Download Supplementary Information (doc 2443K)

Supplementary information
Plasmids
SF-1-shRNA resistant (SF-1R), SF-1R-G35E, SF-1-9A, SF-1-6A and SF-1-3A plasmids
were generated by PCR-based site-directed mutagenesis using the following primers,
respectively (mutated residues are underlined):
GTTCGTATGCCTAAAATTTCTAATCCTCTTCAGCC,
AGAGCTGCAAGGAGTTCTTCAAGCG,
CTGCTGCACAGCGCAGCAGCACGGGCCCAAGAGGCAGCAGCACAGTTGCATGCAG
CAGCAGCAGACCGCCAGGAG,
TCCCTGCTGCACAGCGCAGCAGCACGGGCCCAAGAGGCAGCAGCACAGTTGCATG
CA and CAGTTGCATGCAGCAGCAGCAGACCGCCAGGAG. The GFP, SF-1R and
SF-1R-G35E, SF-1-9A, SF-1-6A and SF-1-3A coding sequences were linked in-frame to
an N-terminal FLAG tag under the control of Elongation Factor 1 alpha promoter. To
identify SF-1 CLS, the coding sequences of various SF-1 fragments were generated by
PCR amplification or by annealing the synthetic oligonucleotides; these fragments were
linked in-frame to the N-terminal GFP tag in pEGFP-N1 vector (Clontech, Palo Alto, CA).
Cell culture, stable transfectant, cell growth, senescence assay, and measurement
of transcriptional activity
Mouse adrenocortical Y1 and Leydig MA-10 cells were grown in Dulbecco’s modified
Eagle medium (DMEM)-F12 medium supplemented with 10% fetal bovine serum at 37°C
in a humidified atmosphere at 5% CO2. In some cases, 10 μM roscovitine were added 24
h before harvesting. Stable Y1 clones expressing GFP and shRNA-resistant SF-1R were
established as previously described 1 with some modifications. Briefly, Y1 cells were
transfected with pEF1α:FLAG-GFP or pEF1α:FLAG-SF-1R-WT or -G35E plasmids. Three
positive clones for GFP, two for SF-1R-WT and five for SF-1R-G35E were expanded for
subsequent experiments. To measure cell growth, cells were seeded and infected with
shRNA lentivirus at multiplicity of infection around 5 to 10. One day after infection, cell
numbers were counted everyday for up to four days. To measure SF-1 transcriptional
activity, WT or different SF-1 mutants were co-transfected with a luciferase reporter
plasmid driven by human CYP11A1 2.3k promoter into cells as indicated in the figure
legends. Luciferase activities were measured at 24 h after transfection. The firefly
luciferase activities were normalized with Renilla luciferase activities from pRLuc, used as
an internal control. The results are the average of three independent experiments, with
error bars indicating standard deviations.
Senescent cells were stained by detecting senescence-associated β-galactosidase
activity according to manufacture’s instruction (Cell Signaling, Beverly, MA).
Bromodeoxyuridine (BrdU) incorporation assay
Cells were incubated with 100 μM BrdU (Roche, Mannheim, Germany) for 2 h, followed
by ice-cold methanol fixation for 5 min. After fixation, cells were sequentially treated with
2N HCl for 20 min and then with 0.1 M sodium tetraborate (pH 8.5) for 2 min at room
temperature followed by immunofluorescence analysis using antibodies against BrdU
(Roche). Cells were co-stained with DAPI to visualize nuclei.
Antibodies
The polyclonal SF-1 2, CYP11A1 3, Hsp70 4, monoclonal anti-centrin (20H5) 5, and rat
monoclonal anti-SF-1 (7D5) 6 antibodies have been described previously. Monoclonal
1
anti-γ-tubulin, anti-FLAG M2, anti-α-tubulin, polyclonal anti-FLAG (Sigma, St. Louis, MO),
anti-hnRNP A1, anti-mitochondria complex II (MitoSciences, Eugene, OR), anti-cleaved
caspase-3 (Asp175) (Cell Signaling) and anti-GFP (Clontech) were obtained
commercially.
Lentivirus-mediated RNA Interference and cDNA expression
A lentivirus expressing short hairpin RNA (shRNA) was used for gene silencing. The
sequences of the shRNA are as follows:
shlam: ctggacttccagaagaacatc
shluc: cctaaggttaagtcgccctcg
shsf1#1: cgatgtgaaattcctgaacaa
shsf1#2: cgcaccatcaagtctgagtat
shsf1#3: cgtctgtctcaagttcctcat
shsf1#4: agtccagaacaacaagcatta
shsf1#5: cgcgtcagatttacagcttat
To generate recombinant lentivirus, plasmids expressing shRNA (or cDNA), envelop and
package proteins were co-transfected into 293FT cells (Invitrogen, Carlsbad, CA)
followed by harvesting the virus according to the protocols provided by the Taiwan
National RNAi Core Facility.
NCBI accession number of genes for sequence alignment
The sequences for alignment are available from NCBI: Bos Taurus γ-tubulin, accession
number AAI20226; Mus musculus γ-tubulin, accession number BAD27264; Drosophila
melanogaster γ-tubulin, accession number AAA28597; Schizosaccharomyces pombe
γ-tubulin, accession number AAA35305; Rattus norvegicus SF-1, accession number
NP_001178028; Mus musculus SF-1, accession number AAI10478; Taeniopygia guttata
SF-1, accession number NP_001070160.
2
References:
1. Chen WY, Juan LJ, Chung BC. SF-1 (nuclear receptor 5A1) activity is activated by
cyclic AMP via p300-mediated recruitment to active foci, acetylation, and increased
DNA binding. Mol Cell Biol 2005; 25(23): 10442-53.
2. Chen WY, Lee WC, Hsu NC, Huang F, Chung BC. SUMO modification of repression
domains modulates function of nuclear receptor 5A1 (steroidogenic factor-1). J Biol
Chem 2004; 279(37): 38730-5.
3. Hu MC, Guo IC, Lin JH, Chung BC. Regulated expression of cytochrome P-450scc
(cholesterol-side-chain cleavage enzyme) in cultured cell lines detected by antibody
against bacterially expressed human protein. Biochem J 1991; 274 ( Pt 3): 813-7.
4. Wang C, Lin BL. The disappearance of an hsc70 species in mung bean seed during
germination: purification and characterization of the protein. Plant Mol Biol 1993; 21(2):
317-29.
5. Errabolu R, Sanders MA, Salisbury JL. Cloning of a cDNA encoding human centrin, an
EF-hand protein of centrosomes and mitotic spindle poles. J Cell Sci 1994; 107 ( Pt 1):
9-16.
6. Yokoyama C, Komatsu T, Ogawa H, Morohashi K, Azuma M, Tachibana T. Generation
of rat monoclonal antibodies specific for Ad4BP/SF-1. Hybridoma (Larchmt) 2009;
28(2): 113-9.
3
Figure S1. Overexpression of SF-1 has no effect on centrosome numbers of U2OS
cells.
(A) Immunoblotting analysis of cell extracts from EYFP or FLAG-SF-1 transfected U2OS
cells using anti-FLAG antibody. Hsp70 is used as a loading control. (B) U2OS cells were
first transfected with EYFP or FLAG-SF-1 for 24 h followed by incubating with or without
hydroxyurea (HU) for another 48 h. Cells with multiple centrosomes were counted and
shown in histogram. More than three hundred cells were counted in each individual group
from three independent experiments and the mean +/- S.D. are shown.
4
Figure S2. shRNA-resistant SF-1 (FLAG-SF-1R) expressed in Y1-derivatives rescues
SF-1 depletion-induced centrosome amplification.
(A) Upper lane shows the sequence of shsf1#3. Lower lane shows the partial sequence of
SF-1R from 1107 to 1127 targeted by shsf1#3. SF-1R was generated by introducing the
mutated residues shown in red into SF-1. (B) Centrosome numbers in Y1-derivatives
stably expressing GFP or FLAG-SF-1R with or without SF-1 depletion were counted, and
the results are shown in histogram (*, P = 0.014). At least 100 cells were counted in three
independent experiments. (C) Transcriptional activity of WT and SF-1-G35E was
measured in Y1 using human CYP11A1 2.3k promoter linking to luciferase as a reporter.
**, P = 0.0004. All results are expressed as the mean +/- S.D. from at least three
independent experiments.
5
Figure S3. Detection of SF-1 centrosomal localization.
(A) SF-1 in Y1 cells was detected by immunoblotting using a monoclonal anti-SF-1 (7D5)
antibody. (B) SF-1 centrosome localization in Y1 cells was examined by
immunofluorescence using a monoclonal anti-SF-1 (7D5) antibody. Scale bar is 5 μm. (C)
Detection of SF-1 in the centrosome of H295 cells by staining with anti-SF-1 (green) and
γ-tubulin (red) antibodies. DNA (DAPI staining) is shown in blue.
6
Figure S4. Centrosomal localization of different SF-1 fragments and the
transcriptional activities of SF-1-9A mutant.
(A) Immunofluorescence analysis of GFP-fused SF-1 fragments. Six hours after
transfection, cells were fixed with paraformaldehyde and co-stained with γ-tubulin (red)
followed by confocal microscopic detection. (B) (Top panel) Partial amino acid sequences
of wildtype and CLS-mutated SF-1 (9A, 6A or 3A) are shown. Amino acids shown in red
are introduced into full length SF-1, generating different SF-1 mutants. (Bottom panel)
Transcriptional activity of WT SF-1 and different CLS-mutated SF-1 (SF-1-9A, 6A or 3A)
were measured in HeLa cells using human CYP11A1 2.3k promoter linking to luciferase
as a reporter. Luciferase activities were measured at 24 h after transcription and
normalized against Renilla luciferase used as the internal control. The results are
expressed as the mean +/- S.D. from three independent experiments.
7