• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Decreased Expression of the p16/MTS1 Gene without
Decreased Expression of the p16/MTS1 Gene without

... by RT-PCR, the cycle number was minimized in the present study, with only one round of PCR performed, and the level of p16 in normal cells is known to be generally low (21–24). Therefore we believe that the signals observed were indeed from carcinoma as opposed to normal cells. The reasons for the d ...
Genetic analysis of TTF2 gene in congenital hypothyroid infants with
Genetic analysis of TTF2 gene in congenital hypothyroid infants with

... Mahjoubi F, Hashemipour M, Moshiri F, Iranpour R, Amini M, Hovsepian S, et al. Genetic analysis of TTF2 gene in congenital hypothyroid infants with thyroid dysgenesis. Pak J Med Sci 2013;29(1)Suppl:325-328. doi: http://dx.doi.org/10.12669/pjms.291(Suppl).3526 This is an Open Access article distribut ...
Keystone2011poster
Keystone2011poster

... The sequencing and phylogenetic analysis of rRNA molecules demonstrated that all organisms could be placed on a single tree of life. Highly conserved, homologous 16S rRNA genes' presence in all organismal lineages makes them the only universal marker that has been adopted by biologist. Unfortunately ...
Polygenic inheritance and micro/minisatellites
Polygenic inheritance and micro/minisatellites

... remarkable aspects of the above observations are that the CTG repeat silenced the growth inhibitory factor/metallothionein III gene promoter whether it was upstream or at a distance downstream from the promoter,53 the efficiency of nucleosome formation increased according to the size of CTG repeats ...
Changing Patterns of Gene Regulation in the Evolution of Arthropod
Changing Patterns of Gene Regulation in the Evolution of Arthropod

... mutation in Drosophila. A Drosophila appendage can be changed to look like another Drosophila appendage, or something so perturbed that it can at best be called a blob-like-thing, but not to look like a lepidopteran or a hymenopteran appendage. The take home message is that mutagenesis in model syst ...
Nerve activates contraction - Green River Community College
Nerve activates contraction - Green River Community College

... — Presence of substrate activates the transcription (mRNA synthesis) of genes coding for the enzymes needed to breakdown the substrate. — Enzymes are not made unless they are needed ...
Genetic basis of neural tube defects. I. Regulatory genes for the
Genetic basis of neural tube defects. I. Regulatory genes for the

... A transcription factor, which can be indirectly involved in the formation of the neural tube, is BRCA1 – a tumor suppressor. This protein inhibits the proliferation of epithelial cells and probably gives a signal to the differentiation of neuroepithelial cells. A clear correlation between mutations ...
Modified Mendelian ratios
Modified Mendelian ratios

... a dilute spotted cinnamon mouse. • The mouse must be: A/_; b/b; C/_; d/d; s/s • Because to be dilute= dd, to be spotted= ss, to be cinnamon= A/_;b/b and C/_ ...
Epigenetic mechanisms regulate placental c-myc
Epigenetic mechanisms regulate placental c-myc

... proliferation. Overexpression of c-myc resulting in the up-regulation of many other genes is known to be involved in the development of cancer. The catalytic subunit of hTERT is one such c-myc downstream target gene (Horikawa et al., 1999). C-myc overexpression thus has a role in telomerase activati ...
Gene Section SSX2 (Synovial Sarcoma, X breakpoint 2) in Oncology and Haematology
Gene Section SSX2 (Synovial Sarcoma, X breakpoint 2) in Oncology and Haematology

... cDNA sequence data, the SSX2 component contained in the SYT-SSX2 oncogene consists of exons 6 and 8. They represent the last 78 amino acids of SSX2 isoform b. This region lacks the KRAB repressive domain but retains the SSXRD region. SS presents in two distinct morphologies, monophasic, populated by ...
VI P M
VI P M

... Siderophores are low molecular weight, iron-chelating agents that solubilize iron (III) and control intracellular iron levels. We have identified a novel siderophore from symbiotic fungal endophytes (genera Epichloë and Neotyphodium) of coolseason grasses. In nature, these fungi are never free-livin ...
Year 13 Biology, 2011.
Year 13 Biology, 2011.

... There will be three internal assessments during the year. Table 1 has more detailed information on the topics we will cover and assessments. There will be no reassessment opportunities, and only one resubmission opportunity for any internal assessments. There will be clear signposts to your Whanau T ...
PDF file
PDF file

... give a readily identified phenotype (lethality or semi-lethality). If the P element in the exceptional male has inserted in the indicated orientation at the 5' end of transcription unit "x", then any cell that expresses GAL4 will also express gene x (see Figure 1). Since the actin-Gal4 driver constr ...
A molecular probe for Basidiomycota: the spermidine
A molecular probe for Basidiomycota: the spermidine

... Using the PCR conditions described above and the designed degenerate primers, it was possible to amplify DNA fragments of the predicted size from genomic DNA of all the Basidiomycota species tested (see Materials and methods), whose genomes have been sequenced or not, that represented the three subp ...
Web API In addition to the web interface, one can access Cas
Web API In addition to the web interface, one can access Cas

... {"targets": [{"gc_contents": 40.0, "strand": "-", "oof_score": 74.2595596756, "sequence": "ACGAAATATCAATGATGGCCAGG", "coverage": 1, "position": 144050592, "offtarget_counts": [1, 0, 0], "id": 34, "chromosome": "chr7", "cds_percentages": ...
embr201439791-sup-0014
embr201439791-sup-0014

... Table S3. Mapped sequences were run through featureCount and differential expression analysis was performed on the raw counts using the R packages DESeq2 (gene level) and DEXSeq (exon level). Since DESeq2 and DEXSeq requires replicates, the salmIR and salm-FRT samples were used as biological replica ...
Fact Sheet 9 | X-LINKED RECESSIVE INHERITANCE This fact sheet
Fact Sheet 9 | X-LINKED RECESSIVE INHERITANCE This fact sheet

... is passed on to us from our mother and the other from our father. 22 of these chromosome pairs are numbered. These numbered pairs are known as the autosomal chromosomes. The 23rd pair is made up of the sex chromosomes called X and Y. Males have an X and a Y chromosome and females have two copies of ...
Complex Patterns of Inheritance
Complex Patterns of Inheritance

... The A allele and the B allele code for the production of proteins on the surface of red blood cells. The type A protein and the type B protein are both “antigens” – proteins used to allow the immune system to distinguish between cells that belong and cells that do not, a necessary part of ...
1471-2164-10-531-S3
1471-2164-10-531-S3

... Figure S3. Tag Count Distribution of PGK1. PGK1 has 11 known exons. Among randomly selected 0.5, 1.0, 1.5, 2.0, 3.0, 5.0, 10. 15, and 20 million tags from UHRR sample, we have consistently observed 5 tags from the 3’ most exon, and 1 tag from the 5th exon from the 3’ end. As shown in the figure abov ...
Polyploidy and genome evolution in plants
Polyploidy and genome evolution in plants

... wheat, polyploid antisense transcripts generated by readout transcription of a retrotransposon caused silencing of an adjacent gene [49]. Small RNAs and RNA interference (RNAi) could also play a role in gene silencing in polyploids. Superimposed on these immediate and shortterm responses to genome ...
Epigenetic chromatin states uniquely define the developmental
Epigenetic chromatin states uniquely define the developmental

... process that arises from a small pool of self-renewing hematopoietic stem cells (HSCs). Upon induction of differentiation, HSCs lose self-renewal ability and develop through a series of specialized progenitor cell types that possess restricted differentiation potential.1 Although several cell-intrin ...
RNA Molecules: More than Mere Information Intermediaries
RNA Molecules: More than Mere Information Intermediaries

... Thus, RNAIII of S. aureus provides an example of a relatively small RNA molecule that controls expression of various genes by several different mechanisms. Clostridium perfringens contains a system called VR-RNA that resembles RNAIII. A small untranslated RNA is the effector molecule of the two-comp ...
russell-silver syndrome
russell-silver syndrome

... bridge and a small jaw). Other variable features may be seen in children with RSS (see For More Information). Some individuals with RSS will have many of the possible characteristics associated with RSS while others will have very few. ...
A Noise Trimming and Positional Significance of
A Noise Trimming and Positional Significance of

... sites from zero to many. An individual site may attract insertions from one to many depending on the coverage depth of sequencing as well as the genetic property of a gene. The number of insertions at the same site is called insertion count or simply count. The significance of mutation of a gene sho ...
Gene List Enrichment Analysis
Gene List Enrichment Analysis

... Main types of enrichment analysis Main types of enrichment analysis • List‐based: inputs are  Li b d i – A subset of all genes chosen by some relevant method – A list of annotations, each linked to genes A li f i ...
< 1 ... 109 110 111 112 113 114 115 116 117 ... 340 >

Epigenetics of diabetes Type 2

In recent years it has become apparent that the environment and underlying mechanisms affect gene expression and the genome outside of the central dogma of biology. It has been found that many Epigenetic mechanisms are involved in the regulation and expression of genes such as DNA methylation and chromatin remodeling. These epigenetic mechanisms are believed to be a contributing factor to pathological diseases such as Diabetes type II. An understanding of the epigenome of Diabetes patients may help to elucidate otherwise hidden causes of this disease.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report