Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Supplementary information Plasmids SF-1-shRNA resistant (SF-1R), SF-1R-G35E, SF-1-9A, SF-1-6A and SF-1-3A plasmids were generated by PCR-based site-directed mutagenesis using the following primers, respectively (mutated residues are underlined): GTTCGTATGCCTAAAATTTCTAATCCTCTTCAGCC, AGAGCTGCAAGGAGTTCTTCAAGCG, CTGCTGCACAGCGCAGCAGCACGGGCCCAAGAGGCAGCAGCACAGTTGCATGCAG CAGCAGCAGACCGCCAGGAG, TCCCTGCTGCACAGCGCAGCAGCACGGGCCCAAGAGGCAGCAGCACAGTTGCATG CA and CAGTTGCATGCAGCAGCAGCAGACCGCCAGGAG. The GFP, SF-1R and SF-1R-G35E, SF-1-9A, SF-1-6A and SF-1-3A coding sequences were linked in-frame to an N-terminal FLAG tag under the control of Elongation Factor 1 alpha promoter. To identify SF-1 CLS, the coding sequences of various SF-1 fragments were generated by PCR amplification or by annealing the synthetic oligonucleotides; these fragments were linked in-frame to the N-terminal GFP tag in pEGFP-N1 vector (Clontech, Palo Alto, CA). Cell culture, stable transfectant, cell growth, senescence assay, and measurement of transcriptional activity Mouse adrenocortical Y1 and Leydig MA-10 cells were grown in Dulbecco’s modified Eagle medium (DMEM)-F12 medium supplemented with 10% fetal bovine serum at 37°C in a humidified atmosphere at 5% CO2. In some cases, 10 μM roscovitine were added 24 h before harvesting. Stable Y1 clones expressing GFP and shRNA-resistant SF-1R were established as previously described 1 with some modifications. Briefly, Y1 cells were transfected with pEF1α:FLAG-GFP or pEF1α:FLAG-SF-1R-WT or -G35E plasmids. Three positive clones for GFP, two for SF-1R-WT and five for SF-1R-G35E were expanded for subsequent experiments. To measure cell growth, cells were seeded and infected with shRNA lentivirus at multiplicity of infection around 5 to 10. One day after infection, cell numbers were counted everyday for up to four days. To measure SF-1 transcriptional activity, WT or different SF-1 mutants were co-transfected with a luciferase reporter plasmid driven by human CYP11A1 2.3k promoter into cells as indicated in the figure legends. Luciferase activities were measured at 24 h after transfection. The firefly luciferase activities were normalized with Renilla luciferase activities from pRLuc, used as an internal control. The results are the average of three independent experiments, with error bars indicating standard deviations. Senescent cells were stained by detecting senescence-associated β-galactosidase activity according to manufacture’s instruction (Cell Signaling, Beverly, MA). Bromodeoxyuridine (BrdU) incorporation assay Cells were incubated with 100 μM BrdU (Roche, Mannheim, Germany) for 2 h, followed by ice-cold methanol fixation for 5 min. After fixation, cells were sequentially treated with 2N HCl for 20 min and then with 0.1 M sodium tetraborate (pH 8.5) for 2 min at room temperature followed by immunofluorescence analysis using antibodies against BrdU (Roche). Cells were co-stained with DAPI to visualize nuclei. Antibodies The polyclonal SF-1 2, CYP11A1 3, Hsp70 4, monoclonal anti-centrin (20H5) 5, and rat monoclonal anti-SF-1 (7D5) 6 antibodies have been described previously. Monoclonal 1 anti-γ-tubulin, anti-FLAG M2, anti-α-tubulin, polyclonal anti-FLAG (Sigma, St. Louis, MO), anti-hnRNP A1, anti-mitochondria complex II (MitoSciences, Eugene, OR), anti-cleaved caspase-3 (Asp175) (Cell Signaling) and anti-GFP (Clontech) were obtained commercially. Lentivirus-mediated RNA Interference and cDNA expression A lentivirus expressing short hairpin RNA (shRNA) was used for gene silencing. The sequences of the shRNA are as follows: shlam: ctggacttccagaagaacatc shluc: cctaaggttaagtcgccctcg shsf1#1: cgatgtgaaattcctgaacaa shsf1#2: cgcaccatcaagtctgagtat shsf1#3: cgtctgtctcaagttcctcat shsf1#4: agtccagaacaacaagcatta shsf1#5: cgcgtcagatttacagcttat To generate recombinant lentivirus, plasmids expressing shRNA (or cDNA), envelop and package proteins were co-transfected into 293FT cells (Invitrogen, Carlsbad, CA) followed by harvesting the virus according to the protocols provided by the Taiwan National RNAi Core Facility. NCBI accession number of genes for sequence alignment The sequences for alignment are available from NCBI: Bos Taurus γ-tubulin, accession number AAI20226; Mus musculus γ-tubulin, accession number BAD27264; Drosophila melanogaster γ-tubulin, accession number AAA28597; Schizosaccharomyces pombe γ-tubulin, accession number AAA35305; Rattus norvegicus SF-1, accession number NP_001178028; Mus musculus SF-1, accession number AAI10478; Taeniopygia guttata SF-1, accession number NP_001070160. 2 References: 1. Chen WY, Juan LJ, Chung BC. SF-1 (nuclear receptor 5A1) activity is activated by cyclic AMP via p300-mediated recruitment to active foci, acetylation, and increased DNA binding. Mol Cell Biol 2005; 25(23): 10442-53. 2. Chen WY, Lee WC, Hsu NC, Huang F, Chung BC. SUMO modification of repression domains modulates function of nuclear receptor 5A1 (steroidogenic factor-1). J Biol Chem 2004; 279(37): 38730-5. 3. Hu MC, Guo IC, Lin JH, Chung BC. Regulated expression of cytochrome P-450scc (cholesterol-side-chain cleavage enzyme) in cultured cell lines detected by antibody against bacterially expressed human protein. Biochem J 1991; 274 ( Pt 3): 813-7. 4. Wang C, Lin BL. The disappearance of an hsc70 species in mung bean seed during germination: purification and characterization of the protein. Plant Mol Biol 1993; 21(2): 317-29. 5. Errabolu R, Sanders MA, Salisbury JL. Cloning of a cDNA encoding human centrin, an EF-hand protein of centrosomes and mitotic spindle poles. J Cell Sci 1994; 107 ( Pt 1): 9-16. 6. Yokoyama C, Komatsu T, Ogawa H, Morohashi K, Azuma M, Tachibana T. Generation of rat monoclonal antibodies specific for Ad4BP/SF-1. Hybridoma (Larchmt) 2009; 28(2): 113-9. 3 Figure S1. Overexpression of SF-1 has no effect on centrosome numbers of U2OS cells. (A) Immunoblotting analysis of cell extracts from EYFP or FLAG-SF-1 transfected U2OS cells using anti-FLAG antibody. Hsp70 is used as a loading control. (B) U2OS cells were first transfected with EYFP or FLAG-SF-1 for 24 h followed by incubating with or without hydroxyurea (HU) for another 48 h. Cells with multiple centrosomes were counted and shown in histogram. More than three hundred cells were counted in each individual group from three independent experiments and the mean +/- S.D. are shown. 4 Figure S2. shRNA-resistant SF-1 (FLAG-SF-1R) expressed in Y1-derivatives rescues SF-1 depletion-induced centrosome amplification. (A) Upper lane shows the sequence of shsf1#3. Lower lane shows the partial sequence of SF-1R from 1107 to 1127 targeted by shsf1#3. SF-1R was generated by introducing the mutated residues shown in red into SF-1. (B) Centrosome numbers in Y1-derivatives stably expressing GFP or FLAG-SF-1R with or without SF-1 depletion were counted, and the results are shown in histogram (*, P = 0.014). At least 100 cells were counted in three independent experiments. (C) Transcriptional activity of WT and SF-1-G35E was measured in Y1 using human CYP11A1 2.3k promoter linking to luciferase as a reporter. **, P = 0.0004. All results are expressed as the mean +/- S.D. from at least three independent experiments. 5 Figure S3. Detection of SF-1 centrosomal localization. (A) SF-1 in Y1 cells was detected by immunoblotting using a monoclonal anti-SF-1 (7D5) antibody. (B) SF-1 centrosome localization in Y1 cells was examined by immunofluorescence using a monoclonal anti-SF-1 (7D5) antibody. Scale bar is 5 μm. (C) Detection of SF-1 in the centrosome of H295 cells by staining with anti-SF-1 (green) and γ-tubulin (red) antibodies. DNA (DAPI staining) is shown in blue. 6 Figure S4. Centrosomal localization of different SF-1 fragments and the transcriptional activities of SF-1-9A mutant. (A) Immunofluorescence analysis of GFP-fused SF-1 fragments. Six hours after transfection, cells were fixed with paraformaldehyde and co-stained with γ-tubulin (red) followed by confocal microscopic detection. (B) (Top panel) Partial amino acid sequences of wildtype and CLS-mutated SF-1 (9A, 6A or 3A) are shown. Amino acids shown in red are introduced into full length SF-1, generating different SF-1 mutants. (Bottom panel) Transcriptional activity of WT SF-1 and different CLS-mutated SF-1 (SF-1-9A, 6A or 3A) were measured in HeLa cells using human CYP11A1 2.3k promoter linking to luciferase as a reporter. Luciferase activities were measured at 24 h after transcription and normalized against Renilla luciferase used as the internal control. The results are expressed as the mean +/- S.D. from three independent experiments. 7