• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Educator's Resource Guide 4226  Biology 1 s 4-5
Educator's Resource Guide 4226 Biology 1 s 4-5

... RR as the genotype for the red parent and BB for the blue parent. Complete the Punnett square to show the resulting genotypes and phenotypes of the offspring. ...
Non-Mendelian Inheritance
Non-Mendelian Inheritance

... To explain the preferential digestion of mt– cpDNA, it has been proposed that the maternal transmission of cpDNA is governed by a methylation-restriction system analogous to that found in bacteria: after gametic fusion, the mt– cpDNA is digested by a restriction enzyme while the modified mt+ cpDNA r ...
The Relationship Between DNA Replication and the
The Relationship Between DNA Replication and the

... of escape was 35 min, with a standard deviation of 4 min. Genefrequency analysis of D N A extracted from sporulating cultures HPUra has an immediate and specific inhibitory effect on DNA replication (Brown, 1970, 1971). The experiments described above therefore determined the time at which sporulati ...
The Value of MLPA in Waardenburg Syndrome - MRC
The Value of MLPA in Waardenburg Syndrome - MRC

... has been discovered as an etiology for WS 1 or 3. Point mutations in PAX3 have been identified in more than 90% of affected individuals with WS 1 or 3. In contrast, WS2 is genetically heterogeneous, with only 10–15% of affected individuals having a point mutation in MITF. Although several other gene ...
rpoB gene sequence-based characterization of emerging non
rpoB gene sequence-based characterization of emerging non

... mycobacterial infections. Cumulative experience has indicated that this molecular tool underestimates the diversity of this group and does not distinguish between all recognized mycobacterial taxa. In order to improve the recognition of emerging rapidly growing mycobacteria (RGM), rpoB gene sequenci ...
Physical Mapping of a 670-kb Region of Chromosomes XVI and XVII
Physical Mapping of a 670-kb Region of Chromosomes XVI and XVII

... Figure 2 Megarestriction map and YAC contig of the region containing the loci h49 and j18. (A) Megarestriction map of the region spanning the loci h49 and j18. As described in legend of Figure 1, T. cruzi chromosomal DNA and isolated chromosomal bands XVI and XVII were digested with different restri ...
Epigenetic Inactivation of Chalcone Synthase-A
Epigenetic Inactivation of Chalcone Synthase-A

... C002 plants were treated with 5-azacytidine (Fig. 3C) or trichostatin A (Fig. 3D). The frequencies of cytosine methylation at CpG/CpNpG/CpNpN sites were reduced to 62.9%/55.8%/15.5% and 44.1%/46.1%/13.0% by treatments with 5-azacytidine and trichostatin A, respectively. The CaMV 35S promoter contain ...
Documentation - Broad Institute
Documentation - Broad Institute

... RC454 is a tool to clean 454 reads based on their alignment to a reference consensus assembly. The correction process is aggressive, and as such requires an assembly that is highly representative of the population represented by the read data. It is highly recommended that the user use a de novo ass ...
Conditions for gene disruption by homologous
Conditions for gene disruption by homologous

... Materials and methods and electroporated with 300 ng of pSVA78 plasmid DNA (Table 2). This plasmid harbors the lacS gene with flanking regions of the Sso02684 and Sso2681 genes (upstream flanking region was 733 bp, downstream flanking region was 756 bp). Upon transformation of the cells, the deletio ...
WheatNet: A genome-scale functional network for hexaploid bread
WheatNet: A genome-scale functional network for hexaploid bread

... In the second approach, users exploit gene expression data related to a trait of interest. Gene expression profiles are one of the most common types of genomic data, and differential expression analysis provides many genes that are potentially associated with given traits such as abiotic and biotic ...
Approaches to gene mapping in complex disorders and their
Approaches to gene mapping in complex disorders and their

... became readily accessible were restricted to the use of `classic' genetic markers such as red blood cell antigens (ABO, MNS and Rh) and the human leucocyte antigens (HLA). The use of DNA markers began with the discovery of techniques for measuring variation within genomic DNA. Modern maps were intro ...
Advances in genetics show the need for extending screening
Advances in genetics show the need for extending screening

... the vicinity of codon 3527 of the APOB gene are known to prevent LDL from binding to the LDLR.5,8 Familial hypercholesterolaemia, FDB, and inherited hypercholesterolaemia of unknown aetiology are commonly referred to as autosomal dominant hypercholesterolaemia (ADH, MIM #143890). Recently, mutations ...
E.Publication
E.Publication

... genes work to do what they do. And they are uncovering the functions of specific genes. These discoveries are teaching us a great deal about the genetic instructions that construct and operate the human body. This new information will give us new opportunities to control the destiny of our bodies. B ...
Transcription factors Oct-1 and NF-YA regulate the p53
Transcription factors Oct-1 and NF-YA regulate the p53

... GADD45 promoter. In p53-de®cient cell lines, the UVor MMS-induction of the GADD45 promoter has been found attenuated compared to that seen in cells with functional p53. A previous report by our group has demonstrated that p53 can regulate the GADD45 promoter through its interaction with WT1, which i ...
Nucleotide sequence changes in the MSX1 and IRF6 genes in
Nucleotide sequence changes in the MSX1 and IRF6 genes in

... >350 recognisable Mendelian single gene disorders [4], teratogenic effects and various uncategorised syndromes. The majority of OFC cases (~70%) are considered nonsyndromic (NS-OFC) where the clefts are isolated, i.e. occur without other anomalies. NS-OFC arises as a complex multifactorial trait wit ...
Sequence Diversity, Reproductive Isolation and Species
Sequence Diversity, Reproductive Isolation and Species

... The sequences of S. paradoxus fall into three clades correlated with geography on a continental scale. We found three major subpopulations: European, Far Eastern (East Russia and Japan), and North American. Within these subpopulations, the levels of sequence divergence range from 0.08 to 0.21%. Betw ...
Distortion of quantitative genomic and expression
Distortion of quantitative genomic and expression

... requirement for Cot-1 either by hybridizing with computationally defined sc probes lacking repeats or by substituting synthetic repetitive elements complementary to sequences in genomic probes. ...
Identification of Bacterial Species Using Colony PCR
Identification of Bacterial Species Using Colony PCR

Protein Sequence Alignment and Database Searching
Protein Sequence Alignment and Database Searching

Cloning, characterization and in vitro and in planta expression of a
Cloning, characterization and in vitro and in planta expression of a

... enzymes [13]. Early observations that plants secrete inhibitor proteins that bind and inactive microbial hydrolases, specifically the binding of plant polygalacturonase inhibitor proteins (PGIPs) to fungal polygalacturonases, spurred the search for analogous inhibitor proteins from microbes that mig ...
Slide 1
Slide 1

... 1. DNA isolated from tissue sample  Small samples can be amplified using another technique called “PCR” 2. DNA cut into fragments with enzymes  DNAs of different sequences produce fragments of different sizes 3. Fragments separated on basis of size and visualized 4. Each person’s set of fragments ...
Resources for the map-based cloning of tga1
Resources for the map-based cloning of tga1

... Maize Beta-tublin2 (Genbank X52879) was selected as an endogenous control for PCR quantification and its forward primer, reverse primer and probe are CCTATAACGCCACGCTCTCTGT, CATTGTCCAGCACCATGCA and 6FAMCACCAGCTCGTGGAGAACGCCG-TAMRA. Real-time PCR reactions were performed on an ABI Prism 7000 sequence ...
Landscape genetics
Landscape genetics

... Here we will focus on microsatellites as they have been the mainstay for landscape genetics work since its inception; only recently have SNPs offered an alternative and potentially more powerful approach for quantifying the genetic differences between individuals. A microsatellite is a highly variab ...
Biocatalytic potential of thermophilic bacteria and actinomycetes
Biocatalytic potential of thermophilic bacteria and actinomycetes

... actinomycetes are the organisms which can grow and produce such compounds optimally high temperature [3]. Thermophiles are further subcategorized on the basis of their temperature tolerance: for instance, facultative thermophiles, can grow at temperatures between 50˚C-65˚C, but also grow also at 37˚ ...
Odorant binding proteins and olfactory receptors
Odorant binding proteins and olfactory receptors

... For many of us the five senses have been of philosophical and scientific interest for as long as we can remember. Through our senses we are able to interact with our environment and respond to cues which, most of the time, are not visible to our consciousness. Unlike touch, vision and hearing; taste ...
< 1 ... 70 71 72 73 74 75 76 77 78 ... 577 >

Genomics

Genomics is a discipline in genetics that applies recombinant DNA, DNA sequencing methods, and bioinformatics to sequence, assemble, and analyze the function and structure of genomes (the complete set of DNA within a single cell of an organism). Advances in genomics have triggered a revolution in discovery-based research to understand even the most complex biological systems such as the brain. The field includes efforts to determine the entire DNA sequence of organisms and fine-scale genetic mapping. The field also includes studies of intragenomic phenomena such as heterosis, epistasis, pleiotropy and other interactions between loci and alleles within the genome. In contrast, the investigation of the roles and functions of single genes is a primary focus of molecular biology or genetics and is a common topic of modern medical and biological research. Research of single genes does not fall into the definition of genomics unless the aim of this genetic, pathway, and functional information analysis is to elucidate its effect on, place in, and response to the entire genome's networks.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report