCR based mutagenesis
using overlapping primers (14) was used to generate mutations in
pMPZADAR1-E3L, pMPZADAR1-E3L, and pMPE3L. Briefly, overlapping
primers 40-45 bases in length were designed with an 8-10 base 5’ overhang.
The codon of interest was mutated on both primers in middle of the region of
overlap. PCR reactions and cloning were performed as for QuikChange
84
mutagenesis (Stratagene). The identity of all constructs was verified by
sequencing.
Cell Culture. BHK21 cells were cultured in MEM (Gibco) containing
10% FBS, 50 g/mL gentamycin, and 0.1 mM non-essential amino acid
solution (Gibco). Cells were incubated at 37ºC with 5% CO2. RK13 cells were
cultured in MEM (Gibco) containing 5% FBS, 50 g/mL gentamycin, and
0.1mM non-essential amino acid solution (Gibco). Cells were incubated at
37ºC with 5% CO2.
In vivo recombination. The WR strain of VV with the E3L gene
replaced with the lacZ gene (VVE3L) was used as the parent virus for
recombination. In vivo recombination was performed as described previously
(12), except that BHK cells were used, and cells were infected at an MOI of
0.05 pfu/cell. All viruses except VV ZDLM1-E3L and E3L mutants were
obtained by transient dominant selection as previously described (12)(30).
For DLM1-E3L and all mutations in E3L, recombinant viruses were
obtained after selection for interferon resistance in RK-13 cells. Confluent
monolayers of RK-13 cells were treated with 1000 U/ml of recombinant
huIFN/D and infected with virus obtained from a standard
infection/transfection reaction. Plaques that form in interferon-treated cells
85
have taken up a functional E3L gene. After multiple rounds of plaque
purification, the plaques were amplified to make virus stocks.
Virus amplification. BHK21 cells were used to amplify recombinant
virus. Cell culture media was removed from the monolayers and virus
infections were performed in MEM (Gibco) containing 2% FBS, 50 g/mL
gentamycin, and 0.1 mM non-essential amino acid solution (Gibco). Cells
were infected with 200 L virus, and incubated at 37ºC, 5% CO2 for 1 hour,
rocking every 10 minutes. Following infection, the cell culture medium was
replaced. At 100% cytopathicity, infected BHK21 cells were harvested and
subjected to 3 rounds of freezing (-80ºC) and thawing (37ºC), followed by 30
second sonication to release the virus. Cell debris was pelletted by
centrifugation (700xg, 10min at 4ºC). The supernatant was transferred into a
fresh tube and stored at -80ºC. The virus in the supernatant was titered in
RK13 cells. For animal experiments, four different stocks of purified virus were pooled
together and titered.
Sequencing of the gene from the recombinant virus. DNA was
extracted from the virus using phenol chloroform-isoamyl alcohol extraction
followed by ethanol precipitation, and resuspended in 10 L water. PCR was
performed using convergent primers (5’CGAACCACCAGAGGATG 3’ and
5’TAGTCGCGTTAATAGTACTAC 3’) annealing to the E3L flanking sequences.
86
The PCR product was gel purified. DNA was extracted from the gel using 
agarase (New England Biolabs), and sequenced using E3L flanking primers.
Circular Dichroism. The conversion of d(CG)6 from right-handed BDNA to left-handed Z-DNA is monitored by measuring changes in circular
dichroism (CD) in the ultraviolet (20). As the ZADAR1 protein domain is
titered into a solution of d(CG)6, the spectrum gradually converts from that of
right-handed B-DNA to that of left-handed Z-DNA; the conversion is
complete at a ratio of approximately one ZADAR1 residue per four base pairs
(2). The rate and extent to which the mutated ZADAR1 protein converts
d(CG)6 from B-DNA to Z-DNA was measured.
Infection of Mice. C57BL/6 breeders were obtained from Charles River
(Massachusetts), and colonies were established at Arizona State University Animal
Resource Center. For subsequent experiments C57BL/6 were obtained from Jackson
Laboratories (Maine). Both males and females between 4-6 weeks of age were used for
experiments. Five mice (males and females) of approximately equal age and weight were
housed in each cage. Separate cages were used for each dose of the virus administered.
Approximately 1-2L of the anesthetic cocktail (7.5 mg/mL of xylazine (Phoenix
Pharmaceuticals, St. Joseph, Missouri), 2.5 mg/mL of acepromazine maleate, and 37.5
mg/mL ketamine (Fort Dodge Laboratories, Fort Dodge, Iowa)) per gram of body weight
was injected into mice via the intramuscular route. Following anesthesia, mice were
infected intracranially with 10L of either increasing doses or a single dose of virus
87
using a 27-gauge hypodermic needle and a 1cc syringe. Mice were monitored daily for
morbidity and mortality and, on alternate days, for weight loss until the end of the
experiment when no more death was observed. The percentage of the mice that survived
at the end of the experiment was plotted against the dose of virus administered.