• Study Resource
  • Explore
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Tutorial - SigTerms
Tutorial - SigTerms

Molecular Biology and Evolution
Molecular Biology and Evolution

... Evolutionary Rate Variation at Multiple Levels of Biological Organization in Plant Mitochondrial DNA 243-246 Daniel B. Sloan, Camille M. Barr, Matthew S. Olson, Stephen R. Keller, and Douglas R. Taylor ...
KOD -Plus
KOD -Plus

... blunt-end PCR products amplified using KOD -Plus- [Code No. KOD-201], KOD -Plus- Neo [Code No. KOD-401] or KOD FX [Code No. KFX-101]. The kit contains pTA2 Vector, 2x Ligation Buffer, T4 DNA Ligase and 10x A-attachment Mix. 10 x A-attachment mix is a reagent comprising anti-KOD DNA polymerase antibo ...
2. Biotechnology and Development
2. Biotechnology and Development

... 3. Genetic engineering prospects and application In the following part of discussion, we are interesting to give a view on what so-called genetic engineering which is the molecular biology and genetics. Molecular biology is the science that treats research activities on cell molecular level, similar ...
Recombinant Technology
Recombinant Technology

... Copyright © 2005 Pearson Education, Inc. Publishing as Benjamin Cummings ...
Replication - UniMAP Portal
Replication - UniMAP Portal

... Next, an enzyme called DNA helicase locally "unzips" the DNA molecule by breaking the hydrogen bonds between complementary nucleotide bases, which exposes the bases in a replication fork. Other protein molecules stabilize the single strands so that they do not rejoin while replication proceeds After ...
C2005/F2401 `07 -- Lecture 16 -- Last Edited
C2005/F2401 `07 -- Lecture 16 -- Last Edited

... 3. How Virus takes Over. In many viruses, only nucleic acid enters the host cell. Once inside, the viral nucleic acid uses the enzymes (and the ATP) of the host for transcription and translation of its own genetic information. The viral genetic info directs synthesis of materials (mostly proteins) t ...
The 3`termini of transcripts originating from genes
The 3`termini of transcripts originating from genes

... Figure 4. Comparison between putative secondary structures of the terminators of the E. coli phages X (A.t R .) and fd (both redrawn from Rosenberg and Court (1b)) and the M:. voltae xerminator described here. Note the lack of an oligo(T) at the 3'end of the termination factor rho dependent terminat ...
Guide to Seq. Annotation - UC Davis Plant Sciences
Guide to Seq. Annotation - UC Davis Plant Sciences

... If you do not find anything with BLASTN you can do a more sensitive search using BLASTX, which will translate your DNA and search the protein databases, which is more sensitive for more distantly related sequences. If the gene is in inverted orientation (plus/minus matches), first reverse complement ...
Teaching deep time through macroevolution and
Teaching deep time through macroevolution and

... “tree” based on the similarity of characters--this is done by hand. [cladograms are visual representations of calculated relationships] 2. Students create character matrix and extract DNA/ sequence the 28s rRNA gene. [scaled up repetition, base pair differences are empirically determined] 3. Student ...
Ramapo Bioinformatics - Ramapo College of New Jersey
Ramapo Bioinformatics - Ramapo College of New Jersey

... science for students of Bioinformatics, Biology, Biochemistry, health sciences, computer science and other related fields. In this course, students will learn about the major issues concerning representation, analysis and application of biological, molecular and biochemical information, especially f ...
Human-Genetics-Concepts-and-Applications-9E
Human-Genetics-Concepts-and-Applications-9E

... B. a single base site in the genome that varies among individuals in a population. C. a single copy of a gene. D. a gene that is expressed differently in males and females. E. the DNA base that begins a gene. ...
Powerpoint template for scientific poster
Powerpoint template for scientific poster

...  A potential NRPS gene cluster was reassembled in FXJ1.172 during genome comparison and annotation, and it shows a demand of aromatic amino acid for its biosynthesis by substrate specificity prediction of its A domains (Fig. 6). Different aromatic amino acids were added to a basic medium for FXJ1.1 ...
Molecular studies on an ancient gene encoding
Molecular studies on an ancient gene encoding

... Eukaryotic genes, as well as a small number of prokaryotic and organellar genes, have long intervening unexpressed sequences (introns) dividing the coding sequence into pieces (exons). The existence of introns in contemporary genomes has led to several mechanistic and historical questions. The debat ...
File - Central Dogma of Molecular Biology
File - Central Dogma of Molecular Biology

... • Keep in mind that all of the molecules described in the replication process actually work together to maximize DNA production. • Think of them as the individual parts of a “DNA synthesis machine.” ...
Uncovering the Protein Tyrosine Phosphatome in Cattle an
Uncovering the Protein Tyrosine Phosphatome in Cattle an

... UniProt contained information on only 12 PTPs The alignment of the 37 human sequences against the cattle RefSeq sequences using BLASTP uncovered 26 predicted sequences and confirmed 11 known sequences The best human-cattle matches were for PTPRD, PTPRK, and PTPN11 – this indicates that they are very ...
RNA Detection and quantitation
RNA Detection and quantitation

... the state of a cell. • In general increases in the levels of a particular protein is reflected by increases in the corresponding mRNA transcript. • Changes in gene expression is important in the cellular response to external stimuli and to basic cellular function. • Completion of human genome sequen ...
G.tigrina Hox
G.tigrina Hox

... 4) The three amplified gene fragments will then be inserted into pGEM-T vectors and recombined via ligation. 5) The pGEM-T vectors will be placed into E.coli, amplified, and sequenced to determine if the gene fragments properly recombined and the restriction sites were removed. 6) Enzymatically remo ...
Kartagener`s Syndrome: a relentless triad
Kartagener`s Syndrome: a relentless triad

... Bouvagnet, P. 2001. Axonemal Dynein Intermiediate-Chain Gene (DNAI1) Mutations Result in Situs Inversus and Primary Ciliary Dyskinesia (Kartagener Syndrome). Am. ...
NAME :Abubakar Aisha MATRIC NO:14/sci05/001 DEPT
NAME :Abubakar Aisha MATRIC NO:14/sci05/001 DEPT

Heredity - lrobards
Heredity - lrobards

... Sex-linked gene- a gene located on either sex chromosome Duchenne muscular dystrophy- a disease characterized by a progressive weakening of the muscles and loss of coordination Hemophilia- a sex linked disorder defined by the absence of one or more of the protein required for the blood clotting fact ...
Hybridization of labeled DNA
Hybridization of labeled DNA

... more than 3 standard deviations below the mean of the high intensity mode were flagged and excluded from further analysis. Segmentation of the remaining data was performed using a circular binary segmentation method with post processing to insure that regions had at least 3 genomic coordinate consec ...
Learning about the Human Genome Explore the 23andMe Browse
Learning about the Human Genome Explore the 23andMe Browse

... C. elegans (round worm) = 97M base pairs, 19K genes  Mus musculus (house mouse) = 2.9 billion base pairs, 25K genes   ...
Hardy-Weinberg Lab
Hardy-Weinberg Lab

... • Scientists were able to extract DNA nucleotides from the tissue and use the information to sequence several genes. • Your task is to use BLAST to analyze these genes and determine the most likely placement of the fossil species on Figure 4. ...
Chapter 20~ DNA Technology & Genomics
Chapter 20~ DNA Technology & Genomics

... TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT human genome CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA ...
< 1 ... 188 189 190 191 192 193 194 195 196 ... 577 >

Genomics

Genomics is a discipline in genetics that applies recombinant DNA, DNA sequencing methods, and bioinformatics to sequence, assemble, and analyze the function and structure of genomes (the complete set of DNA within a single cell of an organism). Advances in genomics have triggered a revolution in discovery-based research to understand even the most complex biological systems such as the brain. The field includes efforts to determine the entire DNA sequence of organisms and fine-scale genetic mapping. The field also includes studies of intragenomic phenomena such as heterosis, epistasis, pleiotropy and other interactions between loci and alleles within the genome. In contrast, the investigation of the roles and functions of single genes is a primary focus of molecular biology or genetics and is a common topic of modern medical and biological research. Research of single genes does not fall into the definition of genomics unless the aim of this genetic, pathway, and functional information analysis is to elucidate its effect on, place in, and response to the entire genome's networks.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report